Method for preparing immobilized arginine deiminase (ADI) and producing [.SUP.14/15.N]-L-citrulline
12378563 ยท 2025-08-05
Assignee
Inventors
Cpc classification
C12N9/78
CHEMISTRY; METALLURGY
C12N1/005
CHEMISTRY; METALLURGY
C07K2319/735
CHEMISTRY; METALLURGY
C12N15/66
CHEMISTRY; METALLURGY
International classification
C12N1/00
CHEMISTRY; METALLURGY
C12N15/66
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
Abstract
Arginine deiminase (ADI)-containing genetically engineered Corynebacterium glutamicum (C. glutamicum), a fusion protein cipA-arc, use thereof, and a method for preparing [.sup.14/15N]-L-citrulline through enzymatic catalysis are provided. The ADI-containing genetically engineered Corynebacterium glutamicum (C. glutamicum) has a deposit number of CGMCC No. 19404, which expresses a fusion protein cipA-arc. Both the genetically engineered strain and the fusion protein cipA-arc can be used to convert [.sup.14/15N]-L-arginine into [.sup.14/15N]-L-citrulline.
Claims
1. A fusion protein cipA-arc, wherein arginine deiminase (ADI) arc is immobilized on a protein crystalline inclusion of cipA to produce cipA-arc with a catalytic activity, wherein the fusion protein cipA-arc comprises the sequence encoded by SEQ ID NO: 1 and the sequence encoded by SEQ ID NO: 2, and wherein the sequences encoded by SEQ ID NO: 1 and SEQ ID NO: 2 are linked by a sequence comprising SaII and XhoI restriction enzyme cleavage sites.
2. A fusion protein cipA-arc, wherein arginine deiminase (ADI) arc is immobilized on a protein crystalline inclusion of cipA to produce cipA-arc with a catalytic activity, wherein a specific activity of the cipA-arc is between 21.8 and 23.1 U/mg, wherein the definition of the specific activity is one unit of enzyme activity (1U) required to catalyze the conversion of [.sup.14/15N]-L-arginine into 1 mol of citrulline per minute at 37 C. and pH 6.0; the catalytic activity catalyzes a conversion reaction of [.sup.14/15N]-L-arginine to produce [.sup.14/15N]-L-citrulline and the conversion reaction conducted at 37 C., pH of 6.5 for 5 h has a yield of 97.4% [.sup.14/15N]-L-citrulline; and the fusion protein cipA-arc can catalyze the conversion reaction for 50 times without a reduction in enzymatic activity more than 1.5%; and wherein the fusion protein cipA-arc is prepared by a method comprising the following steps: (1) preparing C. glutamicum competent cells; (2) transforming a recombinant plasmid pXMJ19-cipA-arc into the C. glutamicum competent cells prepared in step (1) through electric shock to obtain a genetically engineered recombinant strain, wherein the recombinant plasmid pXMJ19-cipA-arc is constructed by the following process: (a) obtaining a first target fragment comprising the gene sequence of SEQ ID NO: 1, and sequencing the first target fragment; subjecting each of the first target fragment and an expression vector pXMJ19 to double enzyme digestion using a Hindlll restriction enzyme site at the 5 terminus relative to SEQ ID NO: 1 and a SaII restriction enzyme site at the 3 terminus relative to SEQ ID NO: 1, recovering each of enzyme digestion products by gel, and ligating the first target fragment and the expression vector pXMJ19; and transforming a ligation product into Escherichia coli (E. coli) DH5 competent cells to obtain a positive transformant expressing a vector pXMJ19-cipA; and (b) obtaining a second target fragment comprising the gene sequence of SEQ ID NO: 2, and sequencing the second target fragment; subjecting each of the second target fragment and the vector pXMJ19-cipA to double enzyme digestion using a XhoI restriction enzyme site at the 5 terminus relative to SEQ ID NO: 2 and a SacI restriction enzyme site at the 3 terminus relative to SEQ ID NO: 2, recovering each of enzyme digestion products by gel, and ligating the second target fragment and the vector pXMJ19-cipA; and transforming a ligation product into E. coli DH5 competent cells to obtain a recombinant plasmid pXMJ19-cipA-arc; and (3) inducing expression of the fusion protein cipA-arc in the genetically engineered recombinant strain obtained in step (2) by culturing, and subjecting the resulting cells to ultrasonic disruption and centrifugation to obtain a precipitate, wherein the precipitate contains the fusion protein cipA-arc.
