MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA) MOLECULES AND USES THEREOF

20230159929 · 2023-05-25

    Inventors

    Cpc classification

    International classification

    Abstract

    Described are short interfering nucleic acid (siNA) molecules comprising modified nucleotides, compositions, and methods and uses thereof.

    Claims

    1. A nucleotide comprising a structure of: ##STR00261## wherein Rx is a nucleobase, aryl, heteroaryl, or H.

    2. A nucleotide of claim 1 comprising a structure of: ##STR00262## wherein R.sub.y is a nucleobase.

    3. A nucleotide comprising a structure of: ##STR00263## wherein R.sub.y is a nucleobase.

    4.-5. (canceled)

    6. A nucleotide phosphate mimic comprising a structure of: ##STR00264## ##STR00265## wherein R.sub.y is a nucleobase and R.sup.15 is H or CH.sub.3.

    7-8. (canceled)

    9. A short interfering nucleic acid (siNA) molecule comprising a sense strand and an antisense strand, and comprising at least one nucleotide selected from ##STR00266## wherein Rx is a nucleobase, aryl, heteroaryl, or H; ##STR00267## wherein R.sub.y is a nucleobase; and any combination thereof.

    10. A short interfering nucleic acid (siNA) molecule comprising a sense strand and an antisense strand, wherein the antisense comprises a nucleotide phosphate mimic at its 5′ end selected from: ##STR00268## ##STR00269## wherein R.sub.y is a nucleobase and R.sup.15 is H or CH.sub.3.

    11. A short interfering nucleic acid (siNA) molecule comprising: (a) a sense strand comprising a first nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucleotide sequence: (i) is 15 to 30 nucleotides in length; and (ii) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and the nucleotide at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide or wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and at least one modified nucleotide is a 2′-fluoro nucleotide; and  an antisense strand comprising a second nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucleotide sequence: (iii) is 15 to 30 nucleotides in length; and (iv) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and at least one modified nucleotide is a 2′-fluoro nucleotide; or (b) a sense strand comprising a first nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucleotide sequence: (i) is 15 to 30 nucleotides in length; and (ii) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and at least one modified nucleotide is a 2′-fluoro nucleotide; and  an antisense strand comprising a second nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucleotide sequence: (iii) is 15 to 30 nucleotides in length; and (iv) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and the nucleotide at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide; wherein the sense strand and/or the antisense strand comprise at least one, at least two, at least 3, at least 4, or at least 5 nucleotide(s) according to claim 1.

    12. A short interfering nucleic acid (siNA) molecule comprising: (a) a sense strand comprising a first nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucleotide sequence: (i) is 15 to 30 nucleotides in length; and (ii) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and the nucleotide at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide or wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and at least one modified nucleotide is a 2′-fluoro nucleotide; and  an antisense strand comprising a second nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucleotide sequence: (iii) is 15 to 30 nucleotides in length; and (iv) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and at least one modified nucleotide is a 2′-fluoro nucleotide; or (b) a sense strand comprising a first nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucleotide sequence: (i) is 15 to 30 nucleotides in length; and (ii) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and at least one modified nucleotide is a 2′-fluoro nucleotide; and  an antisense strand comprising a second nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucleotide sequence: (iii) is 15 to 30 nucleotides in length; and (iv) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and the nucleotide at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide; wherein the antisense strand comprises a nucleotide phosphate mimic according to claim 6 at its 5′ end.

    13. The siNA molecule of claim 9, wherein the antisense strand comprises a 5′-stabilized end cap selected from: ##STR00270## ##STR00271## wherein R.sub.y is a nucleobase and R.sup.15 is H or CH.sub.3.

    14. The siNA molecule according to claim 9, wherein the antisense strand comprises a 5′-stabilized end cap selected from the group consisting of Formula (1) to Formula (16), Formula (9X) to Formula (12X), Formula (16X), Formula (9Y) to Formula (12Y), Formula (16Y), Formula (21) to Formula (36), Formula 36X, Formula (41) to (56), Formula (49X) to (52X), Formula (49Y) to (52Y), Formula 56X, Formula 56Y, Formula (61), Formula (62), and Formula (63): ##STR00272## ##STR00273## ##STR00274## ##STR00275## ##STR00276## ##STR00277## ##STR00278## ##STR00279## ##STR00280## ##STR00281## ##STR00282## ##STR00283## ##STR00284## ##STR00285## wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H.

    15. The siNA molecule according to claim 9, wherein the antisense strand comprises a 5′-stabilized end cap selected from the group consisting of Formula (71) to Formula (86), Formula (79X) to Formula (82X), Formula (79Y) to (82Y), Formula 86X, Formula 86X′, Formula 86Y, and Formula 86Y′: ##STR00286## ##STR00287## ##STR00288## ##STR00289## ##STR00290## ##STR00291## wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H.

    16. The siNA molecule according to claim 9, wherein the antisense strand comprises a 5′-stabilized end cap selected from the group consisting of Formulas (1A)-(15 A), Formulas (1A-1)-(7 A-1), Formulas (1A-2)-(7 A-2), Formulas (1A-3)-(7 A-3), Formulas (1A-4)-(7 A-4), Formulas (9B)-(12B), Formulas (9AX)-(12AX), Formulas (9AY)-(12AY), Formulas (9BX)-(12BX), and Formulas (9BY)-(12BY): ##STR00292## ##STR00293## ##STR00294## ##STR00295## ##STR00296##

    17. The siNA molecule according to claim 9, wherein the antisense strand comprises a 5′-stabilized end cap selected from the group consisting of Formulas (21A)-(35 A), Formulas (29B)-(32B), Formulas (29AX)-(32AX), Formulas (29AY)-(32AY), Formulas (29BX)-(32BX), and Formulas (29BY)-(32BY): ##STR00297## ##STR00298## ##STR00299##

    18. The siNA molecule according to claim 9, wherein the antisense strand comprises a 5′-stabilized end cap selected from the group consisting of Formulas (71A)-(86 A), Formulas (79XA)-(82XA), Formulas (79YA)-(82YA); Formula (86XA), Formula (86X′A), Formula (86Y), and Formula (86Y′): ##STR00300## ##STR00301## ##STR00302##

    19. The siNA molecule of claim 9, wherein the sense strand and/or the antisense strand independently comprise 1 or more phosphorothioate internucleoside linkages, 1 or more mesyl phosphoroamidate internucleoside linkages, or a combination thereof.

    20. (canceled)

    21. The siNA molecule of claim 9, wherein the siNA further comprises a phosphorylation blocker.

    22. (canceled)

    23. The siNA molecule of claim 19, wherein: (i) at least one phosphorothioate internucleoside linkage in the sense strand is between the nucleotides at positions 1 and 2 from the 5′ end of the first nucleotide sequence; (ii) at least one phosphorothioate internucleoside linkage is between the nucleotides at positions 2 and 3 from the 5′ end of the first nucleotide sequence; (ii) at least one phosphorothioate internucleoside linkage in the antisense strand is between the nucleotides at positions 1 and 2 from the 5′ end of the second nucleotide sequence; (iii) at least one phosphorothioate internucleoside linkage in the antisense strand is between the nucleotides at positions 2 and 3 from the 5′ end of the second nucleotide sequence; (iv) at least one phosphorothioate internucleoside linkage in the antisense strand is between the nucleotides at positions 1 and 2 from the 3′ end of the second nucleotide sequence; and/or (iv) at least one phosphorothioate internucleoside linkage is between the nucleotides at positions 2 and 3 from the 3′ end of the second nucleotide sequence.

    24.-26. (canceled)

    27. The siNA molecule of claim 19, wherein: (i) at least one mesyl phosphoroamidate internucleoside linkage in the sense strand is between the nucleotides at positions 1 and 2 from the 5′ end of the first nucleotide sequence; (ii) at least one mesyl phosphoroamidate internucleoside linkage is between the nucleotides at positions 2 and 3 from the 5′ end of the first nucleotide sequence; (ii) at least one mesyl phosphoroamidate internucleoside linkage in the antisense strand is between the nucleotides at positions 1 and 2 from the 5′ end of the second nucleotide sequence; (iii) at least one mesyl phosphoroamidate internucleoside linkage in the antisense strand is between the nucleotides at positions 2 and 3 from the 5′ end of the second nucleotide sequence; (iv) at least one mesyl phosphoroamidate internucleoside linkage in the antisense strand is between the nucleotides at positions 1 and 2 from the 3′ end of the second nucleotide sequence; and/or (iv) at least one mesyl phosphoroamidate internucleoside linkage is between the nucleotides at positions 2 and 3 from the 3′ end of the second nucleotide sequence.

    28.-29. (canceled)

    30. A short interfering nucleic acid (siNA) comprising a sense strand and an antisense strand, wherein the sense strand and/or the antisense strand independently comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more mesyl phosphoroamidate internucleoside linkages.

    31. The siNA molecule according to claim 9, wherein the siNA further comprises a galactosamine.

    32. The siNA according to claim 31, wherein the galactosamine is N-acetylgalactosamine (GalNAc) of Formula (VI): ##STR00303## wherein m is 1, 2, 3, 4, or 5; each n is independently 1 or 2; p is 0 or 1; each R is independently H; each Y is independently selected from —O—P(═O)(SH)—, —O—P(═O)(O)—, —O—P(═O)(OH)—, and —O—P(S)S—; Z is H or a second protecting group; either L is a linker or L and Y in combination are a linker; and A is H, OH, a third protecting group, an activated group, or an oligonucleotide.

    33. The siNA according to claim 31, wherein the galactosamine is N-acetylgalactosamine (GalNAc) of Formula (VII): ##STR00304## wherein R.sup.z is OH or SH; and each n is independently 1 or 2.

    34. The siNA molecule according to claim 9, wherein: (i) at least one end of the siNA is a blunt end; (ii) at least one end of the siNA comprises an overhang, wherein the overhang comprises at least one nucleotide; or (iii) both ends of the siNA comprise an overhang, wherein the overhang comprises at least one nucleotide.

    35. The siNA molecule according to claim 9, wherein; (i) the target gene is a viral gene; (ii) the target gene is a gene is from a DNA virus. (iii) the target gene is a gene from a double-stranded DNA (dsDNA) virus; (iv) the target gene is a gene from a hepadnavirus; (v) the target gene is a gene from a a hepatitis B virus (HBV); (vi) the target gene is a gene from a HBV of any one of genotypes A-J; or (vii) the target gene is selected from the S gene or X gene of a HBV

    36. An siNA as shown in Table 1, Table 2, Table 3, Table 4, or Table 5.

    37. A composition comprising the siNA according to claim 9; and a pharmaceutically acceptable excipient.

    38. The composition of claim 37 further comprising 2 or more siNAs comprising a sense strand and an antisense strand, and comprising at least one nucleotide selected from ##STR00305## wherein Rx is a nucleobase, aryl, heteroaryl, or H; ##STR00306## wherein R.sub.y is a nucleobase; and any combination thereof.

    39. The composition according to claim 37 further comprising an additional treatment agent.

    40. The composition of claim 39, wherein the additional treatment agent is selected from a nucleotide analog, nucleoside analog, a capsid assembly modulator (CAM), a recombinant interferon, an entry inhibitor, a small molecule immunomodulatory, and oligonucleotide therapy.

    41. The composition of claim 40, wherein the oligonucleotide therapy is an additional siNA, an antisense oligonucleotide (ASO), NAPs, or STOPS™.

    42. A method of treating a disease in a subject in need thereof, comprising administering to the subject the siNA according to claim 9.

    43.-75. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0048] FIG. 1 illustrates an exemplary siNA molecule.

    [0049] FIG. 2 illustrates an exemplary siNA molecule.

    [0050] FIGS. 3A-3H illustrate exemplary double-stranded siNA molecules.

    [0051] FIG. 4 shows a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, ds-siNA-009, or ds-siNA-010.

    [0052] FIG. 5A shows a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, ds-siNA-017 (with the addition of a GalNAc), or ds-siNA-018 (with the addition of a GalNAc).

    [0053] FIG. 5B shows a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, CONTROL 7, or CONTROL 8.

    [0054] FIG. 6 shows a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, ds-siNA-011, ds-siNA-012, or ds-siNA-013.

    [0055] FIG. 7 shows shows a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, ds-siNA-026, ds-siNA-027, ds-siNA-028, ds-siNA-029, ds-siNA-030, ds-siNA-031, or ds-siNA-032.

    [0056] FIG. 8 shows shows a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, ds-siNA-046, ds-siNA-047, ds-siNA-048, or ds-siNA-049.

    DETAILED DESCRIPTION

    [0057] Disclosed herein are novel, modified nucelobase monomers that may comprise a unique chemical moiety in place of a base, lack a bond between the 3′ and 4′ carbons of the central furanose ring (i.e., an unlocked nucleotide), and/or possess a phosphate mimicking group (such nucleotides may henceforth be referred to as “nucleotide phosphate mimics”). Also disclosed herein are short interfering nucleic acid (siNA) molecules comprising modified nucleobases (i.e., nucleotides).

    [0058] In general, the siNA molecules described herein may be double-stranded siNA (ds-siNA) molecules. The siNA molecules described herein may comprise modified nucleotides selected from 2′-O-methyl nucleotides and 2′-fluoro nucleotides. The siNA molecules described herein may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more phosphorothioate internucleoside linkages. The siNA molecules described herein may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more mesyl phosphoramidate internucleoside linkages. The siNA molecules described herein may comprise at least one phosphorylation blocker. The siNA molecules described herein may comprise a 5′-stabilized end cap (including but not limited to the disclosed nucleotide phosphate mimics). The siNA molecules described herein may comprise a galactosamine. The siNA molecules described herein may comprise one or more blunt ends. The siNA molecules described herein may comprise one or more overhangs.

    [0059] For instance, the present disclosure provides modified nucleotides comprising a structure of:

    ##STR00045##

    wherein R.sub.y is a nucleobase, as well as modified nucleotides comprising a structure of:

    ##STR00046##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H. In some embodiments, the modified nucleotides may comprise a structure of:

    ##STR00047##

    wherein R.sub.y is a nucleobase. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0060] The present disclosure also provides nucleotide phosphate mimics that can serve as a stabilized end cap at the 5′ end of the antisense strand of any of the disclosed siNA. The disclosed nucleotide phosphate mimics include, but are not limited to, the structures:

    ##STR00048##

    wherein R.sub.y is a nucleobase and R.sup.15 is H or CH.sub.3. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof. In some embodiments, the disclosed nucleotide phosphate mimics include, but are not limited to, the structures:

    ##STR00049## ##STR00050## ##STR00051## ##STR00052## ##STR00053## ##STR00054## ##STR00055## ##STR00056##

    wherein R.sup.15 is H or CH.sub.3.

    [0061] The disclosed short interfering nucleic acid (siNA) molecules may comprise at least one, at least two, at least 3, at least 4, or at least 5 of the foregoing modified nucleotides and/or one of the foregoing nucleotide phosphate mimics at the 5′ end of the antisense strand. Indeed, a short interfering nucleic acid (siNA) molecule of the present disclosure may comprise: [0062] (a) a sense strand comprising a first nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucleotide sequence: [0063] (i) is 15 to 30 nucleotides in length; and [0064] (ii) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and the nucleotide at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide or wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and at least one modified nucleotide is a 2′-fluoro nucleotide; and  an antisense strand comprising a second nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucleotide sequence: [0065] (iii) is 15 to 30 nucleotides in length; and [0066] (iv) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and at least one modified nucleotide is a 2′-fluoro nucleotide; or [0067] (b) a sense strand comprising a first nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucleotide sequence: [0068] (i) is 15 to 30 nucleotides in length; and [0069] (ii) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and at least one modified nucleotide is a 2′-fluoro nucleotide; and  an antisense strand comprising a second nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucleotide sequence: [0070] (iii) is 15 to 30 nucleotides in length; and [0071] (iv) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and the nucleotide at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide; or [0072] (c) a sense strand comprising a first nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucleotide sequence: [0073] (i) is 15 to 30 nucleotides in length; and [0074] (ii) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and the nucleotide at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide or wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and at least one modified nucleotide is a 2′-fluoro nucleotide; and  an antisense strand comprising a second nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucleotide sequence: [0075] (iii) is 15 to 30 nucleotides in length; and [0076] (iv) comprises 15 or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide, wherein at least one modified nucleotide is a 2′-O-methyl nucleotide and the nucleotide at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide;
    so long as the sense strand and/or the antisense strand comprise at least one, at least two, at least 3, at least 4, or at least 5 of the modified nucleotide(s) selected from

    ##STR00057##

    wherein Rx is a nucleobase, aryl, heteroaryl, or H; and/or so long as the antisense strand comprises a nucleotide phosphate mimic selected from:

    ##STR00058##

    when R.sup.15 is CH.sub.3); where R.sup.15 is H or CH.sub.3.

    [0077] Further, the siNA of the present disclosure may comprise a sense strand and/or an antisense strand that each independently comprise 1 or more phosphorothioate internucleoside linkages, 1 or more mesyl phosphoramidate internucleoside linkages, or a combination thereof. The siNA may comprise a phosphorylation blocker, a galactosamine, and/or a 5′-stabilized end cap (other than those noted above). The siNA may be conjugated to a targeting moiety, such as a galactosamine.

    [0078] Further disclosed herein are compositions comprising two or more of the siNA molecules described herein.

    [0079] Further disclosed herein are compositions comprising any of the siNA molecule described and a pharmaceutically acceptable carrier or diluent. Such compositions may also include an additional therapeutic agent, or may be administered in conjunction with an additional therapeutic agent (either concurrently or sequentially).

    [0080] Further disclosed herein are compositions comprising two or more of the siNA molecules described herein for use as a medicament.

    [0081] Further disclosed herein are compositions comprising any of the siNA molecule described and a pharmaceutically acceptable carrier or diluent for use as a medicament. Such medicaments may also include an additional therapeutic agent, or may be administered in conjunction with an additional therapeutic agent (either concurrently or sequentially).

    [0082] Further disclosed herein are methods of treating a disease in a subject in need thereof, the methods comprising administering to the subject any of the siNA molecules (or a combination thereof) or compositions/medicaments described herein.

    [0083] Further disclosed herein are uses of any of the siNA molecules described herein (or a combination thereof) in the manufacture of a medicament for treating a disease.

    Short Interfering Nucleic Acid (siNA) Molecules

    [0084] As indicated above, the present disclosure provides siNA molecules comprising modified nucleotides. Any of the siNA molecules described herein may be double-stranded siNA (ds-siNA) molecules. The terms “siNA molecules” and “ds-siNA molecules” may be used interchangeably. In some embodiments, the ds-siNA molecules comprise a sense strand and an antisense strand.

    [0085] For the purposes of the present disclosure, the siNA molecules disclosed herein may generally comprise (a) at least one phosphorylation blocker, conjugated moiety, and/or 5′-stabilized end cap; and (b) a short interfering nucleic acid (siNA). In some embodiments, the phosphorylation blocker is a phosphorylation blocker disclosed herein. In some embodiments, the conjugated moiety is a galactosamine disclosed herein. In some embodiments, the 5′-stabilized end cap is a 5′-stabilized end cap disclosed herein.

    [0086] The siNA may comprise any of the first nucleotide, second nucleotide, sense strand, or antisense strand sequences disclosed herein. The siNA may comprise 5 to 100, 5 to 90, 10 to 100, 10 to 90, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 30, 10 to 25, 15 to 100, 15 to 90, 15 to 80, 15 to 70, 15 to 60, 15 to 50, 15 to 30, or 15 to 25 nucleotides. The siNA may comprise at least 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. The siNA may comprise less than or equal to 50, 45, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, or 19 nucleotides. The nucleotides may be modified nucleotides. The siNA may be single stranded (ss-siNA). The siNA may be double stranded (ds-siNA).

    [0087] The ds-siNA may comprise (a) a sense strand comprising 15 to 30, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 17 to 30, 17 to 25, 17 to 24, 17 to 23, 17 to 22, 17 to 21, 18 to 30, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 19 to 30, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 20 to 25, 20 to 24, 20 to 23, 21 to 25, 21 to 24, or 21 to 23 nucleotides; and (b) an antisense strand comprising 15 to 30, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 17 to 30, 17 to 25, 17 to 24, 17 to 23, 17 to 22, 17 to 21, 18 to 30, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 19 to 30, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 20 to 25, 20 to 24, 20 to 23, 21 to 25, 21 to 24, or 21 to 23 nucleotides. The ds-siNA may comprise (a) a sense strand comprising about 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides; and (b) an antisense strand comprising about 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. The ds-siNA may comprise (a) a sense strand comprising about 19 nucleotides; and (b) an antisense strand comprising about 21 nucleotides. The ds-siNA may comprise (a) a sense strand comprising about 21 nucleotides; and (b) an antisense strand comprising about 23 nucleotides.

    [0088] Any of the siNA molecules disclosed herein may further comprise one or more linkers independently selected from a phosphodiester (PO) linker, phosphorothioate (PS) linker, phosphorodithioate linker, mesyl phosphoramidate (Ms), and PS-mimic linker. In some embodiments, the PS-mimic linker is a sulfur linker. In some embodiments, the linkers are internucleoside linkers. Alternatively or additionally, the linkers may connect a nucleotide of the siNA molecule to at least one phosphorylation blocker, conjugated moiety, or 5′-stabilized end cap. In some embodiments, the linkers connect a conjugated moiety to a phosphorylation blocker or 5′-stabilized end cap.

    [0089] An exemplary siNA molecule of the present disclosure is shown in FIG. 1. As shown in FIG. 1, an exemplary siNA molecule comprises a sense strand (101) and an antisense strand (102). The sense strand (101) may comprise a first oligonucleotide sequence (103). The first oligonucleotide sequence (103) may comprise one or more phosphorothioate internucleoside linkages (109). The phosphorothioate internucleoside linkage (109) may be between the nucleotides at the 5′ or 3′ terminal end of the first oligonucleotide sequence (103). The phosphorothioate internucleoside linkage (109) may be between the first three nucleotides from the 5′ end of the first oligonucleotide sequence (103). The first oligonucleotide sequence (103) may comprise one or more 2′-fluoro nucleotides (110). The first oligonucleotide sequence (103) may comprise one or more 2′-O-methyl nucleotides (111). The first oligonucleotide sequence (103) may comprise 15 or more modified nucleotides independently selected from 2′-fluoro nucleotides (110) and 2′-O-methyl nucleotides (111). The sense strand (101) may further comprise a phosphorylation blocker (105). The sense strand (101) may further comprise a galactosamine (106). The antisense strand (102) may comprise a second oligonucleotide sequence (104). The second oligonucleotide sequence (104) may comprise one or more phophorothioate internucleoside linkages (109). The phosphorothioate internucleoside linkage (109) may be between the nucleotides at the 5′ or 3′ terminal end of the second oligonucleotide sequence (104). The phosphorothioate internucleoside linkage (109) may be between the first three nucleotides from the 5′ end of the second oligonucleotide sequence (104). The phosphorothioate internucleoside linkage (109) may be between the first three nucleotides from the 3′ end of the second oligonucleotide sequence (104). The second oligonucleotide sequence (104) may comprise one or more 2′-fluoro nucleotides (110). The second oligonucleotide sequence (104) may comprise one or more 2′-O-methyl nucleotides (111). The second oligonucleotide sequence (104) may comprise 15 or more modified nucleotides independently selected from 2′-fluoro nucleotides (110) and 2′-O-methyl nucleotides (111). The antisense strand (102) may further comprise a 5′-stabilized end cap (107). The siNA may further comprise one or more blunt ends. Alternatively, or additionally, one end of the siNA may comprise an overhang (108). The overhang (108) may be part of the sense strand (101). The overhang (108) may be part of the antisense strand (102). The overhang (108) may be distinct from the first nucleotide sequence (103). The overhang (108) may be distinct from the second nucleotide sequence (104). The overhang (108) may be part of the first nucleotide sequence (103). The overhang (108) may be part of the second nucleotide sequence (104). The overhang (108) may comprise 1 or more nucleotides. The overhang (108) may comprise 1 or more deoxyribonucleotides. The overhang (108) may comprise 1 or more modified nucleotides. The overhang (108) may comprise 1 or more modified ribonucleotides. The sense strand (101) may be shorter than the antisense strand (102). The sense strand (101) may be the same length as the antisense strand (102). The sense strand (101) may be longer than the antisense strand (102).

    [0090] An exemplary siNA molecule of the present disclosure is shown in FIG. 2. As shown in FIG. 2, an exemplary siNA molecule comprises a sense strand (201) and an antisense strand (202). The sense strand (201) may comprise a first oligonucleotide sequence (203). The first oligonucleotide sequence (203) may comprise one or more phophorothioate internucleoside linkages (209). The phosphorothioate internucleoside linkage (209) may be between the nucleotides at the 5′ or 3′ terminal end of the first oligonucleotide sequence (203). The phosphorothioate internucleoside linkage (209) may be between the first three nucleotides from the 5′ end of the first oligonucleotide sequence (203). The first oligonucleotide sequence (203) may comprise one or more 2′-fluoro nucleotides (210). The first oligonucleotide sequence (203) may comprise one or more 2′-O-methyl nucleotides (211). The first oligonucleotide sequence (203) may comprise 15 or more modified nucleotides independently selected from 2′-fluoro nucleotides (210) and 2′-O-methyl nucleotides (211). The sense strand (201) may further comprise a phosphorylation blocker (205). The sense strand (201) may further comprise a galactosamine (206). The antisense strand (202) may comprise a second oligonucleotide sequence (204). The second oligonucleotide sequence (204) may comprise one or more phophorothioate internucleoside linkages (209). The phosphorothioate internucleoside linkage (209) may be between the nucleotides at the 5′ or 3′ terminal end of the second oligonucleotide sequence (204). The phosphorothioate internucleoside linkage (209) may be between the first three nucleotides from the 5′ end of the second oligonucleotide sequence (204). The phosphorothioate internucleoside linkage (209) may be between the first three nucleotides from the 3′ end of the second oligonucleotide sequence (204). The second oligonucleotide sequence (204) may comprise one or more 2′-fluoro nucleotides (210). The second oligonucleotide sequence (204) may comprise one or more 2′-O-methyl nucleotides (211). The second oligonucleotide sequence (204) may comprise 15 or more modified nucleotides independently selected from 2′-fluoro nucleotides (210) and 2′-O-methyl nucleotides (211). The antisense strand (202) may further comprise a 5′-stabilized end cap (207). The siNA may further comprise one or more overhangs (208). The overhang (208) may be part of the sense strand (201). The overhang (208) may be part of the antisense strand. (202). The overhang (208) may be distinct from the first nucleotide sequence (203). The overhang (208) may be distinct from the second nucleotide sequence (204). The overhang (208) may be part of the first nucleotide sequence (203). The overhang (208) may be part of the second nucleotide sequence (204). The overhang (208) may be adjacent to the 3′ end of the first nucleotide sequence (203). The overhang (208) may be adjacent to the 5′ end of the first nucleotide sequence (203). The overhang (208) may be adjacent to the 3′ end of the second nucleotide sequence (204). The overhang (208) may be adjacent to the 5′ end of the second nucleotide sequence (204). The overhang (208) may comprise 1 or more nucleotides. The overhang (208) may comprise 1 or more deoxyribonucleotides. The overhang (208) may comprise a TT sequence. The overhang (208) may comprise 1 or more modified nucleotides. The overhang (208) may comprise 1 or more modified nucleotides disclosed herein (e.g., 2-fluoro nucleotide, 2′-O-methyl nucleotide, 2′-fluoro nucleotide mimic, 2′-O-methyl nucleotide mimic, or a nucleotide comprising a modified nucleobase). The overhang (208) may comprise 1 or more modified ribonucleotides. The sense strand (201) may be shorter than the antisense strand (202). The sense strand (201) may be the same length as the antisense strand (202). The sense strand (201) may be longer than the antisense strand (202).

    [0091] FIGS. 3A-3H depict exemplary ds-siNA modification patterns. As shown in FIGS. 3A-3G, an exemplary ds-siNA molecule may have the following formula:


    5′-a.sub.n.sup.1B.sub.n.sup.2A.sub.n.sup.3B.sub.n.sup.4A.sub.n.sup.5B.sub.n.sup.6A.sub.n.sup.7B.sub.n.sup.8A.sub.n.sup.9-3′


    3′-C.sub.q.sup.1A.sub.q.sup.2B.sub.q.sup.3A.sub.q.sup.4B.sub.q.sup.5A.sub.q.sup.6B.sub.q.sup.7A.sub.q.sup.8B.sub.q.sup.9A.sub.q.sup.10B.sub.q.sup.11A.sub.q.sup.12-5′

    wherein:

    [0092] the top strand is a sense strand comprising a first nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucleotide sequence comprises 15 to 30 nucleotides;

    [0093] the bottom strand is an antisense strand comprising a second nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucleotide sequence comprises 15 to 30 nucleotides; [0094] each A is independently a 2′-O-methyl nucleotide or a nucleotide comprising a 5′ stabilized end cap or phosphorylation blocker; [0095] B is a 2′-fluoro nucleotide; [0096] C represents overhanging nucleotides and is a 2′-O-methyl nucleotide, a deoxy nucleotide, or uracil; [0097] n.sup.1=1-6 nucleotides in length; [0098] each n.sup.2, n.sup.6, n.sup.8, q.sup.3, q.sup.5, q.sup.7, q.sup.9, q.sup.11, and q.sup.12 is independently 0-1 nucleotides in length; each n.sup.3 and n.sup.4 is independently 1-3 nucleotides in length; [0099] n.sup.5 is 1-10 nucleotides in length; [0100] n.sup.7 is 0-4 nucleotides in length; [0101] each n.sup.9, q.sup.1, and q.sup.2 is independently 0-2 nucleotides in length; [0102] q.sup.4 is 0-3 nucleotides in length; [0103] q.sup.6 is 0-5 nucleotides in length; [0104] q.sup.8 is 2-7 nucleotides in length; and [0105] q.sup.10 is 2-11 nucleotides in length.
    The ds-siNA may further comprise a conjugated moiety. The conjugated moiety may comprise any of the galactosamines disclosed herein. The ds-siNA may further comprise (i) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2 and positions 2 and 3 from the 5′ end of the sense strand; and (ii) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5′ end of the antisense strand. The ds-siNA may further comprise a 5′-stabilizing end cap. The 5′-stabilizing end cap may be a vinyl phosphonate. The 5′-stabilizing end cap may be attached to the 5′ end of the antisense strand. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker. An exemplary ds-siNA molecule may have the following formula:


    5′-A.sub.2-4B.sub.1A.sub.1-3B.sub.2-3A.sub.2-10B.sub.0-1A.sub.0-4B.sub.0-1A.sub.0-2-3′


    3′-C.sub.2A.sub.0-2B.sub.0-1A.sub.0-3B.sub.0-1A.sub.0-5B.sub.0-1A.sub.2-7B.sub.1A.sub.2-11B.sub.1A.sub.1-5′

    wherein:

    [0106] the top strand is a sense strand comprising a first nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucleotide sequence comprises 15 to 30 nucleotides;

    [0107] the bottom strand is an antisense strand comprising a second nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucleotide sequence comprises 15 to 30 nucleotides; [0108] each A is independently a 2′-O-methyl nucleotide or a nucleotide comprising a 5′ stabilized end cap or phosphorylation blocker; [0109] B is a 2′-fluoro nucleotide; [0110] C represents overhanging nucleotides and is a 2′-O-methyl nucleotide, a deoxy nucleotide, or uracil.
    The ds-siNA may further comprise a conjugated moiety. The conjugated moiety may comprise any of the galactosamines disclosed herein. The ds-siNA may further comprise (i) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2 and positions 2 and 3 from the 5′ end of the sense strand; and (ii) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5′ end of the antisense strand. The ds-siNA may further comprise a 5′-stabilizing end cap. The 5′-stabilizing end cap may be a vinyl phosphonate. The vinyl phosphonate may be a deuterated vinyl phosphonate. The deuterated vinyl phosphonate may be a mono-deuterated vinyl phosphonate. The deuterated vinyl phosphonate may be a mono-di-deuterated vinyl phosphonate. The 5′-stabilizing end cap may be attached to the 5′ end of the antisense strand. The 5′-stabilizing end cap may be attached to the 3′ end of the antisense strand. The 5′-stabilizing end cap may be attached to the 5′ end of the sense strand. The 5′-stabilizing end cap may be attached to the 3′ end of the sense strand. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker.

    [0111] The exemplary ds-siNA shown in FIGS. 3A-3H comprise (i) a sense strand comprising 19-21 nucleotides; and (ii) an antisense strand comprising 21-23 nucleotides. The ds-siNA may optionally further comprise (iii) a conjugated moiety, wherein the conjugated moiety (e.g., a GalNAc, noted as G3 in FIGS. 3A-3G) is attached to the 3′ end or the 5′ end of the sense strand or the antisense strand. The ds-siNA may comprise a 2 nucleotide overhang consisting of nucleotides at positions 20 and 21 from the 5′ end of the antisense strand. The ds-siNA may comprise a 2 nucleotide overhang consisting of nucleotides at positions 22 and 23 from the 5′ end of the antisense strand. The ds-siNA may further comprise 1, 2, 3, 4, 5, 6 or more phosphorothioate (ps) internucleoside linkages or mesyl phosphoramidate internucleoside linkage (Ms). At least one phosphorothioate internucleoside linkage or mesyl phosphoramidate internucleoside linkage (Ms) may be between the nucleotides at positions 1 and 2 or positions 2 and 3 from the 5′ end of the sense strand. At least one phosphorothioate internucleoside linkage or mesyl phosphoramidate internucleoside linkage (Ms) may be between the nucleotides at positions 1 and 2 or positions 2 and 3 from the 5′ end of the antisense strand. At least one phosphorothioate internucleoside linkage or mesyl phosphoramidate internucleoside linkage (Ms) may be between the nucleotides at positions 19 and 20, positions 20 and 21, positions 21 and 22, or positions 22 and 23 from the 5′ end of the antisense strand. As shown in FIGS. 3A-3H, 4-6 nucleotides in the sense strand may be 2′-fluoro nucleotides. As shown in FIGS. 3A-3H, 2-5 nucleotides in the antisense strand may be 2′-fluoro nucleotides. As shown in FIGS. 3A-3H, 13-15 nucleotides in the sense strand may be 2′-O-methyl nucleotides. As shown in FIGS. 3A-3H, 14-19 nucleotides in the antisense strand may be 2′-O-methyl nucleotides. As shown in FIGS. 3A-3H, the ds-siNA does not contain a base pair between 2′-fluoro nucleotides on the sense and antisense strands. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker.

    [0112] As shown in FIG. 3A, a ds-siNA may comprise (a) a sense strand consisting of 19 nucleotides, wherein 2′-fluoro nucleotides are at positions 3, 7-9, 12, and 17 from the 5′ end of the sense strand, and wherein 2′-O-methyl nucleotides are at positions 1, 2, 4-6, 10, 11, 13-16, 18, and 19 from the 5′ end of the sense strand; (b) an antisense strand consisting of 21 nucleotides, wherein nucleotides at positions 2 and 14 from the 5′ end of the antisense strand are 2′-fluoro nucleotides; and wherein nucleotides at positions 1, 3-13, and 15-21 are 2′-O-methyl nucleotides. The ds-siNA may further comprise a conjugated moiety attached to the 3′ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2 and positions 2 and 3 from the 5′ end of the sense strand; and (ii) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5′ end of the antisense strand. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a 2′-fluoro nucleotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-O-methyl nucleotide on the sense or antisense strand is a 2′-O-methyl nucleotide mimic. In some embodiments, one or more nucleotides in the sense strand and/or the antisense strand may be a 3′,4′ seco modified nucleotide in which the bond between the 3′ and 4′ positions of the furanose ring is broken (e.g., mun34).

    [0113] As shown in FIG. 3B, a ds-siNA may comprise (a) a sense strand consisting of 19 nucleotides, wherein 2′-fluoro nucleotides are at positions 3, 7, 8, and 17 from the 5′ end of the sense strand, and wherein 2′-O-methyl nucleotides are at positions 1, 2, 4-6, 9-16, 18, and 19 from the 5′ end of the sense strand; (b) an antisense strand consisting of 21 nucleotides, wherein nucleotides at positions 2 and 14 from the 5′ end of the antisense strand are 2′-fluoro nucleotides; and wherein nucleotides at positions 1, 3-13, and 15-21 are 2′-O-methyl nucleotides. The ds-siNA may further comprise a conjugated moiety attached to the 3′ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2 and positions 2 and 3 from the 5′ end of the sense strand; and (ii) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5′ end of the antisense strand. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a 2′-fluoro nucleotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-O-methyl nucleotide on the sense or antisense strand is a 2′-O-methyl nucleotide mimic. In some embodiments, one or more nucleotides in the sense strand and/or the antisense strand may be a 3′,4′ seco modified nucleotide in which the bond between the 3′ and 4′ positions of the furanose ring is broken (e.g., mun34).

    [0114] As shown in FIG. 3C, a ds-siNA may comprise (a) a sense strand consisting of 19 nucleotides, wherein 2′-fluoro nucleotides are at positions 3, 7-9, 12 and 17 from the 5′ end of the sense strand, and wherein 2′-O-methyl nucleotides are at positions 1, 2, 4-6, 10, 11, 13-16, 18, and 19 from the 5′ end of the sense strand; (b) an antisense strand consisting of 21 nucleotides, wherein the nucleotides in the antisense strand comprise an alternating 1:3 modification pattern, and wherein 1 nucleotide is a 2′-fluoro nucleotide and 3 nucleotides are 2′-O-methyl nucleotides. The ds-siNA may further comprise a conjugated moiety attached to the 3′ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2 and positions 2 and 3 from the 5′ end of the sense strand; and (ii) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5′ end of the antisense strand. The ds-siNA may comprise 2-5 alternating 1:3 modification patterns on the antisense strand. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a 2′-fluoro nucleotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the antisense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-O-methyl nucleotide on the sense or antisense strand is a 2′-O-methyl nucleotide mimic. In some embodiments, one or more nucleotides in the sense strand and/or the antisense strand may be a 3′,4′ seco modified nucleotide in which the bond between the 3′ and 4′ positions of the furanose ring is broken (e.g., mun34).

    [0115] As shown in FIG. 3D, a ds-siNA may comprise (a) a sense strand consisting of 19 nucleotides, wherein 2′-fluoro nucleotides are at positions 5 and 7-9 from the 5′ end of the sense strand, and wherein 2′-O-methyl nucleotides are at positions 1-4, 6, and 10-19 from the 5′ end of the sense strand; (b) an antisense strand consisting of 21 nucleotides, wherein the nucleotides in the antisense strand comprise an alternating 1:3 modification pattern, and wherein 1 nucleotide is a 2′-fluoro nucleotide and 3 nucleotides are 2′-O-methyl nucleotides. The ds-siNA may further comprise a conjugated moiety attached to the 3′ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2 and positions 2 and 3 from the 5′ end of the sense strand; and (ii) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5′ end of the antisense strand. The ds-siNA may comprise 2-5 alternating 1:3 modification patterns on the antisense strand. The alternating 1:3 modification pattern may start at the nucleotide at any of positions 2, 6, 10, 14, and/or 18 from the 5′ end of the antisense strand. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a 2′-fluoro nucleotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the antisense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-O-methyl nucleotide on the sense or antisense strand is a 2′-O-methyl nucleotide mimic. In some embodiments, one or more nucleotides in the sense strand and/or the antisense strand may be a 3′,4′ seco modified nucleotide in which the bond between the 3′ and 4′ positions of the furanose ring is broken (e.g., mun34).

    [0116] As shown in FIG. 3E, a ds-siNA may comprise (a) a sense strand consisting of 19 nucleotides, wherein 2′-fluoro nucleotides are at positions 5 and 7-9 from the 5′ end of the sense strand, and wherein 2′-O-methyl nucleotides are at positions 1-4, 6, and 10-19 from the 5′ end of the sense strand; (b) an antisense strand consisting of 21 nucleotides, wherein the nucleotides in the antisense strand comprise an alternating 1:2 modification pattern, and wherein 1 nucleotide is a 2′-fluoro nucleotide and 2 nucleotides are 2′-O-methyl nucleotides. The ds-siNA may further comprise a conjugated moiety attached to the 3′ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2 and positions 2 and 3 from the 5′ end of the sense strand; and (ii) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5′ end of the antisense strand. The ds-siNA may comprise 2-5 alternating 1:2 modification patterns on the antisense strand. The alternating 1:2 modification pattern may start at the nucleotide at any of positions 2, 5, 8, 14, and/or 17 from the 5′ end of the antisense strand. In some embodiments, the ds-siNA comprises (a) a sense strand consisting of 19 nucleotides, wherein 2′-fluoro nucleotides are at positions 5 and 7-9 from the 5′ end of the sense strand, and wherein 2′-O-methyl nucleotides are at positions 1-4, 6, and 10-19 from the 5′ end of the sense strand; (b) an antisense strand consisting of 21 nucleotides, wherein 2′-fluoro nucleotides are at positions 2, 5, 8, 14, and 17 from the 5′ end of the antisense strand, and wherein 2′-O-methyl nucleotides are at positions 1, 3, 4, 6, 7, 9-13, 15, 16, and 18-21 from the 5′ end of the sense strand. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a 2′-fluoro nucleotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the antisense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-O-methyl nucleotide on the sense or antisense strand is a 2′-O-methyl nucleotide mimic. In some embodiments, one or more nucleotides in the sense strand and/or the antisense strand may be a 3′,4′ seco modified nucleotide in which the bond between the 3′ and 4′ positions of the furanose ring is broken (e.g., mun34).

    [0117] As shown in FIG. 3F, a ds-siNA may comprise (a) a sense strand consisting of 19 nucleotides, wherein 2′-fluoro nucleotides are at positions 5 and 7-9 from the 5′ end of the sense strand, and wherein 2′-O-methyl nucleotides are at positions 1-4, 6, and 10-19 from the 5′ end of the sense strand; (b) an antisense strand consisting of 21 nucleotides, wherein 2′-fluoro nucleotides are at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand, and wherein 2′-O-methyl nucleotides are at positions 1, 3-5, 7-13, 15, and 17-21 from the 5′ end of the antisense strand. The ds-siNA may further comprise a conjugated moiety attached to the 3′ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2 and positions 2 and 3 from the 5′ end of the sense strand; and (ii) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5′ end of the antisense strand. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a f4P nucleotide. In some embodiments, at least 1, 2, 3, or 4 of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a f4P nucleotide. In some embodiments, at least one of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a f4P nucleotide. In some embodiments, at least two of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a f4P nucleotide. In some embodiments, less than or equal to 3 of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a f4P nucleotide. In some embodiments, less than or equal to 2 of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a f4P nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 2 from the 5′ end of the antisense strand is a f4P nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 6 from the 5′ end of the antisense strand is a f4P nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 14 from the 5′ end of the antisense strand is a f4P nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 16 from the 5′ end of the antisense strand is a f4P nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a f2P nucleotide. In some embodiments, at least 1, 2, 3, or 4 of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a f2P nucleotide. In some embodiments, at least one of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a f2P nucleotide. In some embodiments, at least two of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a f2P nucleotide. In some embodiments, less than or equal to 3 of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a f2P nucleotide. In some embodiments, less than or equal to 2 of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a f2P nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 2 from the 5′ end of the antisense strand is a f2P nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 6 from the 5′ end of the antisense strand is a f2P nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 14 from the 5′ end of the antisense strand is a f2P nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 16 from the 5′ end of the antisense strand is a f2P nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a fX nucleotide. In some embodiments, at least 1, 2, 3, or 4 of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a fX nucleotide. In some embodiments, at least one of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a fX nucleotide. In some embodiments, at least two of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a fX nucleotide. In some embodiments, less than or equal to 3 of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a fX nucleotide. In some embodiments, less than or equal to 2 of the 2′-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand is a fX nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 2 from the 5′ end of the antisense strand is a fX nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 6 from the 5′ end of the antisense strand is a fX nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 14 from the 5′ end of the antisense strand is a fX nucleotide. In some embodiments, the 2′-fluoro-nucleotide at position 16 from the 5′ end of the antisense strand is a fX nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a 2′-fluoro nucleotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the antisense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-O-methyl nucleotide on the sense or antisense strand is a 2′-O-methyl nucleotide mimic. In some embodiments, one or more nucleotides in the sense strand and/or the antisense strand may be a 3′,4′ seco modified nucleotide in which the bond between the 3′ and 4′ positions of the furanose ring is broken (e.g., mun34).

    [0118] As shown in FIG. 3G, a ds-siNA may comprise (a) a sense strand consisting of 21 nucleotides, wherein 2′-fluoro nucleotides are at positions 5, 9-11, 14, and 19 from the 5′ end of the sense strand, and wherein 2′-O-methyl nucleotides are at positions 1-4, 6-8, 12, 13, 15-18, 20, and 21 from the 5′ end of the sense strand; and (b) an antisense strand consisting of 23 nucleotides, wherein 2′-flouro nucleodies are at positions 2 and 14 from the 5′ end of the antisense strand, and wherein 2′-O-methyl nucleotides are at positions 1, 3-13, and 15-23 from the 5′ end of the antisense strand. The ds-siNA may further comprise a conjugated moiety attached to the 3′ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2 and positions 2 and 3 from the 5′ end of the sense strand; and (ii) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5′ end of the antisense strand. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a 2′-fluoro nucleotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the antisense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-O-methyl nucleotide on the sense or antisense strand is a 2′-O-methyl nucleotide mimic. In some embodiments, one or more nucleotides in the sense strand and/or the antisense strand may be a 3′,4′ seco modified nucleotide in which the bond between the 3′ and 4′ positions of the furanose ring is broken (e.g., mun34).

    [0119] As shown in FIG. 3H, a ds-siNA may comprise (a) a sense strand consisting of 21 nucleotides, wherein 2′-fluoro nucleotides are at positions 7 and 9-11 from the 5′ end of the sense strand, and wherein 2′-O-methyl nucleotides are at positions 1-6, 8, and 12-21 from the 5′ end of the sense strand; and (b) an antisense strand consisting of 23 nucleotides, wherein 2′-flouro nucleodies are at positions 2, 6, 14, and 16 from the 5′ end of the antisense strand, and wherein 2′-O-methyl nucleotides are at positions 1, 3-5, 7-13, 15, and 17-23 from the 5′ end of the antisense strand. Optionally, the nucleotides at positions 22 and 23 of from the 5′ end of the antisense strand may be unlocked nucleotides. Optionally, the ds-siNA may further comprise a conjugated moiety attached to the 3′ end of the sense strand (not pictured). The ds-siNA may optionally comprise a vinyl phosphonate attached to the 5′ end of the antisense strand (pictured), but in some embodiments, a 5′ end cap disclosed herein may be suitable as well. The ds-siNA may further comprise (i) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2, positions 2 and 3, and positions 20 and 21 from the 5′ end of the sense strand; and (ii) phosphorothioate internucleoside linkages between the nucleotides at positions 1 and 2; positions 2 and 3; positions 21 and 22, and positions 22 and 23 from the 5′ end of the antisense strand. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a 5′ stabilizing end cap. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide, a d2vd3U nucleotide, an omeco-d3U nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 5′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the sense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, the 2′-O-methyl nucleotide at position 1 from the 3′ end of the antisense strand is a d2vd3 nucleotide, a d2vd3U nucleotide, an omeco-d3 nucleotide, an omeco-d3U nucleotide, a 4h nucleotide, a 4hU nucleotide, a v-mun nucleotide, a c2o-4h nucleotide, an omeco-mun nucleotide, a d2vm nucleotide, or a d2vmA nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand or antisense strand is a 2′-fluoro nucleotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the sense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-fluoro nucleotides on the antisense strand is a fB, fN, f(4nh)Q, f4P, f2P, or fX nucleotide. In some embodiments, at least 1, 2, 3, 4 or more 2′-O-methyl nucleotide on the sense or antisense strand is a 2′-O-methyl nucleotide mimic. In some embodiments, one or more nucleotides in the sense strand and/or the antisense strand may be a 3′,4′ seco modified nucleotide in which the bond between the 3′ and 4′ positions of the furanose ring is broken (e.g., mun34).

    siNA Sense Strand

    [0120] Any of the siNA molecules described herein may comprise a sense strand. The sense strand may comprise a first nucleotide sequence. The first nucleotide sequence may be 15 to 30, 15 to 25, 15 to 23, 17 to 23, 19 to 23, or 19 to 21 nucleotides in length. In some embodiments, the first nucleotide sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the first nucleotide sequence is at least 19 nucleotides in length. In some embodiments, the first nucleotide sequence is at least 21 nucleotides in length.