3. The fusion protein cipA-arc according to claim 2, wherein in step (1) the preparing C. glutamicum competent cells comprises the following: cultivating C. glutamicum ATCC13032 in an Luria-Bertani medium supplemented with 5 g/L glucose (LBG)-containing solid medium, picking and inoculating fresh bacteria in an LBG liquid medium, and cultivating; transferring a resulting bacterial solution to an LBG medium at an inoculum amount of 0.8% to 1.5%, and continuing to cultivate until OD.sub.600 is 0.8 to 1.0; pre-cooling the resulting bacterial solution by an ice/water mixture, centrifuging, and discarding a resulting supernatant; adding glycerin, and pipetting up and down until bacteria are suspended; centrifuging, and discarding a resulting supernatant; and adding glycerin, and pipetting up and down until bacteria are suspended to obtain the C. glutamicum competent cells.
4. The fusion protein cipA-arc according to claim 3, wherein in step (2) the recombinant plasmid pXMJ19-cipA-arc is transformed into the C. glutamicum competent cells through the electric shock by the following process: thoroughly mixing the C. glutamicum competent cells and the positive transformant recombinant plasmid pXMJ19-cipA-arc, cooling a resulting mixture on ice, and subjecting the resulting mixture to the electric shock for 1 ms to 10 ms at a voltage of 1 kV to 5 kV under a same temperature condition; adding an LBG liquid medium at room temperature, transferring a resulting mixture to a centrifuge tube, and subjecting the resulting mixture to shaking cultivation; coating a resulting bacterial solution on a chloramphenicol-resistant plate, and picking single colonies to extract a plasmid; and confirming an insertion of the second target fragment through the double enzyme digestion and polymerase chain reaction (PCR).
5. The fusion protein cipA-arc according to claim 4, wherein the electric shock is conducted for 5 ms at a voltage of 2.5 kV.
6. The fusion protein cipA-arc according to claim 5, wherein in step (3), the inducing expression of the fusion protein cipA-arc in the genetically engineered recombinant strain comprises: inoculating the genetically engineered recombinant strain into a chloramphenicol-containing LBG medium, cultivating on a shaker until an OD.sub.600 value of a bacterial solution reaches 0.8 to 1.0, and adding isopropyl--D-thiogalactoside (IPTG) to induce overnight; centrifuging to collect the recombinant whole cells, washing the strain with a Tris-HCl buffer, and resuspending in phosphate buffer saline (PBS); and subjecting the recombinant whole cells to ultrasonic disruption, and centrifuging to obtain the precipitate, wherein the precipitate contains the fusion protein cipA-arc.
7. The fusion protein cipA-arc according to claim 4, wherein in step (3), the inducing expression of the fusion protein cipA-arc in the genetically engineered recombinant strain comprises: inoculating the genetically engineered recombinant strain into a chloramphenicol-containing LBG medium, cultivating on a shaker until an OD.sub.600 value of a bacterial solution reaches 0.8 to 1.0, and adding isopropyl--D-thiogalactoside (IPTG) to induce overnight; centrifuging to collect the recombinant whole cells, washing the strain with a Tris-HCl buffer, and resuspending in phosphate buffer saline (PBS); and subjecting the recombinant whole cells to ultrasonic disruption, and centrifuging to obtain the precipitate, wherein the precipitate contains the fusion protein cipA-arc.
8. The fusion protein cipA-arc according to claim 2, wherein the fusion protein cipA-arc is expressed in a genetically engineered strain of Corynebacterium glutamicum (C. glutamicum) deposited in the China General Microbiological Culture Collection Center (CGMCC) of Chinese Academy of Sciences, No. 1, Beichen West Road, Chaoyang District, Beijing, China on Jan. 17, 2020, with a deposition name of C. glutamicum SUMHS-2020.01 and a deposit number of CGMCC No. 19404.
9. A method for preparing [.sup.14/15N]-L-citrulline through enzymatic catalysis, comprising the following step: adding the fusion protein cipA-arc according to claim 3 to a conversion solution to allow a conversion reaction, wherein the conversion solution comprises [.sup.14/15N]-L-arginine and a buffer, and the conversion reaction is conducted for 2 hours to 8 hours at a temperature of 25 C. to 50 C. and a pH of 5.0 to 8.0.
10. The method for preparing [.sup.14/15N]-L-citrulline through enzymatic catalysis according to claim 9, wherein the buffer is PBS; and the conversion reaction is conducted for 5 hours at a temperature of 37 C. and a pH of 6.5.
11. The method for preparing [.sup.14/15N]-L-citrulline through enzymatic catalysis according to claim 9, wherein the C. glutamicum competent cells are prepared by the following process: cultivating C. glutamicum ATCC13032 in an LBG-containing solid medium, picking and inoculating fresh bacteria in an Luria-Bertani medium supplemented with 5 g/L glucose (LBG) liquid medium, and cultivating; transferring an activated bacterial solution to an LBG medium at an inoculum amount of 0.8% to 1.5%, and continuing to cultivate until OD 600 is 0.8 to 1.0; pre-cooling the resulting bacterial solution by an ice/water mixture, centrifuging, and discarding a resulting supernatant; adding glycerin, and pipetting up and down until bacteria are suspended; centrifuging, and discarding a resulting supernatant; and adding glycerin, and pipetting up and down until bacteria are suspended to obtain the C. glutamicum competent cells.
12. The method for preparing [.sup.14/15N]-L-citrulline through enzymatic catalysis according to claim 11, wherein the recombinant plasmid pXMJ19-cipA-arc is transformed into the C. glutamicum competent cells through the electric shock by the following process: thoroughly mixing the C. glutamicum competent cells and the positive transformant recombinant plasmid pXMJ19-cipA-arc, cooling a resulting mixture on ice, and subjecting the resulting mixture to the electric shock for 1 ms to 10 ms at a voltage of 1 kV to 5 kV under a same temperature condition; adding an LBG liquid medium at room temperature, transferring a resulting mixture to a centrifuge tube, and subjecting the resulting mixture to shaking cultivation; coating a resulting bacterial solution on a chloramphenicol-resistant plate, and picking single colonies to extract a plasmid; and confirming an insertion of the second target fragment through the double enzyme digestion and polymerase chain reaction (PCR).
13. The method for preparing [.sup.14/15N]-L-citrulline through enzymatic catalysis according to claim 12, wherein the electric shock is conducted for 5 ms at a voltage of 2.5 kV.
14. A method of preparing [.sup.14/15N]-L-citrulline comprising the step of adding the fusion protein cipA-arc according to claim 2 to a conversion solution to allow a conversion reaction.
15. A method of preparing [.sup.14/15N]-L-citrulline comprising the step of adding the fusion protein cipA-arc according to claim 3 to a conversion solution to allow a conversion reaction.
16. A method of preparing [.sup.14/15N]-L-citrulline comprising the step of adding the fusion protein cipA-arc according to claim 4 to a conversion solution to allow a conversion reaction.
17. A method of preparing [.sup.14/15N]-L-citrulline comprising the step of adding the fusion protein cipA-arc according to claim 5 to a conversion solution to allow a conversion reaction.
Description
DETAILED DESCRIPTION OF THE EMBODIMENTS
(1) The present application will be described in detail below with reference to examples, but the present application is not limited to these examples.
(2) Unless otherwise specified, the raw materials in the examples of the present application are purchased from a discovery platform. The plasmid pXMJ19 is purchased from Wuhan Miaoling Biotechnology Co., Ltd.
(3) The C. glutamicum ATCC13032 is purchased from Guangdong Microbial Culture Collection Center (GDMCC).
(4) According to an embodiment of the present application, it mainly includes: 1) target genes (cipA and arc) are each chemically synthesized; 2) the synthesized cipA and arc are continuously ligated to the vector pXMG19 to construct an expression vector pXMJ19-cipA-arc; 3) the pXMJ19-cipA-arc is introduced into C. glutamicum ATCC13032 through electroporation; 4) induction expression is conducted and the inclusion body cipA-arc (namely, the fusion protein cipA-arc) is isolated; and 5) the inclusion body cipA-arc is used to catalyze the conversion of arginine to produce [.sup.14/15N]-L-citrulline.