    [0121] In some embodiments, the sense strand is the same length as the first nucleotide sequence. In some embodiments, the sense strand is longer than the first nucleotide sequence. In some embodiments, the sense strand may further comprise 1, 2, 3, 4, or 5 or more nucleotides than the first nucleotide sequence. In some embodiments, the sense strand may further comprise a deoxyribonucleic acid (DNA). In some embodiments, the DNA is thymine (T). In some embodiments, the sense strand may further comprise a TT sequence. In some embodiments, the sense strand may further comprise one or more modified nucleotides that are adjacent to the first nucleotide sequence. In some embodiments, the one or more modified nucleotides are independently selected from any of the modified nucleotides disclosed herein (e.g., 2′-fluoro nucleotide, 2′-O-methyl nucleotide, 2′-fluoro nucleotide mimic, 2′-O-methyl nucleotide mimic, or a nucleotide comprising a modified nucleobase).

    [0122] In some embodiments, the first nucleotide sequence comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide. In some embodiments, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucleotides in the first nucleotide sequence are modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide. In some embodiments, 100% of the nucleotides in the first nucleotide sequence are modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide. In some embodiments, the 2′-O-methyl nucleotide is a 2′-O-methyl nucleotide mimic. In some embodiments, the 2′-fluoro nucleotide is a 2′-fluoro nucleotide mimic.

    [0123] In some embodiments, between about 15 to 30, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 17 to 30, 17 to 25, 17 to 24, 17 to 23, 17 to 22, 17 to 21, 18 to 30, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 19 to 30, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 20 to 25, 20 to 24, 20 to 23, 21 to 25, 21 to 24, or 21 to 23 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, between about 2 to 20 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, between about 5 to 25 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, between about 10 to 25 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, between about 12 to 25 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 12 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 13 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 14 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 15 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 16 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 17 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 18 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 19 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 21 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 20 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 19 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 18 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 17 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 16 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 15 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 14 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 13 modified nucleotides of the first nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least one modified nucleotide of the first nucleotide sequence is a 2′-O-methyl pyrimidine. In some embodiments, at least 5, 6, 7, 8, 9, or 10 modified nucleotides of the first nucleotide sequence are 2′-O-methyl pyrimidines. In some embodiments, at least one modified nucleotide of the first nucleotide sequence is a 2′-O-methyl purine. In some embodiments, at least 5, 6, 7, 8, 9, or 10 modified nucleotides of the first nucleotide sequence are 2′-O-methyl purines. In some embodiments, the 2′-O-methyl nucleotide is a 2′-O-methyl nucleotide mimic.

    [0124] In some embodiments, between 2 to 15 modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, between 2 to 10 modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, between 2 to 6 modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 1 to 6, 1 to 5, 1 to 4, or 1 to 3 modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 1, 2, 3, 4, 5, or 6 modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 1 modified nucleotide of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, at least 2 modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 3 modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 4 modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 5 modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 6 modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 10, 9, 8, 7, 6, 5, 4, 3 or fewer modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 10 or fewer modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 7 or fewer modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 6 or fewer modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 5 or fewer modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 4 or fewer modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 3 or fewer modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 2 or fewer modified nucleotides of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least one modified nucleotide of the first nucleotide sequence is a 2′-fluoro pyrimidine. In some embodiments, 1, 2, 3, 4, 5, or 6 modified nucleotides of the first nucleotide sequence are 2′-fluoro pyrimidines. In some embodiments, at least one modified nucleotide of the first nucleotide sequence is a 2′-fluoro purine. In some embodiments, 1, 2, 3, 4, 5, or 6 modified nucleotides of the first nucleotide sequence are 2′-fluoro purines. In some embodiments, the 2′-fluoro nucleotide is a 2′-fluoro nucleotide mimic.

    [0125] In some embodiments, the nucleotide at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, at least two nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least three nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least four nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least five nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, the nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, the nucleotide at position 3 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 7 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 8 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 9 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 12 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 17 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the 2′-fluoro nucleotide is a 2′-fluoro nucleotide mimic.

    [0126] In some embodiments, at least 1, 2, 3, 4, 5, 6, or 7 nucleotides at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, at least two nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least three nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, the nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5′ end of the first nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, the nucleotide at position 3 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 5 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 7 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 8 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 9 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 10 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 11 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 12 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 14 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 17 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 19 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 3, 7, 8, 9, 12, and/or 17 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 3, 7, 8, and/or 17 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 3, 7, 8, 9, 12, and/or 17 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 5, 7, 8, and/or 9 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 5, 9, 10, 11, 12, and/or 19 from the 5′ end of the first nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the 2′-fluoro nucleotide is a 2′-fluoro nucleotide mimic.

    [0127] In some embodiments, the 2′-fluoro or 2′-O-methyl nucleotide mimic is a nucleotide mimic of Formula (V):

    ##STR00059##

    wherein R.sub.x is independently a nucleobase, aryl, heteroaryl, or H, Q.sup.1 and Q.sup.2 are independently S or O, R.sup.5 is independently —OCD.sub.3, —F, or —OCH.sub.3, and R.sup.6 and R.sup.7 are independently H, D, or CD.sub.3. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0128] In some embodiments, the 2′-fluoro or 2′-O-methyl nucleotide mimic is a nucleotide mimic of Formula (16)-Formula (20):

    ##STR00060##

    wherein R.sub.x is independently a nucleobase, aryl, heteroaryl, or H and R.sup.2 is F or —OCH.sub.3. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0129] In some embodiments, the sense strand, the antisense strand, or both may each independently comprise at least 1, at least 2, at least 3, at least 4, or at least 5 or more modified nucleotide(s) having the following chemical structure:

    ##STR00061##

    wherein R.sub.y is a nucleobase and wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0130] In some embodiments, the sense strand, the antisense strand, or both may each independently comprise at least 1, at least 2, at least 3, at least 4, or at least 5 or more modified nucleotide(s) having the following chemical structure:

    ##STR00062##

    wherein R.sub.y is a nucleobase. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0131] For the purposes of the present disclosure, the modified nucleotide may be in any position of the sense strand. In some embodiments, the modified nucleotide may be at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 of the sense strand relative to the 5′ end. For example, when the modified nucleotide is

    ##STR00063##

    it may be located at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 of the sense strand relative to the 5′ end. In some embodiments, when the modified nucleotide is

    ##STR00064##

    it may be located at position 3, 16, 17, or 18, relative to the 5′ end of the sense strand.

    [0132] In some embodiments, the first nucleotide sequence comprises, consists of, or consists essentially of ribonucleic acids (RNAs). In some embodiments, the first nucleotide sequence comprises, consists of, or consists essentially of modified RNAs. In some embodiments, the modified RNAs are selected from a 2′-O-methyl RNA and 2′-fluoro RNA. In some embodiments, 15, 16, 17, 18, 19, 20, 21, 22, or 23 modified nucleotides of the first nucleotide sequence are independently selected from 2′-O-methyl RNA and 2′-fluoro RNA.

    [0133] In some embodiments, the sense strand may further comprise one or more internucleoside linkages independently selected from a phosphodiester (PO) internucleoside linkage, phosphorothioate (PS) internucleoside linkage, mesyl phosphoramidate internucleoside linkage (Ms), phosphorodithioate internucleoside linkage, and PS-mimic internucleoside linkage. In some embodiments, the PS-mimic internucleoside linkage is a sulfo internucleoside linkage.

    [0134] In some embodiments, the sense strand may further comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more phosphorothioate internucleoside linkages. In some embodiments, the sense strand comprises 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 or fewer phosphorothioate internucleoside linkages. In some embodiments, the sense strand comprises 2 to 10, 2 to 8, 2 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 phosphorothioate internucleoside linkages. In some embodiments, the sense strand comprises 1 to 2 phosphorothioate internucleoside linkages. In some embodiments, the sense strand comprises 2 to 4 phosphorothioate internucleoside linkages. In some embodiments, at least one phosphorothioate internucleoside linkage is between the nucleotides at positions 1 and 2 from the 5′ end of the first nucleotide sequence. In some embodiments, at least one phosphorothioate internucleoside linkage is between the nucleotides at positions 2 and 3 from the 5′ end of the first nucleotide sequence. In some embodiments, the sense strand comprises two phosphorothioate internucleoside linkages between the nucleotides at positions 1 to 3 from the 5′ end of the first nucleotide sequence.

    [0135] In some embodiments, the sense strand may further comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more mesyl phosphoramidate internucleoside linkages. In some embodiments, the sense strand comprises 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 or fewer mesyl phosphoramidate internucleoside linkages. In some embodiments, the sense strand comprises 2 to 10, 2 to 8, 2 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 mesyl phosphoramidate internucleoside linkages. In some embodiments, the sense strand comprises 1 to 2 mesyl phosphoramidate internucleoside linkages. In some embodiments, the sense strand comprises 2 to 4 mesyl phosphoramidate internucleoside linkages.

    [0136] In some embodiments, the sense strand may comprise any of the modified nucleotides disclosed in the sub-section titled “Modified Nucleotides” below. In some embodiments, the sense strand may comprise a 5′-stabilized end cap, and the 5′-stabilized end cap may be selected from those disclosed in the sub-section titled “5′-Stabilized End Cap” below.

    siNA Antisense Strand

    [0137] Any of the siNA molecules described herein may comprise an antisense strand. The antisense strand may comprise a second nucleotide sequence. The second nucleotide sequence may be 15 to 30, 15 to 25, 15 to 23, 17 to 23, 19 to 23, or 19 to 21 nucleotides in length. In some embodiments, the second nucleotide sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the second nucleotide sequence is at least 19 nucleotides in length. In some embodiments, the second nucleotide sequence is at least 21 nucleotides in length.

    [0138] In some embodiments, the antisense strand is the same length as the second nucleotide sequence. In some embodiments, the antisense strand is longer than the second nucleotide sequence. In some embodiments, the antisense strand may further comprise 1, 2, 3, 4, or 5 or more nucleotides than the second nucleotide sequence. In some embodiments, the antisense strand is the same length as the sense strand. In some embodiments, the antisense strand is longer than the sense strand. In some embodiments, the antisense strand may further comprise 1, 2, 3, 4, or 5 or more nucleotides than the sense strand. In some embodiments, the antisense strand may further comprise a deoxyribonucleic acid (DNA). In some embodiments, the DNA is thymine (T). In some embodiments, the antisense strand may further comprise a TT sequence. In some embodiments, the antisense strand may further comprise one or more modified nucleotides that are adjacent to the second nucleotide sequence. In some embodiments, the one or more modified nucleotides are independently selected from any of the modified nucleotides disclosed herein (e.g., 2′-fluoro nucleotide, 2′-O-methyl nucleotide, 2′-fluoro nucleotide mimic, 2′-O-methyl nucleotide mimic, or a nucleotide comprising a modified nucleobase).

    [0139] In some embodiments, the second nucleotide sequence comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, or more modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide. In some embodiments, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucleotides in the second nucleotide sequence are modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide. In some embodiments, 100% of the nucleotides in the second nucleotide sequence are modified nucleotides independently selected from a 2′-O-methyl nucleotide and a 2′-fluoro nucleotide.

    [0140] In some embodiments, between about 15 to 30, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 17 to 30, 17 to 25, 17 to 24, 17 to 23, 17 to 22, 17 to 21, 18 to 30, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 19 to 30, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 20 to 25, 20 to 24, 20 to 23, 21 to 25, 21 to 24, or 21 to 23 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, between about 2 to 20 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, between about 5 to 25 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, between about 10 to 25 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, between about 12 to 25 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 12 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 13 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 14 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 15 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 16 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 17 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 18 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least about 19 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 21 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 20 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 19 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 18 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 17 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 16 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 15 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 14 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, less than or equal to 13 modified nucleotides of the second nucleotide sequence are 2′-O-methyl nucleotides. In some embodiments, at least one modified nucleotide of the second nucleotide sequence is a 2′-O-methyl pyrimidine. In some embodiments, at least 5, 6, 7, 8, 9, or 10 modified nucleotides of the second nucleotide sequence are 2′-O-methyl pyrimidines. In some embodiments, at least one modified nucleotide of the second nucleotide sequence is a 2′-O-methyl purine. In some embodiments, at least 5, 6, 7, 8, 9, or 10 modified nucleotides of the second nucleotide sequence are 2′-O-methyl purines. In some embodiments, the 2′-O-methyl nucleotide is a 2′-O-methyl nucleotide mimic.

    [0141] In some embodiments, between 2 to 15 modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, between 2 to 10 modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, between 2 to 6 modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 1 to 6, 1 to 5, 1 to 4, or 1 to 3 modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 1, 2, 3, 4, 5, or 6 modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 1 modified nucleotide of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, at least 2 modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 3 modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 4 modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least 5 modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 10, 9, 8, 7, 6, 5, 4, 3 or fewer modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 10 or fewer modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 7 or fewer modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 6 or fewer modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 5 or fewer modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 4 or fewer modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 3 or fewer modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, 2 or fewer modified nucleotides of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least one modified nucleotide of the second nucleotide sequence is a 2′-fluoro pyrimidine. In some embodiments, 1, 2, 3, 4, 5, or 6 modified nucleotides of the second nucleotide sequence are 2′-fluoro pyrimidines. In some embodiments, at least one modified nucleotide of the second nucleotide sequence is a 2′-fluoro purine. In some embodiments, 1, 2, 3, 4, 5, or 6 modified nucleotides of the second nucleotide sequence are 2′-fluoro purines. In some embodiments, the 2′-fluoro nucleotide is a 2′-fluoro nucleotide mimic.

    [0142] In some embodiments, the 2′-fluoro nucleotide or 2′-O-methyl nucleotide is a 2′-fluoro or 2′-O-methyl nucleotide mimic. In some embodiments, the 2′-fluoro or 2′-O-methyl nucleotide mimic is a nucleotide mimic of Formula (V):

    ##STR00065##

    wherein R.sub.x is independently a nucleobase, aryl, heteroaryl, or H, Q.sup.1 and Q.sup.2 are independently S or O, R.sup.5 is independently —OCD.sub.3, —F, or —OCH.sub.3, and R.sup.6 and R.sup.7 are independently H, D, or CD.sub.3. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0143] In some embodiments, the 2′-fluoro or 2′-O-methyl nucleotide mimic is a nucleotide mimic of Formula (16)-Formula (20):

    ##STR00066##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H and R.sup.2 is independently F or —OCH.sub.3. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0144] In some embodiments, the antisense strand, sense strand, or both may each independently comprise at least 1, at least 2, at least 3, at least 4, or at least 5 or more modified nucleotide(s) having the following chemical structure:

    ##STR00067##

    wherein R.sub.y is a nucleobase and wherein Rx is a nucleobase, aryl, heteroaryl, or H. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0145] In some embodiments, the antisense strand, sense strand, or both may each independently comprise at least 1, at least 2, at least 3, at least 4, or at least 5 or more modified nucleotide(s) having the following chemical structure:

    ##STR00068##

    wherein R.sub.y is a nucleobase. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0146] For the purposes of the present disclosure, the modified nucleotide may be in any position of the antisense strand. In some embodiments, the modified nucleotide may be at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 of the antisense strand relative to the 5′ end.

    [0147] In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, at least two nucleotides at positions 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5′ end of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least three nucleotides at positions 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5′ end of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least four nucleotides at positions 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5′ end of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, at least five nucleotides at positions 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5′ end of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, the nucleotides at positions 2 and/or 14 from the 5′ end of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, the nucleotides at positions 2, 6, and/or 16 from the 5′ end of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, the nucleotides at positions 2, 6, 14, and/or 16 from the 5′ end of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, the nucleotides at positions 2, 6, 10, 14, and/or 18 from the 5′ end of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, the nucleotides at positions 2, 5, 8, 14, and/or 17 from the 5′ end of the second nucleotide sequence are 2′-fluoro nucleotides. In some embodiments, the nucleotide at position 2 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 5 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 6 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 8 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 10 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 14 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 16 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 17 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the nucleotide at position 18 from the 5′ end of the second nucleotide sequence is a 2′-fluoro nucleotide. In some embodiments, the 2′-fluoro nucleotide is a 2′-fluoro nucleotide mimic.

    [0148] In some embodiments, the nucleotides in the second nucleotide sequence are arranged in an alternating 1:3 modification pattern, wherein 1 nucleotide is a 2′-fluoro nucleotide and 3 nucleotides are 2′-O-methyl nucleotides, and wherein the alternating 1:3 modification pattern occurs at least 2 times. In some embodiments, the alternating 1:3 modification pattern occurs 2-5 times. In some embodiments, at least two of the alternating 1:3 modification pattern occur consecutively. In some embodiments, at least two of the alternating 1:3 modification pattern occurs nonconsecutively. In some embodiments, at least 1, 2, 3, 4, or 5 alternating 1:3 modification pattern begins at nucleotide position 2, 6, 10, 14, and/or 18 from the 5′ end of the antisense strand. In some embodiments, at least one alternating 1:3 modification pattern begins at nucleotide position 2 from the 5′ end of the antisense strand. In some embodiments, wherein at least one alternating 1:3 modification pattern begins at nucleotide position 6 from the 5′ end of the antisense strand. In some embodiments, at least one alternating 1:3 modification pattern begins at nucleotide position 10 from the 5′ end of the antisense strand. In some embodiments, at least one alternating 1:3 modification pattern begins at nucleotide position 14 from the 5′ end of the antisense strand. In some embodiments, at least one alternating 1:3 modification pattern begins at nucleotide position 18 from the 5′ end of the antisense strand. In some embodiments, the 2′-fluoro nucleotide is a 2′-fluoro nucleotide mimic.

    [0149] In some embodiments, the nucleotides in the second nucleotide sequence are arranged in an alternating 1:2 modification pattern, wherein 1 nucleotide is a 2′-fluoro nucleotide and 2 nucleotides are 2′-O-methyl nucleotides, and wherein the alternating 1:2 modification pattern occurs at least 2 times. In some embodiments, the alternating 1:2 modification pattern occurs 2-5 times. In some embodiments, at least two of the alternating 1:2 modification pattern occurs consecutively. In some embodiments, at least two of the alternating 1:2 modification pattern occurs nonconsecutively. In some embodiments, at least 1, 2, 3, 4, or 5 alternating 1:2 modification pattern begins at nucleotide position 2, 5, 8, 14, and/or 17 from the 5′ end of the antisense strand. In some embodiments, at least one alternating 1:2 modification pattern begins at nucleotide position 2 from the 5′ end of the antisense strand. In some embodiments, at least one alternating 1:2 modification pattern begins at nucleotide position 5 from the 5′ end of the antisense strand. In some embodiments, at least one alternating 1:2 modification pattern begins at nucleotide position 8 from the 5′ end of the antisense strand. In some embodiments, at least one alternating 1:2 modification pattern begins at nucleotide position 14 from the 5′ end of the antisense strand. In some embodiments, at least one alternating 1:2 modification pattern begins at nucleotide position 17 from the 5′ end of the antisense strand. In some embodiments, the 2′-fluoro nucleotide is a 2′-fluoro nucleotide mimic.

    [0150] In some embodiments, the second nucleotide sequence comprises, consists of, or consists essentially of ribonucleic acids (RNAs). In some embodiments, the second nucleotide sequence comprises, consists of, or consists essentially of modified RNAs. In some embodiments, the modified RNAs are selected from a 2′-O-methyl RNA and 2′-fluoro RNA. In some embodiments, 15, 16, 17, 18, 19, 20, 21, 22, or 23 modified nucleotides of the second nucleotide sequence are independently selected from 2′-O-methyl RNA and 2′-fluoro RNA. In some embodiments, the 2′-fluoro nucleotide is a 2′-fluoro nucleotide mimic.

    [0151] In some embodiments, the sense strand may further comprise one or more internucleoside linkages independently selected from a phosphodiester (PO) internucleoside linkage, phosphorothioate (PS) internucleoside linkage, phosphorodithioate internucleoside linkage, and PS-mimic internucleoside linkage. In some embodiments, the PS-mimic internucleoside linkage is a sulfo internucleoside linkage.

    [0152] In some embodiments, the antisense strand may further comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more phosphorothioate internucleoside linkages. In some embodiments, the antisense strand comprises 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 or fewer phosphorothioate internucleoside linkages. In some embodiments, the antisense strand comprises 2 to 10, 2 to 8, 2 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand comprises 2 to 10, 2 to 8, 2 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand comprises 2 to 8 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand comprises 3 to 8 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand comprises 4 to 8 phosphorothioate internucleoside linkages. In some embodiments, at least one phosphorothioate internucleoside linkage is between the nucleotides at positions 1 and 2 from the 5′ end of the second nucleotide sequence. In some embodiments, at least one phosphorothioate internucleoside linkage is between the nucleotides at positions 2 and 3 from the 5′ end of the second nucleotide sequence. In some embodiments, at least one phosphorothioate internucleoside linkage is between the nucleotides at positions 1 and 2 from the 3′ end of the second nucleotide sequence. In some embodiments, at least one phosphorothioate internucleoside linkage is between the nucleotides at positions 2 and 3 from the 3′ end of the second nucleotide sequence. In some embodiments, the antisense strand comprises two phosphorothioate internucleoside linkages between the nucleotides at positions 1 to 3 from the 5′ end of the first nucleotide sequence. In some embodiments, the antisense strand comprises two phosphorothioate internucleoside linkages between the nucleotides at positions 1 to 3 from the 3′ end of the first nucleotide sequence. In some embodiments, the antisense strand comprises (a) two phosphorothioate internucleoside linkages between the nucleotides at positions 1 to 3 from the 5′ end of the first nucleotide sequence; and (b) two phosphorothioate internucleoside linkages between the nucleotides at positions 1 to 3 from the 3′ end of the first nucleotide sequence.

    [0153] In some embodiments, the antisense strand may further comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more mesyl phosphoramidate internucleoside linkages. In some embodiments, the antisense strand comprises 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 or fewer mesyl phosphoramidate internucleoside linkages. In some embodiments, the antisense strand comprises 2 to 10, 2 to 8, 2 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 mesyl phosphoramidate internucleoside linkages. In some embodiments, the antisense strand comprises 2 to 10, 2 to 8, 2 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 mesyl phosphoramidate internucleoside linkages. In some embodiments, the antisense strand comprises 2 to 8 mesyl phosphoramidate internucleoside linkages. In some embodiments, the antisense strand comprises 3 to 8 mesyl phosphoramidate internucleoside linkages. In some embodiments, the antisense strand comprises 4 to 8 mesyl phosphoramidate internucleoside linkages.

    [0154] In some embodiments, at least one end of the ds-siNA is a blunt end. In some embodiments, at least one end of the ds-siNA comprises an overhang, wherein the overhang comprises at least one nucleotide. In some embodiments, both ends of the ds-siNA comprise an overhang, wherein the overhang comprises at least one nucleotide. In some embodiments, the overhang comprises 1 to 5 nucleotides, 1 to 4 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides. In some embodiments, the overhang consists of 1 to 2 nucleotides.

    [0155] In some embodiments, the sense strand may comprise any of the modified nucleotides disclosed in the sub-section titled “Modified Nucleotides” below. In some embodiments, the sense strand may comprise a 5′-stabilized end cap, and the 5′-stabilized end cap may be selected from those disclosed in the sub-section titled “5′-Stabilized End Cap” below.

    Modified Nucleotides

    [0156] The siNA molecules disclosed herein comprise one or more modified nucleotides. In some embodiments, the sense strands disclosed herein comprise one or more modified nucleotides. In some embodiments, any of the first nucleotide sequences disclosed herein comprise one or more modified nucleotides. In some embodiments, the antisense strands disclosed herein comprise one or more modified nucleotides. In some embodiments, any of the second nucleotide sequences disclosed herein comprise one or more modified nucleotides. In some embodiments, the one or more modified nucleotides is adjacent to the first nucleotide sequence. In some embodiments, at least one modified nucleotide is adjacent to the 5′ end of the first nucleotide sequence. In some embodiments, at least one modified nucleotide is adjacent to the 3′ end of the first nucleotide sequence. In some embodiments, at least one modified nucleotide is adjacent to the 5′ end of the first nucleotide sequence and at least one modified nucleotide is adjacent to the 3′ end of the first nucleotide sequence. In some embodiments, the one or more modified nucleotides is adjacent to the second nucleotide sequence. In some embodiments, at least one modified nucleotide is adjacent to the 5′ end of the second nucleotide sequence. In some embodiments, at least one modified nucleotide is adjacent to the 3′ end of the second nucleotide sequence. In some embodiments, at least one modified nucleotide is adjacent to the 5′ end of the second nucleotide sequence and at least one modified nucleotide is adjacent to the 3′ end of the second nucleotide sequence. In some embodiments, a 2′-O-methyl nucleotide in any of sense strands or first nucleotide sequences disclosed herein is replaced with a modified nucleotide. In some embodiments, a 2′-O-methyl nucleotide in any of antisense strands or second nucleotide sequences disclosed herein is replaced with a modified nucleotide.

    [0157] In some embodiments, any of the siNA molecules, siNAs, sense strands, first nucleotide sequences, antisense strands, and second nucleotide sequences disclosed herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more modified nucleotides. In some embodiments, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the nucleotides in the siNA molecule, siNA, sense strand, first nucleotide sequence, antisense strand, or second nucleotide sequence are modified nucleotides.

    [0158] In some embodiments, a modified nucleotide is selected from the group consisting of 2′-fluoro nucleotide, 2′-O-methyl nucleotide, 2′-fluoro nucleotide mimic, 2′-O-methyl nucleotide mimic, a locked nucleic acid, an unlocked nucleic acid, and a nucleotide comprising a modified nucleobase. In some embodiments, the unlocked nucleic acid is a 2′,3′-unlocked nucleic acid. In some embodiments, the unlocked nucleic acid is a 3′,4′-unlocked nucleic acid (e.g., mun34) in which the furanose ring lacks a bond between the 3′ and 4; carbons.

    [0159] In some aspects, the siNA of the present disclosure will comprise at least one modified nucleotide selected from:

    ##STR00069##

    (wherein Rx is a nucleobase, aryl, heteroaryl, or H),

    ##STR00070##

    wherein R.sub.y is a nucleobase,

    ##STR00071##

    wherein R.sub.y is a nucleobase, or combinations thereof. In some embodiments, the siNA may comprise at least 2, at least 3, at least 4, or at least 5 or more of these modified nucleotides. In some embodiments, the sense strand may comprise at least 1, at least 2, at least 3, at least 4, or at least 5 or more of

    ##STR00072##

    (wherein Rx is a nucleobase, aryl, heteroaryl, H),

    ##STR00073##

    wherein R.sub.y is a nucleobase,

    ##STR00074##

    R.sub.y is a nucleobase, or combinations thereof. In some embodiments, the antisense strand may comprise at least 1, at least 2, at least 3, at least 4, or at least 5 or more of

    ##STR00075##

    (wherein Rx is a nucleobase, aryl, heteroaryl, or H),

    ##STR00076##

    wherein R.sub.y is a nucleobase

    ##STR00077##

    wherein R.sub.y is a nucleobase, or combinations thereof. In some embodiments, both the sense strand and the antisense strand may each independently comprise at least 1, at least 2, at least 3, at least 4, or at least 5 or more of

    ##STR00078##

    (wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H)

    ##STR00079##

    wherein R.sub.y is a nucleobase,

    ##STR00080##

    wherein R.sub.y is a nucleobase, or combinations thereof. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof. For example, in some embodiments of

    ##STR00081##

    the modified nucleotide may have a structure of

    ##STR00082##

    ##STR00083##

    [0160] In some embodiments, any of the siRNAs disclosed herein may additionally comprise other modified nucleotides, such as 2′-fluoro or 2′-O-methyl nucleotide mimics. For example, the disclosed siNA may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 2′-fluoro or 2′-O-methyl nucleotide mimics. In some embodiments, any of the sense strands disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 2′-fluoro or 2′-O-methyl nucleotide mimics. In some embodiments, any of the first nucleotide sequences disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 2′-fluoro or 2′-O-methyl nucleotide mimics. In some embodiments, any of the antisense strand disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 2′-fluoro or 2′-O-methyl nucleotide mimics. In some embodiments, any of the second nucleotide sequences disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 2′-fluoro or 2′-O-methyl nucleotide mimics. In some embodiments, the 2′-fluoro or 2′-O-methyl nucleotide mimic is a nucleotide mimic of Formula (16)-Formula (20):

    ##STR00084##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H and R.sup.2 is independently F or —OCH.sub.3. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0161] In some embodiments, the siNA molecules disclosed herein comprise at least one 2′-fluoro nucleotide, at least one 2′-O-methyl nucleotide, and at least one 2′-fluoro or 2′-O-methyl nucleotide mimic. In some embodiments, the at least one 2′-fluoro or 2′-O-methyl nucleotide mimic is adjacent to the first nucleotide sequence. In some embodiments, the at least one 2′-fluoro or 2′-O-methyl nucleotide mimic is adjacent to the 5′ end of first nucleotide sequence. In some embodiments, the at least one 2′-fluoro or 2′-O-methyl nucleotide mimic is adjacent to the 3′ end of first nucleotide sequence. In some embodiments, the at least one 2′-fluoro or 2′-O-methyl nucleotide mimic is adjacent to the second nucleotide sequence. In some embodiments, the at least one 2′-fluoro or 2′-O-methyl nucleotide mimic is adjacent to the 5′ end of second nucleotide sequence. In some embodiments, the at least one 2′-fluoro or 2′-O-methyl nucleotide mimic is adjacent to the 3′ end of second nucleotide sequence. In some embodiments, the first nucleotide sequence does not comprise a 2′-fluoro nucleotide mimic. In some embodiments, the first nucleotide sequence does not comprise a 2′-O-methyl nucleotide mimic. In some embodiments, the second nucleotide sequence does not comprise a 2′-fluoro nucleotide mimic. In some embodiments, the second nucleotide sequence does not comprise a 2′-O-methyl nucleotide mimic.

    [0162] In some embodiments, any of the siRNAs, sense strands, first nucleotide sequences, antisense strands, or second nucleotide sequences disclosed herein comprise at least one modified nucleotide that is

    ##STR00085##

    wherein Rx is a nucleobase, aryl, heteroaryl, or H; or

    ##STR00086##

    wherein R.sub.y is a nucleobase.

    Phosphorylation Blocker

    [0163] Further disclosed herein are siNA molecules comprising a phosphorylation blocker. In some embodiments, a 2′-O-methyl nucleotide in any of sense strands or first nucleotide sequences disclosed herein is replaced with a nucleotide containing a phosphorylation blocker. In some embodiments, a 2′-O-methyl nucleotide in any of antisense strands or second nucleotide sequences disclosed herein is replaced with a nucleotide containing a phosphorylation blocker. In some embodiments, a 2′-O-methyl nucleotide in any of sense strands or first nucleotide sequences disclosed herein is further modified to contain a phosphorylation blocker. In some embodiments, a 2′-O-methyl nucleotide in any of antisense strands or second nucleotide sequences disclosed herein is further modified to contain a phosphorylation blocker.

    [0164] In some embodiments, any of the siNA molecules disclosed herein comprise a phosphorylation blocker of Formula (IV):

    ##STR00087##

    wherein R.sub.y is a nucleobase, R.sup.4 is —O—R.sup.30 or —NR.sup.31R.sup.32, R.sup.30 is C.sub.1-C.sub.8 substituted or unsubstituted alkyl; and R.sup.31 and R.sup.32 together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0165] In some embodiments, any of the siNA molecules disclosed herein comprise a phosphorylation blocker of Formula (IV):

    ##STR00088##

    wherein R.sub.y is a nucleobase, and R.sup.4 is —OCH.sub.3 or —N(CH.sub.2CH.sub.2).sub.2O. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0166] In some embodiments, a siNA molecule comprises (a) a phosphorylation blocker of Formula (IV):

    ##STR00089##

    wherein R.sub.y is a nucleobase, R.sup.4 is —O—R.sup.30 or —NR.sup.31R.sup.32, R.sup.30 is C.sub.1-C.sub.8 substituted or unsubstituted alkyl; and R.sup.31 and R.sup.32 together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; and (b) a short interfering nucleic acid (siNA), wherein the phosphorylation blocker is conjugated to the siNA. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof.

    [0167] In some embodiments, a siNA molecule comprises (a) a phosphorylation blocker of Formula (IV):

    ##STR00090##

    wherein R.sub.y is a nucleobase, and R.sup.4 is —OCH.sub.3 or —N(CH.sub.2CH.sub.2).sub.2O; and (b) a short interfering nucleic acid (siNA), wherein the phosphorylation blocker is conjugated to the siNA.

    [0168] In some embodiments, the phosphorylation blocker is attached to the 3′ end of the sense strand or first nucleotide sequence. In some embodiments, the phosphorylation blocker is attached to the 3′ end of the sense strand or first nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the phosphorylation blocker is attached to the 5′ end of the sense strand or first nucleotide sequence. In some embodiments, the phosphorylation blocker is attached to the 5′ end of the sense strand or first nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the phosphorylation blocker is attached to the 3′ end of the antisense strand or second nucleotide sequence. In some embodiments, the phosphorylation blocker is attached to the 3′ end of the antisense strand or second nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the phosphorylation blocker is attached to the 5′ end of the antisense strand or second nucleotide sequence. In some embodiments, the phosphorylation blocker is attached to the 5′ end of the antisense strand or second nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the one or more linkers are independently selected from the group consisting of a phosphodiester linker, phosphorothioate linker, mesyl phosphoramidate linker and phosphorodithioate linker.

    Conjugated Moiety

    [0169] Further disclosed herein are siNA molecules comprising a conjugated moiety. In some embodiments, the conjugated moiety is selected from galactosamine, peptides, proteins, sterols, lipids, phospholipids, biotin, phenoxazines, active drug substance, cholesterols, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. In some embodiments, the conjugated moiety is attached to the 3′ end of the sense strand or first nucleotide sequence. In some embodiments, the conjugated moiety is attached to the 3′ end of the sense strand or first nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the conjugated moiety is attached to the 5′ end of the sense strand or first nucleotide sequence. In some embodiments, the conjugated moiety is attached to the 5′ end of the sense strand or first nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the conjugated moiety is attached to the 3′ end of the antisense strand or second nucleotide sequence. In some embodiments, the conjugated moiety is attached to the 3′ end of the antisense strand or second nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the conjugated moiety is attached to the 5′ end of the antisense strand or second nucleotide sequence. In some embodiments, the conjugated moiety is attached to the 5′ end of the antisense strand or second nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the one or more linkers are independently selected from the group consisting of a phosphodiester linker, phosphorothioate linker, phosphorodithioate linker, and mesyl phosphoramidate linker.

    [0170] In some embodiments, the conjugated moiety is galactosamine. In some embodiments, any of the siNAs disclosed herein are attached to a conjugated moiety that is galactosamine. In some embodiments, the galactosamine is N-acetylgalactosamine (GalNAc). In some embodiments, any of the siNA molecules disclosed herein comprise GalNAc. In some embodiments, the GalNAc is of Formula (VI):

    ##STR00091##

    wherein m is 1, 2, 3, 4, or 5; each n is independently 1 or 2; p is 0 or 1; each R is independently H or a first protecting group; each Y is independently selected from —O—P(═O)(SH)—, —O—P(═O)(O)—, —O—P(═O)(OH)—, —O—P(S)S—, and —O—; Z is H or a second protecting group; either L is a linker or L and Y in combination are a linker; and A is H, OH, a third protecting group, an activated group, or an oligonucleotide. In some embodiments, the first protecting group is acetyl. In some embodiments, the second protecting group is trimethoxytrityl (TMT). In some embodiments, the activated group is a phosphoramidite group. In some embodiments, the phosphoramidite group is a cyanoethoxy N,N-diisopropylphosphoramidite group. In some embodiments, the linker is a C6-NH.sub.2 group. In some embodiments, A is a short interfering nucleic acid (siNA) or siNA molecule. In some embodiments, m is 3. In some embodiments, R is H, Z is H, and n is 1. In some embodiments, R is H, Z is H, and n is 2.

    [0171] In some embodiments, the GalNAc is Formula (VII):

    ##STR00092##

    wherein R.sup.z is OH or SH; and each n is independently 1 or 2. In some embodiments, the targeting ligand may be a GalNAc targeting ligand may comprise 1, 2, 3, 4, 5 or 6 GalNAc units. In some embodiments, the targeting ligand may be a GalNAc selected from GalNAc2, GalNAc3, GalNAc4 (the GalNAc of Formula VII, wherein n=1 and R.sup.z═OH), GalNAc5, and GalNAc6.

    [0172] In some embodiments, the GalNAc may be GalNAc amidite (i.e., compound 40-9, see Example 22), GalNAc 4 CPG (i.e., compound 40-8, see Example 22 and Example 23), GalNAc phophoramidite, or GalNAc4-ps-GalNAc4-ps-GalNAc4. These GalNAc moieties are shown below:

    TABLE-US-00001 GalNAc 4 moieties [00093]embedded image GalNAc4 phosphoramidite [00094]embedded image GalNAc4 CPG [00095]text missing or illegible when filed

    [0173] GalNAc3, GalNAc4, GalNAc5 and GalNAc6 may be conjugated to an siNA disclosed herein during synthesis with 1 2, or 3 moieties. Further GalNAc moieties, such as GalNAc1 and GalNAc2, can be used to form 5′ and 3′-GalNAc using post synthesis conjugation.

    GalNAc Phosphoramidites

    [0174]

    TABLE-US-00002 GalNAc building blocks [00096]embedded image GalNAc-3 phosphoramidite [00097]embedded image GalNAc-4 phosphoramidite [00098]embedded image GalNAc-5 phosphoramidite [00099]embedded image GalNAc-6 phosphoramidite After Attachment to Oligos (Nomenclature) [00100]embedded image (GalNAc3-(PS)2-p) [00101]embedded image (GalNAc4-(PS)2-p) [00102]embedded image (GalNAc5-(PS)2-p) [00103]embedded image (GalNAc6-(PS)2-p) [00104]text missing or illegible when filed

    [0175] In some embodiments, the galactosamine is attached to the 3′ end of the sense strand or first nucleotide sequence. In some embodiments, the galactosamine is attached to the 3′ end of the sense strand or first nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the galactosamine is attached to the 5′ end of the sense strand or first nucleotide sequence. In some embodiments, the galactosamine is attached to the 5′ end of the sense strand or first nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the galactosamine is attached to the 3′ end of the antisense strand or second nucleotide sequence. In some embodiments, the galactosamine is attached to the 3′ end of the antisense strand or second nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the galactosamine is attached to the 5′ end of the antisense strand or second nucleotide sequence. In some embodiments, the galactosamine is attached to the 5′ end of the antisense strand or second nucleotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the one or more linkers are independently selected from the group consisting of a phosphodiester (p or po) linker, phosphorothioate (ps) linker, mesyl phosphoramidate linker (Ms), phosphoramidite (HEG) linker, triethylene glycol (TEG) linker, and/or phosphorodithioate linker. In some embodiments, the one or more linkers are independently selected from the group consisting of p-(PS)2, (PS)2-p-TEG-p, (PS)2-p-HEG-p, and (PS)2-p-(HEG-p)2.

    [0176] In some embodiments, the conjugated moiety is a lipid moiety. In some embodiments, any of the siNAs disclosed herein are attached to a conjugated moiety that is a lipid moiety. Examples of lipid moieties include, but are not limited to, a cholesterol moiety, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1-di-O-hexadecyl-rac-glycero-S—H-phosphonate, a polyamine or a polyethylene glycol chain, adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

    [0177] In some embodiments, the conjugated moiety is an active drug substance. In some embodiments, any of the siNAs disclosed herein are attached to a conjugated moiety that is an active drug substance. Examples of active drug substances include, but are not limited to, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (5)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

    5′-Stabilized End Cap

    [0178] Further disclosed herein are siNA molecules comprising a 5′-stabilized end cap. As used herein the terms “5′-stabilized end cap” and “5′ end cap” are used interchangeably. In some embodiments, a 2′-O-methyl nucleotide in any of sense strands or first nucleotide sequences disclosed herein is replaced with a nucleotide containing a 5′-stabilized end cap. In some embodiments, a 2′-O-methyl nucleotide in any of antisense strands or second nucleotide sequences disclosed herein is replaced with a nucleotide containing a 5′-stabilized end cap. In some embodiments, a 2′-O-methyl nucleotide in any of sense strands or first nucleotide sequences disclosed herein is further modified to contain a 5′-stabilized end cap. In some embodiments, a 2′-O-methyl nucleotide in any of antisense strands or second nucleotide sequences disclosed herein is further modified to contain a 5′-stabilized end cap.

    [0179] In some embodiments, the 5′-stabilized end cap is a 5′ phosphate mimic. In some embodiments, the 5′-stabilized end cap is a modified 5′ phosphate mimic. In some embodiments, the modified 5′ phosphate is a chemically modified 5′ phosphate. In some embodiments, the 5′-stabilized end cap is a 5′-vinyl phosphonate. In some embodiments, the 5′-vinyl phosphonate is a 5′-(E)-vinyl phosphonate or 5′-(Z)-vinyl phosphonate. In some embodiments, the 5′-vinyl phosphonate is a deuterated vinyl phosphonate. In some embodiments, the deuterated vinyl phosphonate is a mono-deuterated vinyl phosphonate. In some embodiments, the deuterated vinyl phosphonate is a di-deuterated vinyl phosphonate. In some embodiments, the 5′-stabilized end cap is a phosphate mimic. Examples of phosphate mimics are disclosed in Parmar et al., J Med Chem, 201861(3):734-744, International Publication Nos. WO2018/045317 and WO2018/044350, and U.S. Pat. No. 10,087,210, each of which is incorporated by reference in its entirety.

    [0180] In some aspects, the present disclosure provides siNA comprising a nucleotide phosphate mimic selected from:

    ##STR00105##

    wherein R.sub.y is a nucleobase and R.sup.15 is H or CH.sub.3. In some embodiments, the nucleobase is selected from thymine, cytosine, guanine, adenine, uracil, and an analogue or derivative thereof. In some embodiments, the disclosed nucleotide phosphate mimics include, but are not limited to, the structures:

    ##STR00106## ##STR00107## ##STR00108## ##STR00109## ##STR00110## ##STR00111## ##STR00112## ##STR00113##

    wherein R.sup.15 is H or CH.sub.3.

    [0181] In some aspects, the present disclosure provides siNA comprising a nucleotide phosphate mimic selected from:

    ##STR00114## ##STR00115##

    when R.sup.15 is CH.sub.3), and

    ##STR00116##

    where R.sup.15 is H or CH.sub.3. In some embodiments, one of these novel nucleotide phosphate mimics (e.g., omeco-d3 nucleotide, 4h nucleotide, v-mun nucleotide, c2o-4h nucleotide, coc-4h nucleotide, omeco-mun nucleotide, 4h-vp nucleotide, or d2vm nucleotide) are located at the 5′ end of the antisense strand; however, these novel nucleotide phosphate mimics may also be incorporated at the 5′ end of the sense strand, the 3′ end of the antisense strand, or the 3′ end of the sense strand.

    [0182] Additionally or alternatively, the siNA molecules disclosed herein may comprise in the sense strand, the antisense strand, or both a 5′-stabilized end cap of Formula (Ia):

    ##STR00117##

    wherein R.sub.x is H, a nucleobase, aryl, or heteroaryl; R.sup.26 is

    ##STR00118##

    —CH═CD-Z, —CD=CH—Z, —CD=CD-Z, —(CR.sup.21R.sup.22).sub.n—Z, or —(C.sub.2-C.sub.6 alkenylene)-Z and R.sup.20 is H; or R.sup.26 and R.sup.20 together form a 3- to 7-membered carbocyclic ring substituted with —(CR.sup.21R.sup.22).sub.n—Z or —(C.sub.2-C.sub.6 alkenylene)-Z; n is 1, 2, 3, or 4; Z is —ONR.sup.23R.sup.24, —OP(O)OH(CH.sub.2).sub.mCO.sub.2R.sup.23, —OP(S)OH(CH.sub.2).sub.mCO.sub.2R.sup.23, —P(O)(OH).sub.2, —P(O)(OH)(OCH.sub.3), —P(O)(OH)(OCD.sub.3), —SO.sub.2(CH.sub.2).sub.mP(O)(OH).sub.2, —SO.sub.2NR.sup.23R.sup.25, —NR.sup.23R.sup.24, —NR.sup.23SO.sub.2R.sup.24; either R.sup.21 and R.sup.22 are independently hydrogen or C.sub.1-C.sub.6 alkyl, or R.sup.21 and R.sup.22 together form an oxo group; R.sup.23 is hydrogen or C.sub.1-C.sub.6 alkyl; R.sup.24 is —SO.sub.2R.sup.25 or —C(O)R.sup.25; or R.sup.23 and R.sup.24 together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; R.sup.25 is C.sub.1-C.sub.6 alkyl; and m is 1, 2, 3, or 4. In some embodiments, R.sup.1 is an aryl. In some embodiments, the aryl is a phenyl.

    [0183] Additionally or alternatively, the siNA molecules disclosed herein may comprise in the sense strand, the antisense strand, or both a 5′-stabilized end cap of Formula (Ib):

    ##STR00119##

    wherein R.sub.x is H, a nucleobase, aryl, or heteroaryl; R.sup.26 is

    ##STR00120##

    —CH═CD-Z, —CD=CH—Z, —CD=CD-Z, —(CR.sup.21R.sup.22).sub.n—Z, or —(C.sub.2-C.sub.6 alkenylene)-Z and R.sup.20 is H; or R.sup.26 and R.sup.20 together form a 3- to 7-membered carbocyclic ring substituted with —(CR.sup.21R.sup.22).sub.n—Z or —(C.sub.2-C.sub.6 alkenylene)-Z; n is 1, 2, 3, or 4; Z is —ONR.sup.23R.sup.24, —OP(O)OH(CH.sub.2).sub.mCO.sub.2R.sup.23, —OP(S)OH(CH.sub.2).sub.mCO.sub.2R.sup.23, —P(O)(OH).sub.2, —P(O)(OH)(OCH.sub.3), —P(O)(OH)(OCD.sub.3), —SO.sub.2(CH.sub.2).sub.mP(O)(OH).sub.2, —SO.sub.2NR.sup.23R.sup.25, —NR.sup.23R.sup.24, —NR.sup.23SO.sub.2R.sup.24; either R.sup.21 and R.sup.22 are independently hydrogen or C.sub.1-C.sub.6 alkyl, or R.sup.21 and R.sup.22 together form an oxo group; R.sup.23 is hydrogen or C.sub.1-C.sub.6 alkyl; R.sup.24 is —SO.sub.2R.sup.25 or —C(O)R.sup.25; or R.sup.23 and R.sup.24 together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; R.sup.25 is C.sub.1-C.sub.6 alkyl; and m is 1, 2, 3, or 4. In some embodiments, R.sup.1 is an aryl. In some embodiments, the aryl is a phenyl.

    [0184] Additionally or alternatively, the siNA molecules disclosed herein may comprise in the sense strand, the antisense strand, or both a 5′-stabilized end cap of Formula (Ic):

    ##STR00121##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H,

    R.SUP.26 .is

    [0185] ##STR00122##

    —CH═CD-Z, —CD=CH—Z, —CD=CD-Z, —(CR.sup.21R.sup.22).sub.n—Z, or —(C.sub.2-C.sub.6alkenylene)-Z and R.sup.20 is hydrogen; or R.sup.26 and R.sup.20 together form a 3- to 7-membered carbocyclic ring substituted with —(CR.sup.21R.sup.22).sub.n—Z or —(C.sub.2-C.sub.6 alkenylene)-Z; n is 1, 2, 3, or 4; Z is —ONR.sup.23R.sup.24, —OP(O)OH(CH.sub.2).sub.mCO.sub.2R.sup.23, —OP(S)OH(CH.sub.2).sub.mCO.sub.2R.sup.23, —P(O)(OH).sub.2, —P(O)(OH)(OCH.sub.3), —P(O)(OH)(OCD.sub.3), —SO.sub.2(CH.sub.2).sub.mP(O)(OH).sub.2, —SO.sub.2NR.sup.23R.sup.25, —NR.sup.23R.sup.24, or —NR.sup.23SO.sub.2R.sup.24; R.sup.21 and R.sup.22 either are independently hydrogen or C.sub.1-C.sub.6 alkyl, or R.sup.21 and R.sup.22 together form an oxo group; R.sup.23 is hydrogen or C.sub.1-C.sub.6 alkyl; R.sup.24 is —SO.sub.2R.sup.25 or —C(O)R.sup.25; or

    [0186] R.sup.23 and R.sup.24 together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; R.sup.25 is C.sub.1-C.sub.6 alkyl; and m is 1, 2, 3, or 4. In some embodiments, R.sup.1 is an aryl. In some embodiments, the aryl is a phenyl.