(5) In an embodiment of the present application, a [.sup.14/15N]-L-citrulline conversion rate is calculated based on a mole number of carbon.
Example 1 Construction of an ADI-Containing Genetically Engineered Strain
(6) According to the cipA gene sequence reported by Kirsten Jung et al. (2016), a coding region DNA optimized according to a codon bias of C. glutamicum was chemically synthesized by GENEWIZ. The cipA gene sequence was as follows:
(7) TABLE-US-00001 (SEQIDNO:1) ATGATCAACGACATGCACCCATCCCTGATCAAGGACAAGGACATGATGGA CGACGTTATGCTGCGCTCCTGCAAGATCATCGCTATGAAGATCATGCCAG ACAAGGTTATGCAGGTTATGGTTACCGTTCTGATGCTGGACGGCACCTCC GAGGAGATGCTGCTGAAGTGGAACCTGCTGGACAACCGCGGCATGGCTAT CTACAAGGTTCTGATGGAGGCTCTGTGCGGCAAGAAGGACGTTAAGATCG GCACCGTTGGCAAGGTTGGCCCACTGGGCTGCGACTACATCAACTGCGTT GAGATCTCCATG.
(8) A HindIII site was introduced at a 5 terminus of the synthesized gene sequence (SEQ ID NO: 1), a SaII site was introduced at a 3 terminus of the synthesized gene sequence to obtain a target fragment, and the target fragment was sequenced; each of the target fragment and an expression vector pXMJ19 (Biofeng) was subjected to double enzyme digestion with HindIII/SaII, each of enzyme digestion products was recovered by gel, and the target fragment and the vector were ligated; and a ligation product was transformed into E. coli DH5 competent cells to obtain a positive transformant, which was named pXMJ19-cipA after identification.
(9) 1.2 According to the ADI (arc) gene sequence reported by Kim et al. (2007), a coding region DNA optimized according to a codon bias of C. glutamicum was chemically synthesized by GENEWIZ. The arc gene sequence was as follows:
(10) TABLE-US-00002 (SEQIDNO:2) ATGAACAACGGCATCAACGTTAACTCCGAGATCGGCAAGCTGAAGTCCGT TCTGCTGCACCGCCCAGGCGCTGAGGTTGAGAACATCACCCCAGACACCA TGAAGCAGCTGCTGTTCGACGACATCCCATACCTGAAGATCGCTCAGAAG GAGCACGACTTCTTCGCTCAGACCCTGCGCGACAACGGCGCTGAGACCGT TTACATCGAGAACCTGGCTACCGAGGTTTTCGAGAAGTCCTCCGAGACCA AGGAGGAGTTCCTGTCCCACCTGCTGCACGAGGCTGGCTACCGCCCAGGC CGCACCTACGACGGCCTGACCGAGTACCTGACCTCCATGTCCACCAAGGA CATGGTTGAGAAGATCTACGCTGGCGTTCGCAAGAACGAGCTGGACATCA AGCGCACCGCTCTGTCCGACATGGCTGGCTCCGACGCTGAGAACTACTTC TACCTGAACCCACTGCCAAACGCTTACTTCACCCGCGACCCACAGGCTTC CATGGGCGTTGGCATGACCATCAACAAGATGACCTTCCCAGCTCGCCAGC CAGAGTCCCTGATCACCGAGTACGTTATGGCTAACCACCCACGCTTCAAG GACACCCCAATCTGGCGCGACCGCAACCACACCACCCGCATCGAGGGCGG CGACGAGCTGATCCTGAACAAGACCACCGTTGCTATCGGCGTTTCCGAGC GCACCTCCTCCAAGACCATCCAGAACCTGGCTAAGGAGCTGTTCGCTAAC CCACTGTCCACCTTCGACACCGTTCTGGCTGTTGAGATCCCACACAACCA CGCTATGATGCACCTGGACACCGTTTTCACCATGATCAACCACGACCAGT TCACCGTTTTCCCAGGCATCATGGACGGCGCTGGCAACATCAACGTTTTC ATCCTGCGCCCAGGCAAGGACGACGAGGTTGAGATCGAGCACCTGACCGA CCTGAAGGCTGCTCTGAAGAAGGTTCTGAACCTGTCCGAGCTGGACCTGA TCGAGTGCGGCGCTGGCGACCCAATCGCTGCTCCACGCGAGCAGTGGAAC GACGGCTCCAACACCCTGGCTATCGCTCCAGGCGAGATCGTTACCTACGA CCGCAACTACGTTACCGTTGAGCTGCTGAAGGAGCACGGCATCAAGGTTC ACGAGATCCTGTCCTCCGAGCTGGGCCGCGGCCGCGGCGGCGCTCGCTGC ATGTCCCAGCCACTGTGGCGCGAGGACCTGTAA.
(11) A XhoI site was introduced at a 5 terminus of the synthesized gene sequence (SEQ ID NO: 2), a SacI site was introduced at a 3 terminus of the synthesized gene sequence to obtain a target fragment, and the target fragment was sequenced; each of the target fragment and an expression vector pXMJ19-cipA was subjected to double enzyme digestion with XhoI/SacI, each of enzyme digestion products was recovered by gel, and the target fragment and the vector were ligated; and a ligation product was transformed into E. coli DH5 competent cells to obtain a positive transformant, which was named pXMJ19-cipA-arc after identification, namely, the ADI-containing genetically engineered strain. The genetically engineered strain had a deposition name of C. glutamicum SUMHS-2020.01; and the genetically engineered strain was deposited in the China General Microbiological Culture Collection Center (CGMCC) of Chinese Academy of Sciences, No. 1, Beichen West Road, Chaoyang District, Beijing, China on Jan. 17, 2020, with a deposit number of CGMCC No. 19404.
Example 2 Expression of the Fusion Protein cipA-Arc
(12) 2.1 Preparation of C. glutamicum Competent Cells
(13) C. glutamicum ATCC13032 was streaked on an LBG-containing solid medium plate and cultivated in a 30 C. incubator for a period of time; fresh bacteria were picked and inoculated in an LBG liquid medium, and cultivated for 12 h to 24 h in a shaker with a temperature of 30 C. and a rotational speed of 200 r/min; an activated bacterial solution was transferred to an LBG medium at an inoculum amount of 1%, and cultivated in a shaker with a temperature of 30 C. and a rotational speed of 200 r/min until OD.sub.600 was about 0.9; a resulting bacterial solution was pre-cooled for 15 min to 20 min in an ice/water mixture, then dispensed into sterilized 50 mL centrifuge tubes in a clean bench, centrifuged at 6,000 g and 4 C. for 30 s, and placed in ice water for 2 min; a resulting supernatant in each centrifuge tube was discarded, 2.5 mL of pre-cooled 10% glycerin was immediately added to each centrifuge tube, and a resulting mixture was slowly pipetted up and down with a pipette until bacteria were suspended; a resulting suspension was centrifuged at 6,000 g and 4 C. for 30 s, a resulting supernatant was discarded, 500 L of pre-cooled 10% glycerin was immediately added, and a resulting mixture was slowly pipetted up and down until the bacteria were suspended; the operation was repeated three times.
(14) 2.2 Transformation of the Recombinant Plasmid pXMJ19-cipA-Arc into the Competent Cells Through Electric Shock
(15) 80 L of the competent cells and 2 L of the recombinant plasmid pXMJ19-cipA-arc were thoroughly mixed, cooled on ice for 10 min, and immediately added to an ice-cold cuvette, and electric shock was conducted for 5 ms at a voltage of 2.5 kV; the cuvette was taken out as soon as possible at the end of a pulse, 1 mL of an LBG liquid medium was added at room temperature, and a resulting mixture was transferred to a centrifuge tube and cultivated at 30 C. under gentle shaking for 2 h; 200 L of a resulting bacterial solution was coated on a 20 g/ml chloramphenicol-resistant plate; and single colonies were picked to extract the plasmid, and the insertion of the target fragment was confirmed through double enzyme digestion and PCR.