    [0187] Additionally or alternatively, the siNA molecules disclosed herein may comprise in the sense strand, the antisense strand, or both a 5′-stabilized end cap of Formula (IIa):

    ##STR00123##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H, R.sup.26 is

    ##STR00124##

    —CH.sub.2SO.sub.2NHCH.sub.3, or

    ##STR00125##

    R.sup.9 is —SO.sub.2CH.sub.3 or —COCH.sub.3, custom-characteris a double or single bond, R.sup.10═—CH.sub.2PO.sub.3H or —NHCH.sub.3, R.sup.11 is —CH.sub.2— or —CO—, and R.sup.12 is H and R.sup.13 is CH.sub.3 or R.sup.12 and R.sup.13 together form —CH.sub.2CH.sub.2CH.sub.2—. In some embodiments, R.sup.1 is an aryl. In some embodiments, the aryl is a phenyl.

    [0188] Additionally or alternatively, the siNA molecules disclosed herein may comprise in the sense strand, the antisense strand, or both a 5′-stabilized end cap of Formula (IIb):

    ##STR00126##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H, R.sup.26 is

    ##STR00127##

    —CH.sub.2SO.sub.2NHCH.sub.3, or

    ##STR00128##

    R.sup.9 is —SO.sub.2CH.sub.3 or —COCH.sub.3, custom-character is a double or single bond, R.sup.10═—CH.sub.2PO.sub.3H or —NHCH.sub.3, R.sup.11 is —CH.sub.2— or —CO—, and R.sup.12 is H and R.sup.13 is CH.sub.3 or R.sup.12 and R.sup.13 together form —CH.sub.2CH.sub.2CH.sub.2—. In some embodiments, R.sup.1 is an aryl. In some embodiments, the aryl is a phenyl.

    [0189] Additionally or alternatively, the siNA molecules disclosed herein may comprise in the sense strand, the antisense strand, or both a 5′-stabilized end cap of Formula (III):

    ##STR00129##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H, L is —CH.sub.2—, —CH═CH—, —CO—, or —CH.sub.2CH.sub.2—, and A is —ONHCOCH.sub.3, —ONHSO.sub.2CH.sub.3, —PO.sub.3H, —OP(SOH)CH.sub.2CO.sub.2H, —SO.sub.2CH.sub.2PO.sub.3H, —SO.sub.2NHCH.sub.3, —NHSO.sub.2CH.sub.3, or —N(SO.sub.2CH.sub.2CH.sub.2CH.sub.2). In some embodiments, R.sup.1 is an aryl. In some embodiments, the aryl is a phenyl.

    [0190] Additionally or alternatively, the siNA molecules disclosed herein may comprise a 5′-stabilized end cap selected from the group consisting of Formula (1) to Formula (16), Formula (9X) to Formula (12X), Formula (16X), Formula (9Y) to Formula (12Y), Formula (16Y), Formula (21) to Formula (36), Formula 36X, Formula (41) to (56), Formula (49X) to (52X), Formula (49Y) to (52Y), Formula 56X, Formula 56Y, Formula (61) and Formula (62):

    ##STR00130## ##STR00131## ##STR00132## ##STR00133## ##STR00134## ##STR00135## ##STR00136## ##STR00137## ##STR00138##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H.

    [0191] In some embodiments, any of the siNA molecules disclosed herein comprise a 5′-stabilized end cap selected from the group consisting of Formula (50), Formula (50X), Formula (50Y), Formula (56), Formula (56X), Formula (56Y), Formula (61), Formula (62), and Formula (63):

    ##STR00139##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H.

    [0192] In some embodiments, any of the siNA molecules disclosed herein comprise a 5′-stabilized end cap selected from the group consisting of Formula (71) to Formula (86), Formula (79X) to Formula (82X), Formula (79Y) to (82Y), Formula 86X, Formula 86X′, Formula 86Y, and Formula 86Y′:

    ##STR00140## ##STR00141## ##STR00142## ##STR00143## ##STR00144##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H.

    [0193] In some embodiments, any of the siNA molecules disclosed herein comprise a 5′-stabilized end cap selected from the group consisting of Formula (78), Formula (79), Formula (79X), Formula (79Y), Formula (86), Formula (86X), and Formula (86X′):

    ##STR00145##

    wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H.

    [0194] In some embodiments, any of the siNA molecules disclosed herein comprise a 5′-stabilized end cap selected from the group consisting of Formulas (1A)-(15 A), Formulas (1A-1)-(7 A-1), Formulas (1A-2)-(7 A-2), Formulas (1A-3)-(7 A-3), Formulas (1A-4)-(7 A-4), Formulas (9B)-(12B), Formulas (9AX)-(12AX), Formulas (9AY)-(12AY), Formulas (9BX)-(12BX), and Formulas (9BY)-(12BY):

    ##STR00146## ##STR00147## ##STR00148## ##STR00149## ##STR00150## ##STR00151## ##STR00152## ##STR00153## ##STR00154## ##STR00155## ##STR00156## ##STR00157## ##STR00158## ##STR00159## ##STR00160## ##STR00161## ##STR00162##

    [0195] In some embodiments, any of the siNA molecules disclosed herein comprise a 5′-stabilized end cap selected from the group consisting of Formulas (21A)-(35 A), Formulas (29B)-(32B), Formulas (29AX)-(32AX), Formulas (29AY)-(32AY), Formulas (29BX)-(32BX), and Formulas (29BY)-(32BY):

    ##STR00163## ##STR00164## ##STR00165## ##STR00166## ##STR00167## ##STR00168## ##STR00169##

    [0196] In some embodiments, any of the siNA molecules disclosed herein comprise a 5′-stabilized end cap selected from the group consisting of Formulas (71A)-(86 A), Formulas (79XA)-(82XA), Formulas (79YA)-(82YA); Formula (86XA), Formula (86X′A), Formula (86Y), and Formula (86Y′):

    ##STR00170## ##STR00171## ##STR00172## ##STR00173## ##STR00174## ##STR00175##

    [0197] In some embodiments, any of the siNA molecules disclosed herein comprise a 5′-stabilized end cap selected from the group consisting of Formula (78A), Formula (79A), Formula (79XA), Formula (79YA), Formula (86A), Formula (86XA), and Formula (86X′A):

    ##STR00176##

    [0198] In some embodiments, the 5′-stabilized end cap is attached to the 5′ end of the antisense strand. In some embodiments, the 5′-stabilized end cap is attached to the 5′ end of the antisense strand via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the one or more linkers are independently selected from the group consisting of a phosphodiester (p or po) linker, phosphorothioate (ps) linker, mesyl phosphoramidate (Ms) linker, phosphoramidite (HEG) linker, triethylene glycol (TEG) linker, and/or phosphorodithioate linker. In some embodiments, the one or more linkers are independently selected from the group consisting of p-(PS).sub.2, (PS).sub.2-p-TEG-p, (PS).sub.2-p-IEG-p, and (PS).sub.2-p-(HEG-p).sub.2.

    [0199] As indicated above, the present disclosure provides compositions comprising any of the siNA molecules, sense strands, antisense strands, first nucleotide sequences, or second nucleotide sequences described herein. The disclosed siNA and compositions thereof can be used in the treatment of various diseases and conditions (e.g., viral diseases, liver disease, etc.).

    Linker

    [0200] In some embodiments, any of the siRNAs, sense strands, first nucleotide sequences, antisense strands, and/or second nucleotide sequences disclosed herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or more internucleoside linkers. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more internucleoside linkers are independently selected from the group consisting of a phosphodiester (p or po) linker, phosphorothioate (ps) linker, mesyl phosphoramidate (Ms) linker, or phosphorodithioate linker.

    [0201] In some embodiments, any of the siRNAs, sense strands, first nucleotide sequences, antisense strands, and/or second nucleotide sequences disclosed herein further comprise 1, 2, 3, 4 or more linkers that attach a conjugated moiety, phosphorylation blocker, and/or 5′ end cap to the siRNA, sense strand, first nucleotide sequence, antisense strand, and/or second nucleotide sequences. In some embodiments, the 1, 2, 3, 4 or more linkers are independently selected from the group consisting of a phosphodiester (p or po) linker, phosphorothioate (ps) linker, mesyl phosphoramidate (Ms), phosphoramidite (HEG) linker, triethylene glycol (TEG) linker, and/or phosphorodithioate linker. In some embodiments, the one or more linkers are independently selected from the group consisting of p-(PS)2, (PS)2-p-TEG-p, (PS)2-p-HEG-p, and (PS)2-p-(IEG-p)2.

    Exemplary siNA

    [0202] As noted above, the siNA disclosed herein may comprise a modified nucleotide, such as the 2′-fluoro nucleotide fB, fN, or 4 (4nh)Q. Other 2′-fluoro nucleotides, such as f2P, f4P, and fX may be incorporated into the disclosed siNA as well. A siNA comprising a disclosed 2′-fluoro nucleotide (e.g., fB, fN, or 4 (4nh)Q and bolded in the Table) may comprise one or more of the disclosed 2′-fluoro nucleotides and the one or more 2′-fluoro nucleotides may be present in the sense strand or the antisense strand or both. Table 1 shows exemplary siNA comprising these 2′-fluoro nucleotides.

    TABLE-US-00003 TABLE 1 siNA Comprising 2′-Fluoro Nucleotides Name SS/AS 5′ to 3′ ds-siNA-001 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU (SEQ ID NO: 1) mApsfZPpsmUmGmAfGmAmGmAmAmGmUmCfCmAfCmCmAmCpsmGp smA (SEQ ID NO: 2) ds-siNA-002 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU (SEQ ID NO: 3) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCf4PmAfCmCmAmCpsmGp smA (SEQ ID NO: 4) ds-siNA-003 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU (SEQ ID NO: 5) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCfCmAflPmCmAmCpsmGp smA (SEQ ID NO: 6) ds-siNA-004 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU (SEQ ID NO: 7) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCf2PmAf2PmCmAmCpsmG psmA (SEQ ID NO: 8) ds-siNA-005 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU (SEQ ID NO: 9) mApsfBpsmUmGmAfGmAmGmAmAmGmUmCfCmAfCmCmAmCpsmGps mA (SEQ ID NO: 10) ds-siNA-006 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU (SEQ ID NO: 11) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCfBmAfCmCmAmCpsmGps mA (SEQ ID NO: 12) ds-siNA-007 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU (SEQ ID NO: 13) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCfBmAfBmCmAmCpsmGps mA (SEQ ID NO: 14) ds-siNA-008 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU (SEQ ID NO: 15) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCflPmAfCmCmAmCpsmGp smA (SEQ ID NO: 16) ds-siNA-O23 5′- mCpsmCpsmGmUfGmUfGf(4nh)QfAmCmUmUmCmGmCmUmUmCmA-p- (ps)2-GalNAc4 (SEQ ID NO: 63) 3′- mCpsmUpsmGmGfCmAmCfAmCmGmUmGmAfAmGmCfGmAmApsfGpsd 2vd3U-5′ (SEQ ID NO: 64) ds-siNA-O24 5 ′ -mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCm A-p- (ps)2-GalNAc4 (SEQ ID NO: 65) 3′- mCpsmUpsmGmGfCmAmCfAmCmGmUmGmAfAmGf(4nh)QfGmAmApsf Gpsd2vd3U-5′ (SEQ ID NO: 66) ds-siNA-O25 5 ′ -mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCm A-p- (ps)2GalNAc4 (SEQ ID NO: 67) 3′- mCpsmUpsmGmGf(4nh)QmAmCfAmCmGmUmGmAfAmGmCfGmAmApsf Gpsd2vd3U-5′ (SEQ ID NO: 68) mX = 2′-O-methyl nucleotide; fX = 2′-fluoro nucleotide; 5dcd3X = nucleotide of Formula 17; 5dfX = nucleotide of Formula 16; vX= 5′ vinyl phosphonate nucleotide; d2vX = deuterated 5′ vinyl phosphonate nucleotide; vmX = 5′ vinyl phosphonate, 2′-O-methyl nucleotide; ; f4P = [00177]embedded imagef2P = [00178]embedded imagefB = [00179]embedded imagef(4nh)Q = [00180]embedded imageps = phosphorothioate linkage; X is a nucleobase (e.g. A, G, C, U or T)

    [0203] Additionally or alternatively, the disclosed siNA may also incorporate a novel nucleotide phosphate mimic (e.g., omeco-d3U, 4hU, v-mun, c2o-4h, omeco-mun, d2vmA, coc-4h, 4H-VP nucleotide). Table 2 shows exemplary siNA comprising these nucleotide phosphate mimics. A siNA comprising a disclosed novel phosphate mimic (e.g., omeco-d3U, 4hU, v-mun, c2o-4h, omeco-mun, coc-4h, or d2vmA and bolded in the Table) may comprise one or more of the disclosed novel phosphate mimic and the one or more novel phosphate mimics may be present in the sense strand or the antisense strand or both.

    TABLE-US-00004 TABLE 2 siNA Comprising Nucleotide Phosphate Mimics Name SS/AS 5′ to 3′ ds-siNA-009 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmAp-ps2- GalNAc4 (SEQ ID NO: 17) omeco- d3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUps mC (SEQ ID NO: 18) ds-siNA-010 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmAp-ps2- GalNAc4 (SEQ ID NO: 19) 4hUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUps mC (SEQ ID NO: 20) ds-siNA-011 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmAp-ps2- GalNAc4 (SEQ ID NO: 21) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsm UpsmC (SEQ ID NO: 22) ds-siNA-012 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-ps2- GalNAc4 (SEQ ID NO: 23) V- munUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmU psmC (SEQ ID NO: 24) ds-siNA-013 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-ps2- GalNAc4 (SEQ ID NO: 25) c2o- 4hUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUps mC (SEQ ID NO: 26) ds-siNA-014 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-ps2- GalNAc4 (SEQ ID NO: 27) omeco- munUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmU psmC (SEQ ID NO: 28) ds-siNA-015 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-ps2- GalNAc4 (SEQ ID NO: 29) omeco- munUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmU psmC (SEQ ID NO: 30) ds-siNA-016 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-ps2- GalNAc4 (SEQ ID NO: 33) d2vmApsfUpsmUmGmAfGmAmGmAmAmGmUmCfCmAf2PmCmAmCpsm GpsmA (SEQ ID NO: 34) ds-siNA-050 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2- GalNAc4 (SEQ ID NO: 111) C0C-4hUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsm UpsmC (SEQ ID NO: 112) mX = 2′-O-methyl nucleotide; fX = 2′-fluoro nucleotide; 5dcd3X = nucleotide of Formula 17; 5dfX = nucleotide of Formula 16; vX= 5′ vinyl phosphonate nucleotide; d2vX = deuterated 5′ vinyl phosphonate nucleotide; vmX = 5′ vinyl phosphonate, 2′-O-methyl nucleotide; omeco-d3U = [00181]embedded image4hU = [00182]embedded imaged2vd3U = [00183]embedded imagev-munU = [00184]embedded imagec2o-4hU = [00185]embedded imagecoc-4hU = [00186]embedded imageomeco-munU = [00187]embedded imageps = phosphorothioate linkage; X is a nucleobase (e.g. A, G, C, U or T)

    [0204] Additionally or alternatively, the disclosed siNA may also incorporate a novel unlocked nucleotide monomers. These novel unlocked nucleotides may have of structure of

    ##STR00188##

    (wherein R.sub.x is a nucleobase, aryl, heteroaryl, or H) or, more specifically,

    ##STR00189##

    wherein R.sub.y is a nucleobase. These unlocked nucleotides are distinct from unlock nucleic acids (UNA) known in the art in which the 2′ to 3′ bond is missing

    ##STR00190##

    Table 3 shows exemplary siNA comprising these unlocked nucleotides. A siNA comprising a 3′,4′ UNA (e.g., mun34) may comprise one or more of the disclosed 3′, 4′ UNAs and the one or more 3′, 4′ UNAs may be present in the sense strand or the antisense strand or both.

    TABLE-US-00005 TABLE 3 siNA Comprising Modified Unlocked Nucleotides Name SS/AS (5′ to 3′) ds-siNA-017 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA (SEQ ID NO: 35) mUpsfGpsmAmAfGmun34CmGfAmAmGmUmGmCfAmCmAfCmGmGpsmU psmC (SEQ ID NO: 36) ds-siNA-018 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA (SEQ ID NO: 37) mUpsfGpsmAmAfGmCmun34GfAmAmGmUmGmCfAmCmAfCmGmGpsmU psmC (SEQ ID NO: 38) ds-siNA-019 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-ps2- GalNAc4 (SEQ ID NO: 39) d2vd3UpsfGpsmAmAfGmCmun34GfAmAmGmUmGmCfAmCmAfCmGmGps mUpsmC (SEQ ID NO: 40) ds-siNA-034 mCpsmCpsmun34GmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA (SEQ ID NO: 93) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-035 mCpsmCpsmGmun34UfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA (SEQ ID NO: 95) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-036 mCpsmCpsmGmUfGmun34UfGfCfAmCmUmUmCmGmCmUmUmCmA (SEQ ID NO: 96) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-037 mCpsmCpsmGmUfGmUfGfCfAmun34CmUmUmCmGmCmUmUmCmA (SEQ ID NO: 97) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-038 mCpsmCpsmGmUfGmUfGfCfAmCmun34UmUmCmGmCmUmUmCmA (SEQ ID NO: 98) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-039 mCpsmCpsmGmUfGmUfGfCfAmCmUmun34UmCmGmCmUmUmCmA (SEQ ID NO: 99) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-040 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmun34CmGmCmUmUmCmA (SEQ ID NO: 100) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-041 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmun34GmCmUmUmCmA (SEQ ID NO: 101) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-042 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmun34CmUmUmCmA (SEQ ID NO: 102) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-043 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmun34UmUmCmA (SEQ ID NO: 103) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-044 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmun34UmCmA (SEQ ID NO: 104) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-045 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmun34CmA (SEQ ID NO: 105) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) mX = 2′-O-methyl nucleotide; fX = 2′-fluoro nucleotide; 5dcd3X = nucleotide of Formula 17; 5dfX = nucleotide of Formula 16; vX = 5′ vinyl phosphonate nucleotide; d2vX = deuterated 5′ vinyl phosphonate nucleotide; vmX = 5′ vinyl phosphonate, 2′-O-methyl nucleotide; d2vd3U = [00191]embedded imagemun34C = [00192]embedded imagemun34G = [00193]embedded imageunC = [00194]embedded imageunG = [00195]embedded imageps = phosphorothioate linkage; X is a nucleobase (e.g. A, G, C, U or T)

    [0205] Additionally or alternatively, the disclosed siNA may also incorporate 1 or more mesyl phosphoroamidate internucleoside linkages. The mesyl phosphoroamidate internucleoside linkage (also known as “yp”) may have the structure of

    ##STR00196##

    Table 4 shows exemplary siNA comprising these mesyl phosphoroamidate internucleoside linkages. A siNA comprising mesyl phosphoroamidate internucleoside linkage (denoted “yp” and bolded in the Table) may comprise one or more yp linkages and the one or more yp linkages may be present in the sense strand or the antisense strand or both.

    TABLE-US-00006 TABLE 4 siNA Comprising Mesyl Phosphoroamidate Internucleoside Linkages Name SS/AS (5′ to 3′) ds-siNA-020 5′-mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCm Am AmU-p- (ps)2-GalNAc4 (SEQ ID NO: 69) 3′- mApsmGpsmCmAmCfCmAfCmCmUmGmAmAmGmAfGmAmGmUypfUypm A-5′ (SEQ ID NO: 70) ds-siNA-021 5′-mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCm Am AmU-p- (ps)2-GalNAc4 (SEQ ID NO: 71) 3′- mAypmGypmCmAmCfCmAfCmCmUmGmAmAmGmAfGmAmGmUpsfUpsm A-5′ (SEQ ID NO: 72) ds-siNA-022 5′-mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCm Am AmU-p- (ps)2-GalNAc4 (SEQ ID NO: 73) 3′- mAypmGypmCmAmCfCmAfCmCmUmGmAmAmGmAfGmAmGmUypfUyp mA-5′ (SEQ ID NO: 74) mX = 2′-O-methyl nucleotide; fX = 2′-fluoro nucleotide; ps = phosphorothioate linkage; X is a nucleobase (e.g. A, G, C, U or T); yp = [00197]embedded image

    [0206] Additionally or alternatively, the disclosed siNA may also incorporate a novel monomer referred to herein as “apN,” which has a structure of

    ##STR00198##

    wherein Ry represents a nucleobase (e.g., U, A, G, T, C), and in some embodiments, the apN may be an “apU,” which has a structure of

    ##STR00199##

    Table 5 shows exemplary siNA comprising these modified nucleotides. A siNA comprising an apU nucleotide (denoted “aU” and bolded in the Table) may comprise one or more apU nucleotides and the one or more apU nucleotides may be present in the sense strand or the antisense strand or both.

    TABLE-US-00007 TABLE 5 siNA Comprising Modified apU Nucleotides Name SS/AS (5′ to 3′) ds-siNA-026 mCpsmCpsmGaUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2- GalNAc4 (SEQ ID NO: 77) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUp smC (SEQ ID NO: 78) ds-siNA-027 mCpsmCpsmGmUfGaUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2- GalNAc4 (SEQ ID NO: 79) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUp smC (SEQ ID NO: 80) ds-siNA-028 mCpsmCpsmGmUfGmUfGfCfAmCmUaUmCmGmCmUmUmCmA-p-(ps)2- GalNAc4 (SEQ ID NO: 81) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUp smC (SEQ ID NO: 82) ds-siNA-O29 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCaUmUmCmA-p-(ps)2- GalNAc4 (SEQ ID NO: 83) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUp smC (SEQ ID NO: 84) ds-siNA-030 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUaUmCmA-p-(ps)2- GalNAc4 (SEQ ID NO: 85) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUp smC (SEQ ID NO: 86) ds-siNA-031 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2- GalNAc4 (SEQ ID NO: 87) d2vd3UpsfGpsmAmAfGmCmGfAmAmGaUmGmCfAmCmAfCmGmGpsmUps mC (SEQ ID NO: 88) ds-siNA-032 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2- GalNAc4 (SEQ ID NO: 89) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsaUps mC (SEQ ID NO: 90) ds-siNA-O33 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2- GalNAc4 (SEQ ID NO: 91) aUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 92) mX = 2′-O-methyl nucleotide; fX = 2′-fluoro nucleotide; 5dcd3X = nucleotide of Formula 17; 5dfX = nucleotide of Formula 16; vX= 5′ vinyl phosphonate nucleotide; d2vX = deuterated 5′ vinyl phosphonate nucleotide; vmX = 5′ vinyl phosphonate, 2′-O-methyl nucleotide; d2vd3U = [00200]embedded imageaU = [00201]embedded imageps = phosphorothioate linkage; X is a nucleobase (e.g. A, G, C, U or T)

    Target Gene

    [0207] Without wishing to be bound by theory, upon entry into a cell, any of the ds-siNA molecules disclosed herein may interact with proteins in the cell to form a RNA-Induced Silencing Complex (RISC). Once the ds-siNA is part of the RISC, the ds-siNA may be unwound to form a single-stranded siNA (ss-siNA). The ss-siNA may comprise the antisense strand of the ds-siNA. The antisense strand may bind to a complementary messenger RNA (mRNA), which results in silencing of the gene that encodes the mRNA.

    [0208] The target gene may be any gene in a cell. In some embodiments, the target gene is a viral gene. In some embodiments, the viral gene is from a DNA virus. In some embodiments, the DNA virus is a double-stranded DNA (dsDNA) virus. In some embodiments, the dsDNA virus is a hepadnavirus. In some embodiments, the hepadnavirus is a hepatitis B virus (HBV). In some embodiments, the HBV is selected from HBV genotypes A-J. In some embodiments, the viral disease is caused by an RNA virus. In some embodiments, the RNA virus is a single-stranded RNA virus (ssRNA virus). In some embodiments, the ssRNA virus is a positive-sense single-stranded RNA virus ((+)ssRNA virus). In some embodiments, the (+)ssRNA virus is a coronavirus. In some embodiments, the coronavirus is a β-coronaviruses. In some embodiments, the β-coronaviruses is selected from the group consisting of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (also known by the provisional name 2019 novel coronavirus, or 2019-nCoV), human coronavirus OC43 (hCoV-OC43), Middle East respiratory syndrome-related coronavirus (MERS-CoV, also known by the provisional name 2012 novel coronavirus, or 2012-nCoV), and severe acute respiratory syndrome-related coronavirus (SARS-CoV, also known as SARS-CoV-1). In some embodiments, the β-coronaviruses is SARS-CoV-2, the causative agent of COVID-19. Some exemplary target genes are shown in Table 17 at the end of the specification.

    [0209] In some embodiments, the target gene is selected from the S gene or X gene of the HBV. In some embodiments, the HBV has a genome sequence shown in the nucleotide sequence of SEQ ID NO: 55 which corresponds to the nucleotide sequence of GenBank Accession No. U95551.1, which is incorporated by reference in its entirety.

    [0210] An exemplary HBV genome sequence is shown in SEQ ID NO: 60, corresponding to Genbank Accession No. KC315400.1, which is incorporated by reference in its entirety. Nucleotides 2307 . . . 3215, 1 . . . 1623 of SEQ ID NO: 60 correspond to the polymerase/RT gene sequence, which encodes for the polymerase protein. Nucleotides 2848 . . . 3215, 1 . . . 835 of SEQ ID NO: 60 correspond to the PreS1/S2/S gene sequence, which encodes for the large S protein. Nucleotides 3205 . . . 3215, 1 . . . 835 of SEQ ID NO: 60 correspond to the PreS2/S gene sequence, which encodes for the middle S protein. Nucleotides 155 . . . 835 of SEQ ID NO: 60 correspond to the S gene sequence, which encodes the small S protein. Nucleotides 1374 . . . 1838 of SEQ ID NO: 60 correspond to the X gene sequence, which encodes the X protein. Nucleotides 1814 . . . 2452 of SEQ ID NO: 60 correspond to the PreC/C gene sequence, which encodes the precore/core protein. Nucleotides 1901 . . . 2452 of SEQ ID NO: 60 correspond to the C gene sequence, which encodes the core protein. The HBV genome further comprises viral regulatory elements, such as viral promoters (preS2, preS1, Core, and X) and enhancer elements (ENH1 and ENH2). Nucleotides 1624 . . . 1771 of SEQ ID NO: 60 correspond to ENH2. Nucleotides 1742 . . . 1849 of SEQ ID NO: 60 correspond to the Core promoter. Nucleotides 1818 . . . 3215, 1 . . . 1930 of SEQ ID NO: 60 correspond to the pregenomic RNA (pgRNA), which encodes the core and polymerase proteins.

    [0211] In some embodiments, the sense strand comprises a sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary or hybridizes to a viral target RNA sequence that begins in an X region of HBV or in an S region of HBV. The viral target may, e.g., begin at the 5′-end of target-site in acc. KC315400.1 (genotype B, “gt B”), or in any one of genotypes A, C, or D. The skilled person would understand the HBV position, e.g., as described in Wing-Kin Sung, et al., Nature Genetics 44:765 (2012). In some embodiments, the S region is defined as from the beginning of small S protein (in genotype B KC315400.1 isolate, position #155) to before beginning of X protein (in genotype B KC315400.1 isolate, position #1373). In some embodiments, the X region is defined as from the beginning X protein (in genotype B KC315400.1 isolate, position #1374) to end of DR2 site (in genotype B KC315400.1 isolate, position #1603).

    [0212] In some embodiments, the second nucleotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucleotides within positions 200-720 or 1100-1700 of SEQ ID NO: 55. In some embodiments, the second nucleotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucleotides within positions 200-280, 300-445, 460-510, 650-720, 1170-1220, 1250-1300, or 1550-1630 of SEQ ID NO: 55. In some embodiments, the second nucleotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucleotides within positions 200-230, 250-280, 300-330, 370-400, 405-445, 460-500, 670-700, 1180-1210, 1260-1295, 1520-1550, or 1570-1610 of SEQ ID NO: 55. In some embodiments, the second nucleotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucleotides starting at position 203, 206, 254, 305, 375, 409, 412, 415, 416, 419, 462, 466, 467, 674, 676, 1182, 1262, 1263, 1268, 1526, 1577, 1578, 1580, 1581, 1583, or 1584 of SEQ ID NO: 55.

    [0213] In some embodiments, the first nucleotide is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to a nucleotide region within SEQ ID NO: 55, with the exception that the thymines (Ts) in SEQ ID NO: 55 are replaced with uracil (U). In some embodiments, the first nucleotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucleotides within positions 200-720 or 1100-1700 of SEQ ID NO: 55. In some embodiments, the first nucleotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucleotides within positions 200-280, 300-445, 460-510, 650-720, 1170-1220, 1250-1300, or 1550-1630 of SEQ ID NO: 55. In some embodiments, the first nucleotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucleotides within positions 200-230, 250-280, 300-330, 370-400, 405-445, 460-500, 670-700, 1180-1210, 1260-1295, 1520-1550, or 1570-1610 of SEQ ID NO: 55. In some embodiments, the first nucleotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucleotides starting at position 203, 206, 254, 305, 375, 409, 412, 415, 416, 419, 462, 466, 467, 674, 676, 1182, 1262, 1263, 1268, 1526, 1577, 1578, 1580, 1581, 1583, or 1584 of SEQ ID NO: 55.

    [0214] Several disease-causing coronaviruses share a high degree of homology in the regions of the genome encoding non-structural proteins (nsp), and more specifically, in the region encoding nsp8-nsp15. Indeed, there is roughly 65% identity across the roughly 7 kB sequence of β-coronaviruses from about nucleotide 12900 to about nucleotide 19900 of 2019-nCoV, and some subsections of the genomic span of nsp8 to nsp15 may comprise 95% or more identity. All of the genes in this region encode non-structural proteins associated with replication. Accordingly, this segment of the genome is suitable for targeting with an siNA that can provide a broad spectrum treatment for multiple different types of coronavirus, such as MERS-CoV, SARS-CoV-1, and SARS-CoV-2.

    [0215] In some embodiments, the target gene is selected from genome of SARS-CoV-2. In some embodiments, SARS-CoV-2 has a genome sequence shown in the nucleotide sequence of SEQ ID NO: 74, which corresponds to the nucleotide sequence of GenBank Accession No. NC_045512.2, which is incorporated by reference in its entirety. In some embodiments, the target gene a sequence 15 to 30, 15 to 25, 15 to 23, 17 to 23, 19 to 23, or 19 to 21 nucleotides in length, and preferably 19 or 21 nucleotides in length, within SEQ ID NO: 74. In some embodiments, the antisense strand sequence is complementary to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucleotides, and preferably 19 to 21 nucleotides, and more preferably 19 or 21 nucleotides, within positions 190-216, 233-279, 288-324, 455-477, 626-651, 704-723, 3352-3378, 5384-5403, 6406-6483, 7532-7551, 9588-9606, 10484-10509, 11609-11630, 11834-11853, 12023-12045, 12212-12234, 12401-12420, 12839-12867, 12885-12924, 12966-12990, 13151-13176, 13363-13386, 13388-13416, 13458-13416, 13458-13520, 13762-13790, 14290-14312, 14404-14429, 14500-14531, 14623-14642, 14650-14687, 14698-14717, 14722-14748, 14750-14777, 14821-14846, 14854-14873, 14875-14903, 14962-14990, 14992-15020, 15055-15140, 15172-15200, 15310-15332, 15346-15367, 15496-15518, 15622-15644, 15838-15869, 15886-15905, 15985-16010, 16057-16079, 16186-16205, 16430-16448, 16822-16865, 16954-16976, 17008-17042, 17080-17111, 17137-17156, 17269-17289, 17530-17549, 17563-17582, 17680-17699, 17746-17765, 17857-17876, 17956-17975, 18100-18122, 18196-18218, 19618-19639, 19783-19802, 19831-19850, 20107-20130, 20776-20795, 21502-21524, 24302-24325, 24446-24465, 24620-24651, 24662-24684, 25034-25057, 25104-25128, 25364-25387, 25502-25530, 26191-26227, 26232-26267, 26269-26330, 26332-26394, 26450-26481, 26574-26600, 27003-27064, 27093-27111, 27183-27212, 27382-27407, 27511-27533, 27771-27818, 28270-28296, 28397-28434, 28513-28546, 28673-28692, 28706-28726, 28744-28794, 28799-28827, 28946-28972, 28976-29034, 29144-29172, 29174-29196, 29228-29259, 29285-29305, 29342-29394, 29444-29463, 29543-29566, 29598-29630, 29652-29687, 29689-29731, 29733-29757, or 29770-29828 of SEQ ID NO: 74. In some embodiments, the sense strand sequence is identical to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucleotides, and preferably 19 to 21 nucleotides, and more preferably 19 or 21 nucleotides, within positions 190-216, 233-279, 288-324, 455-477, 626-651, 704-723, 3352-3378, 5384-5403, 6406-6483, 7532-7551, 9588-9606, 10484-10509, 11609-11630, 11834-11853, 12023-12045, 12212-12234, 12401-12420, 12839-12867, 12885-12924, 12966-12990, 13151-13176, 13363-13386, 13388-13416, 13458-13416, 13458-13520, 13762-13790, 14290-14312, 14404-14429, 14500-14531, 14623-14642, 14650-14687, 14698-14717, 14722-14748, 14750-14777, 14821-14846, 14854-14873, 14875-14903, 14962-14990, 14992-15020, 15055-15140, 15172-15200, 15310-15332, 15346-15367, 15496-15518, 15622-15644, 15838-15869, 15886-15905, 15985-16010, 16057-16079, 16186-16205, 16430-16448, 16822-16865, 16954-16976, 17008-17042, 17080-17111, 17137-17156, 17269-17289, 17530-17549, 17563-17582, 17680-17699, 17746-17765, 17857-17876, 17956-17975, 18100-18122, 18196-18218, 19618-19639, 19783-19802, 19831-19850, 20107-20130, 20776-20795, 21502-21524, 24302-24325, 24446-24465, 24620-24651, 24662-24684, 25034-25057, 25104-25128, 25364-25387, 25502-25530, 26191-26227, 26232-26267, 26269-26330, 26332-26394, 26450-26481, 26574-26600, 27003-27064, 27093-27111, 27183-27212, 27382-27407, 27511-27533, 27771-27818,28270-28296, 28397-28434,28513-28546, 28673-28692, 28706-28726, 28744-28794, 28799-28827, 28946-28972, 28976-29034, 29144-29172, 29174-29196, 29228-29259, 29285-29305, 29342-29394, 29444-29463, 29543-29566, 29598-29630, 29652-29687, 29689-29731, 29733-29757, or 29770-29828 of SEQ ID NO: 74.

    [0216] In some embodiments, the target gene is selected from genome of SARS-CoV. In some embodiments, SARS-CoV has a genome corresponding to the nucleotide sequence of GenBank Accession No. NC_004718.3, which is incorporated by reference in its entirety.

    [0217] In some embodiments, the target gene is selected from the genome of MERS-CoV. In some embodiments, MERS-CoV has a genome corresponding to the nucleotide sequence of GenBank Accession No. NC_019843.3, which is incorporated by reference in its entirety.

    [0218] In some embodiments, the target gene is selected from the genome of hCoV-OC43. In some embodiments, hCoV-OC43 has a genome corresponding to the nucleotide sequence of GenBank Accession No. NC_006213.1, which is incorporated by reference in its entirety.

    [0219] In some embodiments, the target gene is involved in liver metabolism. In some embodiments, the target gene is an inhibitor of the electron transport chain. In some embodiments, the target gene encodes the MCJ protein (MCJ/DnaJC15 or Methylation-Controlled J protein). In some embodiments, the MCJ protein is encoded by the mRNA sequence of SEQ ID NO: 56, which corresponds to the nucleotide sequence of GenBank Accession No. NM_013238.3, which is incorporated by reference in its entirety.

    [0220] In some embodiments, the target gene is TAZ. In some embodiments, TAZ comprises the nucleotide sequence of SEQ ID NO: 57, which corresponds to the nucleotide sequence of GenBank Accession No. NM_000116.5, which is incorporated by reference in its entirety.

    [0221] In some embodiments, the target gene is angiopoietin like 3 (ANGPTL3). In some embodiments, ANGPTL3 comprises the nucleotide sequence of SEQ ID NO: 60, which corresponds to the nucleotide sequence of GenBank Accession No. NM_014495.4, which is incorporated by reference in its entirety.

    In some embodiments, the target gene is diacylglycerol acyltransferase 2 (DGAT2). In some embodiments, DGAT2 comprises the nucleotide sequence of SEQ ID NO: 59, which corresponds to the nucleotide sequence of GenBank Accession No. NM_001253891.1, which is incorporated by reference in its entirety.

    Compositions

    [0222] As indicated above, the present disclosure provides compositions comprising any of the siNA molecules, sense strands, antisense strands, first nucleotide sequences, or second nucleotide sequences described herein. The compositions may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more siNA molecules described herein. The compositions may comprise a first nucleotide sequence comprising a nucleotide sequence of any one SEQ ID NOs: 1 and 2. In some embodiments, the composition comprises a second nucleotide sequence comprising a nucleotide sequence of any one of SEQ ID NOs: 51-74. In some embodiments, the composition comprises a sense strand comprising a nucleotide sequence of any one of SEQ ID NOs: 1 and 2. In some embodiments, the composition comprises an antisense strand comprising a nucleotide sequence of any one of SEQ ID NOs: 51-74.

    [0223] Alternatively, the compositions may comprise (a) a phosphorylation blocker; and (b) a short interfering nucleic acid (siNA). In some embodiments, the phosphorylation blocker is any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA is any of the siNAs disclosed herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucleotide sequences, or second nucleotide sequences described herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucleotide sequences, or second nucleotide sequences described herein. In some embodiments, the siNA comprises one or more modified nucleotides. In some embodiments, the one or more modified nucleotides are independently selected from a 2′-fluoro nucleotide and a 2′-O-methyl nucleotide. In some embodiments, the 2′-fluoro nucleotide or the 2′-O-methyl nucleotide is independently selected from any of the 2′-fluoro or 2′-O-methyl nucleotide mimics disclosed herein. In some embodiments, the siNA comprises a nucleotide sequence comprising any of the modification patterns disclosed herein.

    [0224] In some embodiments, the composition comprises (a) a conjugated moiety; and (b) a short interfering nucleic acid (siNA). In some embodiments, the conjugated moiety is any of the galactosamines disclosed herein. In some embodiments, the siNA is any of the siNAs disclosed herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucleotide sequences, or second nucleotide sequences described herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucleotide sequences, or second nucleotide sequences described herein. In some embodiments, the siNA comprises one or more modified nucleotides. In some embodiments, the one or more modified nucleotides are independently selected from a 2′-fluoro nucleotide and a 2′-O-methyl nucleotide. In some embodiments, the 2′-fluoro nucleotide or the 2′-O-methyl nucleotide is independently selected from any of the 2′-fluoro or 2′-O-methyl nucleotide mimics disclosed herein. In some embodiments, the siNA comprises a nucleotide sequence comprising any of the modification patterns disclosed herein.

    [0225] In some embodiments, the composition comprises (a) a 5′-stabilized end cap; and (b) a short interfering nucleic acid (siNA). In some embodiments, the 5′-stabilized end cap is any of the 5-stabilized end caps disclosed herein. In some embodiments, the siNA is any of the siNAs disclosed herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucleotide sequences, or second nucleotide sequences described herein. In some embodiments, the siNA comprises one or more modified nucleotides. In some embodiments, the one or more modified nucleotides are independently selected from a 2′-fluoro nucleotide and a 2′-O-methyl nucleotide. In some embodiments, the 2′-fluoro nucleotide or the 2′-O-methyl nucleotide is independently selected from any of the 2′-fluoro or 2′-O-methyl nucleotide mimics disclosed herein. In some embodiments, the siNA comprises a nucleotide sequence comprising any of the modification patterns disclosed herein.

    [0226] In some embodiments, the composition comprises (a) at least one phosphorylation blocker, conjugated moiety, or 5′-stabilized end cap; and (b) a short interfering nucleic acid (siNA). In some embodiments, the phosphorylation blocker is any of the phosphorylation blockers disclosed herein. In some embodiments, the conjugated moiety is any of the galactosamines disclosed herein. In some embodiments, the 5′-stabilized end cap is any of the 5-stabilized end caps disclosed herein. In some embodiments, the siNA is any of the siNAs disclosed herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucleotide sequences, or second nucleotide sequences described herein. In some embodiments, the siNA comprises one or more modified nucleotides. In some embodiments, the one or more modified nucleotides are independently selected from a 2′-fluoro nucleotide and a 2′-O-methyl nucleotide. In some embodiments, the 2′-fluoro nucleotide or the 2′-O-methyl nucleotide is independently selected from any of the 2′-fluoro or 2′-O-methyl nucleotide mimics disclosed herein. In some embodiments, the siNA comprises a nucleotide sequence comprising any of the modification patterns disclosed herein.

    [0227] The composition may be a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises an amount of one or more of the siNA molecules described herein formulated with one or more pharmaceutically acceptable carriers (additives) and/or diluents. The pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; or (8) nasally.

    [0228] The phrase “therapeutically-effective amount” as used herein means that amount of a compound, material, or composition comprising a siNA of the present disclosure which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal at a reasonable benefit/risk ratio applicable to any medical treatment.

    [0229] The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

    [0230] Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

    [0231] Examples of pharmaceutically-acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

    [0232] Formulations of the present disclosure include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound (e.g., siNA molecule) which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.1 percent to about ninety-nine percent of active ingredient, preferably from about 5 percent to about 70 percent, most preferably from about 10 percent to about 30 percent.

    [0233] In certain embodiments, a formulation of the present disclosure comprises an excipient selected from the group consisting of cyclodextrins, celluloses, liposomes, micelle forming agents, e.g., bile acids, and polymeric carriers, e.g., polyesters and polyanhydrides; and a compound (e.g., siNA molecule) of the present disclosure. In certain embodiments, an aforementioned formulation renders orally bioavailable a compound (e.g., siNA molecule) of the present disclosure.

    [0234] Methods of preparing these formulations or compositions include the step of bringing into association a compound (e.g., siNA molecule) of the present disclosure with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a compound (e.g., siNA molecule) of the present disclosure with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

    [0235] Formulations of the disclosure suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a compound (e.g., siNA molecule) of the present disclosure as an active ingredient. A compound (e.g., siNA molecule) of the present disclosure may also be administered as a bolus, electuary or paste.

    [0236] In solid dosage forms of the disclosure for oral administration (capsules, tablets, pills, dragees, powders, granules, trouches and the like), the active ingredient is mixed with one or more pharmaceutically-acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds and surfactants, such as poloxamer and sodium lauryl sulfate; (7) wetting agents, such as, for example, cetyl alcohol, glycerol monostearate, and non-ionic surfactants; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid, and mixtures thereof; (10) coloring agents; and (11) controlled release agents such as crospovidone or ethyl cellulose.

    [0237] In the case of capsules, tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-shelled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.

    [0238] A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.

    [0239] The tablets, and other solid dosage forms of the pharmaceutical compositions of the present disclosure, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be formulated for rapid release, e.g., freeze-dried.

    [0240] They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.

    [0241] Liquid dosage forms for oral administration of the compounds (e.g., siNA molecules) of the disclosure include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (I particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.

    [0242] Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.

    [0243] Suspensions, in addition to the active compounds (e.g., siNA molecules), may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.

    [0244] Formulations of the pharmaceutical compositions of the disclosure for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more compounds (e.g., siNA molecules) of the disclosure with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound (e.g., siNA molecule).

    [0245] Formulations of the present disclosure which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.

    [0246] Dosage forms for the topical or transdermal administration of a compound (e.g., siNA molecule) of this disclosure include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound (e.g., siNA molecule) may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.

    [0247] The ointments, pastes, creams and gels may contain, in addition to an active compound (e.g., siNA molecule) of this disclosure, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.

    [0248] Powders and sprays can contain, in addition to a compound (e.g., siNA molecule) of this disclosure, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.

    [0249] Transdermal patches have the added advantage of providing controlled delivery of a compound (e.g., siNA molecule) of the present disclosure to the body. Such dosage forms can be made by dissolving or dispersing the compound (e.g., siNA molecule) in the proper medium. Absorption enhancers can also be used to increase the flux of the compound (e.g., siNA molecule) across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the compound (e.g., siNA molecule) in a polymer matrix or gel.

    [0250] Ophthalmic formulations, eye ointments, powders, solutions and the like, are also contemplated as being within the scope of this disclosure.

    [0251] Pharmaceutical compositions of this disclosure suitable for parenteral administration comprise one or more compounds (e.g., siNA molecules) of the disclosure in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.

    [0252] Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

    [0253] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms upon the subject compounds may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.

    [0254] In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally-administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.

    [0255] Injectable depot forms are made by forming microencapsule matrices of the subject compounds (e.g., siNA molecules) in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.

    [0256] When the compounds (e.g., siNA molecules) of the present disclosure are administered as pharmaceuticals, to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99% (more preferably, 10 to 30%) of active ingredient in combination with a pharmaceutically acceptable carrier.

    Treatments and Administration

    [0257] The siNA molecules of the present disclosure may be used to treat a disease in a subject in need thereof. In some embodiments, a method of treating a disease in a subject in need thereof comprises administering to the subject any of the siNA molecules disclosed herein. In some embodiments, a method of treating a disease in a subject in need thereof comprises administering to the subject any of the compositions disclosed herein.

    [0258] The preparations (e.g., siNA molecules or compositions) of the present disclosure may be given orally, parenterally, topically, or rectally. They are of course given in forms suitable for each administration route. For example, they are administered in tablets or capsule form, administration by injection, infusion or inhalation; topical by lotion or ointment; and rectal by suppositories. Oral administrations are preferred.

    [0259] The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.

    [0260] The phrases “systemic administration,” “administered systemically,” “peripheral administration” and “administered peripherally” as used herein mean the administration of a compound, drug or other material other than directly into the central nervous system, such that it enters the patient's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.

    [0261] These compounds may be administered to humans and other animals for therapy by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intracisternally and topically, as by powders, ointments or drops, including buccally and sublingually.

    [0262] Regardless of the route of administration selected, the compounds (e.g., siNA molecules) of the present disclosure, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present disclosure, are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of skill in the art.

    [0263] Actual dosage levels of the active ingredients in the pharmaceutical compositions of this disclosure may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

    [0264] The selected dosage level will depend upon a variety of factors including the activity of the particular compound (e.g., siNA molecule) of the present disclosure employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the rate and extent of absorption, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

    [0265] A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds (e.g., siNA molecules) of the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

    [0266] In general, a suitable daily dose of a compound (e.g., siNA molecule) of the disclosure is the amount of the compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose generally depends upon the factors described above. Preferably, the compounds are administered at about 0.01 mg/kg to about 200 mg/kg, more preferably at about 0.1 mg/kg to about 100 mg/kg, even more preferably at about 0.5 mg/kg to about 50 mg/kg. In some embodiments, the compound is administered at a dose equal to or greater than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, or 1 mg/kg. In some embodiments, the compound is administered at a dose equal to or less than 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, or 15 mg/kg. In some embodiments, the total daily dose of the compound is equal to or greater than 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 100 mg.

    [0267] When the compounds (e.g., siNA molecules) described herein are co-administered with another, the effective amount may be less than when the compound is used alone.

    [0268] If desired, the effective daily dose of the active compound (e.g., siNA molecule) may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. Preferred dosing is one administration per day. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times a week. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times a month. In some embodiments, the compound is administered once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days. In some embodiments, the compound is administered once every 1, 2, 3, 4, 5, 6, 7, or 8 weeks.

    Diseases

    [0269] The siNA molecules and compositions described herein may be administered to a subject to treat a disease. Further disclosed herein are uses of any of the siNA molecules or compositions disclosed herein in the manufacture of a medicament for treating a disease.

    [0270] In some embodiments, the disease is a viral disease. In some embodiments, the viral disease is caused by a DNA virus. In some embodiments, the DNA virus is a double stranded DNA (dsDNA virus). In some embodiments, the dsDNA virus is a hepadnavirus. In some embodiments, the hepadnavirus is a hepatitis B virus (HBV).

    [0271] In some embodiments, the disease is a liver disease. In some embodiments, the liver disease is nonalcoholic fatty liver disease (NAFLD). In some embodiments, the NAFLD is nonalcoholic steatohepatitis (NASH). In some embodiments, the liver disease is hepatocellular carcinoma (HCC).

    [0272] The siNA molecules of the present disclosure may be used to treat or prevent a disease in a subject in need thereof. In some embodiments, a method of treating or preventing a disease in a subject in need thereof comprises administering to the subject any of the siNA molecules disclosed herein. In some embodiments, a method of treating or preventing a disease in a subject in need thereof comprises administering to the subject any of the compositions disclosed herein.

    [0273] In some embodiments of the disclosed methods and uses, the disease is a respiratory disease. In some embodiments, the respiratory disease is a viral infection. In some embodiments, the respiratory disease is viral pneumonia. In some embodiments, the respiratory disease is an acute respiratory infection. In some embodiments, the respiratory disease is a cold. In some embodiments, the respiratory disease is severe acute respiratory syndrome (SARS). In some embodiments, the respiratory disease is Middle East respiratory syndrome (MERS). In some embodiments, the disease is coronavirus disease 2019 (e.g., COVID-19). In some embodiments, the respiratory disease can include one or more symptoms selected from coughing, sore throat, runny nose, sneezing, headache, fever, shortness of breath, myalgia, abdominal pain, fatigue, difficulty breathing, persistent chest pain or pressure, difficulty waking, loss of smell and taste, muscle or joint pain, chills, nausea or vomiting, nasal congestion, diarrhea, haemoptysis, conjunctival congestion, sputum production, chest tightness, and palpitations. In some embodiments, the respiratory disease can include complications selected from sinusitis, otitis media, pneumonia, acute respiratory distress syndrome, disseminated intravascular coagulation, pericarditis, and kidney failure. In some embodiments, the respiratory disease is idiopathic.

    [0274] In some embodiments, the present disclosure provides methods of treating or preventing a coronavirus infection, comprising administering to a subject in need thereof a therapeutically effective amount of one or more of the siNAs or a pharmaceutical composition as disclosed herein. In some embodiments, the coronavirus infection is selected from the group consisting of Middle East Respiratory Syndrome (MERS), Severe Acute Respiratory Syndrome (SARS), and COVID-19. In some embodiments, the subject has been treated with one or more additional coronavirus treatment agents. In some embodiments, the subject is concurrently treated with one or more additional coronavirus treatment agents.

    Administration of siNA

    [0275] Administration of any of the siNAs disclosed herein may be conducted by methods known in the art. In some embodiments, the siNA is administered by subcutaneous (SC) or intravenous (IV) delivery. The preparations (e.g., siNAs or compositions) of the present disclosure may be given orally, parenterally, topically, or rectally. They are of course given in forms suitable for each administration route. For example, they are administered in tablets or capsule form, administration by injection, infusion or inhalation; topical by lotion or ointment; and rectal by suppositories. In some embodiments, subcutaneous administration is preferred.

    [0276] The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.

    [0277] The phrases “systemic administration,” “administered systemically,” “peripheral administration” and “administered peripherally” as used herein mean the administration of a compound, drug or other material other than directly into the central nervous system, such that it enters the patient's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.

    [0278] These compounds may be administered to humans and other animals for therapy by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intracisternally and topically, as by powders, ointments or drops, including buccally and sublingually.

    [0279] Regardless of the route of administration selected, the compounds (e.g., siNAs) of the present disclosure, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present disclosure, are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of skill in the art.

    [0280] Actual dosage levels of the active ingredients in the pharmaceutical compositions of this disclosure may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

    [0281] The selected dosage level will depend upon a variety of factors including the activity of the particular compound (e.g., siNA) of the present disclosure employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the rate and extent of absorption, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

    [0282] A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds (e.g., siNAs) of the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

    [0283] In general, a suitable daily dose of a compound (e.g., siNA) of the disclosure is the amount of the compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose generally depends upon the factors described above. Preferably, the compounds are administered at about 0.01 mg/kg to about 200 mg/kg, more preferably at about 0.1 mg/kg to about 100 mg/kg, even more preferably at about 0.5 mg/kg to about 50 mg/kg. In some embodiments, the compound is administered at about 1 mg/kg to about 40 mg/kg, about 1 mg/kg to about 30 mg/kg, about 1 mg/kg to about 20 mg/kg, about 1 mg/kg to about 15 mg/kg, or 1 mg/kg to about 10 mg/kg. In some embodiments, the compound is administered at a dose equal to or greater than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, or 1 mg/kg. In some embodiments, the compound is administered at a dose equal to or greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 mg/kg. In some embodiments, the compound is administered at a dose equal to or less than 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, or 15 mg/kg. In some embodiments, the total daily dose of the compound is equal to or greater than 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 100 mg.

    [0284] If desired, the effective daily dose of the active compound (e.g., siNA) may be administered as two, three, four, five, six, seven, eight, nine, ten or more doses or sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 times. Preferred dosing is one administration per day. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times a week. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times a month. In some embodiments, the compound is administered once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days. In some embodiments, the compound is administered every 3 days. In some embodiments, the compound is administered once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks. In some embodiments, the compound is administered every month. In some embodiments, the compound is administered once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 months. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 times over a period of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 days. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 times over a period of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 weeks. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 times over a period of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 months. In some embodiments, the compound is administered at least once a week for a period of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 weeks. In some embodiments, the compound is administered at least once a week for a period of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 months. In some embodiments, the compound is administered at least twice a week for a period of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 weeks. In some embodiments, the compound is administered at least twice a week for a period of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 months. In some embodiments, the compound is administered at least once every two weeks for a period of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 weeks. In some embodiments, the compound is administered at least once every two weeks for a period of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 months. In some embodiments, the compound is administered at least once every four weeks for a period of at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 weeks. In some embodiments, the compound is administered at least once every four weeks for a period of at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 months.

    [0285] In some embodiments, any one of the siNAs or compositions disclosed herein is administered in a particle or viral vector. In some embodiments, the viral vector is a vector of adenovirus, adeno-associated virus (AAV), alphavirus, flavivirus, herpes simplex virus, lentivirus, measles virus, picornavirus, poxvirus, retrovirus, or rhabdovirus. In some embodiments, the viral vector is a recombinant viral vector. In some embodiments, the viral vector is selected from AAVrh.74, AAVrh.10, AAVrh.20, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12 and AAV-13.

    [0286] The subject of the described methods may be a mammal, and it includes humans and non-human mammals. In some embodiments, the subject is a human, such as an adult human.

    [0287] Some embodiments include a method for treating an HBV virus in a subject infected with the virus comprising administering a therapeutically effective amount of one or more siNA of the present disclosure or a composition of the present disclosure to the subject in need thereof thereby reducing the viral load of the virus in the subject and/or reducing a level of a virus antigen in the subject. The siNA may be complementary or hybridize to a portion of the target RNA in the virus, e.g., an X region and/or an S region of HBV.

    Combination Therapies

    [0288] Any of the methods disclosed herein may further comprise administering to the subject an additional HBV treatment agent. Any of the compositions disclosed herein may further comprise an additional HBV treatment agent. In some embodiments, the additional HBV treatment agent is selected from a nucleotide analog, nucleoside analog, a capsid assembly modulator (CAM), a recombinant interferon, an entry inhibitor, a small molecule immunomodulator and oligonucleotide therapy. In some embodiments, the additional HBV treatment agent is selected from HBV STOPS™ ALG-010133, HBV CAM ALG-000184, ASO 1 (SEQ ID NO: 61), ASO 2 (SEQ ID NO: 62) recombinant interferon alpha 2b, IFN-a, PEG-IFN-a-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, NVR3-778, BAY41-4109, JNJ-632, JNJ-3989 (ARO-HBV), RG6004, GSK3228836, REP-2139, REP-2165, AB-729, VIR-2218, RG6346 (DCR-HBVS), JNJ-6379, GLS4, ABI-HO731, JNJ-440, NZ-4, RG7907, EDP-514, AB-423, AB-506, ABI-H03733 and ABI-H2158. In some embodiments, the oligonucleotide therapy is selected from Nucleic Acid Polymers or S-Antigen Transport-inhibiting Oligonucleotide Polymers (NAPs or STOPS), siRNA, and ASO. In some embodiments, the oligonucleotide therapy is an additional siNA. In some embodiments, the additional siNA is selected from any of ds-siNA-001 to ds-siNA-025. In some embodiments, the oligonucleotide therapy is an antisense oligonucleotide (ASO). In some embodiments, the ASO is ASO 1 (SEQ ID NO: 61) or ASO 2 (SEQ ID NO: 62). In some embodiments, any of the siNAs disclosed herein are co-administered with STOPS. Exemplary STOPS are described in International Publication No. WO2020/097342 and U.S. Publication No. 2020/0147124, both of which are incorporated by reference in their entirety. In some embodiments, the STOPS is ALG-010133. In some embodiments, any of the siNAs disclosed herein are co-administered with tenofovir. In some embodiments, any of the siNAs disclosed herein are co-administered with a CAM. Exemplary CAMs are described in Berke et al., Antimicrob Agents Chemother, 2017, 61(8):e00560-17, Klumpp, et al., Gastroenterology, 2018, 154(3):652-662.e8, International Application Nos. PCT/US2020/017974, PCT/US2020/026116, and PCT/US2020/028349 and U.S. application Ser. Nos. 16/789,298, 16/837,515, and 16/849,851, each which is incorporated by reference in its entirety. In some embodiments, the CAM is ALG-000184, ALG-001075, ALG-001024, JNJ-632, BAY41-4109, or NVR3-778. In some embodiments, the siNA and the HBV treatment agent are administered simultaneously. In some embodiments, the siNA and the HBV treatment agent are administered concurrently. In some embodiments, the siNA and the HBV treatment agent are administered sequentially. In some embodiments, the siNA is administered prior to administering the HBV treatment agent. In some embodiments, the siNA is administered after administering the HBV treatment agent. In some embodiments, the siNA and the HBV treatment agent are in separate containers. In some embodiments, the siNA and the HBV treatment agent are in the same container.

    [0289] Any of the methods disclosed herein may further comprise administering to the subject a liver disease treatment agent. Any of the compositions disclosed herein may further comprise a liver disease treatment agent. In some embodiments, the liver disease treatment agent is selected from a peroxisome proliferator-activator receptor (PPAR) agonist, farnesoid X receptor (FXR) agonist, lipid-altering agent, and incretin-based therapy. In some embodiments, the PPAR agonist is selected from a PPARα agonist, dual PPARα/δ agonist, PPARγ agonist, and dual PPARα/γ agonist. In some embodiments, the dual PPARα agonist is a fibrate. In some embodiments, the PPARα/δ agonist is elafibranor. In some embodiments, the PPARγ agonist is a thiazolidinedione (TZD). In some embodiments, TZD is pioglitazone. In some embodiments, the dual PPARα/γ agonist is saroglitazar. In some embodiments, the FXR agonist is obeticholic acis (OCA). In some embodiments, the lipid-altering agent is aramchol. In some embodiments, the incretin-based therapy is a glucagon-like peptide 1 (GLP-1) receptor agonist or dipeptidyl peptidase 4 (DPP-4) inhibitor. In some embodiments, the GLP-1 receptor agonist is exenatide or liraglutide. In some embodiments, the DPP-4 inhibitor is sitagliptin or vildapliptin. In some embodiments, the siNA and the liver disease treatment agent are administered concurrently. In some embodiments, the siNA and the liver disease treatment agent are administered sequentially. In some embodiments, the siNA is administered prior to administering the liver disease treatment agent. In some embodiments, the siNA is administered after administering the liver disease treatment agent. In some embodiments, the siNA and the liver disease treatment agent are in separate containers. In some embodiments, the siNA and the liver disease treatment agent are in the same container.

    Definitions

    [0290] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this disclosure belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al., (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure.

    [0291] The terms “a” and “an” as used herein mean “one or more” and include the plural unless the context is inappropriate.

    [0292] As used herein, the terms “patient” and “subject” refer to organisms to be treated by the methods of the present disclosure. Such organisms are preferably mammals (e.g., marines, simians, equines, bovines, porcinis, canines, felines, and the like), and more preferably humans.

    [0293] As used herein, the term “effective amount” refers to the amount of a compound (e.g., a siNA of the present disclosure) sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications, or dosages and is not intended to be limited to a particular formulation or administration route.

    [0294] As used herein, the term “treating” includes any effect, e.g., lessening, reducing, modulating, ameliorating or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof.

    [0295] As used herein, the terms “alleviate” and “alleviating” refer to reducing the severity of the condition, such as reducing the severity by, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

    [0296] As used herein, the term “pharmaceutical composition” refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vivo or ex vivo.

    [0297] As used herein, the term “pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions (e.g., such as an oil/water or water/oil emulsions), and various types of wetting agents. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see, for example, Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, Pa. [1975].

    [0298] The term “about” as used herein when referring to a measurable value (e.g., weight, time, and dose) is meant to encompass variations, such as ±10%, 5%, +1%, or ±0.1% of the specified value.

    [0299] As used herein, the term “nucleobase” refers to a nitrogen-containing biological compound that forms a nucleoside. Examples of nucleobases include, but are not limited to, thymine, uracil, adenine, cytosine, guanine, and an analogue or derivative thereof.

    [0300] Throughout the description, where compositions are described as having, including, or comprising specific components, or where processes and methods are described as having, including, or comprising specific steps, it is contemplated that, additionally, there are compositions of the present disclosure that consist essentially of, or consist of, the recited components, and that there are processes and methods according to the present disclosure that consist essentially of, or consist of, the recited processing steps.

    [0301] As a general matter, compositions specifying a percentage are by weight unless otherwise specified. Further, if a variable is not accompanied by a definition, then the previous definition of the variable controls.

    [0302] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided may be different from the actual publication dates that may need to be independently confirmed.

    EXAMPLES

    Example 1: siNA Synthesis

    [0303] This example describes an exemplary method for synthesizing ds-siNAs, such as the siNAs disclosed in Tables 1-5 (as identified by the ds-siNA ID).

    [0304] The 2′-O-Me phosphoramidite 5′-O-DMT-deoxy Adenosine (NH-Bz), 3′-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite, 5′-O-DMT-deoxy Guanosine (NH-ibu), 3′-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite, 5′-O-DMT-deoxy Cytosine (NH-Bz), 3′-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite, 5′-O-DMT-Uridine 3′-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite and solid supports were purchased from Chemgenes Corp. MA.

    ##STR00202##

    [0305] The 2′-F-5′-O-DMT-(NH-Bz) Adenosine-3′-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite, 2′-F-5′-O-DMT-(NH-ibu)-Guanosine, 3′-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite, 5′-O-DMT-(NH-Bz)-Cytosine, 2′-F-3′-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite, 5′-O-DMT-Uridine, 2′-F-3′-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite and solid supports were purchased from Thermo Fischer Milwaukee Wis., USA.

    ##STR00203##

    [0306] All the monomers were dried in vacuum desiccator with desiccants (P.sub.2O.sub.5, RT 24h). The solid supports (CPG) attached to the nucleosides and universal supports was obtained from LGC and Chemgenes. The chemicals and solvents for post synthesis workflow were purchased from commercially available sources like VWR/Sigma and used without any purification or treatment. Solvent (Acetonitrile) and solutions (amidite and activator) were stored over molecular sieves during synthesis.

    [0307] The oligonucleotides were synthesized on a DNA/RNA Synthesizers (Expedite 8909 or ABI-394 or MM-48) using standard oligonucleotide phosphoramidite chemistry starting from the 3′ residue of the oligonucleotide preloaded on CPG support. An extended coupling of 0.1M solution of phosphoramidite in CH.sub.3CN in the presence of 5-(ethylthio)-1H-tetrazole activator to a solid bound oligonucleotide followed by standard capping, oxidation and deprotection afforded modified oligonucleotides. The 0.1M 12, THF:Pyridine; Water-7:2:1 was used as oxidizing agent while DDTT ((dimethylamino-methylidene) amino)-3H-1,2,4-dithiazaoline-3-thione was used as the sulfur-transfer agent for the synthesis of oligoribonucleotide phosphorothioates. The stepwise coupling efficiency of all modified phosphoramidites was more than 98%.

    TABLE-US-00008 Reagents Detailed Description Deblock Solution 3% Dichloroacetic acid (DCA) in Dichloromethane (DCM) Amidite Concentration 0.1M in Anhydrous Acetonitrile Activator 0.25M Ethyl-thio-Tetrazole (ETT) Cap-A solution Acetic anhydride in pyridine/THF Cap-B Solution 16% 1-Methylimidazole in THF Oxidizing Solution 0.02M I.sub.2, THF:pyridine; water-7:2:l Sulfurizing Solution 0.2M DDTT in pyridine/acetonitrile 1:1

    [0308] Cleavage and Deprotection:

    [0309] Deprotection and cleavage from the solid support was achieved with mixture of ammonia methylamine (1:1, AMA) for 15 min at 65° C. When the universal linker was used, the deprotection was left for 90 min at 65° C. or solid supports were heated with aqueous ammonia (28%) solution at 55° C. for 8-16 h to deprotect the base labile protecting groups.

    [0310] Quantitation of Crude siNA or Raw Analysis

    [0311] Samples were dissolved in deionized water (1.0 mL) and quantitated as follows: Blanking was first performed with water alone (2 ul) on Thermo Scientific™ Nanodrop UV spectrophotometer or BioTek™ Epoch™ plate reader then Oligo sample reading was obtained at 260 nm. The crude material is dried down and stored at −20° C.

    [0312] Crude HPLC/LC-MS Analysis

    [0313] The 0.1 OD of the crude samples were analyzed for crude HPLC and LC-MS analysis. After Confirming the crude LC-MS data then purification step was performed if needed based on the purity.

    [0314] HPLC Purification

    [0315] The unconjugated and GalNac modified oligonucleotides were purified by anion-exchange HPLC. The buffers were 20 mM sodium phosphate in 10% CH.sub.3CN, pH 8.5 (buffer A) and 20 mM sodium phosphate in 10% CH.sub.3CN, 1.0 M NaBr, pH 8.5 (buffer B). Fractions containing full-length oligonucleotides were pooled.

    [0316] Desalting of Purified SiNA

    [0317] The purified dry siNA was then desalted using Sephadex G-25 M (Amersham Biosciences). The cartridge was conditioned with 10 mL of deionized water thrice. Finally, the purified siNA dissolved thoroughly in 2.5 mL RNAse free water was applied to the cartridge with very slow drop wise elution. The salt free siNA was eluted with 3.5 ml deionized water directly into a screw cap vial. Alternatively, some unconjugated siNA was deslated using Pall AcroPrep™ 3K MWCO desalting plates.

    [0318] IEX HPLC and Electrospray LC/MS Analysis

    [0319] Approximately 0.10 OD of siNA is dissolved in water and then pipetted into HPLC autosampler vials for IEX-HPLC and LC/MS analysis. Analytical HPLC and ES LC-MS confirmed the identity and purity of the compounds.

    [0320] Duplex Preparation:

    [0321] Single strand oligonucleotides (Sense and Antisense strands) were annealed (1:1 by molar equivalents, heat at 90° C. for 2 min followed by gradual cooling at room temperature) to give the duplex ds-siNA. The final compounds were analyzed on size exclusion chromatography (SEC).

    Example 2

    [0322] ##STR00204## ##STR00205##

    Preparation of PH-ALIG-14-1-1

    [0323] Into a 5000-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of argon, was placed uridine (150.00 g, 614.24 mmol, 1.00 eq), pyridine (2.2 L), TBDPSCI (177.27 g, 644.95 mmol, 1.05 eq). The resulting solution was stirred overnight at room temperature. The resulting mixture was concentrated. The resulting solution was extracted with 3×1000 mL of dichloromethane and the organic layers combined. The resulting mixture was washed with 3×1 L of 0.5N HCl(aq.) and 2×500 mL of 0.5N NaHCO.sub.3 (aq.). The resulting mixture was washed with 2×1 L of H.sub.2O. The mixture was dried over anhydrous sodium sulfate. The solids were filtered out. The filtrate was concentrated. This resulted in 262 g (crude) PH-ALIG-14-1-1. LC-MS (m/z) 483.00 [M+H].sup.+; 1 H NMR (400 MHz, DMSO-d.sub.6) δ 11.35 (d, J=2.2 Hz, 1H), 7.70 (d, J=8.1 Hz, 1H), 7.64 (m, 4H), 7.52-7.40 (m, 6H), 5.80 (d, J=4.1 Hz, 1H), 5.50 (d, J=5.1 Hz, 1H), 5.28 (dd, J=8.0, 2.2 Hz, 1H), 5.17 (d, J=5.3 Hz, 1H), 4.15-4.05 (m, 2H), 4.00-3.85 (m, 2H), 3.85-3.73 (m, 1H), 1.03 (s, 9H).

    Preparation of PH-ALIG-14-1-2

    [0324] Into a 10 L 3-necked round-bottom flask purged and maintained with an inert atmosphere of argon, was placed a solution of PH-ALIG-14-1-1 (260.00 g, 538.7 mmol, 1.0 eq.) in MeOH (5000 mL). This was followed by the addition of a solution of NaIO.sub.4 (126.8 g, 592.6 mmol, 1.1 eq.) in H.sub.2O (1600 mL) in several batches at 0° C. The resulting solution was stirred for 1 hr at room temperature. The reaction was then quenched by the addition of 3 L of Na.sub.2S.sub.2O.sub.3(sat.) at 0° C. The resulting solution was extracted with 3×1 L of dichloromethane and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out. The filtrate was concentrated. This resulted in 290 g (crude) of PH-ALIG-14-1-2 as a white solid.

    Preparation of PH-ALIG-14-1-3

    [0325] Into a 5 L 3-necked round-bottom flask purged and maintained with an inert atmosphere of argon, was placed PH-ALIG-14-1-2 (290 g, 603.4 mmol, 1.0 eq), EtOH (3 L). This was followed by the addition of NaBH.sub.4 (22.8 g, 603.4 mmol, 1.0 eq), in portions at 0° C. The resulting solution was stirred for 1 hr at room temperature. The reaction was then quenched by the addition of 2000 mL of water/ice. The resulting solution was extracted with 3×1000 mL of dichloromethane and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out. The filtrate was concentrated. This resulted in 230 g (crude) of PH-ALIG-14-1-3 as a white solid. LC-MS: m/z 485.10 [M+H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.28 (d, J=2.2 Hz, 1H), 7.63-7.37 (m, 11H), 5.84 (dd, J=6.4, 4.9 Hz, 1H), 5.44 (dd, J=8.0, 2.2 Hz, 1H), 5.11 (t, J=6.0 Hz, 1H), 4.78 (t, J=5.2 Hz, 1H), 3.65 (dd, J=11.4, 5.7 Hz, 1H), 3.60-3.52 (m, 5H), 3.18 (d, J=5.2 Hz, 1H), 0.96 (s, 9H).

    Preparation of PH-ALIG-14-1-4

    [0326] Into a 5000-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of argon, was placed a solution of PH-ALG-14-1-3 (120 g, 1 eq) in DCM (1200 mL). This was followed by the addition of DIEA (95.03 g, 3 eq) at 0 degrees C. To this was added methanesulfonic anhydride (129 g, 3 eq), in portions at 0° C. The resulting solution was stirred for 1 hr at room temperature. The reaction was then quenched by the addition of 1000 mL of water/ice. The resulting solution was extracted with 3×500 mL of dichloromethane and the organic layers combined and dried over anhydrous magnesium sulfate. The solids were filtered out. The filtrate was concentrated. This resulted in 160 g (crude) of PH-ALG-14-1-4 as a yellow solid; LC-MS (m/z) 641.05[M+H].sup.+

    Preparation of PH-ALIG-14-1-5

    [0327] Into a 1 L round-bottom flask, was placed a solution of PH-ALG-14-1-4 (160.00 g, 1.00 equiv) in THF (1600 mL), DBU (108 g, 2.8 equiv). The resulting solution was stirred for 1 hr at 30° C. The reaction was then quenched by the addition of 3000 mL of water/ice. The resulting solution was extracted with 3×500 mL of dichloromethane and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out. The filtrate was concentrated. This resulted in 150 g (crude) of PH-ALG-14-1-5 as brown oil; LC-MS: (ES, m/z): 567.25[M+H].sup.+

    [0328] .sup.1HNMR (400 MHz, DMSO-d.sub.6) δ 7.83 (d, J=7.4 Hz, 1H), 7.67-7.55 (m, 4H), 7.55-7.35 (m, 6H), 6.05 (dd, J=5.9, 1.7 Hz, 1H), 5.72 (d, J=7.4 Hz, 1H), 4.81 (dd, J=10.4, 5.8 Hz, 1H), 4.58-4.46 (m, 2H), 4.42 (p, J=5.2, 4.6 Hz, 1H), 4.33 (dd, J=10.6, 5.9 Hz, 1H), 3.79-3.70 (m, 2H), 3.23 (s, 3H), 0.98 (s, 9H).

    Preparation of PH-ALIG-14-1-6

    [0329] Into a 3000-mL round-bottom flask purged and maintained with an inert atmosphere of argon, was placed PH-ALIG-14-1-5 (150.00 g, 201.950 mmol, 1. eq), DMF (1300.00 mL), potassium benzoate (44.00 g, 1.0 eq). The resulting solution was stirred for 1.5 hr at 80° C. The reaction was then quenched by the addition of 500 mL of water/ice. The resulting solution was extracted with 3×500 mL of dichloromethane The resulting mixture was washed with 3×1000 ml of H.sub.2O. The resulting mixture was concentrated. The residue was applied onto a silica gel column with EA/PE (99:1). The collected fractions were combined and concentrated. This resulted in 40 g of PH-ALIG-14-1-6 as yellow oil. LC-MS: m/z 571.20 [M+H].sup.+;

    [0330] 1HNMR: (400 MHz, DMSO-d.sub.6) δ 7.97-7.91 (m, 2H), 7.89 (d, J=7.4 Hz, 1H), 7.74-7.51 (m, 7H), 7.51-7.31 (m, 6H), 6.16 (m, 1H), 5.76 (d, J=7.4 Hz, 1H), 4.78 (m, 1H), 4.61 (m, 1H), 4.55-4.46 (m, 2H), 4.38 (m, 1H), 3.82 (d, J=5.0 Hz, 2H), 0.97 (s, 9H)

    Preparation of PH-ALIG-14-1-7 A

    [0331] Into a 2-L round-bottom flask, was placed PH-ALIG-14-1-6 (30.00 g, 1 eq), MeOH (1.20 L), p-toluenesulfonic acid (4.50 g, 0.5 eq). The resulting solution was stirred for 2 hr at 70° C. The reaction was then quenched by the addition of 3 L of NaHCO.sub.3(sat.). The pH value of the solution was adjusted to 7 with NaHCO.sub.3(sat.). The resulting solution was extracted with 3×1 L of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out. The filtrate was concentrated under vacuum. The crude product was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, silica gel; mobile phase, PE/EA=50/50 increasing to PE/EA=25/75 within 30; Detector, 254. This resulted in 11.5 g (3.1% yield in seven steps) PH-ALIG-14-1-7 A as a white solid. LC-MS: m/z 625.15[M+Na].sup.+; .sup.1HNMR: (400 MHz, DMSO-d.sub.6) δ 11.37 (d, J=2.3 Hz, 1H), 7.99-7.93 (m, 2H), 7.74-7.65 (m, 1H), 7.63-7.50 (m, 7H), 7.50-7.33 (m, 6H), 6.08 (t, J=6.0 Hz, 1H), 5.49 (m, 1H), 4.60 (m, 1H), 4.43 (m, 1H), 4.03-3.96 (m, 1H), 3.70 (d, J=5.3 Hz, 2H), 3.62-3.49 (m, 2H), 3.21 (s, 3H), 0.97 (s, 9H).

    Preparation of PH-ALIG-14-1-7

    [0332] Into a 2-L round-bottom flask, was placed PH-ALIG-14-1-7 A (11.50 g). To the above 7M NH3 (g) in MeOH (690.00 mL) was introduced in at 30° C. The resulting solution was stirred overnight at 30 degrees C. The resulting mixture was concentrated under vacuum. The crude product was purified by Flash with the following conditions (IntelFlash-1): Column, silica gel; mobile phase, PE/EA=60/40 increasing to PE/EA=1/99 within 60; Detector, 254. This resulted in 8.1 g (97% yield) of PH-ALIG-14-1-7 as a white solid. LC-MS-: m/z 499.35 [M+H].sup.+; .sup.1HNMR: (300 MHz, DMSO-d.sub.6) δ 11.31 (s, 1H), 7.64-7.50 (m, 5H), 7.48-7.35 (m, 6H), 6.02 (t, J=5.8 Hz, 1H), 5.45 (d, J=8.0 Hz, 1H), 4.80 (t, J=5.1 Hz, 1H), 3.58 (m, 7H), 3.27 (s, 3H), 0.96 (s, 9H).

    Preparation of PH-ALIG-14-1-8

    [0333] Into a 250-mL round-bottom flask, was placed PH-ALIG-14-1-7 (8.10 g, 1 equiv), pyridine (80.0 mL), DMTr-Cl (7.10 g, 1.3eq). The flask was evacuated and flushed three times with Argon. The resulting solution was stirred for 2 hr at room temperature. The reaction was then quenched by the addition of 500 mL of NaHCO.sub.3(sat.). The resulting solution was extracted with 2×500 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out. The filtrate was concentrated under vacuum. The crude product was purified by Flash with the following conditions (IntelFlash-1): Column, C18; mobile phase, ACN/H.sub.2O=5/95 increasing to ACN/H.sub.2O=95/5 within 30; Detector, 254. This resulted in 11.5 g (88% yield) of PH-ALIG-14-1-8 as a white solid; LC-MS: m/z 823.40 [M+Na].sup.+; 1HNMR: (300 MHz, DMSO-d.sub.6) δ 11.37 (s, 1H), 7.55-7.18 (m, 20H), 6.92-6.83 (m, 4H), 6.14 (t, J=5.9 Hz, 1H), 5.48 (d, J=8.0 Hz, 1H), 3.74 (m, 7H), 3.57 (m, 4H), 3.25 (m, 5H), 0.84 (s, 9H).

    Preparation of PH-ALIG-14-1-9

    [0334] Into a 1000-mL round-bottom flask, was placed PH-ALIG-14-1-8 (11.5 g, 1.00 eq), THF (280.00 mL), TBAF (14.00 mL, 1.00 eq). The resulting solution was stirred for 3 hr at room temperature. The reaction was then quenched by the addition of 1 L of water. The resulting solution was extracted with 3×500 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out. The filtrate was concentrated under vacuum. The crude product was purified by Flash with the following conditions (IntelFlash-1): Column, C18; mobile phase, ACN/H.sub.2O=5/95 increasing to ACN/H.sub.2O=95/5 within 30; Detector, 254. This resulted in 7.8 g (98% yield) of PH-ALIG-14-1-9 as a white solid. LC-MS: m/z 561.20 [M−H].sup.−; .sup.1HNMR: (300 MHz, DMSO-d.sub.6) δ 11.32 (s, 1H), 7.66 (d, J=8.1 Hz, 1H), 7.52-7.39 (m, 2H), 7.39-7.20 (m, 7H), 6.96-6.83 (m, 4H), 6.17 (t, J=5.9 Hz, 1H), 5.63 (d, J=8.0 Hz, 1H), 4.63 (t, J=5.6 Hz, 1H), 3.90-3.46 (m, 9H), 3.26 (s, 5H), 3.19-2.98 (m, 2H).

    Preparation of PH-ALIG-14-1-10

    [0335] Into a 3-L round-bottom flask, was placed PH-ALIG-14-1-9 (7.80 g, 1.00 eq), DCM (300.00 mL), NaHCO.sub.3 (3.50 g, 3 eq). This was followed by the addition of Dess-Martin (7.06 g, 1.2 equiv) with stirring at 0° C., and the resulting solution was stirred for 20 min at 0° C. The resulting solution was stirred for 5 hr at room temperature. The reaction mixture was cooled to 0 degree C. with a water/ice bath. The reaction was then quenched by the addition of 500 mL of NaHCO.sub.3:Na.sub.2S.sub.2O.sub.3=1:1. The resulting solution was extracted with 3×500 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out. The filtrate was concentrated under vacuum. The crude product was purified by Flash with the following conditions (IntelFlash-1): Column, C18; mobile phase, ACN/H.sub.2O=5/95 increasing to ACN/H.sub.2O=95/5 within 30; Detector, 254. This resulted in 5.8 g (75% yield) of PH-ALIG-14-1-10 as a white solid. LC-MS: m/z 558.80 [M−H].sup.−; .sup.1HNMR-: (300 MHz, DMSO-d.sub.6) δ 11.35-11.22 (m, 1H), 9.43 (s, 1H), 7.75 (d, J=8.1 Hz, 1H), 7.49-7.19 (m, 8H), 6.90 (m, 5H), 6.00 (t, J=5.9 Hz, 1H), 5.66 (m, 1H), 4.40 (m, 1H), 3.75 (s, 7H), 3.70-3.56 (m, 3H), 3.29 (d, J=3.7 Hz, 3H).

    Preparation of PH-ALIG-14-1-11

    [0336] Into a 250-mL 3-round-bottom flask, was placed THF (150.00 mL), NaH (1.07 g, 60% w, 3.00 equiv). The flask was evacuated and flushed three times with Argon, and the reaction mixture was cooled to −78° C. This was followed by the addition of [[(bis[[(2,2-dimethylpropanoyl)oxy]methoxy]phosphoryl)methyl([(2,2-dimethylpropanoyl)oxy]methoxy)phosphoryl]oxy]methyl 2,2-dimethylpropanoate (14.60 g, 2.6 eq, in 60 m L THF) dropwise with stirring at −78° C. in 10 min, and the resulting solution was stirred for 30 min at −78° C. This was followed by the addition of PH-ALIG-14-1-10 (5.00 g, 1.00 eq, in 50 mL THF) dropwise with stirring at −78° C. in 10 min. The resulting solution was stirred for 4 hr at room temperature. The reaction was then quenched by the addition of 400 mL of NH.sub.4Cl(sat.). The resulting solution was extracted with 3×400 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out. The filtrate was concentrated under vacuum. The crude product was purified by Flash with the following conditions (IntelFlash-1): Column, C18; mobile phase, ACN/H.sub.2O=5/95 increasing to ACN/H.sub.2O=95/5 within 30; Detector, 254. This resulted in 7.2 g (crude) of PH-ALIG-14-1-11a solid. LC-MS: m/z: 865.10 [M−H].sup.−

    Preparation of PH-ALIG-14-1-12

    [0337] Into a 500-mL round-bottom flask, was placed PH-ALIG-14-1-11 (6.00 g), H.sub.2O (30.00 mL), AcOH (120.00 mL). The resulting solution was stirred for 1 hr at 50 degrees C. The reaction mixture was cooled to 0 degree C. with a water/ice bath. The reaction was then quenched by the addition of 2 L of NaHCO.sub.3(sat.). The pH value of the solution was adjusted to 7 with NaHCO.sub.3(sat.). The resulting solution was extracted with 3×500 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out. The filtrate was concentrated under vacuum. The crude product was purified by Flash with the following conditions (IntelFlash-1): Column, C18; mobile phase, ACN/H.sub.2O=5/95 increasing to ACN/H.sub.2O=95/5 within 30; Detector, 254. This resulted in 2.6 g (44% yield in two steps) of PH-ALIG-14-1-12 as yellow oil. LC-MS: m/z 587.25 [M+Na].sup.+; .sup.1HNMR: (300 MHz, DMSO-d.sub.6) δ 11.31 (s, 1H), 7.73 (d, J=8.1 Hz, 1H), 6.63 (ddd, J=24.2, 17.2, 4.2 Hz, 1H), 6.14-5.96 (m, 2H), 5.65-5.48 (m, 5H), 5.09 (t, J=5.6 Hz, 1H), 4.17 (s, 1H), 3.65 (d, J=6.1 Hz, 2H), 3.52 (m, 2H), 3.27 (s, 3H), 1.15 (d, J=3.7 Hz, 18H); .sup.31PNMR-: (162 MHz, DMSO-d.sub.6) δ 17.96.

    Preparation of PH-ALIG-14-1-0

    [0338] Into a 250-mL 3-necked round-bottom flask, was placed DCM (60.00 mL), DCI (351.00 mg, 1.2 eq), 3-[[bis(diisopropylamino)phosphanyl]oxy]propanenitrile (971.00 mg, 1.3 eq), 4 A MS. The flask was evacuated and flushed three times with Argon, and the reaction mixture was cooled to 0° C. This was followed by the addition of PH-ALIG-14-1-12 (1.40 g, 1.00 eq, in 30 mL DCM) dropwise with stirring at 0° C. in 30 second. The resulting solution was stirred for 1 hr at room temperature. The reaction was then quenched by the addition of 50 mL of water. The resulting solution was extracted with 3×50 mL of ethyl acetate and the organic layers combined. The resulting mixture was washed with 3×50 ml of NaCl(sat.). The mixture was dried over anhydrous magnesium sulfate. The solids were filtered out. The filtrate was concentrated under vacuum. The crude product was purified by Prep-Archiral-SFC with the following conditions: Column: Ultimate Diol, 2*25 cm, 5|Im; Mobile Phase A: CO.sub.2, Mobile Phase B: ACN (0.2% TEA); Flow rate: 50 mL/min; Gradient: isocratic 30% B; Column Temperature (20° C.): 35; Back Pressure (bar): 100; Wave Length: 254 nm; RT1 (min): 2.58; Sample Solvent: MeOH—HPLC; Injection Volume: 1 mL; Number Of Runs: 4. This resulted in 1.31 g (65% yield) PH-ALIG-14-1-0 as yellow oil. LC-MS: m/z 763.40 [M−H].sup.−; 1HNMR-: (300 MHz, Acetonitrile-d.sub.3) δ 9.05 (s, 1H), 7.51 (d, J=8.1 Hz, 1H), 6.64 (dddd, J=23.8, 17.1, 4.8, 1.9 Hz, 1H), 6.23-5.92 (m, 2H), 5.70-5.51 (m, 5H), 4.38 (d, J=4.9 Hz, 1H), 3.96-3.56 (m, 8H), 3.35 (s, 3H), 2.70 (m, 2H), 1.33-1.14 (m, 30H); 31 PNMR-: (Acetonitrile-d.sub.3) δ 148.75, 148.53, 16.68.

    Example 3

    [0339] ##STR00206## ##STR00207##

    Preparation of PH-ALIG-14-1-7B

    [0340] A solution of PH-ALIG-14-1-6 (23 g, 40.300 mmol, 1.00 equiv) andp-TsOH (9.02 g, 52.390 mmol, 1.3 equiv) in MeOH (1000 mL) was stirred for overnight at 40° C. under argon atmosphere. The reaction was quenched with sat. sodium bicarbonate (aq.) at 0 degrees C. The resulting mixture was extracted with EtOAc (2×500 mL). The combined organic layers were washed with water (2×500 mL), dried over anhydrous MgSO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, C18 silica gel; mobile phase, ACN in water, 10% to 90% gradient in 30 min; detector, UV 254 nm. This resulted in PH-ALIG-14-1-7B (5.3 g, 36.%) as a colorless oil; LC-MS: (ES, m/z): 365 [M+H].sup.+; .sup.1H-NMR: (300 MHz, DMSO-d.sub.6) δ 11.20 (s, 1H), 8.09-7.78 (m, 2H), 7.63-7.50 (m, 2H), 7.51-7.35 (m, 2H), 5.95 (t, J=5.9 Hz, 1H), 5.51 (d, J=8.1 Hz, 1H), 4.73 (t, J=5.7 Hz, 1H), 4.41 (dd, J=11.9, 3.3 Hz, 1H), 4.17 (dd, J=11.9, 6.3 Hz, 1H), 3.69 (dq, J=10.1, 6.8, 6.3 Hz, 1H), 3.48-3.40 (m, 2H), 3.39-3.29 (m, 2H), 3.07 (s, 3H).

    Preparation s of PH-ALIG-14-3-1

    [0341] Into a 250-mL 3-necked round-bottom flask, was placed PH-ALIG-14-1-7B (7.00 g, 19.212 mmol, 1.00 equiv), ACN (60.00 mL), H.sub.2O (60.00 mL), TEMPO (0.72 g, 4.611 mmol, 0.24 equiv), BAIB (13.61 g, 42.267 mmol, 2.20 equiv). The resulting solution was stirred for 1 overnight at 30° C. The reaction was then quenched by the addition of 200 mL of water/ice. The resulting solution was extracted with 2×200 mL of ethyl acetate, The resulting mixture was washed with 2×200 ml of water. The mixture was dried over anhydrous sodium sulfate and concentrated. The crude product was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, ACN/H.sub.2O=5/95 increasing to ACN/H.sub.2O=95/5 within 30 min; Detector, UV 254 nm; product was obtained. This resulted in 5 g (68.8%) of PH-ALIG-14-3-1 as a solid. LC-MS: (ES, m/z): 379 [M+H].sup.+; .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 13.24 (s, 1H), 11.31 (d, J=2.2 Hz, 1H), 8.18-7.83 (m, 2H), 7.81-7.63 (m, 2H), 7.61-7.42 (m, 2H), 6.01 (t, J=6.0 Hz, 1H), 5.61 (dd, J=8.0, 2.2 Hz, 1H), 4.72-4.40 (m, 3H), 3.73-3.55 (m, 2H), 3.22 (s, 3H).

    Preparation of PH-ALIG-14-3-2

    [0342] Into a 250-mL round-bottom flask, was placed PH-ALIG-14-3-1 (4.5 g, 11.894 mmol, 1.00 equiv), DMF (90.00 mL), Pb(OAc).sub.4 (15.82 g, 35.679 mmol, 3.00 equiv). The resulting solution was stirred overnight at 30° C. The reaction was then quenched by the addition of 200 mL of water/ice. The resulting solution was extracted with 2×200 mL of ethyl acetate The resulting mixture was washed with 2×200 ml of water. The mixture was dried over anhydrous sodium sulfate and concentrated. The crude product was purified by Flash with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, ACN/H.sub.2O=5/95 increasing to ACN/H.sub.2O=95/5 within 30 min; Detector, UV 254 nm; product was obtained. This resulted in 4 g PH-ALIG-14-3-2 as oil; LC-MS: (ES, m/z): 415 [M+Na].sup.+; .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 11.39 (s, 1H), 7.93 (dd, J=24.2, 7.6 Hz, 2H), 7.75-7.46 (m, 4H), 6.35-6.03 (m, 2H), 5.71-5.47 (m, 1H), 4.60-4.14 (m, 2H), 3.88-3.54 (m, 2H), 3.26 (d, J=6.7 Hz, 3H), 2.03 (d, J=49.7 Hz, 3H).

    Preparation of PH-ALIG-14-3-3

    [0343] Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of argon, was placed PH-ALIG-14-3-2 (4.00 g, 10.195 mmol, 1.00 eq), DCM (80.00 mL), dimethyl hydroxymethylphosphonate (22.85 g, 163.114 mmol, 16.00 eq), BF.sub.3.Et.sub.2O (28.94 g, 203.91 mmol, 20 eq). The resulting solution was stirred overnight at room temperature. The reaction was then quenched by the addition of 500 mL of water/ice. The resulting solution was extracted with 2×500 mL of ethyl acetate The resulting mixture was washed with 2×500 ml of water. The mixture was dried over anhydrous sodium sulfate and concentrated. The residue was applied onto a silica gel column with dichloromethane/methanol (20/1). This resulted in 2 g (41.5%) of PH-ALIG-14-3-3 as a solid.

    [0344] LC-MS: (ES, m/z): 490 [M+H.sub.2O]+; 1H-NMR (300 MHz, DMSO-d.sub.6) δ 11.39 (d, J=5.4 Hz, 1H), 7.96 (dt, J=11.5, 9.3 Hz, 2H), 7.81-7.40 (m, 4H), 6.29-5.98 (m, 1H), 5.56 (dd, J=12.2, 8.1 Hz, 1H), 5.28-4.99 (m, 1H), 4.29 (dp, J=25.1, 5.9 Hz, 2H), 4.16-3.84 (m, 2H), 3.75-3.53 (m, 7H), 3.28 (d, J=12.5 Hz, 2H).

    Preparation of PH-ALIG-14-3-4

    [0345] Into a 100-mL round-bottom flask, was placed PH-ALIG-14-3-3 (2.00 g, 4.234 mmol, 1.00 equiv), 7M NH.sub.3 (g) in THF (20.00 mL) was added. The resulting solution was stirred overnight at 25° C. The resulting mixture was concentrated under vacuum. The crude product was purified by prep-sfc Column: Lux Sum i-Cellulose-5, 3*25 cm, 5 m; Mobile Phase A: CO.sub.2, Mobile Phase B: MeOH (0.1% 2M NH.sub.3-MEOH); Flow rate: 70 mL/min; Gradient: isocratic 50% B; Column Temperature (25° C.): 35; Back Pressure (bar): 100; Wave Length: 220 nm; RT1 (min): 3.75; RT2 (min): 4.92; Sample Solvent: MeOH:DCM=1:1; Injection Volume: 1 mL; Number Of Runs: 15, This resulted in 330 mg (21.2%) of PH-ALIG-14-3-4 as a solid. 1H-NMR-: (300 MHz, DMSO-d.sub.6) δ 11.14 (s, 1H), 7.63 (d, J=8.1 Hz, 1H), 6.06 (t, J=5.9 Hz, 1H), 5.64 (d, J=8.0 Hz, 1H), 4.89 (s, 1H), 4.63 (t, J=5.3 Hz, 1H), 3.98 (d, J=9.8 Hz, 2H), 3.70 (dd, J=10.7, 1.2 Hz, 8H), 3.63 (dd, J=6.0, 3.2 Hz, 1H), 3.29 (s, 3H).