(16) 2.3 Induction Expression of the Genetically Engineered Strain
(17) The recombinant strain identified as positive was inoculated in an LBG medium that included chloramphenicol at a final concentration of 20 g/mL, and cultivated in a shaker with a temperature of 30 C. and a rotational speed of 200 r/min until an OD.sub.600 value of a bacterial solution reached 0.9; IPTG was added at a final concentration of 1 mM to induce overnight at a temperature of 30 C. and a rotational speed of 180 r/min, and a resulting bacterial solution was centrifuged at 4 C. to obtain recombinant whole cells; and the recombinant whole cells were washed twice with a 50 mM Tris-HCl buffer at a pH of 7.0, resuspended in 50 mM PBS at a pH of 6.5, subjected to ultrasonic disruption, and centrifuged at 4 C. to obtain a precipitate, which was an inclusion body cipA-arc (namely, the fusion protein cipA-arc).
(18) 2.4 Determination of the Activity of the Fusion Protein cipA-Arc by Spectrophotometry
(19) The enzymatic activity of the cipA-ADI fusion protein was determined through a specific chromogenic reaction of L-citrulline with diacetylmonoxime in a strongly acidic solution and a linear relationship between an absorbance of a reaction complex at 490 nm and a concentration of L-citrulline. A substrate solution (pH 6.0, 50 mM PBS) with [.sup.14/15N]-L-arginine at a final concentration of 200 mM was prepared. 2.8 mL of the substrate solution was taken, 0.2 mL of an enzyme solution was added, and a reaction was conducted at 37 C. for 10 min. An enzyme reaction solution was diluted appropriately (10 to 100 times). 2 mL of a diluted reaction solution was taken, 3 mL of a mixed acid (volume ratio: H.sub.2SO.sub.4:H.sub.3PO.sub.4=1:3) solution was added, and 0.5 mL of a mixture of diacetylmonoxime and thiosemicarbazide was added; and a resulting mixture was thoroughly shaken and immediately placed in a boiling water bath for 10 min, and then an absorbance at 530 nm was determined. Definition of the enzymatic activity of the cipA-ADI fusion protein: at 37 C. and pH 6.0, an enzyme amount required to catalyze the conversion of [.sup.14/15N]-L-arginine into 1 mol of citrulline per minute was defined as one unit for enzyme activity (1U). Definition of specific enzyme activity: the number of units for enzyme activity included in per mg of protein (U/mg). A protein concentration was determined by the Bradford method.
Example 3 Expression of the Fusion Protein cipA-Arc
(20) The experimental conditions and steps were the same as those in Example 2, except that the cultivation in step 2.1 was conducted at a temperature of 20 C. and a rotational speed of 300 r/min until OD.sub.600 was about 0.3.
Example 4 Expression of the Fusion Protein cipA-Arc
(21) The experimental conditions and steps were the same as those in Example 2, except that the cultivation in step 2.1 was conducted at a temperature of 37 C. and a rotational speed of 150 r/min until OD.sub.600 was about 1.0.
Example 5 Expression of the Fusion Protein cipA-Arc
(22) The experimental conditions and steps were the same as those in Example 2, except that the cultivation in step 2.1 was conducted at a temperature of 40 C. and a rotational speed of 180 r/min until OD.sub.600 was about 0.72.
(23) TABLE-US-00003 Influence of different implementation conditions on the preparation of C. glutamicum competent cells Number of Cultivation Rotational speed competent Example temperature ( C.) (r/min) OD.sub.600 cells Example 2- 30 200 0.9 Normal 2.1 Example 3 20 300 0.3 Small Example 4 37 150 1.0 Normal Example 5 40 180 0.72 Small
Example 6 Expression of the Fusion Protein cipA-Arc
(24) The experimental conditions and steps were the same as those in Example 2, except that the electric shock in step 2.2 was conducted for 10 ms at a voltage of 1 kV.
Example 7 Expression of the Fusion Protein cipA-Arc
(25) The experimental conditions and steps were the same as those in Example 2, except that the electric shock in step 2.2 was conducted for 1 ms at a voltage of 5 kV.
(26) TABLE-US-00004 Influence of different electric shock conditions on the conversion efficiency of C. glutamicum competent cells Number of Voltage of successfully- electric Time of Cultivation transformed shock electric temperature recombinant Example (kV) shock (ms) ( C.) single colonies Example 2- 2.5 5 37 200 2.2 Example 6 1 10 37 53 Example 7 5 1 37 12
Example 8 Expression of the Fusion Protein cipA-Arc
(27) The experimental conditions and steps were the same as those in Example 2, except that, in step 2.3, the cultivation was conducted at a temperature of 40 C. and a rotational speed of 150 r/min until OD.sub.600 was about 0.7; and the induction was conducted at a temperature of 40 C. and a rotational speed of 150 r/min.
Example 9 Expression of the Fusion Protein cipA-Arc
(28) The experimental conditions and steps were the same as those in Example 2, except that, in step 2.3, the cultivation was conducted at a temperature of 20 C. and a rotational speed of 300 r/min until OD.sub.600 was about 0.5; and the induction was conducted at a temperature of 20 C. and a rotational speed of 200 r/min.
Example 10 Expression of the Fusion Protein cipA-Arc
(29) The experimental conditions and steps were the same as those in Example 2, except that, in step 2.3, the cultivation was conducted at a temperature of 25 C. and a rotational speed of 150 r/min until OD.sub.600 was about 1.0; and the induction was conducted at a temperature of 35 C. and a rotational speed of 220 r/min.
(30) TABLE-US-00005 Influence of different cultivation conditions on the expresssion efficiency of the fusion protein cipA-arc in the recombinant C. glutamicum Rotational cipA- Temperature speed arc Cultivation Rotational Inducer during during Specific temperature speed concentration induction induction activity Example ( C.) (r/min) OD.sub.600 (mM) ( C.) (r/min) (U/mg) Example 2-2.3 30 200 0.9 1 30 180 23.1 Example 8 40 250 0.7 1 40 150 22.5 Example 9 20 300 0.5 1 20 200 21.8 Example 10 25 150 1.0 1 35 220 22.9
Example 11 Conversion of [.SUP.14/15.N]-L-Arginine to Produce [.SUP.14/15.N]-L-Citrulline
(31) ##STR00001##
(32) The inclusion body cipA-arc, namely, the fusion protein cipA-arc (9,200U), was added to 1 L of a conversion solution, and a conversion reaction was conducted at 37 C. for 5 h, where the conversion solution included 400 g of [.sup.14/15N]-L-arginine as a substrate and had a pH of 6.5. A conversion rate of [.sup.14/15N]-L-arginine was 99.9% or more. A resulting reaction mixture was centrifuged to obtain a supernatant and a precipitate; the supernatant was subjected to vacuum concentration, crystallization, filtration, and drying to obtain 389.6 g of a white powdery solid, with a yield of 97.4%, which was [.sup.14/15N]-L-citrulline with a purity of 99.9% or more; and the precipitate was resuspended in 50 mM PBS with a pH of 6.5, and then added to the conversion solution for conversion. The reaction was repeated 50 times, at which point the enzymatic activity was reduced by 1.5%, and an unused enzyme was added in proportion or the used enzyme was partly replaced by the unused enzyme.
Example 12 Conversion of [.SUP.14/15.N]-L-Arginine to Produce [.SUP.14/15.N]-L-Citrulline
(33) The experimental conditions and steps were the same as those in Example 11, except that the conversion reaction was conducted at 25 C. for 8 h; the conversion solution had a pH of 5.0; a conversion rate of [.sup.14/15N]-L-arginine was 97.6%; 390.8 g of a white powdery solid was obtained, with a yield of 97.7%, which was [.sup.14/15N]-L-citrulline with a purity of 98.5% or more; and the reaction was repeated 50 times, at which point the enzymatic activity was reduced by 7.6%, an unused enzyme was added in proportion or the used enzyme was partly replaced by an unused enzyme, and the pH was adjusted to 5.0.
Example 13 Conversion of [.SUP.14/15.N]-L-Arginine to Produce [.SUP.14/15.N]-L-Citrulline
(34) The experimental conditions and steps were the same as those in Example 11, except that the conversion reaction was conducted at 50 C. for 2 h; the conversion solution had a pH of 8.0; a conversion rate of [.sup.14/15N]-L-arginine was 86.5%; 346.0 g of a white powdery solid was obtained, with a yield of 88.3%, which was [.sup.14/15N]-L-citrulline with a purity of 97.8% or more; and the reaction was repeated 45 times, at which point the enzymatic activity was reduced by 15.4%, an unused enzyme was added in proportion or the used enzyme was partly replaced by an unused enzyme, and the pH was adjusted to 8.0.