    Preparation of PH-ALIG-14-3-0

    [0346] To a stirred solution of 3-{[bis(diisopropylamino)phosphanyl]oxy}propanenitrile (324.10 mg, 1.075 mmol, 1.2 equiv) and 1H-imidazole-4,5-dicarbonitrile (126.99 mg, 1.075 mmol, 1.2 equiv) in DCM (10 mL) was added PH-ALIG-14-3-4 (330 mg, 0.9 mmol, 1.00 eq) dropwise at 25° C. under argon atmosphere. The resulting mixture was stirred for 30 min at 25 degrees C. The reaction was quenched with water/ice. The resulting mixture was extracted with EtOAc (2×10 mL). The combined organic layers were washed with water (2×10 mL), dried over anhydrous MgSO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. Column: Ultimate Diol, 2*25 cm, 5 m; Mobile Phase A: CO2, Mobile Phase B: ACN; Flow rate: 50 mL/min; Gradient: isocratic 30% B; Column Temperature (25° C.): 35; Back Pressure (bar): 100; Wave Length: 254 nm; RT1 (min): 3.95; Sample Solvent: ACN; Injection Volume: 1 mL; Number Of Runs: 10, This resulted in PH-ALIG-14-3-0 (349 mg, 68.4%) as a light yellow oil. LC-MS: (ES, m/z): 567.25 [M+H].sup.+; 1H-NMR: (300 MHz, DMSO-d.sub.6) δ 11.38 (s, 1H), 7.64 (dd, J=8.0, 1.3 Hz, 1H), 6.09 (dt, J=5.8, 3.4 Hz, 1H), 5.65 (dd, J=8.0, 3.2 Hz, 1H), 4.83 (q, J=5.5 Hz, 1H), 4.03 (dt, J=9.7, 2.2 Hz, 2H), 3.83-3.40 (m, 14H), 3.30 (s, 3H), 2.77 (t, J=5.9 Hz, 2H), 1.12 (ddd, J=9.2, 6.7, 1.7 Hz, 12H); .sup.31P NMR (DMSO-d.sub.6) δ 148.0, 147.6, 23.1

    Example 4

    [0347] ##STR00208##

    Preparation of PH-ALIG-14-3-40

    [0348] Into a 100-mL round-bottom flask, was placed 2 PH-ALIG-14-3-3 (2.00 g, 4.234 mmol, 1.00 equiv), 7M NH.sub.3 (g) in THF (20.00 mL) was added. The resulting solution was stirred overnight at 25° C. The resulting mixture was concentrated under vacuum. The crude product was purified by prep-sfc Column: Lux 5 um i-Cellulose-5, 3*25 cm, 5 m; Mobile Phase A: CO2, Mobile Phase B: MeOH (0.1% 2M NH.sub.3-MeOH); Flow rate: 70 mL/min; Gradient: isocratic 50% B; Column Temperature (° C.): 35; Back Pressure (bar): 100; Wave Length: 220 nm; RT1 (min): 3.75; RT2 (min): 4.92; Sample Solvent: MeOH:DCM=1:1; Injection Volume: 1 mL; Number Of Runs: 15, This resulted in 320 mg (22.8%) of PH-ALIG-14-3-40 as a solid. 1H-NMR—−14-3-40: (300 MHz, DMSO-d.sub.6) δ 11.11 (s, 1H), 7.70 (d, J=8.0 Hz, 1H), 6.03 (t, J=6.1 Hz, 1H), 5.64 (d, J=8.0 Hz, 1H), 4.97 (s, 1H), 4.76 (t, J=5.3 Hz, 1H), 4.07-3.85 (m, 1H), 3.79 (dd, J=13.9, 9.3 Hz, 1H), 3.73-3.55 (m, 9H), 3.41 (d, J=5.0 Hz, 2H), 3.28 (s, 3H).

    Preparation of PH-ALIG-14-3-100

    [0349] To a stirred solution/mixture of 3-{[bis(diisopropylamino)phosphanyl]oxy}propanenitrile (517.58 mg, 1.717 mmol, 1.2 equiv) and 1H-imidazole-4,5-dicarbonitrile (202.79 mg, 1.717 mmol, 1.2 equiv) in DCM was added PH-ALIG-14-3-40 (527 mg, 1.431 mmol, 1.00 eq.) dropwise at 25° C. under argon atmosphere. The resulting mixture was stirred for 30 min at 25° C. The reaction was quenched with Water/Ice. The resulting mixture was extracted with EtOAc (2×10 mL). The combined organic layers were washed with water (2×10 mL), dried over anhydrous MgSO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. Column: Ultimate Diol, 2*25 cm, 5 m; Mobile Phase A: CO.sub.2, Mobile Phase B: ACN (0.1% DEA)—HPLC—merk; Flow rate: 50 mL/min; Gradient: isocratic 30% B; Column Temperature (° C.): 35; Back Pressure (bar): 100; Wave Length: 254 nm; RT1 (min): 4.57; Sample Solvent: ACN; Injection Volume: 1 mL; Number Of Runs: 10 to afford PH-ALIG-14-3-100 (264.8 mg, 31.7%) as a light yellow oil. LC-MS: (ES, m/z): 567.25 [M−H].sup.−: 1H NMR (300 MHz, DMSO-d.sub.6) δ 13.24 (s, 1H), 11.31 (d, J=2.2 Hz, 1H), 8.18-7.83 (m, 2H), 7.81-7.63 (m, 2H), 7.61-7.42 (m, 2H), 6.01 (t, J=6.0 Hz, 1H), 5.61 (dd, J=8.0, 2.2 Hz, 1H), 4.72-4.40 (m, 3H), 3.73-3.55 (m, 2H), 3.22 (s, 3H); .sup.31P NMR (DMSO-d.sub.6) δ 148.01, 147.67, 22.8

    Example 5

    [0350] ##STR00209## ##STR00210##

    Preparation of PH-ALIG-14-4-1

    [0351] To a stirred mixture of ascorbic acid (100.00 g, 567.78 mmol, 1.00 equiv) and CaCO.sub.3 (113.0 g, 1129.02 mmol, 2 equiv) in H.sub.2O (1.00 L) was added H.sub.2O.sub.2 (30%)(236.0 g, 6938.3 mmol, 12.22 equiv) dropwise at 0° C. The resulting mixture was stirred overnight at room temperature. The mixture was treat with charcoal and heat to 70 degrees until the no more peroxide was detected. The resulting mixture was filtered, the filter cake was washed with warm water (3×300 mL). The filtrate was concentrated under reduced pressure. The solid was diluted with MeOH (200 mL) and the mixture was stirred for 5 h. The resulting mixture was filtered, the filter cake was washed with MeOH (3×80 mL). The filtrate was concentrated under reduced pressure to afford L-threonate (86 g, 96.6%) as a white crude solid. 1H-NMR−: (300 MHz, Deuterium Oxide) δ 4.02 (dd, J=4.6, 2.4 Hz, 1H), 3.91 (ddt, J=7.6, 5.3, 2.2 Hz, 1H), 3.78-3.44 (m, 2H).

    Preparation of PH-ALIG-14-4-2

    [0352] Into a 5 L round-bottom flask were added L-threonate (70.00 g, 518.150 mmol, 1.00 equiv) and H.sub.2O (2 L) at room temperature. The residue was acidified to pH=1 with Dowex 50wX8, H (+) Form). The resulting mixture was stirred for 1 h at 70° C. The resulting mixture was filtered, the filter cake was washed with water (2×1 L). The filtrate was concentrated under reduced pressure. The solid was co-evaporated with (2×2 L). Then the solid was diluted with ACN (700.00 mL), and the TsOH (5.35 g, 31.089 mmol, 0.06 equiv) was added. The resulting mixture was stirred for 1 h at 80 degrees C. under air atmosphere. The resulting mixture was filtered, the filter cake was washed with ACN (2×500 mL). The filtrate was concentrated under reduced pressure to PH-ALIG-14-4-2 (70 g, crude) as a yellow oil.

    Preparation of PH-ALIG-14-4-3

    [0353] To a stirred solution of (PH-ALIG-14-4-2 (70.0 g crude, 593.2 mmol, 1.00 eq.) in pyridine (280.00 mL) was added benzoyl chloride (207.62 g, 1.483 mol, 2.5 equiv) dropwise at 0° C. under argon atmosphere. The resulting mixture was stirred for 1 h at room temperature under argon atmosphere. The reaction was quenched by the addition of sat. NaHCO.sub.3 (aq.) (500 mL) at 0 degrees C. The resulting mixture was extracted with CH.sub.2Cl.sub.2 (3×500 mL). The combined organic layers were washed with brine (2×300 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc to afford (PH-ALIG-14-4-3 (80 g, 41.4%) as an off-white solid. LC-MS: (ES, m/z): 327 [M+H].sup.+; 1H-NMR: (300 MHz, CDCl.sub.3) δ 8.18-8.04 (m, 4H), 7.68-7.61 (m, 2H), 7.50 (tt, J=7.1, 1.4 Hz, 4H), 5.96-5.57 (m, 2H), 5.11-5.00 (m, 1H), 4.45-4.35 (m, 1H).

    Preparation of PH-ALIG-14-4-4

    [0354] To a stirred solution of PH-ALIG-14-4-3 (125 g, 383.078 mmol, 1.00 eq) in THF (1.50 L) was added DIBAL-H (1M)(600 mL, 2 eq) dropwise at −78° C. under argon atmosphere. The resulting mixture was stirred for 1 h at −78 degrees C. under argon atmosphere. Desired product was detected by LCMS. The reaction was quenched with MeOH at 0° C. The resulting mixture was diluted with EtOAc (600 mL). Then the resulting mixture was filtered, the filter cake was washed with EtOAc (3×800 mL). The filtrate was concentrated under reduced pressure. This resulted in PH-ALIG-14-4-4 (73 g, crude) as a colorless solid. LC-MS: (ES, m/z): 392 [M+Na+ACN]+; 1H-NMR-: (400 MHz, Chloroform-d) δ 8.22-7.99 (m, 8H), 7.62 (dtd, J=7.4, 4.4, 2.2 Hz, 4H), 7.48 (td, J=7.8, 2.4 Hz, 8H), 5.87 (d, J=4.3 Hz, 1H), 5.77 (dt, J=6.6, 3.6 Hz, 1H), 5.56 (d, J=4.9 Hz, 2H), 5.50 (t, J=4.3 Hz, 1H), 4.73 (s, 1H), 4.63 (ddd, J=10.4, 7.9, 6.1 Hz, 2H), 4.28 (dd, J=10.3, 3.8 Hz, 1H), 3.99 (dd, J=10.6, 3.2 Hz, 1H).

    Preparation of PH-ALIG-14-4-5

    [0355] To a stirred solution of (PH-ALIG-14-4-4 (73.00 g, 222.344 mmol, 1.00 equiv) and DMAP (271.63 mg, 2.223 mmol, 0.01 equiv) and pyridine (365.00 mL) in DCM (365.00 mL) were added Ac.sub.2O (24.97 g, 244.6 mmol, 1.1 equiv) dropwise at 0 degrees C. under argon atmosphere. The resulting mixture was stirred for 1 h at room temperature under argon atmosphere. The reaction was quenched with sat. NaHCO.sub.3 (aq.) at 0 degrees C. The resulting mixture was extracted with CH.sub.2Cl.sub.2 (3×500 mL). The combined organic layers were washed with sat. CuSO.sub.4 (3×200 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc to afford PH-ALIG-14-4-5 (60 g, 73%) as a colorless oil. LC-MS: (ES, m/z): 434 [M+Na+ACN].sup.+; 1H-NMR: (400 MHz, Chloroform-d) δ 8.17-8.02 (m, 8H), 7.63 (tddd, J=7.9, 6.6, 3.2, 1.6 Hz, 4H), 7.57-7.44 (m, 8H), 6.66 (d, J=4.5 Hz, 1H), 6.40 (s, 1H), 5.83-5.53 (m, 4H), 4.67 (ddd, J=23.4, 10.5, 6.2 Hz, 2H), 4.24 (dd, J=10.5, 3.8 Hz, 1H), 4.19-4.01 (m, 1H), 2.18 (s, 3H), 2.06 (d, J=3.2 Hz, 3H).

    Preparation of PH-ALIG-14-4-6

    [0356] To a stirred mixture of PH-ALIG-14-4-5 (50.00 g, 135.005 mmol, 1.00 eq) and uracil (15.13 g, 135.005 mmol, 1 eq) in can (500.00 mL) was added BSA (54.81 g, 270.010 mmol, 2 eq) in portions at room temperature under air atmosphere. The resulting mixture was stirred for 1 h at 60° C. under argon atmosphere. After that, the TMSOTf (90.02 g, 405.0 mmol, 3 eq) was added dropwise at 0° C. The resulting mixture was stirred for 2 h at 60° C. under argon atmosphere. The mixture was neutralized to pH=7 with saturated NaHCO.sub.3 (aq.) at 0° C. The resulting mixture was extracted with CH.sub.2C.sub.2 (3×400 mL). The combined organic layers were washed with brine (2×400 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (1:1) to afford PH-ALIG-14-4-6 (43 g, 75.4%) as a white solid. LC-MS: (ES, m/z): [M+H].sup.+; 423 464 [M+H+ACN]+; 1H-NMR-: (300 MHz, Chloroform-d) δ 9.08-8.89 (m, 1H), 8.17-7.94 (m, 4H), 7.70-7.43 (m, 7H), 6.19 (d, J=1.9 Hz, 1H), 5.84-5.71 (m, 2H), 5.62 (td, J=3.3, 2.8, 1.4 Hz, 1H), 4.59-4.44 (m, 2H), 4.14 (q, J=7.2 Hz, 1H).

    Preparation of PH-ALIG-14-4-7

    [0357] A solution of PH-ALIG-14-4-6 (52.00 g, 123.108 mmol, 1 eq) was dissolved in 642 ml of MeOH/H.sub.2O/TEA (5:1:1) at room temperature and heat to reflux until no more starting material was detected (2˜3 h). The resulting mixture was concentrated under reduced pressure. The residue was dissolved in EtOAc (600 mL) and the organic layer was extracted with water (5×800 mL). The aqueous layer was concentrated under vacuum to afford PH-ALIG-14-4-7 (21 g, crude) as a off-white solid. The crude product was used in the next step directly without further purification. LC-MS-: (ES, m/z): 213 [M−H].sup.−; 1 H-NMR: (300 MHz, DMSO-d.sub.6) δ 11.26 (s, 1H), 7.68 (d, J=8.1 Hz, 1H), 5.75 (s, 1H), 5.65 (d, J=1.2 Hz, 1H), 5.59 (d, J=8.1 Hz, 1H), 5.39 (s, 1H), 4.10-3.97 (m, 4H).

    Preparation of PH-ALIG-14-4-8

    [0358] To a stirred mixture of PH-ALIG-14-4-7 (16.00 g, 74.705 mmol, 1.00 equiv) and DBU (22.75 g, 149.409 mmol, 2 equiv) in DCM (80.00 mL) and DMF (200.00 mL) was added DMTr-Cl (7.88 g, 25.680 mmol, 1.1 equiv) dropwise at room temperature under argon atmosphere. The resulting mixture was stirred for 2 h at room temperature under argon atmosphere. The reaction was quenched by the addition of sat. NaHCO.sub.3 (aq.) (100 mL) at 0 degrees C. The resulting mixture was extracted with EtOAc (3×60 mL). The combined organic layers were washed with brine (2×50 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE (0.5% TEA)/EtOAc (2:3) to afford PH-ALIG-14-4-8 (25 g, 64.8%) as a off-white solid; LC-MS: (ES, m/z): 515 [M−H].sup.−; .sup.1H-NMR: (400 MHz, DMSO-d.sub.6) δ 11.33 (s, 1H), 7.57 (d, J=8.1 Hz, 1H), 7.45-7.13 (m, 9H), 6.86 (t, J=8.5 Hz, 4H), 5.94 (d, J=1.7 Hz, 1H), 5.58 (d, J=8.1 Hz, 1H), 5.15 (d, J=2.6 Hz, 1H), 3.97-3.79 (m, 3H), 3.73 (d, J=2.3 Hz, 6H), 3.33 (d, J=2.5 Hz, 1H).

    Preparation of PH-ALIG-14-4-9 A

    [0359] To a stirred solution of PH-ALIG-14-4-8 (6.00 g, 11.616 mmol, 1.00 eq) in THF (240.00 mL) was added NaH (60%) (1.40 g, 35.003 mmol, 3 eq) dropwise at 0° C. under argon atmosphere. The resulting mixture was stirred for 30 min at 0 degrees C. under argon atmosphere. Then the dimethyl ethenylphosphonate (15.81 g, 116.2 mmol, 10.00 eq) was added and the resulting mixture was stirred overnight at room temperature under argon atmosphere. The reaction was quenched with sat. NH.sub.4Cl (aq.) at room temperature. The resulting mixture was extracted with EtOAc (3×100 mL). The combined organic layers were washed with brine (3×80 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, C18 mobile phase, ACN in water, 5% to 95% gradient in 30 min; detector, UV 254 nm to afford PH-ALIG-14-4-9 A (3.65 g, 48.15%) as a white solid.

    [0360] LC-MS: (ES, m/z): 675 [M+Na].sup.+; 1 H-NMR-: (300 MHz, DMSO-d.sub.6) δ 11.39 (s, 1H), 7.44-7.36 (m, 3H), 7.34-7.21 (m, 7H), 6.93-6.83 (m, 4H), 6.08 (d, J=2.0 Hz, 1H), 5.55 (d, J=8.1 Hz, 1H), 4.08 (d, J=11.0 Hz, 1H), 3.92 (d, J=2.0 Hz, 1H), 3.82-3.71 (m, 7H), 3.57 (dd, J=10.9, 3.6 Hz, 6H), 3.30-3.23 (m, 1H), 3.06-2.86 (m, 2H), 1.96 (dt, J=18.1, 7.1 Hz, 2H).

    Preparation of PH-ALIG-14-4-10 A

    [0361] A solution of PH-ALIG-14-4-9 A (2.80 g, 4.3 mmol, 1.00 equiv) in AcOH (12.00 mL) and H.sub.2O (3.00 mL) was stirred for overnight at room temperature under air atmosphere. The reaction was quenched with sat. NaHCO.sub.3 (aq.) at 0 degrees C. The resulting mixture was washed with 3×20 mL of CH.sub.2Cl.sub.2. The product in the water layer. The water layer was concentrated under reduced pressure. The product was purified by Prep-SFC with the following conditions (Prep SFC80-2): Column, Green Sep Basic, 3*15 cm; mobile phase, CO.sub.2 (70%) and IPA (0.5% 2M NH.sub.3-MeOH)(30%); Detector, UV 254 nm; product was obtained. This resulted in 870 mg (57.89%) of PH-ALIG-14-4-10 A as a white solid. LC-MS: (ES, m/z): 351 [M+Na]+; 1H-NMR-: (300 MHz, DMSO-d.sub.6) δ 11.28 (s, 1H), 7.56 (d, J=8.1 Hz, 1H), 5.86 (d, J=4.4 Hz, 1H), 5.65 (d, J=1.6 Hz, 1H), 5.56 (d, J=8.1 Hz, 1H), 4.17 (d, J=10.1 Hz, 1H), 4.10 (d, J=4.3 Hz, 1H), 4.00 (dd, J=10.1, 3.9 Hz, 1H), 3.87 (dt, J=4.1, 1.3 Hz, 1H), 3.72-3.49 (m, 8H), 2.08 (dd, J=7.1, 2.8 Hz, 1H), 2.05-1.96 (m, 1H).

    Preparation of PH-ALIG-14-4-100

    [0362] Into a 250 mL 3-necked round-bottom flask were added Molecularsieve and ACN (30.00 mL) at room temperature. The resulting mixture was stirred for 10 min at room temperature under ar gon atmosphere. Then to the stirred solution were added 3-[[bis(diisopropylamino)phosphanyl]oxy] propanenitrile (1058.46 mg, 3.512 mmol, 1.5 equiv) and DCI (359.12 mg, 3.043 mmol, 1.30 equiv). Then the dimethyl PH-ALIG-14-4-10 A (820.00 mg, 2.341 mmol, 1.00 equiv) in 30 mL ACN was added dropwise at room temperature under argon atmosphere. The resulting mixture was stirred for 1 h at room temperature under argon atmosphere. The resulting mixture was diluted with CH2Cl2 (60 mL). T he combined organic layers were washed with water (3×40 mL) after filtration, dried over anhydrous MgSO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (0.5% TEA in PE/10% EtOH in EtOAc 1:9) to afford PH-ALIG-14-4-100 (800 mg, 62.1%) as a colorless oil. LC-MS: (ES, m z): 549 [M−H].sup.−; 1H-NMR: (300 MHz, DMSO-d.sub.6) δ 11.34 (s, 1H), 7.61 (dd, J=8.1, 1.7 Hz, 1H), 5.80 (dd, J=15.0, 1.8 Hz, 1H), 5.60 (d, J=8.1 Hz, 1H), 4.48-4.23 (m, 2H), 4.17-3.98 (m, 2H), 3.88-3.73 (m, 2H), 3.72-3.51 (m, 10H), 2.79 (q, J=5.9 Hz, 2H), 2.07 (dtt, J=17.9, 7.1, 3.2 Hz, 2H), 1.15 (ddd, J=6.3, 3.8, 2.1 Hz, 12H); .sup.31P NMR (DMSO-d.sub.6) δ 149.71, 149.35, 30.85, 30.75

    Example 6

    [0363] ##STR00211## ##STR00212##

    [0364] Preparation of 2: (J. Chem. Soc., Perkin Trans. 1, 1992, 1943-1952) To a solution of 1 (150.0 g, 1.0 mol) in DMF (2.0 L) was added 2, 2-dimethoxypropane (312.0 g, 3.0 mol) and p-TsOH (1.7 g, 10.0 mmol), then the reaction mixture was stirred at r.t. for 4 h, after the reaction, the solvent was concentrated to give the crude products which was used directly to next step.

    [0365] Preparation of 3: (J. Chem. Soc., Perkin Trans. 1, 1992, 1943-1952) To a solution of 2 (190.0 g, 1.0 mol) in pyridine (2.0 L) was added BzCl (560.0 g, 4.0 mol) then the reaction mixture was stirred at r.t. for 2 h, after the reaction, the reaction mixture was poured into the ice water, EA was added for extraction, and the organic phase was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated to give the crude product which was purified by silica gel column (EA:PE=1:5 to 1:1) to give 3 (350.0 g, 87.9% yield), ESI-LCMS: m/z=421.2 [M+Na].sup.+.

    [0366] Preparation of 4: (J. Chem. Soc., Perkin Trans. 1, 1992, 1943-1952) to a solution of 3 (240.0 g, 815.5 mmol) in MeCN (3.0 L) was added N-(2-oxo-1H-pyrimidin-4-yl) benzamide (193.0 g, 897.0 mmol) and BSA (496.6 g, 2.4 mol). then the reaction mixture was stirred at 50° C. for 30 min, then the reaction mixture was cooled to 0° C., and the TMSOTf (271.5 g, 1.2 mol) was added into the mixture at 0° C., then the reaction mixture was stirred at 70° C. for 2 h, after the reaction, the solvent was concentrated to give an oil, then the oil was poured into the solution of NaHCO.sub.3 maintaining the mixture was slightly alkaline, EA was added for extraction, and the organic phase was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated to give the crude product which was purified by silica gel column (EA:PE=1:3 to 1:1) to give 4 (180.0 g, 44.9% yield). ESI-LCMS: m/z=491.2 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.19 (s, 1H), 8.20 (d, J=7.6 Hz, 1H), 8.01-7.84 (m, 4H), 7.73-7.57 (m, 2H), 7.50 (dt, J=10.4, 7.7 Hz, 4H), 7.40 (d, J=7.4 Hz, 1H), 6.03 (d, J=9.4 Hz, 1H), 5.33 (dd, J=9.4, 7.3 Hz, 1H), 4.66 (dd, J=7.3, 5.3 Hz, 1H), 4.45-4.35 (m, 2H), 4.22 (dd, J=13.7, 2.5 Hz, 1H), 1.58 (s, 3H), 1.34 (s, 3H).

    [0367] Preparation of 5: To a solution of 4 (78.0 g, 158.7 mmol) in pyridine (800.0 mL) was added a solution of NaOH (6.3 g, 158.7 mmol) in a mixture solvent of H.sub.2O and MeOH (4:1, 2N), Then the reaction mixture was stirred at 0° C. for 20 min, LC-MS and TLC show that the raw material was disappeared, then the mixture was pour into a solution of NH.sub.4Cl, EA was added for extraction, and the organic phase was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated to give the crude product, which was purified by silica gel column (DCM:MeOH=30:1 to 10:1) to give 5 (56.0 g, 91.0% yield). ESI-LCMS: m/z=388.1 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.29 (s, 1H), 8.16 (d, J=7.6 Hz, 1H), 8.08-7.99 (m, 2H), 7.67-7.60 (m, 1H), 7.53 (t, J=7.6 Hz, 2H), 7.35 (d, J=7.6 Hz, 1H), 5.63 (d, J=6.1 Hz, 1H), 5.51 (d, J=9.5 Hz, 1H), 4.35-4.13 (m, 3H), 3.78 (dt, J=9.6, 6.5 Hz, 1H), 3.19 (d, J=5.1 Hz, 1H), 1.53 (s, 3H), 1.32 (s, 3H).

    [0368] Preparation of 6: To a solution of 5 (15.0 g, 38.7 mmol) in DCM (200.0 mL) was added Ag.sub.2O (35.8 g, 154.8 mmol), CH.sub.3I (54.6 g, 387.2 mmol) and NaI (1.1 g, 7.7 mmol), then the reaction mixture was stirred at r.t. overnight, after the reaction, filtrate was obtained through filtration, and the filtrate concentrated the solvent to obtain the product 6 (13.0 g, 75.2% yield). ESI-LCMS: m/z=402.30 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.30 (s, 1H), 8.22 (s, 1H), 8.00 (d, J=7.6 Hz, 2H), 7.71-7.20 (m, 4H), 5.56 (d, J=9.3 Hz, 1H), 4.33 (t, J=6.1 Hz, 1H), 4.26 (dd, J=6.2, 2.1 Hz, 1H), 4.20 (d, J=13.5 Hz, 1H), 3.98 (dd, J=13.5, 2.5 Hz, 1H), 3.66 (dd, J=9.3, 6.6 Hz, 1H), 3.34 (s, 3H), 1.57 (s, 3H), 1.32 (s, 3H).

    [0369] Preparation of 7: To a solution of 6 (12.0 g, 29.9 mmol) was added CH.sub.3COOH (120.0 mL), then the mixture was stirred at r.t. for 2 h, LC-MS and TLC showed that the raw material was disappeared, then the solvent was concentrated to get the crude product 7 (10.0 g, 83.3% yield). ESI-LCMS: m/z=362.1 [M+H].sup.+.

    [0370] Preparation of 8: To a solution of 7 (10.0 g, 24.9 mmol) in dioxane:H.sub.2O=3:1 (120.0 mL) was added NaIO.sub.4 (8.8 g, 41.5 mmol), then the reaction mixture was stirred at r.t. for 2 h, LC-MS and TLC showed that the raw material was disappeared, then the reaction mixture was cooled to 0° C., and NaBH.sub.4 (2.4 g, 41.5 mmol) was added into the mixture and stirred at 0° C. for 0.5 h, LC-MS and TLC showed that the raw material was disappeared, then NH.sub.4Cl was added into the mixture to adjust pH to be slightly alkaline, and concentrated to give the crude product, which was purified by silica gel column (PE:EA=5:1 to 1:1) to give 8 (8.0 g, 79.5% yield). ESI-LCMS: m/z=364.1 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.26 (s, 1H), 8.14 (d, J=7.5 Hz, 1H), 8.07-7.94 (m, 2H), 7.67-7.59 (m, 1H), 7.52 (t, J=7.6 Hz, 2H), 7.37 (s, 1H), 5.91 (d, J=6.0 Hz, 1H), 4.77 (t, J=5.6 Hz, 1H), 4.70 (t, J=5.1 Hz, 1H), 3.70 (ddd, J=11.5, 5.0, 2.5 Hz, 1H), 3.57-3.39 (m, 6H), 3.31 (s, 3H).

    [0371] Preparation of 9: To a solution of 8 (4.0 g, 11.0 mmol) in pyridine (50.0 mL) was added DMTrCl (5.5 g, 16.5 mmol), then the reaction mixture was stirred at r.t. for 2 h, LC-MS showed that the raw material was 20.0% and The ratio of product to by-product was 3.5:1. then the solvent was concentrated to get residue which was purified by silica gel column to give the purified products and by-products was 5 g in total, then the product was purified by SFC to get 9 (3.0 g, 40.9% yield). ESI-LCMS: m/z=666.2 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.33 (s, 1H), 8.20 (d, J=7.4 Hz, 1H), 8.04 (d, J=7.7 Hz, 2H), 7.64 (t, J=7.4 Hz, 1H), 7.53 (t, J=7.6 Hz, 2H), 7.40 (d, J=7.8 Hz, 3H), 7.36-7.18 (m, 7H), 6.89 (d, J=8.4 Hz, 4H), 5.96 (d, J=5.7 Hz, 1H), 4.79 (t, J=5.7 Hz, 1H), 3.73 (s, 6H), 3.66-3.46 (m, 4H), 3.37 (s, 3H), 3.16 (ddd, J=10.1, 7.1, 3.0 Hz, 1H), 3.04 (dt, J=10.9, 3.4 Hz, 1H), 2.08 (s, 1H).

    [0372] Preparation of 10: To a solution of 9 (2.8 g, 4.2 mmol) in DCM (30.0 mL) was added CEP[N(iPr).sub.2].sub.2 (1.3 g, 4.2 mmol) and DCI (601.2 mg, 5.1 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 9 was consumed completely. The solution was washed with a solution of NaHCO.sub.3 twice and washed with brine and dried over Na.sub.2SO.sub.4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C.sub.18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20.0 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=90/10; Detector, UV 254 nm. This resulted in to give 10 (2.8 g, 76.8% yield). ESI-LCMS: m/z=866.2 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.34 (s, 1H), 8.22 (d, J=7.4 Hz, 1H), 8.09-7.98 (m, 2H), 7.64 (t, J=7.4 Hz, 1H), 7.53 (t, J=7.6 Hz, 2H), 7.45 (d, J=7.3 Hz, 1H), 7.39 (d, J=7.5 Hz, 2H), 7.31 (t, J=7.6 Hz, 2H), 7.24 (t, J=9.1 Hz, 5H), 6.89 (d, J=8.8 Hz, 4H), 5.96 (d, J=6.1 Hz, 1H), 4.02-3.86 (m, 1H), 3.84-3.63 (m, 11H), 3.56 (dtq, J=13.3, 6.6, 3.5, 3.1 Hz, 3H), 3.37 (s, 2H), 3.16 (ddd, J=10.0, 6.8, 3.3 Hz, 1H), 3.04 (ddd, J=10.7, 5.5, 3.0 Hz, 1H), 2.75 (td, J=5.9, 2.3 Hz, 2H), 1.18-1.07 (m, 12H); .sup.31P NMR (DMSO-d.sub.6) δ 148.02 (d, J=12.0 Hz).

    Example 7

    [0373] ##STR00213## ##STR00214##

    [0374] Preparation of 10: To the solution of 3 (200.0 g, 0.5 mol) in ACN (2000.0 mL) was added a solution of SnCl.sub.4 in DCM (1000.0 mL) at 0° C. under N.sub.2, and the reaction mixture was stirred at 0° C. for 4 h under N.sub.2 atmosphere. Then the reaction solution was poured into saturated sodium bicarbonate solution, the resulting product was extracted with EA (3*500.0 mL). The combined organic layer was washed with water and brine, dried over Na.sub.2SO.sub.4, and concentrated to give the crude, which was purified by silica gel column (PE:EA=5:1 to 0:1) to give 10 (65.0 g, 31.4% yield) as a white solid. ESI-LCMS: m/z=412.0 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.27 (s, 1H), 8.09 (s, 1H), 7.74-7.60 (m, 2H), 7.59-7.57 (m, 1H), 7.44-7.40 (m, 2H), 7.24 (s, 2H), 5.90 (d, J=9.6 Hz, 1H), 5.73 (dd, J=7.4 Hz, 1H), 4.63 (t, 1H), 4.50-4.30 (m, 2H), 4.21 (dd, J=13.6 Hz, 1H), 1.61 (s, 3H), 1.35 (s, 3H).

    [0375] Preparation of 11: To a solution of 10 (40.0 g, 97.3 mmol) in DCM (500.0 mL) was added Et.sub.3N (30.0 g, 297.0 mmol) and DMAP (1.2 g, 9.8 mmol) at r.t. The reaction mixture was replaced with N.sub.2 over 3 times, then MMTrCl (45.0 g, 146.1 mmol) was added to the mixture. The reaction mixture was stirred at r.t. overnight. TLC and LC-MS showed that 10 was consumed, and the reaction mixture was added to an aqueous solution of NaHCO.sub.3 in ice-water. Then extracted product with EA, washed the organic phase with brine, and dried the organic phase over Na.sub.2SO.sub.4, then concentrated to get 11 (66.5 g) as a crude, used next step directly.

    [0376] Preparation of 12: To a solution of 11 (66.5 g, 97.3 mmol) in pyridine (600.0 mL) was added 2N NaOH (H.sub.2O:MeOH=4:1) (200.0 mL) at r.t. Then the reaction mixture was stirred at 0° C. for 30 min, LC-MS and TLC showed that the raw material was disappeared, then the mixture was poured into a solution of NH.sub.4Cl, EA was added for extraction, and the organic phase was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated to give the crude product which was purified by silica gel column (EA:PE=1:5 to 1:1) to give 12 (50.0 g, 88.7% yield for two step). ESI-LCMS: m/z=580.4 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.44 (s, 1H), 7.92 (s, 1H), 7.36-7.16 (m, 13H), 6.89-6.80 (m, 2H), 5.59 (d, J=6.0 Hz, 1H), 5.35 (d, J=9.6 Hz, 1H), 4.32-4.12 (m, 4H), 4.08-3.95 (m, 3H), 3.72 (s, 3H), 1.99 (s, 3H), 1.54 (s, 3H), 1.32 (s, 3H), 1.17 (t, J=7.1 Hz, 3H).

    [0377] Preparation of 13: To a solution of 12 (46.0 g, 79.4 mmol) in CH.sub.3I (200.0 mL) was added Ag.sub.2O (36.6 g, 158.4 mmol) and NaI (6.0 g, 42.5 mmol), then the reaction mixture was stirred at r.t. for 4 h, then the reaction mixture was filtrated and concentrated the solvent to obtain the product 13 (46.0 g, 97.6% yield), used next step directly. ESI-LCMS: m/z=594.3 [M+H].sup.+.

    [0378] Preparation of 14: To a stirred solution of DCA (22.5 mL) in DCM (750.0 mL) was added 13 (46.0 g, 77.5 mmol) and Et.sub.3Si (185.0 mL) at r.t. And the reaction mixture was stirred at r.t. for 12 h. The reaction solution was evaporated to dryness under reduced pressure to give a residue, which was slurry with a solution of NaHCO.sub.3 (50.0 mL) to get 14 (19.0 g, 76% yield), which was used next step directly.

    [0379] Preparation of 15: To a solution of 14 (16.0 g, 49.7 mmol) in pyridine (200.0 mL) was added BzCl (9.0 g, 64.7 mmol) at 0° C. Then the reaction mixture was stirred at r.t. for 2 h. LC-MS showed 6 was consumed completely, then the mixture was cooled to 0° C., and a solution of NaOH in MeOH and H.sub.2O (2 N, 50.0 mL) was added into the reaction mixture, and the mixture was stirred for 1 h at 0° C., then the mixture was poured into a solution of NH.sub.4Cl. The product was extracted with EA (300.0 mL) and the organic layer was washed with brine and dried over Na.sub.2SO.sub.4. Then the organic layer was concentrated to give a residue, which was purified by slurry with PE:EA (8:1, 900.0 mL) to get 15 (20.0 g, 95.0% yield). ESI-LCMS: m/z=426.2 [M+H].sup.+; 1H NMR (400 MHz, DMSO-d.sub.6) δ 11.21 (s, 1H), 8.77-8.69 (m, 2H), 8.06 (d, J=7.6 Hz, 2H), 7.65 (t, J=7.4 Hz, 1H), 7.56 (t, J=7.6 Hz, 2H), 7.34-7.23 (m, 4H), 7.23-7.12 (m, 5H), 6.89-6.80 (m, 4H), 5.90 (d, J=7.9 Hz, 1H), 4.36-4.29 (m, 1H), 4.06 (t, J=8.8 Hz, 1H), 3.92 (dd, J=25.0, 6.9 Hz, OH), 3.72 (d, J=1.0 Hz, 7H), 3.59 (dt, J=10.4, 6.6 Hz, 1H), 3.24 (s, 3H), 2.97 (d, J=7.7 Hz, 1H), 2.76 (q, J=5.5 Hz, 2H), 1.14 (dd, J=9.2, 5.7 Hz, 12H).

    [0380] Preparation of 16: To a mixture solution of HCOOH (180.0 mL) and H.sub.2O (20.0 mL) was added 15 (19.0 g, 44.7 mmol). The reaction mixture was stirred at r.t. for 4 h. LC-MS showed 15 was consumed completely. Then the reaction mixture was concentrated to give a residue which was purified by slurry with MeOH (100.0 mL) to get 16 (16.0 g, 92.7% yield) as a white solid. ESI-LCMS: m/z=385.9 [M+H].sup.+; 1H NMR (400 MHz, DMSO-d.sub.6) δ 11.21 (s, 1H), 8.77 (d, J=1.2 Hz, 2H), 8.09-8.02 (m, 2H), 7.70-7.61 (m, 1H), 7.56 (t, J=7.6 Hz, 2H), 5.56 (d, J=9.2 Hz, 1H), 5.21 (d, J=6.1 Hz, 1H), 4.94 (d, J=4.5 Hz, 1H), 4.18 (t, J=9.1 Hz, 1H), 4.09 (q, J=5.2 Hz, 1H), 3.88-3.71 (m, 4H), 3.21-3.14 (m, 6H).

    [0381] Preparation of 17: To a solution of 16 (16.0 g, 41.4 mmol) in dioxane (200.0 mL) was added H.sub.2O (32.0 mL), and NaIO.sub.4 (9.7 g, 45.5 mmol), then the reaction mixture was stirred at r.t. for 1 h, LC-MS and TLC showed that the raw material was disappeared, then the reaction mixture was cooled to 0° C., and NaBH.sub.4 (1.7 g, 45.5 mmol) was added into the mixture and stirred at 0° C. for 0.5 h, LC-MS and TLC showed that the intermediate state was disappeared, then the NH.sub.4Cl was added into the mixture to adjust pH to be slightly alkaline, and concentrated at r.t. to give the crude product which was purified by silica gel column (DCM:MeOH=20:1 to 8:1) to give 17 (16.0 g, 99.5% yield). ESI-LCMS: m/z=388.0 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.18 (s, 1H), 8.75 (s, 1H), 8.67 (s, 1H), 8.09-7.99 (m, 2H), 7.65 (t, J=7.4 Hz, 1H), 7.56 (t, J=7.6 Hz, 2H), 5.90 (d, J=7.6 Hz, 1H), 4.88 (t, J=5.7 Hz, 1H), 4.67 (t, J=5.5 Hz, 1H), 4.08-3.98 (m, 2H), 3.78 (ddd, J=12.1, 5.2, 3.1 Hz, 1H), 3.68-3.39 (m, 4H), 3.36 (s, OH), 3.20 (s, 3H), 1.99 (s, 1H), 1.17 (t, J=7.1 Hz, 1H).

    [0382] Preparation of 18: To a solution of 17 (12.0 g, 31.0 mmol) in pyridine (50.0 mL) was added DMTrCl (11.5 g, 34.1 mmol), then the reaction mixture was stirred at r.t. for 2 h, LC-MS showed that the raw material was 15.0% remained and the ratio of product to by-product was 3.5:1. Then the reaction solution was poured into ice-water, and extracted with EA, wished with brine, dried over Na.sub.2SO.sub.4, filtered and concentrated to get residue which was purified by silica gel column to give the purified product and by-product were 13.0 g in total, then 4.0 g crude was purified by SFC to get 18 (3.3 g, 15.4% yield). ESI-LCMS: m/z=690.3 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.21 (s, 1H), 8.75 (s, 1H), 8.69 (s, 1H), 8.10-8.03 (m, 2H), 7.70-7.61 (m, 1H), 7.56 (t, J=7.6 Hz, 2H), 7.35-7.12 (m, 9H), 6.90-6.80 (m, 4H), 5.94 (d, J=7.5 Hz, 1H), 4.88 (t, J=5.6 Hz, 1H), 4.36 (t, J=5.1 Hz, 1H), 4.11 (dt, J=7.4, 3.6 Hz, 1H), 3.82 (ddd, J=11.9, 5.1, 3.1 Hz, 1H), 3.72 (d, J=1.3 Hz, 7H), 3.64 (ddd, J=11.9, 6.2, 4.2 Hz, 1H), 3.45 (qd, J=7.0, 4.9 Hz, 2H), 3.24 (s, 3H), 3.09 (ddd, J=9.9, 6.4, 3.2 Hz, 1H), 2.97 (ddd, J=9.9, 5.7, 3.2 Hz, 1H), 1.23 (s, OH), 1.06 (t, J=7.0 Hz, 1H).

    [0383] Preparation of 19: To a suspension of 18 (3.3 g, 4.8 mmol) in DCM (40.0 mL) was added DCI (0.5 g, 4.0 mmol) and CEP[N(iPr).sub.2].sub.2 (1.6 g, 5.3 mmol). The mixture was stirred at r.t. for 0.5 h. LC-MS showed 10 was consumed completely. The solution was washed with a solution of NaHCO.sub.3 twice and washed with brine and dried over Na.sub.2SO.sub.4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C.sub.18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in to give 19 (3.0 g, 3.9 mmol, 81.2% yield) as a white solid. ESI-LCMS: m/z=765.3 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.22 (s, 1H), 8.80-8.71 (m, 2H), 8.11-8.04 (m, 2H), 7.65 (t, J=7.3 Hz, 1H), 7.56 (t, J=7.5 Hz, 2H), 7.36-7.24 (m, 4H), 7.24-7.15 (m, 5H), 6.89-6.82 (m, 4H), 5.92 (d, J=7.7 Hz, 1H), 4.34 (dt, J=7.5, 3.5 Hz, 1H), 4.08 (ddd, J=10.7, 7.3, 2.7 Hz, 1H), 4.03-3.89 (m, 1H), 3.80-3.72 (m, 10H), 3.67-3.53 (m, 2H), 3.47 (dp, J=10.5, 3.4 Hz, 1H), 3.26 (s, 3H) 3.11 (ddd, J=10.3, 6.2, 3.5 Hz, 1H), 3.00 (q, J=6.6, 5.2 Hz, 1H), 2.77 (q, J=5.6 Hz, 2H), 2.08 (s, 1H), 1.15 (t, J=7.0 Hz, 12H); .sup.31P NMR (162 MHz, DMSO-d.sub.6) δ 148.30, 147.99.

    Example 8

    [0384] ##STR00215##

    [0385] Preparation of 19: To a solution of 8 (8.0 g, 22.0 mmol) in EtOH (50.0 mL) was added a solution of CH.sub.3NH.sub.2 (50.0 mL), then the reaction mixture was stirred at r.t. for 4 h, after the reaction, the solvent was concentrated to give the crude, which was added into a mixture solvent of EA (20.0 mL) and PE (10.0 mL), then the mixture was stirred for 30 min and filtered to get 19 (5.5 g, 96.5% yield), which was used directly to next step.

    [0386] Preparation of 20; (J. Chem. Soc., Perkin Trans. 1, 1992, 1943-1952) To a solution of 19 (5.0 g, 19.3 mmol) in H.sub.2O (50.0 mL) and AcOH (50.0 mL) was added NaNO.sub.2 (65.0 g, 772.0 mmol), then the reaction mixture was stirred at r.t. for 2 h, after the reaction, the reaction mixture was concentrated to give the crude product which was purified by silica gel column (DCM:MeOH=20:1 to 6:1) and MPLC (ACN:H.sub.2O=0:100 to 10:90) to give 20 (3.0 g, 59.6% yield). ESI-LCMS: m/z=261.2 (M+H).sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.29 (s, 1H), 7.66 (d, J=8.0 Hz, 1H), 5.67 (dd, J=17.5, 7.6 Hz, 2H), 4.74 (d, J=36.0 Hz, 2H), 3.86-3.63 (m, 1H), 3.58-3.40 (m, 6H).

    [0387] Preparation of 21: To a solution of 20 (3.0 g, 11.5 mmol) in pyridine (30.0 mL) was added DMTrCl (3.9 g, 11.5 mmol), then the reaction mixture was stirred at r.t. for 2 h, LC-MS showed that the raw material was 20.0% and The ratio of product to by-product was 3:1, then the mixture was poured into a solution of NaHCO.sub.3 (100.0 mL), and extracted with EA (100.0 mL), washed with brine and dried over Na.sub.2SO.sub.4, filtered and concentrated to get residue, which was purified by silica gel column to give The purified products and by-products were 5.0 g in total, then the product was purified by SFC to give 21 (1.8 g). ESI-LCMS: m/z=561.2 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.31 (s, 1H), 7.69 (d, J=8.1 Hz, 1H), 7.45-7.15 (m, 8H), 6.88 (d, J=8.5 Hz, 4H), 5.71 (d, J=6.8 Hz, 1H), 5.64 (d, J=8.0 Hz, 1H), 4.79 (t, J=5.5 Hz, 1H), 3.74 (s, 6H), 3.60 (s, 1H), 3.51 (d, J=5.5 Hz, 3H), 3.11 (d, J=6.7 Hz, 1H), 3.02 (d, J=7.0 Hz, 1H).

    [0388] Preparation of 22: To a solution of 21 (1.8 g, 3.2 mmol) in DCM (20.0 mL) was added CEP[N(iPr).sub.2].sub.2 (1.0 g, 3.4 mmol) and DCI (321.0 mg, 2.7 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 21 was consumed completely. The solution was washed with solution of NaHCO.sub.3 twice and washed with brine and dried over Na.sub.2SO.sub.4. Then concentrated to give a residue, which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C.sub.18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20.0 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=90/10; Detector, UV 254 nm. This resulted in to give 22 (2.0 g, 82% yield). ESI-LCMS: m/z=761.2 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.35 (s, 1H), 7.73 (dd, J=8.0, 2.0 Hz, 1H), 7.39 (d, J=7.4 Hz, 2H), 7.35-7.18 (m, 7H), 6.94-6.82 (m, 4H), 5.81-5.74 (m, 1H), 5.67 (d, J=8.0 Hz, 1H), 4.11-3.85 (m, 1H), 3.82-3.67 (m, 11H), 3.67-3.50 (m, 5H), 3.17-3.09 (m, 1H), 3.09-3.01 (m, 1H), 2.74 (td, J=5.8, 2.9 Hz, 2H), 1.13 (dd, J=9.2, 6.7 Hz, 13H); .sup.31P NMR (DMSO-d.sub.6) δ 148.09 (d, J=41.8 Hz).

    Example 9

    [0389] ##STR00216## ##STR00217## ##STR00218##

    [0390] Preparation of 2 (J. Chem. Soc., Perkin Trans. 1, 1992, 1943-1952): To a solution of 1 (150.0 g, 999.1 mmol) in DMF (1000.0 mL) was added P-TsOH (1.7 g, 10.0 mmol), then 2,2-dimethoxy-propane (312.2 g, 3.0 mol) was added to the reaction mixture. The reaction mixture was stirred for 5 h at r.t. 90.0% 1 was consumed by TLC. Then NaHCO.sub.3 (8.4 g, 99.9 mmol) was added to the reaction mixture, filtered out the solid after 30 min, and concentrated the organic phase by vacuum to obtain crude, which was purified by c.c. (PE:EA=1:1 to 0:1) to get compound 2 (115.0 g, 60.5% yield) as a white solid.

    [0391] Preparation of 22 (Rajkamal; Pathak, Navendu P.; Halder, Tanmoy; Dhara, Shubhajit; Yadav, Somnath[Chemistry-A European Journal, 2017, vol. 23, #47, p. 11323-11329]): A solution of 2 (115.0 g, 604.6 mmol) in pyridine (600.0 mL) was cooled to 0° C., then Ac.sub.2O (185.2 g, 1.81 mol) was added drop wise to the reaction mixture. The reaction was stirred for 2 h at r.t., and the raw material was consumed by TLC. The reaction solution was added into water, extracted product with EA. The organic phase was washed with brine, and dried the organic phase with Na.sub.2SO.sub.4, and concentrated to get 22 (150.0 g, 90.4% yield), which was used for next step directly. .sup.1H NMR (400 MHz, Chloroform-d) δ 6.20 (d, J=3.4 Hz, 1H), 5.66 (d, J=6.8 Hz, 1H), 5.17 (t, J=6.9 Hz, 1H), 5.10 (dd, J=7.0, 3.4 Hz, 1H), 4.40-4.25 (m, 3H), 4.21 (dd, J=7.0, 6.1 Hz, 1H), 4.16-4.02 (m, 3H), 3.95 (dd, J=12.9, 4.4 Hz, 1H), 2.17 (s, 1H), 2.15-2.03 (m, 12H), 1.56 (d, J=4.0 Hz, 6H), 1.37 (d, J=3.1 Hz, 6H).

    [0392] Preparation of 23: To a solution of 22 (150.0 g, 546.9 mmol) in ACN (2200.0 mL) was added 6-chloroguanine (139.1 g, 820.4 mmol) and BSA (333.7 g, 1.6 mol) at r.t., then the reaction mixture was replaced with N.sub.2 over 3 times. The reaction was stirred for 30 min at 50° C. After that, the reaction mixture was cooled to 0° C. under N.sub.2. Then TMSOTf (182.1 g, 820.4 mmol) was added into the mixture. After addition, the reaction was stirred for 1.5 h at 70° C. TLC and LC-MS showed the raw material was consumed. Concentrated the most organic solvent by vacuum, then the residual was added to an aqueous solution of NaHCO.sub.3 in ice-water, extracted product with EA (4.0 L), dried the organic phase over Na.sub.2SO.sub.4, and filtered and concentrated to get crude, which was purified by c.c. (DCM to DCM:EA=5:1) to get compound 23 (82.0 g, 35.0% yield) as a white solid. ESI-LCMS: m/z=384.8 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.23 (s, 1H), 7.04 (d, J=22.3 Hz, 2H), 5.57 (d, J=9.6 Hz, 1H), 5.40 (dd, J=9.6, 7.3 Hz, 1H), 4.48 (dd, J=7.4, 5.4 Hz, 1H), 4.40-4.30 (m, 2H), 4.11 (dd, J=13.6, 2.4 Hz, 1H), 1.81 (s, 3H), 1.55 (s, 3H), 1.34 (s, 3H).

    [0393] Preparation of 24: To a solution of 23 (82.0 g, 192.3 mmol) in DCM (1000.0 mL) was added Et.sub.3N (59.4 g, 576.9 mmol) and DMAP (2.4 g, 19.2 mmol) at r.t. The reaction mixture was replaced with N.sub.2 over 3 times, then MMTrCl (90.9 g, 288.4 mmol) was added into the mixture. The reaction mixture was stirred at r.t. overnight. TLC and LC-MS showed that 92.0% raw material was consumed, and the reaction mixture was added to an aqueous solution of NaHCO.sub.3 in ice-water, then extracted product with EA. Washed the organic phase with brine, and dried the organic phase over Na.sub.2SO.sub.4, then concentrated to get crude, which was purified by c.c. (DCM) to give compound 24 (110.0 g, 86.4% yield) as a white solid. ESI-LCMS: m/z=657.1 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.21 (s, 1H), 7.37-7.31 (m, 4H), 7.29-7.23 (m, 6H), 7.20-7.15 (m, 2H), 6.86-6.80 (m, 2H), 5.75 (s, 1H), 5.23 (dd, J=9.6, 7.2 Hz, 1H), 4.85 (s, 1H), 4.44-4.16 (m, 3H), 3.71 (s, 4H), 1.70 (s, 3H), 1.49 (s, 3H), 1.31 (s, 3H).

    [0394] Preparation of 25: To a solution of 24 (110.0 g, 164.3 mmol) in a mixed solvent of THF (500.0 mL) and MeOH (160.0 mL) was added NH.sub.4OH (330.0 mL). The reaction mixture was stirred overnight at r.t., and the raw material was consumed by TLC and LC-MS. The reaction liquid was added into water, extracted product with EA. Washed the organic phase with brine, then dried the organic phase over Na.sub.2SO.sub.4, then concentrated to get the crude, which was purified by c.c. (PE:EA=10:1-1:2) to give compound 25 (98.0 g, 94.2% yield) as a white solid. ESI-LCMS: m/z=615.1 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.32 (s, 1H), 7.36 (dt, J=8.2, 1.4 Hz, 4H), 7.31-7.21 (m, 6H), 7.15 (t, J=7.2 Hz, 2H), 6.85-6.76 (m, 2H), 5.57 (d, J=4.6 Hz, 1H), 4.69 (s, 1H), 4.25 (dt, J=5.1, 2.4 Hz, 1H), 4.03 (q, J=7.1 Hz, 4H), 3.70 (s, 3H), 3.62-3.44 (m, 1H), 1.51 (s, 3H), 1.31 (s, 3H).

    [0395] Preparation of 26 (Ref WO2011/95576, 2011, A1): To a solution of 25 (70.0 g, 114.0 mmol) in CH.sub.3I (350.0 mL) was added Ag.sub.2O (79.2 g, 342.0 mmol) at r.t. Then the reaction mixture was stirred for 4 h at r.t. TLC and LC-MS showed that the raw material was consumed. Filtered out the residue with diatomite, and concentrated the filtrate by vacuum to get crude, which was purified by c.c. (PE:EA=10:1-1:1) to get compound 26 (28.0 g, 31.3% yield) as a white solid. ESI-LCMS: m/z=629.1 [M+H].sup.+.

    [0396] Preparation of 27: A solution of 3-hydroxy-propionitrile (15.6 g, 219.7 mmol) in THF (200.0 mL) was cooled to 0° C. The reaction mixture was replaced by N.sub.2 over 3 times. Then NaH (12.4 g, 310.0 mmol, 60.0%) was added to the reaction mixture in turn. The reaction was stirred for 30 min at r.t., and then the reaction was cooled to 0° C. again. A solution of 26 (26.0 g, 33.0 mmol) in THF (150.0 mL) was added drop wise to the reaction mixture. Then the reaction mixture was stirred at r.t. overnight. TLC and LC-MS showed the raw material was consumed. The reaction liquid was added into water, extracted product with EA. The organic phase was washed with brine, and dried over Na.sub.2SO.sub.4, then concentrated to get the crude, which was purified by c.c. (DCM:MeOH=50:1-30:1) to get compound 27 (18.0 g, 88.0% yield) as white solid. ESI-LCMS: m/z=610.7 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 10.68 (s, 1H), 7.90 (s, 1H), 7.69 (s, 1H), 7.34-7.15 (m, 12H), 6.92-6.81 (m, 2H), 4.46 (d, J=9.5 Hz, 1H), 4.22 (dt, J=5.5, 2.5 Hz, 1H), 4.07 (t, J=6.4 Hz, 1H), 3.84 (dd, J=13.5, 2.1 Hz, 1H), 3.64-3.54 (m, 1H), 3.36 (dd, J=13.3, 2.8 Hz, 1H), 3.08 (s, 3H), 2.59 (t, J=6.0 Hz, 3H), 1.49 (s, 3H), 1.30 (s, 3H).

    [0397] Preparation of 28 (Beigelman, Leonid; Deval, Jerome; Jin, Zhinan WO2014/209979, 2014, A1): To a solution of 27 (18.0 g, 29.5 mmol) in DCM (300.0 mL) was added triethylsilane (70.0 mL) and DCA (10.0 mL) at r.t. Then the reaction mixture was stirred for 6 h at r.t., TLC and LC-MS showed that the raw material was consumed. Concentrated the almost organic solvent by vacuum, then PE (600.0 mL) was added to the reaction mixture. Filtered of the organic phase to get the solid, which was purified by MPLC (MeCN:H.sub.2O=40:60 to 50:50) to get compound 28 (7.5 g, 75.0% yield) as a white solid. ESI-LCMS: m/z=338.3 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 10.70 (s, 1H), 8.03 (s, 1H), 6.49 (s, 2H), 5.15 (d, J=9.6 Hz, 1H), 4.28 (d, J=5.1 Hz, 2H), 4.20 (d, J=13.6 Hz, 1H), 3.93 (ddd, J=13.3, 10.6, 3.7 Hz, 2H), 3.26 (s, 3H), 1.59 (s, 3H), 1.33 (s, 3H);

    [0398] Preparation of 29: A solution of 28 (7.0 g, 20.6 mmol) in Pyr (150.0 mL) was cooled to 0° C. Then the reaction mixture was added i-BuCl (6.6 g, 61.8 mmol) drop wise. The reaction mixture was stirred for 30 min, TLC and LC-MS showed the raw material was consumed. The reaction liquid was added to ice-water, extracted product with EA. The organic phase was washed with brine, and dried over Na.sub.2SO.sub.4, and filtered and concentrated to get the crude, which was purified by c.c. (DCM:MeOH=100:1-30:1) to get compound 29 (5.8 g, 68.6% yield) as a white solid. ESI-LCMS: m/z=409.4 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 12.13 (s, 1H), 11.66 (s, 1H), 8.39 (s, 1H), 5.24 (d, J=9.6 Hz, 1H), 4.36-4.23 (m, 3H), 3.99-3.88 (m, 2H), 3.27 (s, 4H), 2.78 (hept, J=6.8 Hz, 1H), 1.61 (s, 3H), 1.35 (s, 3H), 1.12 (d, J=6.8 Hz, 6H).

    [0399] Preparation of 30: A solution of 29 (5.8 g, 14.1 mmol) was added into a mixed solvent of HCOOH (54.0 mL) and H.sub.2O (6.0 mL) at r.t. Then reaction mixture was stirred for 1 h at r.t. TLC and LC-MS showed the raw material was consumed. Concentrated the reaction solution by vacuum at r.t. to get compound 30 (5.2 g, 14.0 mmol, 98.0% yield), which was used for next step directly. ESI-LCMS: m/z=368.4 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 12.13 (s, 1H), 11.72 (s, 1H), 8.30 (s, 1H), 8.14 (s, 2H), 5.19 (d, J=9.2 Hz, 1H), 3.93 (t, J=9.2 Hz, 1H), 3.85 (dd, J=12.4, 1.9 Hz, 1H), 3.77 (d, J=3.7 Hz, 1H), 3.69-3.62 (m, 2H), 3.20 (s, 3H), 2.79 (h, J=6.8 Hz, 1H), 1.13 (dd, J=6.9, 1.2 Hz, 6H).

    [0400] Preparation of 31: To a solution of 30 (5.2 g, 14.0 mmol) in dioxane (90.0 mL) and H.sub.2O (30.0 mL) was added NaIO.sub.4 (3.7 g, 15.4 mmol) at r.t. The reaction mixture was stirred for 3 h at r.t. LC-MS showed the raw material was consumed, and the reaction solution was cooled to 0° C. Then NaBH.sub.4 (970.0 mg, 25.2 mmol) was added to the reaction mixture, and the raw material was consumed after 3 h by LC-MS. The reaction liquid was quenched with ammonium chloride, and adjusted the pH to 6-7 with 1N HCl, the mixture solution was concentrated to get the crude, which was purified by c.c. (DCM:MeOH=100:1-30:1) to get compound 31 (4.0 g, 68.6% yield) as a white solid. ESI-LCMS: m/z=370.4 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.91 (d, J=151.0 Hz, 2H), 8.62-8.51 (m, 1H), 8.18 (s, 1H), 7.44-7.33 (m, 1H), 5.62 (d, J=7.9 Hz, 1H), 4.84 (t, J=5.7 Hz, 1H), 4.65 (d, J=5.2 Hz, 1H), 3.84 (dd, J=7.7, 3.5 Hz, 1H), 3.76 (ddd, J=12.1, 4.7, 2.7 Hz, 1H), 3.60 (ddd, J=12.0, 5.8, 3.6 Hz, 1H), 3.46 (d, J=8.8 Hz, 2H), 3.16 (s, 3H), 2.77 (h, J=6.8 Hz, 1H), 1.12 (dd, J=6.8, 2.4 Hz, 6H);

    [0401] Preparation of 32: A solution of 31 (4.0 g, 6.4 mmol) was dissolved in pyridine (100.0 mL), and the reaction mixture was replaced by N.sub.2 over 3 times, and then DMTrCl (5.1 g, 8.9 mmol) was added to the reaction mixture at r.t. Then the reaction was stirred for 30 min, TLC and LC-MS showed raw material was consumed. The reaction liquid was added into ice-water, and extracted product with EA. The organic phase was washed with brine, and dried the organic phase over Na.sub.2SO.sub.4, and concentrated to get crude, which was purified by c.c. (DCM:MeOH=100:1-30:1) and SFC to get compound 32 (2.7 g, 37.1% yield) as a white solid. ESI-LCMS: m/z=672.7 [M+H].sup.+; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 11.50 (s, 2H), 8.22 (s, 1H), 7.32-7.24 (m, 4H), 7.22-7.12 (m, 5H), 6.84 (dd, J=9.0, 2.4 Hz, 4H), 5.63 (d, J=7.9 Hz, 1H), 4.85 (t, J=5.6 Hz, 1H), 3.95 (dt, J=7.4, 3.3 Hz, 1H), 3.85-3.77 (m, 1H), 3.73 (s, 7H), 3.65-3.57 (m, 1H), 3.43 (ddt, J=9.9, 6.9, 3.4 Hz, 1H), 3.05 (ddd, J=10.0, 6.2, 3.3 Hz, 1H), 2.96 (ddd, J=10.0, 5.6, 3.4 Hz, 1H), 2.78 (p, J=6.8 Hz, 1H), 1.11 (d, J=6.7 Hz, 6H).

    [0402] Preparation of 33: To a solution of 32 (2.7 g, 2.4 mmol) in DCM (35.0 mL) was added DCI (390.0 mg, 2.0 mmol) at r.t. Then CEP [N (iPr).sub.2].sub.2 (1.2 g, 2.5 mmol) was added to the reaction mixture, then reaction mixture was stirred for 30 min at r.t. LC-MS showed raw material was consumed. The reaction liquid was added to an aqueous solution of NaHCO.sub.3 into ice-water, and extracted product with DCM, washed the organic phase with brine, and dried the organic phase over Na.sub.2SO.sub.4, then filtered and concentrated to give a residue, which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20.0 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=100/0; Detector, UV 254 nm. This resulted in to give compound 33 (2.0 g, 56.4% yield) as a white solid. ESI-LCMS: m/z=872.3 [M+H].sup.+; 1H NMR (400 MHz, DMSO-d.sub.6) δ 11.79 (s, 2H), 8.23 (d, J=1.7 Hz, 1H), 7.35-7.07 (m, 9H), 6.92-6.75 (m, 4H), 5.52 (d, J=8.0 Hz, 1H), 4.21 (s, 1H), 4.10-3.99 (m, 1H), 3.84-3.65 (m, 10H), 3.63-3.52 (m, 2H), 3.45 (ddd, J=10.2, 6.7, 3.6 Hz, 1H), 3.34 (s, 1H), 3.22 (s, 3H), 3.07 (ddd, J=10.2, 6.4, 3.4 Hz, 1H), 2.97 (ddd, J=10.0, 5.6, 3.5 Hz, 1H), 2.78 (dt, J=12.2, 6.4 Hz, 3H), 1.20-1.05 (m, 18H), .sup.31P NMR (162 MHz, DMSO-d.sub.6) δ 148.20, 147.13.

    Example 10

    [0403] ##STR00219## ##STR00220## ##STR00221##

    Example 11

    [0404] ##STR00222##

    [0405] Preparation of 2: To a solution of 1-bromonaphthalene (5.2 g, 25.0 mmol) in dry THF (100.0 mL) was added n-BuLi (13.5 mL, 21.7 mmol, 1.6 M) drop wise at −78° C., then the mixture was stirred at −78° C. for 0.5 h, after that, a solution of 1 (5.5 g, 16.7 mmol) in THF (20.0 mL) was added into the mixture drop wise maintaining inner temperature below −70° C., then the reaction mixture was stirred for 1 h at −70° C. LC-MS showed 1 was consumed completely, the reaction was quenched with saturated ammonium chloride solution (80.0 mL) and extracted with EA, The organic layer was washed with brine, dried over Na.sub.2SO.sub.4, and concentrated under reduced pressure to give a residue, which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C.sub.18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=2/3 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=4/1 within 25 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=3/2; Detector, UV 254 nm. This resulted in to give 2 (5.8 g, 76.3% yield) as a white solid. ESI-LCMS: m/z 441 [M−OH].sup.−.

    [0406] Preparation of 3: To the solution of 2 (5.8 g, 12.6 mmol) in DCM (100.0 mL) was added TES (1.7 g, 14.7 mmol) at −78° C., BF.sub.3. Et.sub.2O (2.7 g, 18.9 mmol) was added into the mixture drop-wise at −78° C. The mixture was stirred at −40° C. for 1 h. LC-MS showed 2 was consumed completely, the solution was added into a saturated sodium bicarbonate solution (50.0 mL) and extracted with DCM. The organic layer was washed with brine, dried over Na.sub.2SO.sub.4, and concentrated under reduced pressure to give a residue, which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C.sub.18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=2/3 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=4/1 within 25 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=7/3; Detector, UV 254 nm. This resulted in to give 3 (2.7 g, 48.2%) as a white solid. ESI-LCMS: m/z 460 [M+H.sub.2O]; .sup.1H-NMR (600 MHz, CDCl.sub.3): δ 8.01-8.00 (d, J=6.5 Hz, 1H), 7.88-7.87 (d, J=7.6 Hz, 2H), 7.77-7.76 (d, J=8.2 Hz, 1H), 7.56-7.49 (m, 2H), 7.38-7.23 (m, 11H), 6.98-5.94 (d, J=26.9 Hz, 1H), 5.09-4.99 (dd, J=61.1 Hz, 1H), 4.71-4.69 (d, J=11.6 Hz, 1H), 4.66-4.59 (m, 2H), 4.43-4.41 (d, J=11.6 Hz, 2H), 4.14-4.08 (m, 1H), 4.02-4.00 (dd, J=13.4 Hz, 1H), 3.81-3.78 (dd, J=14.8 Hz, 1H); .sup.19F-NMR (CDCl.sub.3): δ−193.24.

    [0407] Preparation of 4: To a solution of 3 (2.7 g, 6.0 mmol) in dry DCM (40.0 mL) was added BCl.sub.3 (36.0 mL, 36.0 mmol, 1 M) drop wise at −78° C., and the reaction mixture was stirred at −78° C. for 0.5 h. LC-MS showed 3 was consumed completely. After completion of reaction, the resulting mixture was quenched with MeOH (20.0 mL), then neutralized with sodium hydroxide solution (40.0 mL, 2 M). The mixture was extracted with DCM and concentrated to give a crude, the crude was dissolved in MeOH (30.0 mL) and added a sodium hydroxide solution (30.0 mL, 4 M), and the mixture was stirred at r.t. for 30 min. The mixture was extracted with EA, the organic layer was washed with brine, dried over Na.sub.2SO.sub.4, and concentrated under reduced pressure to give a residue, which was purified by silica gel column chromatography (DCM:MeOH=40:1-15:1) to give 4 (1.3 g, 81.2%) as a white solid. ESI-LCMS: m/z 261 [M−H].sup.−; .sup.1H-NMR (DMSO-d.sub.6): δ 7.98-7.97 (d, J=10.2 Hz, 2H), 7.89-7.87 (m, 2H), 7.63-7.49 (m, 3H), 5.80-5.76 (d, J=26.3 Hz, 1H), 5.43 (s, 1H), 5.00 (s, 1H), 4.85-4.76 (d, J=58.4 Hz, 1H), 4.03-3.85 (m, 3H), 3.68-3.66 (m, 1H), 3.65-3.53 (m, 1H); .sup.19F-NMR (DMSO-d.sub.6): δ−192.76.

    [0408] Preparation of 5: To a solution of 4 (1.3 g, 5.0 mmol) in pyridine (20.0 mL) was added DMTrCl (6.1 g, 16.0 mmol) at r.t. The reaction mixture was stirred at r.t. for 1 h. The LC-MS showed 4 was consumed and water (100.0 mL) was added. The product was extracted with EA and the organic layer was washed with brine and dried over Na.sub.2SO.sub.4, concentrated to give the crude, which was further purified by silica gel (EA:PE=1:30-1:10) to give 5 (2.2 g, 78.5%) as a yellow solid. ESI-LCMS: m/z 563 [M−H].sup.−; .sup.1H-NMR (600 MHz, DMSO-d.sub.6): δ 8.03-7.99 (m, 2H), 7.91-7.86 (m, 2H), 7.64-7.57 (m, 2H), 7.49-7.48 (d, J=6.8 Hz, 2H), 7.40-7.24 (m, 8H), 6.89-6.88 (m, 4H), 5.92-5.88 (d, J=26.6 Hz, 1H), 5.50-5.49 (d, J=4.5 Hz, 1H), 4.96-4.87 (d, J=56.2 Hz, 1H), 4.18-4.14 (m, 2H), 3.74 (s, 6H), 3.42-3.40 (d, J=9.9 Hz, 1H), 3.33 (m, 2H); .sup.19F-NMR (DMSO-d.sub.6): δ−192.18.

    [0409] Preparation of 6: To a suspension of 5 (2.2 g, 3.9 mmol) in DCM (20.0 mL) was added DCI (391.0 mg, 3.3 mmol) and CEP[N(iPr).sub.2].sub.2 (1.4 g, 4.7 mmol). The mixture was stirred at r.t. for 1 h. The LC-MS showed 5 was consumed completely. The solution was washed with a saturated sodium bicarbonate solution and brine successively, dried over Na.sub.2SO.sub.4, concentrated to give the crude, which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C.sub.18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in to give 6 (2.5 g, 83.8%) as a white solid. ESI-LCMS: m/z 765 [M+H].sup.+; .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ 8.07-7.86 (m, 4H), 7.64-7.56 (m, 2H), 7.49-7.45 (m, 2H), 7.41-7.21 (m, 8H), 6.89-6.84 (m, 4H), 6.02-5.93 (m, 1H), 5.19-4.98 (m, 1H), 4.61-4.34 (m, 1H), 4.26-4.24 (m, 1H), 3.74-3.73 (m, 6H), 3.70-3.61 (m, 1H), 3.57-3.42 (m, 4H), 3.29-3.24 (m, 1H), 2.67-2.64 (m, 1H), 2.56-2.52 (m, 1H), 1.09-1.04 (m, 1H), 0.98-0.97 (d, J=6.7 Hz, 3H), 0.89-0.87 (d, J=6.7 Hz, 3H); .sup.19F-NMR (DMSO-d.sub.6): δ−191.75,−191.76,−191.84,−191.85; .sup.31P-NMR (DMSO-d.sub.6): δ 149.51, 149.47, 149.16, 149.14.

    Example 12

    [0410] ##STR00223## ##STR00224##

    Preparation of ALG-14-5-008B

    [0411] To a solution of PH-ALIG-14-4-8 (from Example 5) (6.6 g, 10.86 mmol, 85% purity, 1 eq) and DBU (3.31 g, 21.72 mmol, 3.27 mL, 2 eq) in DMF (70 mL) was added BOMCl (2.55 g, 16.29 mmol, 2.26 mL, 1.5 eq) at 0° C. The mixture was stirred at 20° C. for 12 h. The mixture was diluted with EtOAc (180 mL) and washed with H.sub.2O (80 mL*3), and brine (80 mL), dried over Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 80 g SepaFlash® Silica Flash Column, Eluent of 10-60%, EtOAc/PE gradient @ 60 mL/min) to give ALG-14-5-008B (5.2 g, 70% yield) as a white foam. LCMS (ESI): m/z 659.1.; .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ=7.63 (d, J=8.3 Hz, 1H), 7.40-7.15 (m, 14H), 6.85 (t, J=8.0 Hz, 4H), 5.97 (s, 1H), 5.75 (d, J=8.0 Hz, 1H), 5.39-5.26 (m, 2H), 5.24 (d, J=2.0 Hz, 1H), 4.61 (s, 2H), 3.97 (s, 1H), 3.94-3.83 (m, 2H), 3.68 (d, J=10.0 Hz, 6H), 3.38 (s, 1H)

    Preparation of ALG-14-5-009 A

    [0412] To a solution of ALG-14-5-008B (5.2 g, 8.17 mmol, 1 eq) and dimethoxyphosphorylmethyl trifluoromethanesulfonate (6.67 g, 24.50 mmol, 3 eq) in THF (50 mL) was added NaH (816.65 mg, 20.42 mmol, 60% purity, 2.5 eq) at −5° C. The mixture was stirred at 0° C. for 0.5 h. The reaction mixture was quenched by addition H.sub.2O (50 mL) and diluted with EtOAc (100 mL), then washed with H.sub.2O (50 mL), brine (50 mL), the organic layer was dried over Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The residue was purified by flash silica gel chromatography (ISCO®; 80 g SepaFlash® Silica Flash Column, Eluent of 0-50%, EtOAc/DCM gradient @ 60 mL/min) to give ALG-14-5-009 A (4.2 g, 66.42% yield) as a white foam. LCMS (ESI): m/z 781.1 [M+Na].sup.+, .sup.1H NMR (400 MHz, CDCl.sub.3) δ=7.49-7.25 (m, 14H), 7.21-7.15 (m, 1H), 6.82 (d, J=8.8 Hz, 4H), 6.46 (s, 1H), 5.65 (d, J=8.2 Hz, 1H), 5.57-5.39 (m, 2H), 4.72 (s, 2H), 4.16-4.07 (m, 2H), 3.93 (dd, J=2.6, 10.8 Hz, 1H), 3.81-3.59 (m, 11H), 3.81-3.59 (m, 1H), 3.24 (dd, J=10.6, 13.5 Hz, 1H), 3.10 (dd, J=9.8, 13.3 Hz, 1H), 2.79 (d, J=2.2 Hz, 1H).sup.31P NMR (CD.sub.3CN) δ=22.37 (s)

    Preparation of ALG-14-5-010 A

    [0413] To a solution of ALG-14-5-009 A (4.6 g, 6.06 mmol, 1 eq) and NaI (2.73 g, 18.19 mmol, 3 eq) in MeCN (15 mL) was added chloromethyl 2,2-dimethylpropanoate (3.65 g, 24.25 mmol, 3.51 mL, 4 eq). The mixture was stirred at 85° C. for 24 h. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, Eluent of 0-50%, EtOAc/PE gradient @ 40 mL/min) to give ALG-14-5-010 A (2.7 g, 44.6% yield) as a pale yellow solid. LCMS (m/z): 981.1 [M+Na].sup.+.

    Preparation of ALG-14-5-010C

    [0414] To a solution of ALG-14-5-010 A (2.7 g, 2.82 mmol, 1 eq) in DCM (20 mL) was added Et.sub.3SiH (645.45 mg, 2.82 mmol, 5 mL, 1 eq), followed by addition of TFA (1.54 g, 13.51 mmol, 1 mL, 4.80 eq). The mixture was stirred at 20° C. for 0.5 h. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 24 g SepaFlash® Silica Flash Column, Eluent of 0-50%, EtOAc/DCM gradient @ 30 mL/min) to give ALG-14-5-010C (1.6 g, 84.82% yield) as a pale yellow solid. LCMS (ESI): m/z 679.1 [M+Na].sup.+; .sup.1H NMR (400 MHz, CDCl.sub.3) δ=7.44 (d, J=8.2 Hz, 1H), 7.38-7.26 (m, 5H), 5.76 (d, J=8.2 Hz, 1H), 5.69-5.62 (m, 4H), 5.51-5.43 (m, 1H), 5.51-5.43 (m, 1H), 4.70 (s, 2H), 4.30 (s, 1H), 4.26-4.06 (m, 4H), 3.90 (dd, J=4.9, 8.4 Hz, 2H), 3.22-3.06 (m, 1H), 1.22 (s, 18H).sup.31P NMR (162 MHz, CD.sub.3CN) δ=20.25 (s, 1P).

    Preparation of ALG-14-5-011 A

    [0415] To a mixture of ALG-14-5-010C (1.4 g, 2.13 mmol, 1 eq) in isopropanol (20 ml) and H.sub.2O (2 mL) added Pd/C (1.4 g) and HCOOH (51.22 mg, 1.07 mmol, 2 mL) under N.sub.2. The suspension was degassed under vacuum and purged with H.sub.2 several times. The mixture was stirred under H.sub.2 (15 PSI) at 15° C. for 5 h. The reaction mixture was filtered and the filtrate was concentrated to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 24 g SepaFlash® Silica Flash Column, Eluent of 0-50%, EtOAc/DCM gradient @ 30 mL/min) to give ALG-14-5-011 A (848 mg, 74.14% yield) as a white foam. LCMS (ESI): m/z 537.0 [M+H].sup.+; .sup.1H NMR (400 MHz, CDCl.sub.3) δ=10.01 (s, 1H), 7.53 (d, J=8.0 Hz, 1H), 5.78-5.63 (m, 6H), 4.40 (s, 1H), 4.35-4.22 (m, 3H), 4.11 (d, J=1.5 Hz, 1H), 3.88 (d, J=8.5 Hz, 2H), 1.22 (s, 18H).sup.31P NMR (162 MHz, CD.sub.3CN) δ=20.17 (s, 1P.)

    Preparation of ALG-14-5

    [0416] To a solution of ALG-14-5-011 A (848 mg, 1.58 mmol, 1 eq) in DCM (10 mL) was added 3-bis(diisopropylamino)phosphanyloxypropanenitrile (571.73 mg, 1.90 mmol, 602.45 uL, 1.2 eq) at 0° C., followed by addtion of 1H-imidazole-4,5-dicarbonitrile (186.7 mg, 1.58 mmol, 1 eq). The mixture was stirred at 15° C. for 1 h. The reaction mixture was quenched by addition of sat. aq. NaHCO.sub.3 (10 mL) and diluted with DCM (20 mL). Then the organic layer was washed with sat. aq. NaHCO.sub.3 (10 mL*2), dried over Na.sub.2S04, filtered and concentrated under reduced pressure. The residue was purified by flash silica gel chromatography (ISCO®; 12 g SepaFlash® Silica Flash Column, Eluent of 0-50%, phase A: PE with 0.5% TEA; phase B: EA with 10% EtOH, 30 mL/min) to give ALG-14-5 (720 mg, 61.21% yield) as a colorless oil. LCMS (ESI): m/z 737.1 [M+H].sup.+; .sup.1H NMR (400 MHz, CD.sub.3CN) δ=9.17 (s, 1H), 7.49 (d, J=8.0 Hz, 1H), 5.91-5.77 (m, 1H), 5.65-5.54 (m, 5H), 4.49-4.26 (m, 2H), 4.23-4.07 (m, 2H), 3.92-3.55 (m, 6H), 2.71-2.61 (m, 2H), 1.24-1.16 (m, 30H); .sup.31P NMR (162 MHz, CD.sub.3CN) δ=151.59.

    Example 13: Synthesis of 102

    [0417] ##STR00225##

    Example 14: Synthesis of 103

    [0418] ##STR00226##

    Example 15: Synthesis of 104

    [0419] ##STR00227## ##STR00228##

    Example 16: Synthesis of 105

    [0420] ##STR00229##

    Example 17

    [0421] ##STR00230## ##STR00231##

    [0422] Preparation of 2: A 2 L three-necked round bottom flask equipped with magnetic stirrer and thermometer was charged with 1 (60.0 g, 228.8 mmol) in dry DMF (600.0 mL) at r.t., imidazole (95.2 g, 1.3 mol) was added into the mixture reaction, then the reaction mixture was cooled down to turn 5° C., TBSCl (76.8 g, 499.3 mmol) was added into the mixture reaction, the reaction mixture was allowed to stir for 12 h at r.t. 1 was consumed by LCMS, then the reaction mixture was added in the saturated sodium bicarbonate solution (1.0 L), after quenching the reaction, the aqueous layer was extracted with EA (400.0 mL*2), the combined organic layer was washed with saturated brine and dried over anhydrous sodium sulfate, the organic layer was concentrated to get crude 2 (110.2 g, 212.8 mmol, 93.1% yield) as a white solid, the crude product was used directly for the next step without purification. ESI-LCMS: m/z=487.3 [M+H].sup.+.

    [0423] Preparation of 3: A 3 L three-necked round bottom flask equipped with magnetic stirrer and thermometer was charged with 2 (117.0 g, 225.9 mmol) in THF (550.0 mL) at r.t., water (275.0 mL) was added into the mixture reaction, then the reaction mixture was cooled down to turn 0° C. and add TFA (275.0 mL) by constant pressure funnel after 4 h, the reaction mixture was allowed to stir for 2 h at 0° C. 2 was consumed by TLC. Then, reaction mixture was added in a mixture solvent of ammonium hydroxide (250.0 mL) and water (800.0 mL) at 0° C., after quenching the reaction, the aqueous layer was extracted with EA (500.0 mL*2), the combined organic layer was washed with saturated brine and dried over anhydrous sodium sulfate, the organic layer was concentrated to get crude which was purified by silica gel column chromatography (PE:EA=10:1 to 0:1) to give compound 3 (51.1 g, 59.3% yield) as a white solid. .sup.1H-NMR (600 MHz, DMSO-d.sub.6): δ=11.35 (s, 1H), 7.919 (d, J=6 Hz, 1H), 5.82 (s, 1H), 5.65 (d, J=6 Hz, 1H), 5.18 (s, 1H), 4.29 (s, 1H), 3.83 (s, 2H), 3.65 (d, J=12 Hz, 1H), 3.53 (d, J=6 Hz, 1H), 3.32 (d, J=6 Hz, 1H), 0.87 (s, 9H), 0.08 (s, 6H). ESI-LCMS: m/z=373.1 [M+H].sup.+.

    [0424] Preparation of 4: A 3 L three-necked round bottom flask equipped with magnetic stirrer and thermometer was charged with 3 (50.0 g, 131.5 mmol) in a mixture solvent of DCM (250.0 mL) and DMF (70.0 mL) at r.t., the mixture solution was cooled down to turn 5° C., PDC (63.1 g, 164.4 mmol) and t-BuOH (200.0 mL) were added into the mixture reaction, keep the reaction at 5° C. and add Ac.sub.2O (130.0 mL) by constant pressure funnel after 0.5 h, the reaction mixture was allowed to stir for 4 h at r.t. 3 was consumed by lc-ms, then the reaction mixture was added in the saturated sodium bicarbonate (400.0 mL), after quenching the reaction, the aqueous layer was extracted with DCM (500.0 mL*2), the combined organic layer was washed with saturated brine and dried over anhydrous sodium sulfate, the organic layer was concentrated to get crude which was purified by silica gel column chromatography (PE:EA=10:1 to 2:1) to give compound 4 (29.8 g, 50.6% yield) as a white solid. .sup.1H-NMR (DMSO d.sub.6): δ=11.42 (s, 1H), 8.04 (d, J=6 Hz, 1H), 5.82 (s, 1H), 5.78 (d, J=6 Hz, 1H), 4.44 (s, 1H), 4.25 (s, 1H), 3.84 (s, 1H), 3.32 (s, 3H), 1.46 (s, 9H), 0.89 (s, 9H), 0.12 (s, 6H). ESI-LCMS: m/z=443.1 [M+H].sup.+.

    [0425] Preparation of 5: To a solution of 4 (33.0 g, 74.7 mmol) in dry THF (330.0 mL) was added CH.sub.3OD (66.0 mL) and D.sub.2O (33.0 mL) at r.t. Then the reaction mixture was added NaBD.sub.4 (9.4 g, 224.0 mmol) three times per an hour at 50° C. The solution was stirred at 50° C. for 3 h. LCMS showed 4 was consumed. Water (300.0 mL) was added. The product was extracted with EA (2*300.0 mL). The organic layer was washed with brine and dry over by Na.sub.2SO.sub.4. Then the solution was concentrated under reduced pressure, crude was purified by by silica gel column chromatography (PE:EA=10:1 to 3:1) to give 5 (19.1 g, 68.5% yield) as a white solid. .sup.1H-NMR (600 MHz, DMSO d.sub.6): δ=11.35 (s, 1H), 7.92-7.91 (d, J=6 Hz, 1H), 5.83-5.82 (d, J=6 Hz, 1H), 5.66-5.65 (d, J=6 Hz, 1H), 5.14 (s, 1H), 4.30-4.28 (m, 1H), 3.84-3.82 (m, 2H), 3.34 (s, 3H), 0.88 (s, 9H), 0.09 (s, 6H). ESI-LCMS: m/z 375 [M+H].sup.+.

    [0426] Preparation of 6: To a solution of 5 (19.1 g, 51.1 mmol) in dry ACN (190.0 mL) was added Et.sub.3N (20.7 g, 204.6 mmol) at r.t. and TMSCl (11.1 g, 102.1 mmol) at 0° C. Then the reaction mixture was stirred at r.t. for 40 min. LCMS showed 5 was consumed and an intermediate was formed. Then the solution was added DMAP (12.5 g, 102.3 mmol), Et.sub.3N (10.3 g, 102.1 mmol) and TPSCl (23.2 g, 76.6 mmol). The reaction mixture was stirred at r.t. for 15 h. LCMS showed the intermediate was consumed and conformed another intermediate. Then was added NH.sub.4OH (200.0 mL) and stirred at r.t. for 24 h to give the mixture of product. The product was extracted with EA (2*200.0 mL). The organic layer was washed with brine and dry over by Na.sub.2SO.sub.4. Then the solution was concentrated under reduced pressure, crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O=1/2 increasing to CH.sub.3CN/H.sub.2O=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O=1/0; Detector, UV 254 nm. This resulted in to give 6 (14.0 g, 73.7% yield). .sup.1H-NMR (DMSO-d.sub.6): δ=7.89-7.88 (d, J=6 Hz, 1H), 7.20-7.18 (d, J=12 Hz, 2H), 5.85-5.84 (d, J=6 Hz, 1H), 5.73-5.72 (d, J=6 Hz, 1H), 5.09 (s, 1H), 4.24-4.23 (m, 1H), 3.81-3.80 (d, J=6 Hz, 1H), 3.69-3.68 (m, 1H), 3.36 (s, 3H), 0.87 (s, 9H), 0.07 (s, 6H). ESI-LCMS: m/z 374 [M+H].sup.+.

    [0427] Preparation of 7: To a solution of 6 (14.0 g, 37.5 mmol) in pyridine (140.0 mL) was added TMSCl (6.3 g, 58.0 mmol) at 0° C. and the mixture was stirred at r.t. for 1.5 h. LCMS showed 6 was consumed and an intermediate(a) was formed. Then was added BzCl (10.8 g, 76.8 mmol) at 0° C. and the mixture was stirred at r.t. for 1.5 h. LCMS showed the intermediate was consumed and another intermediate was formed. Then the mixture was added NH.sub.4OH (30.0 mL) and was stirred at r.t. for 15 h. LCMS showed the intermediate was consumed. Water (300.0 mL) was added. The solution was extracted with EA (2*200.0 mL). The organic layer was washed with brine and dry over by Na.sub.2SO.sub.4. Then the solution was concentrated under reduced pressure, crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O=1/1 increasing to CH.sub.3CN/H.sub.2O=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O=1/0; Detector, UV 254 nm. This resulted in to give 7 (10.5 g, 58.6% yield). .sup.1H-NMR (600 MHz, DMSO d.sub.6): δ=11.29 (s, 1H), 8.53-8.52 (d, J=6 Hz, 1H), 8.01-8.00 (d, J=6 Hz, 2H), 7.63-7.61 (m, 1H), 7.52-7.50 (m, 2H), 7.36 (s, 1H), 5.88 (s, 1H), 5.24 (s, 1H), 4.28-4.26 (m, 1H), 3.91 (s, 1H), 3.81-3.79 (m, 1H), 3.46 (s, 3H), 0.87 (s, 9H), 0.08 (s, 6H). ESI-LCMS: m/z 478 [M+H].sup.+.

    [0428] Preparation of 8: To a solution of 7 (10.5 g, 22.0 mmol) in DMSO (105.0 mL) was added EDCI (12.7 g, 66.0 mmol), dry pyridine (1.7 g, 22.0 mmol) at r.t. and TFA (1.3 g, 11.0 mmol) at 0° C. Then the reaction mixture was stirred for 1 h. LCMS showed 7 was consumed. Water (100.0 mL) was added. The solution was extracted with EA (2*200.0 mL). The organic layer was washed with brine and dry over by Na.sub.2SO.sub.4. Then the solution was concentrated under reduced pressure to give the crude product 8 which was used in next step directly. ESI-LCMS: m/z 475 [M+H].sup.+.

    [0429] Preparation of 9: To a solution of 8 in dry THF (120.0 mL) and D20 (40.0 mL) was added K.sub.2CO.sub.3 (12.2 g, 88.1 mmol) and 7a (16.8 g, 26.5 mmol) then the reaction mixture was stirred for 15 h at 35° C. under the N.sub.2 atmosphere. LCMS showed 95% 7 was consumed. Water (60.0 mL) was added. The solution was extracted with EA (2*150.0 mL). The organic layer was washed with brine and dry over by Na.sub.2SO.sub.4. Then the solution was concentrated under reduced pressure, crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O=1/1 increasing to CH.sub.3CN/H.sub.2O=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O=4/1; Detector, UV 254 nm. This resulted in to give 9 (9.3 g, 54.1% yield). .sup.1H-NMR (DMSO-d.sub.6) δ=11.33 (s, 1H), 8.17-8.15 (d, J=12, 1H), 8.02-8.00 (d, J=12, 1H), 7.64-7.62 (m, 1H), 7.53-7.50 (m, 2H), 7.44-7.42 (d, J=12, 1H), 4.46-4.44 (d, J=12, 1H), 4.24-4.23 (d, J=6, 1H), 3.93-3.91 (d, J=12, 1H), 1.16 (s, 18H), 0.86 (s, 9H)), 0.08-0.06 (d, J=12, 6H). ESI-LCMS: m/z 782 [M+H].sup.+. .sup.31P-NMR (DMSO-d.sub.6) δ=16.77, 16.00.

    [0430] Preparation of 10: 9 (9.3 g, 11.9 mmol) in the mixture solution of HOAc (140.0 mL) and H.sub.2O (140.0 mL) was stirred at 30° C. for 15 h. LCMS showed 9 was consumed. The solution was added in the ice water and extracted with EA (2*300.0 mL). The organic layer was quenched to pH=6-7 and then washed with brine and dry over Na.sub.2SO.sub.4. Then the solution was concentrated under reduced, crude was purified by pressure Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O=1/1 increasing to CH.sub.3CN/H.sub.2O=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O=2.5/1; Detector, UV 254 nm. This resulted in to give 10 (5.1 g, 64.6% yield). .sup.1H-NMR (DMSO-d.sub.6) δ=9.09 (s, 1H), 7.92-7.85 (m, 3H), 7.60-7.48 (m, 4H), 6.02 (s, 1H), 5.71-5.64 (m, 4H), 4.53-4.51 (m, 1H), 3.94-3.70 (m, 5H), 3.31 (s, 1H), 1.21 (s, 18H). .sup.31P-NMR (DMSO-d.sub.6) δ=16.45. ESI-LCMS: m/z 668 [M+H].sup.+.

    [0431] Preparation of 11: To a suspension of 10 (4.6 g, 6.9 mmol) in DCM (45.0 mL) added CEOP[N(ipr).sub.2].sub.2 (2.5 g, 8.3 mmol), DCI (730.4 mg, 6.2 mmol). The mixture was stirred at r.t. for 1 h. LCMS showed 10 was consumed completely. The solution was quenched by water (40.0 mL), washed with brine (2*20.0 mL) and dry over by Na.sub.2SO.sub.4. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O=1/1 increasing to CH.sub.3CN/H.sub.2O=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O=4/1; Detector, UV 254 nm. This resulted in to give 11 (4.7 g, 5.4 mmol, 78.3% yield) as a white solid. .sup.1H-NMR (600 MHz, DMSO-d.sub.6) δ=11.34 (s, 1H), 8.18-8.16 (m, 1H), 8.02-8.01 (d, J=6, 2H), 7.65-7.42 (m, 4H), 5.95-5.93 (m, 1H), 5.66-5.61 (m, 4H), 4.64-4.57 (m, 1H), 4.32-4.31 (d, J=6, 1H), 4.12-4.10 (m, 1H), 3.81-3.45 (m, 7H), 2.81-2.79 (m, 2H), 1.16-1.13 (m, 30H). .sup.31P-NMR (CDCl.sub.3-d.sub.6) δ=150.65, 150.20, 16.64, 15.41. ESI-LCMS: m/z 868 [M+H].sup.+;

    Example 18

    [0432] ##STR00232## ##STR00233## ##STR00234##

    [0433] Preparation of 2: 1 (94.5 g, 317.9 mmol) was dissolved in dry DMF (1000 mL) under N.sub.2 atmosphere. To the solution TBSCl (119.3 g, 794.7 mmol) and imidazole (75.8 g, 1.1 mol) was added at 25° C. and stirred for 17 hr. LCMS showed all of 1 consumed. The reaction mixture was washed with H.sub.2O (3000*2 mL), EA (2000*2 mL) and brine (1500 mL). Dried over Na.sub.2SO.sub.4 and concentrated to give crude which goes to the next step. The reaction mixture was concentrated to give crude 2 (200 g, crude). ESI-LCMS: m/z 526 [M+H].sup.+.

    [0434] Preparation of 3: 2 (175.1 g, 333.0 mmol) was evaporated with pyridine and dried in vacuo for two times. The residue was dissolved in pyridine (1500 mL) under N.sub.2. To the solution, i-BuCl (88.7 g, 832.6 mmol) was added at 5° C. under N.sub.2 atmosphere and stirred for 3 hr. LCMS showed all of 2 consumed. The reaction mixture was washed with H.sub.2O (3000*2 mL), EA (2000*2 mL) and brine (1500 mL). Dried over Na.sub.2SO.sub.4 and concentrated to give crude which goes to the next step. The reaction mixture was concentrated to give crude 3 (228 g, crude). ESI-LCMS: m/z 596 [M+H].sup.+.

    [0435] Preparation of 4: A solution of 3 (225 g, 377.6 mmol) was in THF (2000 mL) was added H.sub.2O (500 mL) and TFA (500 mL) was added at 5° C. Then the reaction mixture was stirred at 5° C. for 1 hr. LCMS showed all of 3 consumed. Con NH.sub.4OH (aq) was added to mixture to quench the reaction until the pH=7-8, then washed with H.sub.2O (2000*2 mL), EA (2000*2 mL) and brine (1500 mL). Dried over Na.sub.2SO.sub.4 and concentrated to give crude which was purified by cc. The reaction mixture was concentrated to give 4 (155.6 g, 83.9% yield). ESI-LCMS: m/z 482 [M+H].sup.+.

    [0436] Preparation of 5: 4 (100 g, 207.6 mmol) was dissolved in dry DMF (1000 mL) under N.sub.2. To the solution, t-BuOH (307.8 g, 4.2 mol), PDC (156.1 g, 0.4 mol) and Ac.sub.2O (212.0 g, 2.1 mol) was added at 25° C. under N.sub.2 atmosphere and stirred at 25° C. for 2 hr. LCMS and TLC showed all of 4 consumed. NaHCO.sub.3 (aq) was added to mixture to quench the reaction until the pH=7-8, then washed with H.sub.2O (500*2 mL), EA (500*2 mL) and brine (500 mL). Dried over Na.sub.2SO.sub.4 and concentrated to give crude which was purified by cc. and MPLC. The reaction mixture was concentrated to give 5 (77.3 g, 61.6% yield). ESI-LCMS: m/z 552 [M−H].sup.+.

    [0437] Preparation of 6: 5 (40.0 g, 72.6 mmol) was dissolved in dry THF (400 mL) under N.sub.2. To the solution, MeOD (80 mL) and D20 (40 mL) was added at 25° C. under N.sub.2 atmosphere, then NaBD.sub.4 (9.1 g, 217.4 mmol) was added for three times and stirred for 15 hr. LCMS and TLC showed all of 5 consumed. The mixture was concentrated to give crude which goes to the next step. The reaction mixture was concentrated to give crude 6 (30 g, crude). ESI-LCMS: m/z 414 [M+H].sup.+

    [0438] Preparation of 7: 6 (30 g, crude) was evaporated with pyridine and dried in vacuo for two times. The residue was dissolved in dry pyridine (300 mL) under N.sub.2. Then iBuCl (15.5 g, 145.3 mmol) was slowly added to the reaction mixture at 0° C. under N.sub.2 atmosphere and stirred at 25° C. for 1 hr. LCMS and TLC showed all of 6 consumed. NaHCO.sub.3 (aq) was added to mixture to quench the reaction until the pH=7.5, then washed with H.sub.2O (1500 mL), EA (1000*2 mL) and brine (1500 mL). Dried over Na.sub.2SO.sub.4 and concentrated to give crude residue R1. NaOH (8 g, 0.2 mol), MeOH (80 mL) and H.sub.2O (20 mL) made up NaOH (aq). The residue R1 (40 g, 3.63 mmol) was dissolved in pyridine (20 mL). To the solution, 2N NaOH (aq) (100 ml) was added to the solution and stirred the reaction 15 min at 5° C. TLC showed all of R1 consumed. The mixture was added NH.sub.4Cl to pH=7-8 at 5° C., and concentrated to give crude which was purified by cc. The product was concentrated to give 7 (15.5 g, 33.00% yield over two steps). ESI-LCMS: m/z 484[M+H].sup.+.