(35) TABLE-US-00006 Influence of different catalytic conditions on the catalytic efficiency of the fusion protein cipA-arc Remaining Catalytic Catalytic Conversion enzymatic temperature time rate Number of activity Yield Purity Example ( C.) pH (h) (%) cycles (%) (%) (%) Example 11 37 6.5 5 99.9 50 98.5 97.4 99.9 Example 12 25 5.0 8 97.6 50 92.4 97.7 98.5 Example 13 50 8.0 2 86.5 45 84.6 88.3 97.8
Example 14 Conversion of [.SUP.14/15.N]-L-Arginine to Produce [.SUP.14/15.N]-L-Citrulline by Bacterial Whole Cells
(36) A 30 g/L genetically engineered strain with the induction expression of the inclusion body cipA-arc was added to 1 L of a conversion solution, and a conversion reaction was conducted at 40 C. for 7 h, where the conversion solution included 400 g of [.sup.14/15N]-L-arginine as a substrate and had a pH of 6.7. A conversion rate of [.sup.14/15N]-L-arginine was 99.9% or more. A resulting reaction mixture was centrifuged to obtain a supernatant and a precipitate; the supernatant was subjected to vacuum concentration, crystallization, filtration, and drying to obtain 382.8 g of a white powdery solid, with a yield of 95.7%, which was [.sup.14/15N]-L-citrulline with a purity of 99.5% or more; the precipitate was resuspended in 50 mM PBS with a pH of 6.7, and then added to the conversion solution for conversion. The reaction was repeated 50 times, at which point the enzymatic activity was reduced by 2.2%, and fresh bacteria were added in proportion or the bacteria in use were partly replaced by fresh bacteria.
Example 15 Conversion of [.SUP.14/15.N]-L-Arginine to Produce [.SUP.14/15.N]-L-Citrulline
(37) The experimental conditions and steps were the same as those in Example 14, except that a 60 g/L genetically engineered strain with the induction expression of the inclusion body cipA-arc was adopted; the conversion reaction was conducted at 37 C. for 3.5 h; the conversion solution had a pH of 6.2; a conversion rate of [.sup.14/15N]-L-arginine was 99.9% or more; 385.2 g of a white powdery solid was obtained, with a yield of 96.3%, which was [.sup.14/15N]-L-citrulline with a purity of 99.8% or more; the reaction was repeated 50 times, at which point the enzymatic activity was reduced by 1.6%, fresh bacteria were added in proportion or the bacteria in use were partly replaced by fresh bacteria, and the pH was adjusted to 6.2.
Example 16 Conversion of [.SUP.14/15.N]-L-Arginine to Produce [.SUP.14/15.N]-L-Citrulline
(38) The experimental conditions and steps were the same as those in Example 14, except that a 60 g/L genetically engineered strain with the induction expression of the inclusion body cipA-arc was adopted; the conversion reaction was conducted at 50 C. for 2 b; the conversion solution had a pH of 8.0; a conversion rate of [.sup.14/15N]-L-arginine was 85.5% or more; 345.2 g of a white powdery solid was obtained, with a yield of 86.3%, which was [.sup.14/15N]-L-citrulline with a purity of 94.2% or more; the reaction was repeated 45 times, at which point the enzymatic activity was reduced by 7.4%, fresh bacteria were added in proportion or the bacteria in use were partly replaced by fresh bacteria, and the pH was adjusted to 8.0.
(39) TABLE-US-00007 Influence of different catalytic conditions on the catalytic efficiency of the bacterial whole cells including the fusion protein cipA-arc Catalytic Catalytic Conversion Remaining temperature time rate Number of activity Yield Punty Example ( C.) pH (h) (%) cycles (%) (%) (%) Example 14 40 6.7 7 >99.9 50 97.8 95.7 99.5 Example 15 37 6.3 3.5 >99.9 50 98.4 96.3 99.8 Example 16 50 8.0 2 85.5 45 92.6 86.3 94.2
(40) The above examples are merely few examples of the present application, and do not limit the present application in any form. Although the present application is disclosed as above with preferred examples, the present application is not limited thereto. Some changes or modifications made by any technical personnel familiar with the profession using the technical content disclosed above without departing from the scope of the technical solutions of the present application are equivalent to equivalent implementation cases and fall within the scope of the technical solutions.