    [0439] Preparation of 8: To a stirred solution of 7 (15.5 g, 32.1 mmol) in DMSO (150 mL) were added EDCI (18.5 g, 96.3 mmol), pyridine (2.5 g, 32.1 mmol), TFA (1.8 g, 16.0 mmol) at room temperature under N.sub.2 atmosphere. The reaction mixture was stirred for 1 h at room temperature. The reaction was quenched with water, extracted with EA (300.0 mL), washed with brine, dried over Na.sub.2SO.sub.4 and evaporated under reduced pressure give a crude 8 (17.3 g, crude) which was used directly to next step. ESI-LCMS: m/z=481 [M+H].sup.+.

    [0440] Preparation of 10: A solution of 8 (17.3 g, crude), 9 (21.4 g, 33.7 mmol) and K.sub.2CO.sub.3 (13.3 g, 96.3 mmol) in dry THF (204 mL) and D20 (34 mL) was stirred 5 h at 40° C. The mixture was quenched with water, extracted with EA (600.0 mL), washed with brine, dried over Na.sub.2SO.sub.4 and evaporated under reduced pressure. The residue was purified by silica gel (PE:EA=5:1˜ 1:1) to give 10 (9.3 g, 36.6% yield over 2 steps) as a white solid. ESI-LCMS m/z=787[M+H].sup.+.

    [0441] .sup.1H-NMR (DMSO-d.sub.6): δ 11.24 (s, 1H, exchanged with D20), 8.74 (d, J=2.7 Hz, 2H), 8.05-8.04 (d, J=7.4 Hz, 2H), 7.65 (t, 1H), 7.57-7.54 (t, 2H), 6.20 (d, J=5.0 Hz, 1H), 5.64-5.58 (m, 4H), 4.77 (t, 1H), 4.70 (t, 1H), 4.57-4.56 (t, 1H), 3.35 (s, 3H), 1.09 (d, J=6.5 Hz, 18H), 0.93 (s, 9H), 0.15 (d, J=1.8 Hz, 6H); .sup.31P NMR (DMSO-d.sub.6): δ 17.05;

    [0442] Preparation of 11: To a round-bottom flask was added 10 (9.3 g, 11.5 mmol) in a mixture of H.sub.2O (93 mL) and HCOOH (93 mL). The reaction mixture was stirred for 5 h at 50° C. and 15 h at 35° C. The mixture was extracted with EA (500.0 mL), washed with water, NaHCO.sub.3 solution and brine successively, dried over Na.sub.2SO.sub.4 and evaporated under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/2 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=3/2; Detector, UV 254 nm. To give product 11 (6.3 g, 78% yield). .sup.1H-NMR (600 MHz, DMSO-d.sub.6): δ 12.17 (s, 1H, exchanged with D20), 11.51 (s, 1H), 8.28 (s, 1H), 6.02-6.03 (d, J=4.2 Hz, 1H), 5.63-5.72 (m, 5H), 4.60 (s, 1H), 4.43-4.45 (m, 2H), 3.40 (s, 1H), 3.38 (s, 1H), 2.83-2.88 (m, 1H), 1.15-1.23 (m, 24H); .sup.31P NMR (DMSO-d.sub.6) δ=17.69. ESI-LCMS m/z=674 [M+H].sup.+.

    [0443] Preparation of 12: To a solution of 11 (5.6 g, 8.3 mmol) in DCM (55.0 mL) was added the DCI (835 mg, 7.1 mmol), then CEP[N(ipr).sub.2].sub.2 (3.3 g, 10.8 mmol) was added. The mixture was stirred at r.t. for 1 h. The reaction mixture was washed with H.sub.2O (50.0 mL) and brine (50.0 mL), dried over Na.sub.2SO.sub.4 and evaporated under pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=9/1; Detector, UV 254 nm. The product was concentrated to give 12 (6.3 g, 87% yield) as a white solid. .sup.1H-NMR (DMSO-d.sub.6): δ 12.14 (s, 1H, exchanged with D20), 11.38 (s, 1H), 8.27-8.28 (d, J=6 Hz, 1H), 5.92-5.98 (m, 1H), 5.59-5.65 (m, 4H), 4.57-4.68 (m, 3H), 3.61-3.85 (m, 4H), 3.37 (s, 1H), 3.32 (s, 1H), 2.81-2.85 (m, 3H), 1.09-1.20 (m, 36H); .sup.31P NMR (DMSO-d.sub.6): δ 150.60, 149.97, 17.59, 17.16; ESI-LCMS m/z=874 [M+H].sup.+.

    Example 19: ds-siNA Activity

    [0444] This example investigates the activity of the ds-siNAs synthesized in Example 1.

    [0445] Homo sapiens HepG2.2.15 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) (ATCC 30-2002) supplemented to also contain 10% fetal calf serum (FCS). Cells were incubated at 37° C. in an atmosphere with 5% CO2 in a humidified incubator. For transfection of HepG2.2.15 cells with HBV targeting siRNAs, cells were seeded at a density of 15000 cells/well in 96-well regular tissue culture plates. Transfection of cells was carried out using RNAiMAX (Invitrogen/Life Technologies) according to the manufacturer's instructions. Dose-response experiments were done with oligo concentrations of 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625 and 0.07813 nM. For each HBV targeting siRNA treatment (e.g., ds-siRNA, as identified by the ds-siNA ID in Table 6), four wells were transfected in parallel, and individual data points were collected from each well. After 24 h of incubation with siRNA, media was removed, and cells were lysed and analyzed with a QuantiGene2.0 branched DNA (bDNA) probe set specific for HBV genotype D (also called Hepatitis B virus subtype ayw, complete genome of 3182 base-pairs) as present in cell line HepG2.2.15.

    [0446] For each well, the HBV on-target mRNA levels were normalized to the GAPDH mRNA level. As shown in Tables 6-10, the activity of the HBV targeting ds-siRNAs was expressed as EC50, 50% reduction of normalized HBV RNA level from no drug control. As shown in Tables 6-10, the cytotoxicity of the HBV targeting ds-siRNAs was expressed by CC50 of 50% reduction of GAPDH mRNA from no drug control.

    Example 20: Use of Ds-siNAs to Treat Hepatitis B Virus Infection

    [0447] In this example, the ds-siNAs synthesized in Example 1 are used to treat a hepatitis B virus infection in a subject. Generally, a composition comprising a ds-siNA from Tables 1-5 (as identified by the ds-siNA ID) and a pharmaceutically acceptable carrier is administered to the subject suffering from hepatitis B virus. The ds-siNA from Tables 1-5 are conjugated to N-acetylgalactosamine. The ds-siNA is administered at a dose of 0.3 to 5 mg/kg every three weeks by subcutaneous injection or intravenous infusion.

    Example 21: siNA Activity Assays

    [0448] This example provides exemplary methods for testing the activity of the siNAs disclosed herein.

    [0449] In Vitro Assay:

    [0450] HepG2.2.15 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) (ATCC 30-2002) supplemented to also contain 10% fetal calf serum (FCS). Cells were incubated at 37° C. in an atmosphere with 5% CO.sub.2 in a humidified incubator. For transfection of HepG2.2.15 cells with HBV targeting siRNAs, cells were seeded at a density of 15000 cells/well in 96-well regular tissue culture plates. Transfection of cells was carried out using RNAiMAX (Invitrogen/Life Technologies) according to the manufacturer's instructions. Dose-response experiments were done with oligo concentrations of 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625 and 0.07813 nM. For each HBIV targeting siRNA treatment (e.g., ds-siRNA, as identified by the ds-siNA ID in Tables 6-10), four wells were transfected in parallel, and individual data points were collected from each well. After 24 h of incubation with siRNA, media was removed, and cells were lysed and analyzed with a QuantiGene2.0 branched DNA (bDNA) probe set specific for HBV genotype D (also called Hepatitis B virus subtype ayw, complete genome of 3182 base-pairs) as present in cell line HepG2.2.15.

    [0451] For each well, the HBV on-target mRNA levels were normalized to the GAPDH mRNA level. As shown in Tables 6-10, the activity of the HBV targeting ds-siRNAs was expressed as EC.sub.50, 5000 reduction of normalized HBV RNA level from no drug control. As shown in Tables 6 and 10, the cytotoxicity of the HBV targeting ds-siRNAs was expressed by CC.sub.50 of 50% reduction of GAPDH mRNA from no drug control.

    TABLE-US-00009 TABLE 6 siNA Comprising 2′-Fluoro Nucleotides Emax CC.sub.50 Name SS/AS 5′ to 3′ EC.sub.50 (%) (nM) ds-siNA-001 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU A 71 >45 (SEQ ID NO: 1) mApsfZPpsmUmGmAfGmAmGmAmAmGmUmCfCmAfCmCmAmCpsmGpsmA (SEQ ID NO: 2) ds-siNA-002 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU B 59 >45 (SEQ ID NO: 3) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCf4PmAfCmCmAmCpsmGpsmA (SEQ ID NO: 4) ds-siNA-003 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU A 68 >45 (SEQ ID NO: 5) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCfCmAfZPmCmAmCpsmGpsmA (SEQ ID NO: 6) ds-siNA-004 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU B 61 >45 (SEQ ID NO: 7) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCflPmAf2PmCmAmCpsmGpsmA (SEQ ID NO: 8) ds-siNA-005 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU B 71 >45 (SEQ ID NO: 9) mApsfBpsmUmGmAfGmAmGmAmAmGmUmCfCmAfCmCmAmCpsmGpsmA (SEQ ID NO: 10) ds-siNA-006 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU B 70 >45 (SEQ ID NO: 11) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCfBmAfCmCmAmCpsmGpsmA (SEQ ID NO: 12) ds-siNA-007 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU D — >45 (SEQ ID NO: 13) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCfBmAfBmCmAmCpsmGpsmA (SEQ ID NO: 14) ds-siNA-008 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU A 67 >45 (SEQ ID NO: 15) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCflPmAfCmCmAmCpsmGpsmA (SEQ ID NO: 16) CONTROL 1 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU A 61 >45 (SEQ ID NO: 41) mApsfUpsmUmGmAfGmAmGmAmAmGmUmCf CmAfCmCmAmCpsmGpsmA (SEQ ID NO: 42) For EC.sub.50, A = EC.sub.50 ≤ 0.1 nM; B = 0.1 nM ≤ EC.sub.50 < 1 nM; C = 1 nM < EC.sub.50 < 10; D = EC.sub.50 ≥10 nM. mX = 2′-O-methyl nucleotide; fX = 2′-fluoro nucleotide; 5dcd3X = nucleotide of Formula 17; 5dfX = nucleotide of Formula 16; vX= 5′ vinyl phosphonate nucleotide; d2vX = deuterated 5′ vinyl phosphonate nucleotide; vmX = 5′ vinyl phosphonate, 2′-methyl nucleotide; f4P = [00235]embedded imagef2P = [00236]embedded imagefB = [00237]embedded imageps = phosphorothioate linkage; X is a nucleobase (e.g. A, G, C, U or T)

    TABLE-US-00010 TABLE 7 siNA Comprising Nucleotide Phosphate Mimics Name SS/AS 5′ to 3′ EC.sub.50 CONTROL 2 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC A mUmUmCmA-p-ps2-GalNAc4 (SEQ ID NO: 43) mUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmC mAfCmGmGpsmUpsmC (SEQ ID NO: 44) ds-siNA-009 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC A mUmUmCmAp-ps2-GalNAc4 (SEQ ID NO: 17) omeco- d3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAm CmAfCmGmGpsmUpsmC (SEQ ID NO: 18) ds-siNA-010 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC A mUmUmCmAp-ps2-GalNAc4 (SEQ ID NO: 19) 4hUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAm CmAfCmGmGpsmUpsmC (SEQ ID NO: 20) ds-siNA-011 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC A mUmUmCmAp-ps2-GalNAc4 (SEQ ID NO: 21) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCf AmCmAfCmGmGpsmUpsmC (SEQ ID NO: 22) ds-siNA-012 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC A mUmUmCmA-p-ps2-GalNAc4 (SEQ ID NO: 23) v- munUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfA mCmAfCmGmGpsmUpsmC (SEQ ID NO: 24) ds-siNA-013 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC A mUmUmCmA-p-ps2-GalNAc4 (SEQ ID NO: 25) c2o- 4hUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAm CmAfCmGmGpsmUpsmC (SEQ ID NO: 26) ds-siNA-014 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC B mUmUmCmA-p-ps2-GalNAc4 (SEQ ID NO: 27) omeco- munUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfA mCmAfCmGmGpsmUpsmC (SEQ ID NO: 28) ds-siNA-015 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC A mUmUmCmA-p-ps2-GalNAc4 (SEQ ID NO: 29) omeco- munUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfA mCmAfCmGmGpsmUpsmC (SEQ ID NO: 30) ds-siNA-016 mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmU A mCmAmAmU-p-ps2-GalNAc4 (SEQ ID NO: 33) d2vmApsfUpsmUmGmAfGmAmGmAmAmGmUmCf CmAf2PmCmAmCpsmGpsmA (SEQ ID NO: 34) ds-siNA-023 5′- A mCpsmCpsmGmUfGmUfGf(4nh)QfAmCmUmUmCm GmCmUmUmCmA-p-(ps)2-GalNAc4 (SEQ ID NO: 63) 3′- mCpsmUpsmGmGfCmAmCfAmCmGmUmGmAfAm GmCfGmAmApsfGpsd2vd3U-5′ (SEQ ID NO: 64) ds-siNA-024 5′- A mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC mUmUmCmA-p-(ps)2-GalNAc4 (SEQ ID NO: 65) 3′- mCpsmUpsmGmGfCmAmCfAmCmGmUmGmAfAm Gf(4nh)QfGmAmApsfGpsd2vd3U-5′ (SEQ ID NO: 66) ds-siNA-025 5′- A mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC mUmUmCmA-p-(ps)2GalNAc4 (SEQ ID NO: 67) 3′- mCpsmUpsmGmGf(4nh)QmAmCfAmCmGmUmGm AfAmGmCfGmAmApsfGpsd2vd3U-5′ (SEQ ID NO: 68) ds-siNA-050* mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC C mUmUmCmA-p-(ps)2-GalNAc4 (SEQ ID NO: 93) coc- 4hUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAm CmAfCmGmGpsm UpsmC (SEQ ID NO: 94) For EC50, A = EC50 ≤ 0.1 nM; B = 0.1 nM < EC50 ≤ 1 nM; C = 1 nM < EC50 < 10; D = EC50 ≥ 10 nM. *ds-siNA-050 was also assessed for CC50 and the CC50 for ds-siNA-050 is >1 nm. mX = 2′-O-methyl nucleotide; fX = 2′-fluoro nucleotide; 5dcd3X = nucleotide of Formula 17; 5dfX = nucleotide of Formula 16; vX = 5′ vinyl phosphonate nucleotide; d2vX = deuterated 5’ vinyl phosphonate nucleotide; vmX = 5′ vinyl phosphonate, 2′-O-methyl nucleotide; omeco-d3U = [00238]embedded image4hU = [00239]embedded imaged2vd3U = [00240]embedded imagev-munU = [00241]embedded imagec2o-4hU = [00242]embedded imagecoc-4hU = [00243]embedded imageomeco-munU = [00244]embedded imageps = phosphorothioate linkage; X is a nucleobase (e.g. A, G, C, U or T)

    TABLE-US-00011 TABLE 8 siNA Comprising Modified Unlocked Nucleotides Position EC.sub.50 Name SS/AS (5′ to 3′) of mod. CONTROL 3 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA  6 A (SEQ ID NO: 45) mUpsfGpsmAmAfGunCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 46) CONTROL 4 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA  7 A (SEQ ID NO: 47) mUpsfGpsmAmAfGmCunGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 48) CONTROL 5 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA — A (SEQ ID NO: 49) mUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 50) ds-siNA-017 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA  6 B (SEQ ID NO: 35) mUpsfGpsmAmAfGmun34CmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 36) ds-siNA-018 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA  7 A (SEQ ID NO: 37) mUpsfGpsmAmAfGmCmun34GfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 38) ds-siNA-019 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-ps2-GalNAc4  7 A (SEQ ID NO: 39) d2vd3UpsfGpsmAmAfGmCmun34GfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 40) ds-siNA-034 mCpsmCpsmun34GmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA  3 A (SEQ ID NO: 93) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-035 mCpsmCpsmGmun34UfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA  4 A (SEQ ID NO: 95) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-036 mCpsmCpsmGmUfGmun34UfGfCfAmCmUmUmCmGmCmUmUmCmA  6 A (SEQ ID NO: 96) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-037 mCpsmCpsmGmUfGmUfGfCfAmun34CmUmUmCmGmCmUmUmCmA 10 B (SEQ ID NO: 97) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-038 mCpsmCpsmGmUfGmUfGfCfAmCmun34UmUmCmGmCmUmUmCmA 11 A (SEQ ID NO: 98) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-039 mCpsmCpsmGmUfGmUfGfCfAmCmUmun34UmCmGmCmUmUmCmA 12 A (SEQ ID NO: 99) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-040 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmun34CmGmCmUmUmCmA 13 A (SEQ ID NO: 100) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-041 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmun34GmCmUmUmCmA 14 A (SEQ ID NO: 101) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-042 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmun34CmUmUmCmA 15 A (SEQ ID NO: 102) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-043 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmun34UmUmCmA 16 A (SEQ ID NO: 103) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-044 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmun34UmCmA 17 A (SEQ ID NO: 104) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) ds-siNA-045 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmun34CmA 18 A (SEQ ID NO: 105) psmUpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGpsmGpsmUmC (SEQ ID NO: 94) For EC50, A = EC50 ≤ 0.1 nM; B = 0.1 nM < EC50 ≤ 1 nM; C = l nM < ECso < 10; D = EC.sub.50 ≥ 10 nM. mX = 2′--methyl nucleotide; fX = 2′-fluoro nucleotide; 5dcd3X = nucleotide of Formula 17; 5dfX = nucleotide of Formula 16; vX= 5′ vinyl phosphonate nucleotide; d2vX = deuterated 5′ vinyl phosphonate nucleotide; vmX = 5′ vinyl phosphonate, 2′-O-methyl nucleotide; d2vd3U = 6; [00245]embedded imagemun34C = 3; [00246]embedded imagemun34G = [00247]embedded imageunC = [00248]embedded imageunG = [00249]embedded imageps = phosphorothioate linkage; X is a nucleobase (e.g. A, G, C, U or T)

    TABLE-US-00012 TABLE 9 siNA Comprising Mesyl Phosphoroamidate Internucleoside Linkages Name SS/AS (5′ to 3′) EC.sub.50 ds-siNA-020 5′-mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-(ps)2-GalNAc4 A (SEQ ID NO: 69) 3′-mApsmGpsmCmAmCfCmAfCmCmUmGmAmAmGmAfGmAmGmUypfUypm A-5′ (SEQ ID NO: 70) ds-siNA-021 5′-mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-(ps)2-GalNAc4 C (SEQ ID NO: 71) 3′-mAypmGypmCmAmCfCmAfCmCmUmGmAmAmGmAfGmAmGmUpsfUpsm A-5′ (SEQ ID NO: 72) ds-siNA-O22 5′-mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-(ps)2-GalNAc4 C (SEQ ID NO: 73) 3′-mAypmGypmCmAmCfCmAfCmCmUmGmAmAmGmAfGmAmGmUypfUypmA-5′ (SEQ ID NO: 74) CONTROL 8 5′-mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-(ps)2-GalNAc4 A (SEQ ID NO: 75) 3′-mApsmGpsmCmAmCfCmAfCmCmUmGmAmAmGmAfGmAmGmUpsfUpsm A-5′ (SEQ ID NO: 76) For EC.sub.50, A = EC50 ≤ 0.1 nM; B = 0.1 nM < EC.sub.50 ≤ 1 nM; C = 1 nM < EC.sub.50 < 10; D = EC.sub.50 ≥ 10 nM. mX = 2′-O-methyl nucleotide; fX = 2′-fluoro nucleotide; ps = phosphorothioate linkage; X is a [00250]embedded imagenucleobase (e.g. A, G, C, U or T); yp = 0

    TABLE-US-00013 TABLE 10 siNA Comprising Modified apU Nucleotides Name SS/AS (5′ to 3′) EC.sub.50 CC.sub.50 ds-siNA-026 mCpsmCpsmGaUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2-GalNAc4 A >1 (SEQ ID NO: 77) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 78) ds-siNA-027 mCpsmCpsmGmUfGaUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2-GalNAc4 A >1 (SEQ ID NO: 79) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 80) ds-siNA-028 mCpsmCpsmGmUfGmUfGfCfAmCmUaUmCmGmCmUmUmCmA-p-(ps)2-GalNAc4 A >1 (SEQ ID NO: 81) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 82) ds-siNA-o29 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCaUmUmCmA-p-(ps)2-GalNAc4 A >1 (SEQ ID NO: 83) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 84) ds-siNA-030 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUaUmCmA-p-(ps)2-GalNAc4 A >1 (SEQ ID NO: 85) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 86) ds-siNA-031 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2-GalNAc4 A >1 (SEQ ID NO: 87) d2vd3UpsfGpsmAmAfGmCmGfAmAmGaUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 88) ds-siNA-032 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2-GalNAc4 A >1 (SEQ ID NO: 89) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsaUpsmC (SEQ ID NO: 90) ds-siNA-033 mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmCmA-p-(ps)2-GalNAc4 A >1 (SEQ ID NO: 91) aUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCmGmGpsmUpsmC (SEQ ID NO: 92) For EC.sub.50, A = EC.sub.50 ≤ 0.1 nM; B = 0.1 nM < EC.sub.50 ≤ 1 nM; C = 1 nM < EC.sub.50 < 10; D = EC.sub.50 ≥ 10 nM. mX = 2′-methyl nucleotide; fX = 2′-fluoro nucleotide; 5dcd3X = nucleotide of Formula 17; 5dfX = nucleotide of Formula 16; vX = 5′ vinyl phosphonate nucleotide; d2vX = deuterated 5′ vinyl phosphonate nucleotide; vmX = 5′ vinyl phosphonate, 2′-O-methyl nucleotide; d2vd3U = [00251]embedded imageaU = [00252]embedded imageps = phosphorothioate linkage; X is a nucleobase (e.g. A, G, C, U or T)

    [0452] In Vivo Assay:

    [0453] AAV/HBV is a recombinant AAV carrying replicable HBV genome. Taking advantage of the highly hepatotropic feature of genotype 8 AAV, the HBV genome can be efficiently delivered to the mouse liver cells. Infection of immune competent mouse with AAV/HBV can result in long term HBV viremia, which mimics chronic HBV infection in patients. The AAV/HBV model can be used to evaluate the in vivo activity of various types of anti-HBV agents. Mice were infected with AAV-HBV on day−28 of the study. The test articles or negative control (PBS) were dosed subcutaneously (unless specified otherwise) as single dose on days 0 at 5 mg/kg. Serial blood collections were usually taken every 5 days on day 0, 5, 10 and 15 etc. until the termination of studies. Serum HBV S antigen (HBsAg) was assayed through ELISA.

    [0454] Table 11 shows the siNA that were assessed to determine the impact of some of the exemplary nucleotide phosphate mimics. The results of this assessment are shown in FIG. 4, which provides a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, ds-siNA-009, or ds-siNA-010.

    TABLE-US-00014 TABLE 11 Name SS/AS 5′ to 3′ CONTROL  mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm 2 CmAp-ps2-GalNAc4 (SEQ ID NO: 43) mUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCm GmGpsmUpsmC (SEQ ID NO: 44) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmAp-ps2-GalNAc4 009 (SEQ ID NO: 17) omeco- d3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAf CmGmGpsmUpsmC (SEQ ID NO: 18) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmAp-ps2-GalNAc4 010 (SEQ ID NO: 19) 4hUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAf CmGmGpsmUpsmC (SEQ ID NO: 20)

    [0455] Table 12 shows the siNA that were assessed to determine the impact of some of the exemplary nucleotide phosphate mimics. The results of this assessment are shown in FIG. 5A, which provides a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G011), CONTROL 2, ds-siNA-017 (with the addition of a GalNAc), or ds-siNA-018 (with the addition of a GalNAc).

    TABLE-US-00015 TABLE 12 Name SS/AS 5′ to 3′ ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmA-p-ps2-GalNac4 0017 (SEQ ID NO: 35) mUpsfGpsmAmAfGmun34CmGfAmAmGmUmGmCfAmCm AfCmGmGpsmUpsmC (SEQ ID NO: 36) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmA-p-ps2-GalNac4 0018 (SEQ ID NO: 37) mUpsfGpsmAmAfGmCmun34GfAmAmGmUmGmCfAmCm AfCmGmGpsmUpsmC (SEQ ID NO: 38) CONTROL  mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm 2 CmAp-ps2-GalNAc4 (SEQ ID NO: 43) mUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCm GmGpsmUpsmC (SEQ ID NO: 44)

    [0456] Table 13 shows siAN comprising traditional UNA that were also assessed. These siNA can be considered controls of the novel 3′,4′ seco modified nucleotides disclosed herein. FIG. 5B provides a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, CONTROL 7, or CONTROL 8.

    TABLE-US-00016 TABLE 13 Name SS/AS CONTROL mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm 7 CmA-p-ps2-GalNAc4 (SEQ ID NO: 51) mUpsfGpsmAmAfGunCmGfAmAmGmUmGmCfAmCmAfCm GmGpsmUpsmC (SEQ ID NO: 52) CONTROL mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm 8 CmA-p-ps2-GalNac4 (SEQ ID NO: 53) mUpsfGpsmAmAfGmCunGfAmAmGmUmGmCfAmCmAfCm GmGpsmUpsmC (SEQ ID NO: 54)

    [0457] Table 14 shows the siNA that were assessed to determine the impact of some of the exemplary nucleotide phosphate mimics. The results of this assessment are shown in FIG. 6, which provides a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, ds-siNA-011, ds-siNA-012, or ds-siNA-013.

    TABLE-US-00017 TABLE 14 Name SS/AS 5′ to 3′ CONTROL mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm 2 CmAp-ps2-GalNAc4 (SEQ ID NO: 43) mUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCm GmGpsmUpsmC (SEQ ID NO: 44) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmAp-ps2-GalNAc4 011 (SEQ ID NO: 21) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCm AfCmGmGpsmUpsmC (SEQ ID NO: 22) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmA-p-ps2-GalNAc4 012 (SEQ ID NO: 23) v- munUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAf CmGmGpsmUpsmC (SEQ ID NO: 24) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmA-p-ps2-GalNAc4 013 (SEQ ID NO: 25) c2o- 4hUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAf CmGmGpsmUpsmC (SEQ ID NO: 26)

    [0458] Table 15 shows the siNA that were assessed to determine the impact of incorporation of an apU nucleotide. The results of this assessment are shown in FIG. 7, which provides a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, ds-siNA-026, ds-siNA-027, ds-siNA-028, ds-siNA-029, ds-siNA-030, ds-siNA-031, or ds-siNA-032.

    TABLE-US-00018 TABLE 15 Name SS/AS 5′ to 3′ CONTROL mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm 2 CmAp-ps2-GalNAc4 (SEQ ID NO: 43) mUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCm GmGpsmUpsmC (SEQ ID NO: 44) ds- mCpsmCpsmGaUfGmUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmA-p-(ps)2-GalNAc4 026 (SEQ ID NO: 77) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCm AfCmGmGpsmUpsmC (SEQ ID NO: 78) ds- mCpsmCpsmGmUfGaUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmA-p-(ps)2-GalNAc4 027 (SEQ ID NO: 79) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCm AfCmGmGpsmUpsmC (SEQ ID NO: 80) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUaUmCmGmCmUmUm siNA- CmA-p-(ps)2-GalNAc4 028 (SEQ ID NO: 81) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCm AfCmGmGpsmUpsmC (SEQ ID NO: 82) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCaUmUm siNA- CmA-p-(ps)2-GalNAc4 029 (SEQ ID NO: 83) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCm AfCmGmGpsmUpsmC (SEQ ID NO: 84) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUaUm siNA- CmA-p-(ps)2-GalNAc4 030 (SEQ ID NO: 85) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCm AfCmGmGpsmUpsmC (SEQ ID NO: 86) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmA-p-(ps)2-GalNAc4 031 (SEQ ID NO: 87) d2vd3UpsfGpsmAmAfGmCmGfAmAmGaUmGmCfAmCm AfCmGmGpsmUpsmC (SEQ ID NO: 88) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm siNA- CmA-p-(ps)2-GalNAc4 032 (SEQ ID NO: 89) d2vd3UpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCm AfCmGmGpsaUpsmC (SEQ ID NO: 90)

    [0459] Additionally, the most active compounds from the in vitro screening of ds-siNA-034 to ds-siNA-045 were further modified to attach a GalNAc to the 3′ end of the sense strand and incorporated a deuterated vinyl phosphonate into the antisense strand. The most active compounds among ds-siNA-034 to ds-siNA-045 were ds-siNA-034 (mun34 at position 3 of sense strand), ds-siNA-043 (mun34 at position 16 of sense strand), ds-siNA-044 (mun34 at position 17 of sense strand), and ds-siNA-045 (mun34 at position 18 of sense strand). The GalNAc-conjugated/deuterated versions of these compounds were assigned ds-siNA-046 to ds-siNA-049 (shown in Table 16) and FIG. 8 provides a graph of the change in serum HBsAg from AAV-HBV mice treated with vehicle (G01), CONTROL 2, ds-siNA-046, ds-siNA-047, ds-siNA-048, or ds-siNA-049.

    TABLE-US-00019 TABLE 16 Name SS/AS 5′ to 3′ CONTROL mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUm 2 CmAp-ps2-GalNAc4 (SEQ ID NO: 43) mUpsfGpsmAmAfGmCmGfAmAmGmUmGmCfAmCmAfCm GmGpsmUpsmC (SEQ ID NO: 44) ds- mCpsmCpsmun34GmUfGmUfGfCfAmCmUmUmCmGmCmUm si-NA- UmCmA-p-(ps)2-GalNAc 046 (SEQ ID NO: 106) psd2vd3UpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAf CmGpsmGpsmUmC (SEQ ID NO: 107) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmun34Um si-NA- UmCmA-p-(ps)2-GalNAc 047 (SEQ ID NO: 108) psd2vd3UpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAf CmGpsmGpsmUmC (SEQ ID NO: 107) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmun34 si-NA- UmCmA-p-(ps)2-GalNAc 048 (SEQ ID NO: 109) psd2vd3UpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAf CmGpsmGpsmUmC (SEQ ID NO: 107) ds- mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmCmUmUmun si-NA- 34CmA-p-(ps)2-GalNAc 049 (SEQ ID NO: 110) psd2vd3UpsfGmAmAfGmCmGfAmAmGmUmGmCfAmCmAf CmGpsmGpsmUmC (SEQ ID NO: 107)

    Example 22: Preparation of Compound 40-9 (GalNAc4 Amidite)

    [0460] Compound 40-9 can be conjugated to any siNA disclosed herein as a targeting moiety. This compound, pictured below, can be prepared according to the following brief description.

    ##STR00253## ##STR00254##

    [0461] The building block compound 40-9 is useful for making embodiments of modified phosphorothioated oligonucleotides. The compound 40-9 was prepared as follows:

    [0462] Preparation of compound 40-2: To a solution of commercially available glucosamine hydrochloride 40-1 (60 g, 278.25 mmol, 1 eq) in DCM (300 mL) at 0° C. was added Ac.sub.2O (323.83 g, 3.17 mol, 297.09 mL, 11.4 eq) dropwise, followed by pyridine (300 mL) and DMAP (3.40 g, 27.83 mmol, 0.1 eq). The mixture was allowed to gradually warm to 20° C. and stirred at 20° C. for 24 hours. Upon completion as monitored by LCMS, the mixture was concentrated under reduced pressure, diluted with DCM (900 mL), and extracted with NaHCO.sub.3(sat., aqueous 300 mL*3). The combined organic layers were washed with brine (300 mL), dried over Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure to give compound 40-2 (89.5 g, crude) as a yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3) δ=6.16 (d, J=3.8 Hz, 1H), 5.62 (d, J=9.0 Hz, 1H), 5.27-5.16 (m, 2H), 4.54-4.43 (m, 1H), 4.24 (dd, J=4.0, 12.5 Hz, 1H), 4.10-3.94 (m, 2H), 2.18 (s, 3H), 2.08 (s, 3H), 2.04 (d, J=4.0 Hz, 6H), 1.93 (s, 3H; LCMS (ESI): m/z calcd. for C.sub.16H.sub.23NaNO.sub.10 412.34 [M+Na].sup.+, found 412.0).

    [0463] Preparation of compound 40-3: To a solution of compound 40-2 (40 g, 102.73 mmol, 1 eq) in DCE (320 mL) at 25° C. was added dropwise TMSOTf (23.98 g, 107.87 mmol, 19.49 mL, 1.05 eq), and the mixture was stirred at 60° C. for 4 hours. Upon completion as monitored by LCMS, the mixture was quenched by addition of TEA (60 mL) at 20° C., stirred for 15 min, diluted with DCM (500 mL), and washed with NaHCO.sub.3(sat., aqueous 300 mL*2). The organic layer was washed with brine (300 mL), dried over Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure to give compound 40-3 (32.5 g, crude) as a yellow oil. .sup.1H NMR (400 MHz, CDCl.sub.3) δ=5.96 (d, J=7.3 Hz, 1H), 5.25 (t, J=2.4 Hz, 1H), 4.95-4.88 (m, 1H), 4.19-4.08 (m, 3H), 3.59 (m, 1H), 2.13-2.05 (m, 12H).

    [0464] Preparation of compound 40-4: To a mixture of compound 40-3 (32.5 g, 98.69 mmol, 1 eq) in DCM (250 mL) was added hex-5-en-1-ol (11.86 g, 118.43 mmol, 13.96 mL, 1.2 eq) and 4 A MS (32.5 g). The mixture was stirred at 30° C. for 0.5 h, followed by dropwise addition of TMSOTf (13.16 g, 59.22 mmol, 10.70 mL, 0.6 eq). The mixture was stirred at 30° C. for 16 hours. Upon completion as monitored by LCMS, the reaction mixture was filtered, and the filtrate was diluted with DCM (300 mL) and washed with NaHCO.sub.3(sat., aqueous 150 mL*2). The organic layer was washed with brine (150 mL), dried over Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The residue was purified by flash silica gel chromatography (ISCO®; 220 g SepaFlash® Silica Flash Column, Eluent of 0˜70% PE/EA gradient at 100 mL/min) to give compound 40-4 (12.3 g, 28.64 mmol, 29.02% yield) as a white solid. .sup.1H NMR (400 MHz, CDCl.sub.3) δ=5.78 (m, 1H), 5.45 (d, J=8.8 Hz, 1H), 5.31 (dd, J=9.4, 10.7 Hz, 1H), 5.06 (t, J=9.5 Hz, 1H), 5.02-4.92 (m, 2H), 4.68 (d, J=8.3 Hz, 1H), 4.30-4.23 (m, 1H), 4.16-4.10 (m, 1H), 3.91-3.76 (m, 2H), 3.73-3.66 (m, 1H), 3.48 (td, J=6.7, 9.5 Hz, 1H), 2.09-2.01 (m, 11H), 1.94 (s, 3H), 1.60-1.36 (m, 4H); LCMS (ESI): m/z calcd. for C.sub.20H.sub.32NO.sub.9, 430.47 [M+H].sup.+, found 430.1.

    [0465] Preparation of compound 40-5: To a solution of compound 40-4 (12.3 g, 28.64 mmol, 1 eq) in a mixed solvent of DCM (60 mL) and MeCN (60 mL) was added NaIO.sub.4 (2.5 M, 57.28 mL, 5 eq), and the mixture was stirred at 20° C. for 0.5 hours. RuCl.sub.3 (123.00 mg, 592.97 umol, 0.02 eq) was added, and the mixture was stirred at 20° C. for 2 hours. Upon completion as monitored by LCMS, saturated aqueous NaHCO.sub.3 was added to the mixture to adjust pH>7. The mixture was diluted with DCM (300 mL) and subjected to extraction. The aqueous layer was adjusted to pH<7 by citric acid, and the aqueous layer was extracted with DCM (300 mL*3). The combined organic layers were washed with brine (300 mL), dried over Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure to give compound 40-5 (8.9 g, 69.31% yield, as a brown solid. .sup.1H NMR (400 MHz, CDCl.sub.3) δ=6.14 (d, J=8.8 Hz, 1H), 5.34-5.20 (m, 1H), 5.08-5.01 (m, 1H), 4.67 (d, J=8.3 Hz, 1H), 4.24 (dd, J=4.8, 12.3 Hz, 1H), 4.17-4.05 (m, 1H), 3.90-3.83 (m, 2H), 3.75-3.62 (m, 2H), 3.50 (d, J=5.9, 9.9 Hz, 1H), 2.44-2.27 (m, 2H), 2.09-1.93 (m, 12H), 1.75-1.53 (m, 4H); LCMS (ESI): m/z calcd. for C.sub.19H.sub.30NO.sub.11, 448.44 [M+H].sup.+, found 448.1.

    [0466] Preparation of compound 40-6: To a solution of compound 40-5 (10 g, 22.35 mmol, 1 eq) and 1-hydroxypyrrolidine-2,5-dione (2.83 g, 24.58 mmol, 1.1 eq) in DCM (100 mL) was added EDCI HCl (5.57 g, 29.05 mmol, 1.3 eq), and the mixture was stirred at 20° C. for 2 hour. Upon completion as monitored by LCMS, the reaction mixture was diluted with DCM (200 mL) and washed with H.sub.2O (100 mL). The organic layer was washed with NaHCO.sub.3(sat. aqueous) (100 mL*2) and brine (100 mL), dried over Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure to give compound 40-6 (10.1 g, 82.66%) as a white solid. .sup.1H NMR (400 MHz, CDCl.sub.3) δ=5.85 (d, J=8.8 Hz, 1H), 5.31-5.26 (m, 1H), 5.06 (t, J=9.7 Hz, 1H), 4.69 (d, J=8.3 Hz, 1H), 4.25 (dd, J=4.7, 12.2 Hz, 1H), 4.12 (dd, J=2.3, 12.2 Hz, 1H), 3.94-3.79 (m, 2H), 3.75-3.65 (m, 1H), 3.63-3.53 (m, 1H), 2.87 (br d, J=4.3 Hz, 4H), 2.76-2.56 (m, 2H), 2.08 (s, 3H), 2.02 (d, J=1.8 Hz, 6H), 1.92 (s, 3H), 1.86-1.66 (m, 4H); LCMS (ESI): m/z calcd. for C.sub.23H.sub.33N.sub.2O.sub.13, 545.51 [M+H].sup.+, found 545.1.

    [0467] Preparation of compound 40-8: To a solution of compound 40-7 (40-7 prepared by following the general procedure described in WO 2018013999 A1) (9.8 g, 13.92 mmol, 1 eq) in DCM (100 mL) was added DIEA (3.60 g, 27.84 mmol, 4.85 mL, 2 eq), followed by addition of (2,5-dioxopyrrolidin-1-yl) 5-[3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydropyran-2-yl]oxypentanoate (compound 40-6) (9.86 g, 18.10 mmol, 1.3 eq), and the mixture was stirred at 20° C. for 2 hours. Upon completion as monitored by LCMS, the reaction mixture was diluted with water (100 mL), and then extracted with DCM (100 mL*2). The combined organic layers were washed brine (100 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 120 g SepaFlash® Silica Flash Column, Eluent of 0˜6% MeOH/DCM gradient at 80 mL/min) to give compound 40-8 (13.1 g, 80.95% yield) as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ=8.06 (d, J=9.3 Hz, 1H), 7.81 (q, J=5.4 Hz, 2H), 7.21 (d, J=8.8 Hz, 6H), 6.84 (d, J=9.0 Hz, 6H), 5.04 (t, J=10.0 Hz, 1H), 4.78 (t, J=9.7 Hz, 1H), 4.55 (d, J=8.5 Hz, 1H), 4.17 (dd, J=4.5, 12.3 Hz, 1H), 3.97 (d, J=10.0 Hz, 1H), 3.77 (dd, J=2.6, 9.9 Hz, 1H), 3.72-3.64 (m, 11H), 3.46-3.25 (m, 5H), 3.05-2.84 (m, 8H), 2.18 (t, J=7.2 Hz, 2H), 2.05-1.95 (m, 7H), 1.93 (s, 3H), 1.88 (s, 3H), 1.74 (s, 3H), 1.47-1.13 (m, 20H); LCMS (ESI): RT=2.017 min, m/z calcd. for C.sub.60H.sub.84NaN.sub.4O.sub.17, 1156.32[M+Na].sup.+, 1155.5.

    [0468] Preparation of compound 40-9: To a mixture of compound 40-8 (5 g, 4.41 mmol, 1 eq) and 4 A MS (5 g) in DCM (50 mL) was added 3-bis(diisopropylamino)phosphanyloxypropanenitrile (1.73 g, 5.74 mmol, 1.82 mL, 1.3 eq) at−10° C., followed by addition of 1H-imidazole-4,5-dicarbonitrile (573.12 mg, 4.85 mmol, 1.1 eq), and the mixture was stirred at 0° C. for 2 hours. Upon completion as monitored by LCMS, the reaction mixture was diluted with DCM (100 mL), washed with NaHCO.sub.3(sat., aqueous, 50 mL*2), dried over Na.sub.2SO.sub.4, and concentrated under reduced pressure to give a pale yellow foam. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, 0% to 10% i-PrOH in DCM contain 2% TEA) to give compound 40-9 (3.35 g, 56.60% yield) as a white solid. .sup.1H NMR (400 MHz, CD.sub.3CN) δ=7.35-7.25 (m, 6H), 6.88-6.82 (m, 6H), 6.79 (d, J=9.3 Hz, 1H), 6.63-6.46 (m, 2H), 5.17-5.08 (m, 1H), 4.93 (t, J=9.7 Hz, 1H), 4.59 (d, J=8.6 Hz, 1H), 4.22 (dd, J=4.9, 12.2 Hz, 1H), 4.04 (dd, J=2.4, 12.2 Hz, 1H), 3.85-3.32 (m, 22H), 3.15-3.00 (m, 8H), 2.59 (t, J=5.8 Hz, 2H), 2.23 (br t, J=6.6 Hz, 3H), 2.12-2.04 (m, 4H), 2.00 (s, 3H), 1.96 (s, 3H), 1.93 (s, 3H), 1.82 (s, 3H), 1.66-1.45 (m, 12H), 1.42-1.21 (m, 6H), 1.19-1.07 (m, 12H); LCMS (ESI) m/z calcd. for C.sub.69H.sub.101NaN.sub.6O.sub.18P 1355.68 [M+Na].sup.+, found 1355.7; .sup.31P NMR (CD.sub.3CN) δ=147.00.

    Example 23: Preparation of GalNAc4 CPG

    [0469] ##STR00255##

    [0470] To a solution of 40-8 (21 g, 18.53 mmol, 1 eq) and succinic anhydride (9.27 g, 92.65 mmol, 5 eq) in DCM (160 mL) were added TEA (18.75 g, 185.30 mmol, 25.79 mL, 10 eq) and DMAP (2.26 g, 18.53 mmol, 1 eq) at 15° C. The mixture was stirred at 15° C. for 16 h. TLC (DCM:MeOH=10: 1) showed the reaction was complete. The reaction mixture was diluted with water (200 mL), and then extracted with DCM (300 mL*2). The combined organic layers were washed with brine (300 mL*3), dried over anhydrous Na.sub.2SO.sub.4, concentrated under reduced pressure. The residue was purified by flash silica gel chromatography (ISCO®; 220 g SepaFlash® Silica Flash Column, Eluent of 0˜10% MeOH/DCM/TEA DCM was added 0.5 @ 100 mL/min) to give AGS-6-5 (12.8 g, 56% yield) LCMS: (ESI): m/z 1233.6 [M+H].sup.+. Further Succinate AGS-6-5 was loaded onto LCAA (CNA) 500 Å CPG by following the general procedure to give GalNAc 4 CPG.

    Example 24: Synthesis of Monomer

    [0471] ##STR00256## ##STR00257##

    [0472] Preparation of (2): Into a 1000 mL round-bottom flask were added PDC (8.48 g, 22.53 mmol, 1.2 equiv) and 4 A-MS (18 g) and DCM (300 mL) and PH-ALG-14-4-8 (from example 5) (9.7 g, 18.8 mmol) at room temperature. The resulting mixture was stirred for 5 h at room temperature under argon atmosphere. The resulting mixture was diluted with ethyl acetate (30 mL). The resulting mixture was filtered, the filter cake was washed with ethyl acetate (4×30 mL). The filtrate was concentrated under reduced pressure. This resulted 2 (9 g, crude) as a yellow solid. LC-MS: m/z 513.2 [M−H].sup.−

    [0473] Preparation of (3): Into a 1000 mL 3-necked round-bottom flask were added methyl triphenyl-phosphonium bromide (15.62 g, 43.73 mmol) and THF (180 mL) and t-BuOK (43.7 mL, 2M in TIHF) at 0° C. The resulting mixture was stirred for 30 min at 0° C. under argon atmosphere. To a stirred mixture, 3′-ketone 2 (9 g, 17.49 mmol) in THF was added dropwise at 0° C. under argon atmosphere. The resulting mixture was stirred for 2 h at room temperature under argon atmosphere. The reaction was quenched by the addition of water (1 mL) at room temperature. The resulting mixture was filtered, the filter cake was washed with ethyl acetate (4×20 mL). The filtrate was washed with water (3×20 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, C18; mobile phase, ACN in water, 45% to 70% gradient in 30 min; detector, UV 254 to afford 3 (5.6 g, 56% yield in two steps) as a white solid. LC-MS: m/z 511.15 [M−H].sup.−; .sup.1H-NMR (400 MHz, DMSO-d.sub.6) δ 11.26 (s, 1H), 7.38 (d, J=7.3 Hz, 2H), 7.33-7.18 (m, 8H), 6.90-6.78 (m, 4H), 5.71 (d, J=3.7 Hz, 1H), 5.42 (dd, J=8.1, 1.9 Hz, 1H), 4.96 (d, J=2.1 Hz, 1H), 4.88 (d, J=3.6 Hz, 1H), 4.47 (d, J=15.1 Hz, 3H), 3.72 (d, J=3.8 Hz, 6H).

    [0474] Preparation of (4): Into a 500 mL round-bottom flask were added intermediate 3 (5.5 g, 10.73 mmol) and THF (140 mL) and BH.sub.3-Me.sub.2S (24.14 mL, 48.28 mmol) at 0° C. The resulting mixture was stirred for 5 days at 0° C. under argon atmosphere. To a stirred mixture, MeOH (56 mL) was added dropwise at 0° C. under argon atmosphere. The resulting mixture was stirred for 20 min at 0° C. under argon atmosphere. To a stirred mixture, H.sub.2O (84 mL) were added dropwise at 0° C. under argon atmosphere. Further NaBO.sub.3.4H.sub.2O (29.7 g, 193.14 mmol) were added in several batches at 0° C. under argon atmosphere. The resulting mixture was stirred for 1 day at room temperature under argon atmosphere. The resulting mixture was diluted with ethyl acetate (200 mL). The resulting mixture was extracted with EtOAc (3×200 mL). The combined organic layers were washed with brine (2×100 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, C18; mobile phase, ACN in water, 35% to 70% gradient in 30 min; detector, UV 254 nm. to give compound 4 (1.4 g, 24% yield) as a white solid. LC-MS: m/z 529.15 [M−H].sup.−; .sup.1H-NMR: (400 MHz, DMSO-d.sub.6) δ 11.19 (s, 1H), 7.41 (d, J=7.3 Hz, 2H), 7.35-7.16 (m, 8H), 6.92-6.77 (m, 4H), 5.61 (d, J=3.6 Hz, 1H), 5.41 (d, J=8.0 Hz, 1H), 4.79 (s, 1H), 4.29 (t, J=3.7 Hz, 1H), 4.02 (dd, J=9.0, 7.4 Hz, 1H), 3.84 (m, 1H), 3.71 (d, J=5.6 Hz, 6H), 3.17 (m, 2H), 2.85-2.67 (m, 1H), 2.45 (m, 1H).

    [0475] Preparation of (5): A solution of compound 4 (980 mg, 1.85 mmol) in 2,2-dichloroacetic acid (20 mL, 3% in DCM) was stirred for 30 min at 0° C. under argon atmosphere. The resulting mixture was diluted with pyridine (2 mL). The resulting mixture was concentrated under reduced pressure, and resulted crude 5, which was used without purification.

    [0476] Preparation of (6): A solution compound 5 and DMTrCl (1.47 g, 4.34 mmol) in pyridine (20 mL) was stirred for 2 h at room temperature under argon atmosphere. Reaction was quenched with water at room temperature. The resulting mixture was extracted with EtOAc (3×20 mL). The combined organic layers were washed with brine (2×30 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, C18; mobile phase, ACN in water, 10% to 90% gradient in 30 min; detector, UV 254 nm to give 6 (780 mg) as white solid.

    [0477] Preparation of (7): A mixture of 1H-imidazole-4,5-dicarbonitrile (257.53 mg, 2.18 mmol) and CEP[N(iPr).sub.2].sub.2 (606.7 mg, 2.01 mmol) in DCM (8 mL) was stirred for 10 min at room temperature under argon atmosphere followed by the addition of compound 6 (890 mg, 1.68 mmol) dropwise/in portions at room temperature. The resulting mixture was stirred for 1 h at room temperature under argon atmosphere. The reaction was quenched with NaHCO.sub.3 (aqueous). The resulting mixture was extracted with CH.sub.2C.sub.2 (3×10 mL). The combined organic layers were washed with brine (2×5 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA with 0.5% TEA (1:1) to afford 7 (example 24 monomer) (950 mg, 75.56%) as a white solid. ESI-LCMS: m/z 731 [M+H].sup.+; .sup.1HNMR: (300 MHz, DMSO-d.sub.6) δ 11.34 (d, J=8.4 Hz, 1H), 7.63 (t, J=7.9 Hz, 1H), 7.40-7.26 (m, 4H), 7.29-7.15 (m, 5H), 6.92-6.82 (m, 4H), 5.70 (d, J=5.0 Hz, 1H), 5.53 (d, J=8.1 Hz, 1H), 4.42 (s, 1H), 4.26 (q, J=8.2 Hz, 1H), 4.10-3.92 (m, 1H), 3.72 (d, J=1.6 Hz, 6H), 3.69-3.56 (m, 1H), 3.54-3.35 (m, 3H), 3.20-3.02 (m, 2H), 2.67 (q, J=7.3, 6.0 Hz, 2H), 1.04 (dd, J=6.7, 3.8 Hz, 6H), 0.92 (dd, J=18.1, 6.7 Hz, 6H); .sup.31P NMR: (DMSO-d.sub.6) δ 149.57, 149.07

    Example 25: Synthesis of Monomer

    [0478] ##STR00258##

    [0479] Preparation of (2): Into a 100 mL round-bottom flask were added compound 1 (intermediate 4, example 24) (1 g, 1.83 mmol), molecular sieve (1.7 g) and PDC (0.83 g, 2.2 mmol) at room temperature. To the above mixture was added DCM (30.00 mL). The resulting mixture was stirred for 2 h at room temperature under argon atmosphere. The precipitated solids were collected by filtration and washed with EtOAc (3×20 mL). The resulting mixture was concentrated under reduced pressure. This resulted in compound 2 (1.2 g, 124.10%) as a brown solid. The crude product 2 was used in the next step directly without further purification.

    [0480] Preparation of (3): To a solution of dimethyl (dimethoxyphosphoryl)methylphosphonate (0.79 g, 3.4 mmol) in 18 mL THF was added sodium hydride (60%, 0.27 g) at −50° C. The mixture was stirred for 30 min. Compound 2 (1.2 g, 2.27 mmol) in 18 mL THF was added and the mixture was allowed to warm to room temperature and stirred for 1 h. The reaction was quenched with sat. NH.sub.4Cl (aq.) at room temperature. The resulting mixture was extracted with EtOAc (3×30 mL). The combined organic layers were washed with brine (3×10 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, C18 silica gel; mobile phase, MeCN in water, 5% to 95% gradient in 30 min; detector, UV 254 nm. This resulted in 3 (680 mg, 47.20%) as a white solid. ESI-LCMS: m/z 633 [M+H].sup.+; .sup.1H-NMR (400 MHz, Acetonitrile-d.sub.3) δ 8.80 (s, 1H), 7.45-7.30 (m, 2H), 7.26-7.07 (m, 7H), 6.81-6.67 (m, 4H), 6.57 (d, J=8.0 Hz, 1H), 6.45 (ddd, J=21.7, 17.2, 8.5 Hz, 1H), 5.70 (dd, J=20.1, 17.3 Hz, 1H), 5.23 (d, J=8.0 Hz, 1H), 5.10 (d, J=3.1 Hz, 1H), 4.65 (dd, J=4.6, 3.1 Hz, 1H), 4.05 (t, J=8.4 Hz, 1H), 3.65 (d, J=5.4 Hz, 6H), 3.51 (dd, J=11.0, 6.1 Hz, 6H), 3.40-3.26 (m, 1H).

    [0481] Preparation of (4): To a stirred solution of compound 3 (680 mg, 1.07 mmol) in DCM (20 mL) was added dichloroacetic acid (0.6 mL) dropwise at 0° C. under air atmosphere. The resulting mixture was stirred for 30 min at 0° C. under air atmosphere. The reaction was quenched with sat. NaHCO.sub.3 (aq.) at 0° C. The mixture was extracted with water (2×20 mL). The resulting mixture was concentrated to 25 mL under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, C18 silica gel; mobile phase, MeCN in water, 5% to 95% gradient in 115 min; detector, UV 254 nm. This resulted compound 4 (299 mg, 84%) as a white solid. ESI-LCMS: m/z 333 [M−H].sup.−; .sup.1H NMR (400 MHz, Deuterium Oxide) δ 7.60 (d, J=8.1 Hz, 1H), 6.64 (ddd, J=22.6, 17.4, 7.2 Hz, 1H), 5.98-5.87 (m, 1H), 5.77 (d, J=8.1 Hz, 1H), 5.66 (d, J=4.7 Hz, 1H), 4.45 (dd, J=6.8, 4.7 Hz, 1H), 4.27 (dd, J=9.1, 7.8 Hz, 1H), 4.15 (dd, J=9.1, 8.0 Hz, 1H), 3.63 (d, J=11.2 Hz, 6H), 3.22 (qdd, J=7.0, 2.6, 1.3 Hz, 1H).

    [0482] Preparation of (5): A solution of CEP[N(iPr).sub.2].sub.2 (272.16 mg, 0.9 mmol) in DCM (12 mL) was treated with molecular sieve under argon atmosphere followed by the addition of 1H-imidazole-4,5-dicarbonitrile (106.6 mg, 0.9 mmol). To the resulted solution, compound 4 (200 mg, 0.6 mmol) in 10 mL DCM was added dropwise slowly at room temperature. The resulting mixture was stirred for 1 h at room temperature under argon atmosphere. The resulting mixture was diluted with 0.5% TEA in DCM (20 mL). The reaction was quenched with Water at room temperature. The resulting mixture was extracted with 0.5% TEA in CH.sub.2Cl.sub.2 (3×15 mL). The combined organic layers were washed with brine (2×10 mL), dried over anhydrous MgSO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (0.5% TEA in CH.sub.2Cl.sub.2/MeOH 12:1) to afford final monomer 5 (example 25) (170 mg, 50.60%) as off-white semi-solid. ESI-LCMS: m/z 533 [M+H].sup.+; .sup.1H NMR (400 MHz, Acetonitrile-d.sub.3) δ 8.95 (s, 1H), 7.38 (dd, J=8.1, 6.1 Hz, 1H), 6.61 (dddd, J=21.5, 17.1, 11.1, 8.0 Hz, 1H), 5.92-5.64 (m, 2H), 5.56 (d, J=8.1 Hz, 1H), 4.64-4.44 (m, 1H), 4.11 (td, J=8.5, 4.5 Hz, 1H), 4.02 (td, J=8.9, 6.4 Hz, 1H), 3.82-3.36 (m, 10H), 3.24 (tq, J=16.6, 8.0 Hz, 1H), 2.59 (t, J=6.0 Hz, 1H), 2.54-2.45 (m, 1H), 1.09-0.97 (m, 12H); .sup.31P NMR: δ 149.67, 149.32, 19.25, 19.13.

    Additional Tables

    [0483]

    TABLE-US-00020 TABLE 17 SEQ ID NO: Description Sequence.sup.+ 55 Hepatitis B aattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctg virus ctggtggctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtca (Genbank atcttctcgaggattggggaccctgcgctgaacatggagaacatcacatcaggattccta Accession ggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgca No. gagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc U95551.1) aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggt tatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttc ttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcctcaac caccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatcc ctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcct gggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttacta gtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgat gtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaccaattttc ttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaatttt atgggttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatca aagaatgttttagaaaacttcctattaacaggcctattgattggaaagtatgtcaacgaattg tgggtcttttgggttttgctgccccatttacacaatgtggttatcctgcgttaatgcccttgtat gcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaac aatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctga cgcaacccccactggctggggcttggtcatgggccatcagcgcgtgcgtggaacctttt cggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtc tggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatacatcgtatc catggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc gtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcccctt ctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtct gtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac caccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctct gcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggagg agttgggggaggagattagattaaaggtctttgtactaggaggctgtaggcataaattggt ctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgtcctactg ttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataaaga atttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatct tctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctc accatactgcactcaggcaagcaattctttgctggggggaactaatgactctagctacctg ggtgggtgttaatttggaagatccagcatctagagacctagtagtcagttatgtcaacacta atatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagaga aaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagacc accaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcag gtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca gaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtggggaactt tactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaat atacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaat gagaaaagaagattgcaattgattatgcctgctaggttttatccaaaggttaccaaatattta ccattggataagggtattaaaccttattatccagaacatctagttaatcattacttccaaacta gacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctt tccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaa acacagcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaa caaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcct ccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacact catcctcaggccatgcagtgg 56 MCJ mRNA agtcactgccgcggcgccttgagtctccgggccgccttgccatggctgcccgtggtgtcatc (GenBank gctccagttggcgagagtttgcgctacgctgagtacttgcagccctcggccaaacggccag Accession acgccgacgtcgaccagcagagactggtaagaagtttgatagctgtaggactgggtgttgc No. agctcttgcatttgcaggtcgctacgcatttcggatctggaaacctctagaacaagttatcaca NM_013238.3) gaaactgcaaagaagatttcaactcctagcttttcatcctactataaaggaggatttgaacaga aaatgagtaggcgagaagctggtcttattttaggtgtaagcccatctgctggcaaggctaaga ttagaacagctcataggagagtcatgattttgaatcacccagataaaggtggatctccttacgt agcagccaaaataaatgaagcaaaagacttgctagaaacaaccaccaaacattgatgcttaa ggaccacactgaaggaaaaaaaaagaggggacttcgaaaaaaaaaaaagccctgcaaaa tattctaaaacatggtcttcttaattttctatatggattgaccacagtcttatcttccaccattaagct gtataacaataaaatgttaatagtcttgctttttattatcttttaaagatctccttaaattctataactg atcttttttcttattttgtttgtgacattcatacatttttaagatttttgttatgttctgaattcccccctac acacacacacacacacacacacacacacacgtgcaaaaaatatgatcaagaatgcaattgg gatttgtgagcaatgagtagacctcttattgtttatatttgtaccctcattgtcaatttttttttaggg aatttgggactctgcctatataaggtgttttaaatgtcttgagaacaagcactggctgatacctc ttggagatatgatctgaaatgtaatggaatttattaaatggtgtttagtaaagtaggggttaagg acttgttaaagaaccccactatctctgagaccctatagccaaagcatgaggacttggagagct actaaaatgattcaggtttacaaaatgagccctgtgaggaaaggttgagagaagtctgagga gtttgtatttaattatagtcttccagtactgtatattcattcattactcattctacaaatatttattgacc ccttttgatgtgcaaggcactatcgtgcgtcccctgagagttgcaagtatgaagcagtcatgg atcatgaaccaaaggaacttatatgtagaggaaggataaatcacaaatagtgaatactgttag atacagatgatatattttaaaagttcaaaggaagaaaagaatgtgttaaacactgcatgagag gaggaataagtggcatagagctaggctttagaaaagaaaaatattccgataccatatgattgg tgaggtaagtgttattctgagatgagaattagcagaaatagatatatcaatcggagtgattaga gtgcagggtttctggaaagcaaggtttggacagagtggtcatcaaaggccagccctgtgact tacactgcattaaattaatttcttagaacatagtccctgatcattatcactttactattccaaaggt gagagaacagattcagatagagtgccagcattgtttcccagtattcctttacaaatcttgggttc attccaggtaaactgaactactgcattgtttctatcttaaaatactttttagatatcctagatgcatc tttcaacttctaacattctgtagtttaggagttctcaaccttggcattattgacatgttaggccaaa taattttttttgtgggaggtctcttgtgcgttttagatgattagcaataatccctgacctgttatcta ctaaagactagtcgtttctcatcagttgtgacaacaaaaatggttccagatattgccaaatgcc ctttagaggacagtaatcgcccccagttgagaaccatttcagtaaaactttaattactattttttct tttggtttataaaataatgatcctgaattaaattgatggaaccttgaagtcgataaaatatatttctt gctttaaagtccccatacgtgtcctactaattttctcatgctttagtgttttcacttttctcctgttatc cttgtacctaagaatgccatcccaatccccagatgtccacctgcccaaagtctaggcatagct gaaggccaagctaaaatgtatccctctttttctggtacatgcagcaaaagtaatatgaattatca gctttctgagagcaggcattgtatctgtcttgtttggtgttacattggcacccaataaatatttgtt gagtgaatgaataaattcccatagcactttattcttcacatggtacataactataggggctatag cttggtaccttgtgaagcaactcttggtgtaacataccttatttctcatactaaaatgcaagaacc tttagagcaaggatcttgccattcatctttgtaacctctttactctggagcacttgcatttagcag gcatcataaagttttacgtaccaagaaaatgttgctgttttctgaatactatgcatcaaaaaatgt taccactaatttttaaagctctgctaaggaatattggggcaccctcagatgcaccttttaattgat gtcatattttcctaatccatactttattcatgagaatttgagtcaccccagcattagcttggaatttc cttatttcccatttgctttgcaggtgccttggagtcagatctggttttgaatactatcttcctgttat gtgatcttgggcagttacttaattttctagtcaataacccgtatctataaaatagagaaaataatc ctacacaccggggcctgttgtggggcggggagaggggggagggatcgcatttggagatat actaatgtaaatgacaagttaattggtgcagcacaccaacatggctcatgtctacatatgtaac aaacctgcacgttgtgcacatgtgccctagaacttaaagtataataaaaagaaattttaaaaaa tcctgtcaaataaggttatagtagagaataaggatgtgtaaagcatttagtcacgtaaatgctta aaaaaatgtaatttttacttctttcactgcctcatttaattagttttatctttaataataccttggattca gggtaaagtttcagttatgtcccagtaatcatttattttaccctcgaatctgcaatttggatagaa catggtggggacagctcgtctctattccttgcagcattaacaggctggaggcaccacttctct ggccagcaagttgggcctggttgttggctgagagcctcagttcctttctgcacaggttcctctt tacataggcttctcaacagggctactagagcatcgtcaccatagcagctgtcttataacagag agtggtcggtctgagagacaaaaaatggaagctgccaaattgttctgggtctggaaactgtc agggcatcacttgtgccatattcagttggcctaagaattacagagcctgcctcgattcaaagg gagaggatagagaggactgaaggaatcagtgctcatctttaatatgcagcaggacaggtttg ggattttttttcccccttgagtctgtgaaggcattacttaagaacaaagtcaggcatgtataattg aactacagttacttgaaatataagcccagaaagtttcagataataaatacaactatttttctgctg ttacccttgtacctaaagatgccatcctaatccccagatctccacaactatacctacatagtaga aggttaaaatgtatccctctttttctggtgcatccagcaaaagtaatatcatgaattatgagctct ctgagagcaaggatcatatcagtcttgtttattgttgcagtgaacaagtacagttgcagatattc aggagtaattatctaaatggcagtaggcttataaaactgaattttcaccagccacaccctcccc ccaactccttatctgtaaaaagcttatttgagtggttacctgtcttcagtaaagattgcgcttgca tatttgctgtcattgcatattctgcttaattaagctctgttgatattgcagtttctgtgcatacttacat cttagatgcaatctgagggcctaggaaggccttttaaaaataaaacaattccgattgcagaga aagtgtaagtcaaggacagttaattcaaggggaacatagaaagctatttagattttagttgatg gtgccagtcttcagcgtaaagtcaaaagtggagggaagtttagtaaggaaaaaatgttgggc ttggaatacattgtttagtcttcaaagcactttactttttatgaaatatattttagacattcagcaaat attgaatacttactatatcaggcagtaaagatataaattcattcttaaaatgtgcaacatgttcaa actgaaaaaaatacattcttaaacaggaaactttttccttcatactttttaattaacaagacatata agagttgcattaatgggcgtgcttatgattgatcacccagcagcatcattagaaataatatatttt attcatgtgcagaaatcttttggttgtcctggggaaccttgaacacagaaaagagcttttattga taaggtaattgaacacacttgacaattagcttaatatggtttaataccatttgtgggagaagatg aatcagccaggctctttacgtcaagaatatgaagtttctcttgagtcaaccaacttaagatgag ctacggagactgcagtgaaaagttaaatatccaagtacaccagccaatttcacacagtggaa ccatgctgtcctcgggcaccctgcacctcgcccaacagtcatcaactagatggaggctcctg gctgcaaggaggatttgatgggaatgagtaaatgtgtcagcatagtccgtcccttctaatgga aaagcaacccaaagagcaaatcctattaatggctggatcagtatcatctacttgtcaaaaaca ttccatgaattatgagtcaaaattttatttatggtggcattacacacattaagagatgaggacttc tgttagcataatttattagctggaaaagttgagaaggttctctggactcatttttataggtggaac ctaagtgatctggataattgcccaccagcaaaattgctgggcatggtggacaaagaaaatgtt ccttctaatgattttttatgagctgagtagctattgttcccagctgagtgctcttttcctctttttattg ttgctgagcaaaagaatttataaaaagctctttcttttgtattaaaaaccctgctcaattgaaatg caagttcattaagtaatcttcatttctcttcctgccataataaccctttccctctctgttcgattcaa cagtatctagcagcactgctccaaattttaagtctgaacagactatattacatagatgtagaga aatactcaatcttcagcattaagagggagcttaatttcacacgggtggaatatgatcactcagg ctagatgttggccataaatttcaaattagtatctcaacttagcaggggggatcaacagtggca aacttcaattatgacaggataaaaatcacatagagatattggttcaatatggacatctaaactat aatgctaaaagccaataattagaataagttcattttaagaaaagcattaataatattagctaacg tttagtacctgtgccaaacattctacctatgttaccttgattttcatagccagcctaagaggtact attatgtatccccattttacaggttaagaaacaggctcagaggagtttaggatcttttccaagatt acatagccagtaagtggtggcactaggaaccaaattcagactctgaatcgcatgctgtttatat tatattgcactcattctaaatatgtgggaatcagaatgaaggggcttgtatgacttttggctcatt ttttgatgcatgtgacctgggattataaatgtgaaattaggtttacgaaaggatccagtgtcatt gtgcatcatgggcaaggagtacctaatctctttaattcttccctggaagcttacgatgtccatcc aagtgcacatagcaaaagttctgttgtaaagtttagcagagtgactttctttgactcagagtgat gacggaggaagctttgataagattttatctgaaatgttcatggacaagagctttcaaggagaa catccagagcaaggttctgaagacagctcatgaaggtgaagcagcagacctggcacaaga aatgaagagagagctcagtgtattaaagatgaaaacaagaaaaccgaatatattgaaagga gcagagaggcaatgaaaacaagacaactgaaatgaggtaacttgcagcaattgaaaggga atttcagtacttttatagaattcttaaaaattgtttcctgctgtttattttcaattttgaacagggttatt tgtccatgccatactttttttgccaaattccaaaattgtgtatagttctatagttgtctggtggagtc aatggaactttagttaccagtctaagaatgtgtctttgagattgtccagttaattctctatttccagt agctgtaataaatggtgaaaaggtttctgactcctggagaaagtttctaactccttatgactaat attcataacagacttgtgagttccttgaacatggatacacctatatgcaagagtgtattccaaag ctaactcagtgatctttccatttatctattcttggattagtggtgcctttgctctttccttctgtaaatg tgaatagttaagagttgactgcagaagtgtttacactttggcttccatgcctctggaatgtttgtg ctttggtggtgagatgtgagactatatttgtatagtctgcatctctcaggctgccccagaatgtt gtacagtgcagtgctgaagaaagcagcaggtacacacagaaatgcagcctttcctggttaa ccctgcttggatctgagttacactttgtttcctgacttcttgggacttaggtaatcagtttgccttct actctatctcattttgtactcgcttacatactacattcttgtttgggctttcgtttcttcttgtaagcag agattttttaaaatccaatatgtgaaaatacggatgcactacaattaaataaataaaatgctgttg tgtttgttttgctttaaaattgtaaaggataaacaataagatagttttatctatgtggttttcccgatg cagttaaaataaaacctaatctgctaaaattgaa 57 TAZ gctttccggcggttgcaccgggccggggtgccagcgcccgccttcccgtttcctcccgttcc (GenBank gcagcgcgcccacggcctgtgaccccggcgaccgctccccagtgacgagagagcgggg Accession ccgggcgctgctccggcctgacctgcgaagggacctcggtccagtcccctgttgcgccgc No. gcccccgtccgtccgtgcgcgggccagtcaggggccagtgtctcgagcggtcgaggtcg NM_000116.5) cagacctagaggcgccccacaggccggcccggggcgctgggagcgccggccgcgggc cgggtggggatgcctctgcacgtgaagtggccgttccccgcggtgccgccgctcacctgg accctggccagcagcgtcgtcatgggcttggtgggcacctacagctgcttctggaccaagt acatgaaccacctgaccgtgcacaacagggaggtgctgtacgagctcatcgagaagcgag gcccggccacgcccctcatcaccgtgtccaatcaccagtcctgcatggacgaccctcatctc tgggggatcctgaaactccgccacatctggaacctgaagttgatgcgttggacccctgcagc tgcagacatctgcttcaccaaggagctacactcccacttcttcagcttgggcaagtgtgtgcct gtgtgccgaggagcagaatttttccaagcagagaatgaggggaaaggtgttctagacacag gcaggcacatgccaggtgctggaaaaagaagagagaaaggagatggcgtctaccagaag gggatggacttcattttggagaagctcaaccatggggactgggtgcatatcttcccagaagg gaaagtgaacatgagttccgaattcctgcgtttcaagtggggaatcgggcgcctgattgctg agtgtcatctcaaccccatcatcctgcccctgtggcatgtcggaatgaatgacgtccttcctaa cagtccgccctacttcccccgctttggacagaaaatcactgtgctgatcgggaagcccttca gtgccctgcctgtactcgagcggctccgggcggagaacaagtcggctgtggagatgcgga aagccctgacggacttcattcaagaggaattccagcatctgaagactcaggcagagcagct ccacaaccacctccagcctgggagataggccttgcttgctgccttctggattcttggcccgca cagagctggggctgagggatggactgatgcttttagctcaaacgtggcttttagacagatttg ttcatagaccctctcaagtgccctctccgagctggtaggcattccagctcctccgtgcttcctc agttacacaaaggacctcagctgcttctcccacttggccaagcagggaggaagaagcttag gcagggctctctttccttcttgccttcagatgttctctcccaggggctggcttcaggagggagc atagaaggcaggtgagcaaccagttggctaggggagcagggggcccaccagagctgtg gagaggggaccctaagactcctcggcctggctcctacccaccgcccttgccgaaccagga gctgctcactacctcctcagggatggccgttggccacgtcttccttctgcctgagcttcccccc caccacaggccctttcctcaggcaaggtctggcctcaggtgggccgcaggcgggaaaag cagcccttggccagaagtcaagcccagccacgtggagcctagagtgagggcctgaggtct ggctgcttgcccccatgctggcgccaacaacttctccatcctttctgcctctcaacatcacttg aatcctagggcctgggttttcatgtttttgaaacagaaccataaagcatatgtgttggcttgttgt aaaa 58 ANGPTL3 agaagaaaacagttccacgttgcttgaaattgaaaatcaagataaaaatgttcacaattaagct (GenBank ccttctttttattgttcctctagttatttcctccagaattgatcaagacaattcatcatttgattctctat Accession ctccagagccaaaatcaagatttgctatgttagacgatgtaaaaattttagccaatggcctcctt No. cagttgggacatggtcttaaagactttgtccataagacgaagggccaaattaatgacatatttc NM_014495.4) aaaaactcaacatatttgatcagtctttttatgatctatcgctgcaaaccagtgaaatcaaagaa gaagaaaaggaactgagaagaactacatataaactacaagtcaaaaatgaagaggtaaag aatatgtcacttgaactcaactcaaaacttgaaagcctcctagaagaaaaaattctacttcaac aaaaagtgaaatatttagaagagcaactaactaacttaattcaaaatcaacctgaaactccag aacacccagaagtaacttcacttaaaacttttgtagaaaaacaagataatagcatcaaagacc ttctccagaccgtggaagaccaatataaacaattaaaccaacagcatagtcaaataaaagaa atagaaaatcagctcagaaggactagtattcaagaacccacagaaatttctctatcttccaag ccaagagcaccaagaactactccctttcttcagttgaatgaaataagaaatgtaaaacatgat ggcattcctgctgaatgtaccaccatttataacagaggtgaacatacaagtggcatgtatgcc atcagacccagcaactctcaagtttttcatgtctactgtgatgttatatcaggtagtccatggac attaattcaacatcgaatagatggatcacaaaacttcaatgaaacgtgggagaactacaaata tggttttgggaggcttgatggagaattttggttgggcctagagaagatatactccatagtgaag caatctaattatgttttacgaattgagttggaagactggaaagacaacaaacattatattgaata ttctttttacttgggaaatcacgaaaccaactatacgctacatctagttgcgattactggcaatgt ccccaatgcaatcccggaaaacaaagatttggtgttttctacttgggatcacaaagcaaaagg acacttcaactgtccagagggttattcaggaggctggtggtggcatgatgagtgtggagaaa acaacctaaatggtaaatataacaaaccaagagcaaaatctaagccagagaggagaagag gattatcttggaagtctcaaaatggaaggttatactctataaaatcaaccaaaatgttgatccat ccaacagattcagaaagctttgaatgaactgaggcaaatttaaaaggcaataatttaaacatta acctcattccaagttaatgtggtctaataatctggtattaaatccttaagagaaagcttgagaaa tagattttttttatcttaaagtcactgtctatttaagattaaacatacaatcacataaccttaaagaa taccgtttacatttctcaatcaaaattcttataatactatttgttttaaattttgtgatgtgggaatcaa ttttagatggtcacaatctagattataatcaataggtgaacttattaaataacttttctaaataaaa aatttagagacttttattttaaaaggcatcatatgagctaatatcacaactttcccagtttaaaaaa ctagtactcttgttaaaactctaaacttgactaaatacagaggactggtaattgtacagttcttaa atgttgtagtattaatttcaaaactaaaaatcgtcagcacagagtatgtgtaaaaatctgtaatac aaatttttaaactgatgcttcattttgctacaaaataatttggagtaaatgtttgatatgatttatttat gaaacctaatgaagcagaattaaatactgtattaaaataagttcgctgtctttaaacaaatgga gatgactactaagtcacattgactttaacatgaggtatcactataccttatttgttaaaatatatac tgtatacattttatatattttaacacttaatactatgaaaacaaataattgtaaaggaatcttgtcag attacagtaagaatgaacatatttgtggcatcgagttaaagtttatatttcccctaaatatgctgt gattctaatacattcgtgtaggttttcaagtagaaataaacctcgtaacaagttactgaacgttta aacagcctgacaagcatgtatatatgtttaaaattcaataaacaaagacccagtccctaaatta tagaaatttaaattattcttgcatgtttatcgacatcacaacagatccctaaatccctaaatcccta aagattagatacaaattttttaccacagtatcacttgtcagaatttatttttaaatatgattttttaaa actgccagtaagaaattttaaattaaacccatttgttaaaggatatagtgcccaagttatatggt gacctacctttgtcaatacttagcattatgtatttcaaattatccaatatacatgtcatatatattttta tatgtcacatatataaaagatatgtatgatctatgtgaatcctaagtaaatattttgttccagaaaa gtacaaaataataaaggtaaaaataatctataattttcaggaccacagactaagctgtcgaaat taacgctgatttttttagggccagaataccaaaatggctcctctcttcccccaaaattggacaat ttcaaatgcaaaataattcattatttaatatatgagttgcttcctctatttggtttcc 59 DGAT2 tgccccgttgtgaggtgataaagtgttgcgctccgggacgccagcgccgcggctgccgcct (GenBank ctgctggggtctaggctgtttctctcgcgccaccactggccgccggccgcagctccaggtgt Accession cctagccgcccagcctcgacgccgtcccgggacccctgtgctctgcgcgaagccctggcc No. ccgggggccggggcatgggccaggggcgcggggtgaagcggcttcccgcggggccgt NM_001253891.1) gactgggcgggcttcagccatgaagaccctcatagccgcctactccggggtcctgcgcgg cgagcgtcaggccgaggctgaccggagccagcgctctcacggaggacctgcgctgtcgc gcgaggggtctgggagatggggagtggcctgcagtgccatcctcatgtacatattctgcact gattgctggctcatcgctgtgctctacttcacttggctggtgtttgactggaacacacccaaga aaggtggcaggaggtcacagtgggtccgaaactgggctgtgtggcgctactttcgagacta ctttcccatccagctggtgaagacacacaacctgctgaccaccaggaactatatctttggata ccacccccatggtatcatgggcctgggtgccttctgcaacttcagcacagaggccacagaa gtgagcaagaagttcccaggcatacggccttacctggctacactggcaggcaacttccgaa tgcctgtgttgagggagtacctgatgtctggaggtatctgccctgtcagccgggacaccata gactatttgctttcaaagaatgggagtggcaatgctatcatcatcgtggtcgggggtgcggct gagtctctgagctccatgcctggcaagaatgcagtcaccctgcggaaccgcaagggctttgt gaaactggccctgcgtcatggagctgacctggttcccatctactcctttggagagaatgaagt gtacaagcaggtgatcttcgaggagggctcctggggccgatgggtccagaagaagttcca gaaatacattggtttcgccccatgcatcttccatggtcgaggcctcttctcctccgacacctgg gggctggtgccctactccaagcccatcaccactgttgtgggagagcccatcaccatcccca agctggagcacccaacccagcaagacatcgacctgtaccacaccatgtacatggaggccc tggtgaagctcttcgacaagcacaagaccaagttcggcctcccggagactgaggtcctgga ggtgaactgagccagccttcggggccaattccctggaggaaccagctgcaaatcactttttt gctctgtaaatttggaagtgtcatgggtgtctgtgggttatttaaaagaaattataacaattttgct aaaccattacaatgttaggtcttttttaagaaggaaaaagtcagtatttcaagttctttcacttcca gcttgccctgttctaggtggtggctaaatctgggcctaatctgggtggctcagctaacctctctt cttcccttcctgaagtgacaaaggaaactcagtcttcttggggaagaaggattgccattagtg acttggaccagttagatgattcactttttgcccctagggatgagaggcgaaagccacttctcat acaagcccctttattgccactaccccacgctcgtctagtcctgaaactgcaggaccagtttctc tgccaaggggaggagttggagagcacagttgccccgttgtgtgagggcagtagtaggcat ctggaatgctccagtttgatctcccttctgccacccctacctcacccctagtcactcatatcgga gcctggactggcctccaggatgaggatgggggtggcaatgacaccctgcaggggaaagg actgccccccatgcaccattgcagggaggatgccgccaccatgagctaggtggagtaact ggtttttcttgggtggctgatgacatggatgcagcacagactcagccttggcctggagcacat gcttactggtggcctcagtttaccttccccagatcctagattctggatgtgaggaagagatccc tcttcagaaggggcctggccttctgagcagcagattagttccaaagcaggtggcccccgaa cccaagcctcacttttctgtgccttcctgagggggttgggccggggaggaaacccaaccctc tcctgtgtgttctgttatctcttgatgagatcattgcaccatgtcagacttttgtatatgccttgaaa ataaatgaaagtgagaatcctctaaaaaaaaaaaa 60 HBV ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggt Genbank ggctcaagttccggaacagtaaaccctgctccgactactgcctctcccatatcgtcaatcttct Accession cgaggactggggaccctgtaccgaatatggagagcaccacatcaggattcctaggacccct No. gctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagac KC315400.1 tcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagt ccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgt ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcaccggaccat gcaaaacctgcacaactactgctcaagggacctctatgtttccctcatgttgctgtacaaaacc tacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgg gagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagg gctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtaca acatcttgagtccctttataccgctgttaccaattttcttttatctttgggtatacatttaaaccctca caaaacaaaaagatggggatattcccttaacttcatgggatatgtaattgggagttggggcac tttgcctcaggaacatattgtacaaaaaatcaagcaatgttttaggaaacttcctgtaaacagg cctattgattggaaagtatgtcaacraattgtgggtcttttggggtttgccgcccctttcacgca atgtggatatcctgctttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcg ccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggt caggtctttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatc agcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagctt gttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcg gaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgt cctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttggga ctctaccgtccccttctgcgtctgccgttccgcccgaccacggggcgcacctctctttacgcg gtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcg catggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactctt ggactttcagcaatgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagt gggaggagttgggggaggaggttaggttaaaggtctttgtactaggaggctgtaggcataa attggtgtgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtccta ctgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaag aatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcct cgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcacca tacggcactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgg gaagtaatttggaagatccagcatccagggaattagtagtcagctatgtcaacgttaatatgg gcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaactgttc ttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcc cctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaaga agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctc gggaatctcaatgttagtattccttggacacataaggtgggaaactttacggggctttattcttct acggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgcaggaggac attgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagacttaaat taattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaac cgtattatccagagtatgtagttaatcattacttccagacgcgacattatttacacactctttgga aggcggggatcttatataaaagagagtccacacgtagcgcctcattttgcgggtcaccatatt cttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggcatgggga caaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaa gccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcc aacaaggtgggagtgggagcattcgggccagggttcacccctcctcatgggggactgttg gggtggagccctcaggctcagggcatattcacaacagtgccagcagctcctcctcctgcct ccaccaatcggcagtcaggaaggcagcctactcccttctctccacctctaagagacactcat cctcaggccatgcagtggaa 61 ASO 1 GalNAc4-ps-GalNAc4-ps-GalNAc4-po-mA-po- lnGpslnApslnTpslnApslnApsApsAps(5OH)CpsGps(5m)Cps(5m) CpsGps(5m)CpslnApslnGpslnApscp(5m)C 62 ASO 2 mA-po- lnGpslnApslnTpslnApslnApsApsAps(5OH)CpsGps(5m)Cps(5m) CpsGps(5m)CpslnApslnGpslnApscp(5m)C 74 SARS-CoV- attaaaggtttataccttcccaggtaacaaaccaaccaactttcgatctcttgtagatctgttctct 2 genome aaacgaactttaaaatctgtgtggctgtcactcggctgcatgcttagtgcactcacgcagtata (Genbank attaataactaattactgtcgttgacaggacacgagtaactcgtctatcttctgcaggctgctta Accession cggtttcgtccgtgttgcagccgatcatcagcacatctaggtttcgtccgggtgtgaccgaaa No. ggtaagatggagagccttgtccctggtttcaacgagaaaacacacgtccaactcagtttgcct NC_045512.2) gttttacaggttcgcgacgtgctcgtacgtggctttggagactccgtggaggaggtcttatca gaggcacgtcaacatcttaaagatggcacttgtggcttagtagaagttgaaaaaggcgttttg cctcaacttgaacagccctatgtgttcatcaaacgttcggatgctcgaactgcacctcatggtc atgttatggttgagctggtagcagaactcgaaggcattcagtacggtcgtagtggtgagaca cttggtgtccttgtccctcatgtgggcgaaataccagtggcttaccgcaaggttcttcttcgtaa gaacggtaataaaggagctggtggccatagttacggcgccgatctaaagtcatttgacttag gcgacgagcttggcactgatccttatgaagattttcaagaaaactggaacactaaacatagca gtggtgttacccgtgaactcatgcgtgagcttaacggaggggcatacactcgctatgtcgata acaacttctgtggccctgatggctaccctcttgagtgcattaaagaccttctagcacgtgctgg taaagcttcatgcactttgtccgaacaactggactttattgacactaagaggggtgtatactgct gccgtgaacatgagcatgaaattgcttggtacacggaacgttctgaaaagagctatgaattg cagacaccttttgaaattaaattggcaaagaaatttgacaccttcaatggggaatgtccaaattt tgtatttcccttaaattccataatcaagactattcaaccaagggttgaaaagaaaaagcttgatg gctttatgggtagaattcgatctgtctatccagttgcgtcaccaaatgaatgcaaccaaatgtg cctttcaactctcatgaagtgtgatcattgtggtgaaacttcatggcagacgggcgattttgtta aagccacttgcgaattttgtggcactgagaatttgactaaagaaggtgccactacttgtggtta cttaccccaaaatgctgttgttaaaatttattgtccagcatgtcacaattcagaagtaggacctg agcatagtcttgccgaataccataatgaatctggcttgaaaaccattcttcgtaagggtggtcg cactattgcctttggaggctgtgtgttctcttatgttggttgccataacaagtgtgcctattgggtt ccacgtgctagcgctaacataggttgtaaccatacaggtgttgttggagaaggttccgaaggt cttaatgacaaccttcttgaaatactccaaaaagagaaagtcaacatcaatattgttggtgactt taaacttaatgaagagatcgccattattttggcatctttttctgcttccacaagtgcttttgtggaa actgtgaaaggtttggattataaagcattcaaacaaattgttgaatcctgtggtaattttaaagtt acaaaaggaaaagctaaaaaaggtgcctggaatattggtgaacagaaatcaatactgagtc ctctttatgcatttgcatcagaggctgctcgtgttgtacgatcaattttctcccgcactcttgaaa ctgctcaaaattctgtgcgtgttttacagaaggccgctataacaatactagatggaatttcaca gtattcactgagactcattgatgctatgatgttcacatctgatttggctactaacaatctagttgta atggcctacattacaggtggtgttgttcagttgacttcgcagtggctaactaacatctttggcac tgtttatgaaaaactcaaacccgtccttgattggcttgaagagaagtttaaggaaggtgtagag tttcttagagacggttgggaaattgttaaatttatctcaacctgtgcttgtgaaattgtcggtgga caaattgtcacctgtgcaaaggaaattaaggagagtgttcagacattctttaagcttgtaaata aatttttggctttgtgtgctgactctatcattattggtggagctaaacttaaagccttgaatttaggt gaaacatttgtcacgcactcaaagggattgtacagaaagtgtgttaaatccagagaagaaac tggcctactcatgcctctaaaagccccaaaagaaattatcttcttagagggagaaacacttcc cacagaagtgttaacagaggaagttgtcttgaaaactggtgatttacaaccattagaacaacc tactagtgaagctgttgaagctccattggttggtacaccagtttgtattaacgggcttatgttgct cgaaatcaaagacacagaaaagtactgtgcccttgcacctaatatgatggtaacaaacaata ccttcacactcaaaggcggtgcaccaacaaaggttacttttggtgatgacactgtgatagaag tgcaaggttacaagagtgtgaatatcacttttgaacttgatgaaaggattgataaagtacttaat gagaagtgctctgcctatacagttgaactcggtacagaagtaaatgagttcgcctgtgttgtg gcagatgctgtcataaaaactttgcaaccagtatctgaattacttacaccactgggcattgattt agatgagtggagtatggctacatactacttatttgatgagtctggtgagtttaaattggcttcac atatgtattgttctttctaccctccagatgaggatgaagaagaaggtgattgtgaagaagaaga gtttgagccatcaactcaatatgagtatggtactgaagatgattaccaaggtaaacctttggaa tttggtgccacttctgctgctcttcaacctgaagaagagcaagaagaagattggttagatgatg atagtcaacaaactgttggtcaacaagacggcagtgaggacaatcagacaactactattcaa acaattgttgaggttcaacctcaattagagatggaacttacaccagttgttcagactattgaagt gaatagttttagtggttatttaaaacttactgacaatgtatacattaaaaatgcagacattgtgga agaagctaaaaaggtaaaaccaacagtggttgttaatgcagccaatgtttaccttaaacatgg aggaggtgttgcaggagccttaaataaggctactaacaatgccatgcaagttgaatctgatg attacatagctactaatggaccacttaaagtgggtggtagttgtgttttaagcggacacaatctt gctaaacactgtcttcatgttgtcggcccaaatgttaacaaaggtgaagacattcaacttcttaa gagtgcttatgaaaattttaatcagcacgaagttctacttgcaccattattatcagctggtattttt ggtgctgaccctatacattctttaagagtttgtgtagatactgttcgcacaaatgtctacttagct gtctttgataaaaatctctatgacaaacttgtttcaagctttttggaaatgaagagtgaaaagca agttgaacaaaagatcgctgagattcctaaagaggaagttaagccatttataactgaaagtaa accttcagttgaacagagaaaacaagatgataagaaaatcaaagcttgtgttgaagaagttac aacaactctggaagaaactaagttcctcacagaaaacttgttactttatattgacattaatggca atcttcatccagattctgccactcttgttagtgacattgacatcactttcttaaagaaagatgctc catatatagtgggtgatgttgttcaagagggtgttttaactgctgtggttatacctactaaaaag gctggtggcactactgaaatgctagcgaaagctttgagaaaagtgccaacagacaattatat aaccacttacccgggtcagggtttaaatggttacactgtagaggaggcaaagacagtgctta aaaagtgtaaaagtgccttttacattctaccatctattatctctaatgagaagcaagaaattcttg gaactgtttcttggaatttgcgagaaatgcttgcacatgcagaagaaacacgcaaattaatgc ctgtctgtgtggaaactaaagccatagtttcaactatacagcgtaaatataagggtattaaaata caagagggtgtggttgattatggtgctagattttacttttacaccagtaaaacaactgtagcgtc acttatcaacacacttaacgatctaaatgaaactcttgttacaatgccacttggctatgtaacac atggcttaaatttggaagaagctgctcggtatatgagatctctcaaagtgccagctacagtttct gtttcttcacctgatgctgttacagcgtataatggttatcttacttcttcttctaaaacacctgaag aacattttattgaaaccatctcacttgctggttcctataaagattggtcctattctggacaatctac acaactaggtatagaatttcttaagagaggtgataaaagtgtatattacactagtaatcctacca cattccacctagatggtgaagttatcacctttgacaatcttaagacacttctttctttgagagaag tgaggactattaaggtgtttacaacagtagacaacattaacctccacacgcaagttgtggaca tgtcaatgacatatggacaacagtttggtccaacttatttggatggagctgatgttactaaaata aaacctcataattcacatgaaggtaaaacattttatgttttacctaatgatgacactctacgtgtt gaggcttttgagtactaccacacaactgatcctagttttctgggtaggtacatgtcagcattaaa tcacactaaaaagtggaaatacccacaagttaatggtttaacttctattaaatgggcagataac aactgttatcttgccactgcattgttaacactccaacaaatagagttgaagtttaatccacctgct ctacaagatgcttattacagagcaagggctggtgaagctgctaacttttgtgcacttatcttagc ctactgtaataagacagtaggtgagttaggtgatgttagagaaacaatgagttacttgtttcaa catgccaatttagattcttgcaaaagagtcttgaacgtggtgtgtaaaacttgtggacaacagc agacaacccttaagggtgtagaagctgttatgtacatgggcacactttcttatgaacaatttaa gaaaggtgttcagataccttgtacgtgtggtaaacaagctacaaaatatctagtacaacagga gtcaccttttgttatgatgtcagcaccacctgctcagtatgaacttaagcatggtacatttacttg tgctagtgagtacactggtaattaccagtgtggtcactataaacatataacttctaaagaaactt tgtattgcatagacggtgctttacttacaaagtcctcagaatacaaaggtcctattacggatgttt tctacaaagaaaacagttacacaacaaccataaaaccagttacttataaattggatggtgttgtt tgtacagaaattgaccctaagttggacaattattataagaaagacaattcttatttcacagagca accaattgatcttgtaccaaaccaaccatatccaaacgcaagcttcgataattttaagtttgtat gtgataatatcaaatttgctgatgatttaaaccagttaactggttataagaaacctgcttcaaga gagcttaaagttacatttttccctgacttaaatggtgatgtggtggctattgattataaacactac acaccctcttttaagaaaggagctaaattgttacataaacctattgtttggcatgttaacaatgca actaataaagccacgtataaaccaaatacctggtgtatacgttgtctttggagcacaaaacca gttgaaacatcaaattcgtttgatgtactgaagtcagaggacgcgcagggaatggataatctt gcctgcgaagatctaaaaccagtctctgaagaagtagtggaaaatcctaccatacagaaag acgttcttgagtgtaatgtgaaaactaccgaagttgtaggagacattatacttaaaccagcaaa taatagtttaaaaattacagaagaggttggccacacagatctaatggctgcttatgtagacaat tctagtcttactattaagaaacctaatgaattatctagagtattaggtttgaaaacccttgctactc atggtttagctgctgttaatagtgtcccttgggatactatagctaattatgctaagccttttcttaa caaagttgttagtacaactactaacatagttacacggtgtttaaaccgtgtttgtactaattatatg ccttatttctttactttattgctacaattgtgtacttttactagaagtacaaattctagaattaaagca tctatgccgactactatagcaaagaatactgttaagagtgtcggtaaattttgtctagaggcttc atttaattatttgaagtcacctaatttttctaaactgataaatattataatttggtttttactattaagtg tttgcctaggttctttaatctactcaaccgctgctttaggtgttttaatgtctaatttaggcatgcctt cttactgtactggttacagagaaggctatttgaactctactaatgtcactattgcaacctactgta ctggttctataccttgtagtgtttgtcttagtggtttagattctttagacacctatccttctttagaaa ctatacaaattaccatttcatcttttaaatgggatttaactgcttttggcttagttgcagagtggtttt tggcatatattcttttcactaggtttttctatgtacttggattggctgcaatcatgcaattgtttttca gctattttgcagtacattttattagtaattcttggcttatgtggttaataattaatcttgtacaaatgg ccccgatttcagctatggttagaatgtacatcttctttgcatcattttattatgtatggaaaagttat gtgcatgttgtagacggttgtaattcatcaacttgtatgatgtgttacaaacgtaatagagcaac aagagtcgaatgtacaactattgttaatggtgttagaaggtccttttatgtctatgctaatggag gtaaaggcttttgcaaactacacaattggaattgtgttaattgtgatacattctgtgctggtagta catttattagtgatgaagttgcgagagacttgtcactacagtttaaaagaccaataaatcctact gaccagtcttcttacatcgttgatagtgttacagtgaagaatggttccatccatctttactttgata aagctggtcaaaagacttatgaaagacattctctctctcattttgttaacttagacaacctgaga gctaataacactaaaggttcattgcctattaatgttatagtttttgatggtaaatcaaaatgtgaa gaatcatctgcaaaatcagcgtctgtttactacagtcagcttatgtgtcaacctatactgttacta gatcaggcattagtgtctgatgttggtgatagtgcggaagttgcagttaaaatgtttgatgctta cgttaatacgttttcatcaacttttaacgtaccaatggaaaaactcaaaacactagttgcaactg cagaagctgaacttgcaaagaatgtgtccttagacaatgtcttatctacttttatttcagcagctc ggcaagggtttgttgattcagatgtagaaactaaagatgttgttgaatgtcttaaattgtcacatc aatctgacatagaagttactggcgatagttgtaataactatatgctcacctataacaaagttgaa aacatgacaccccgtgaccttggtgcttgtattgactgtagtgcgcgtcatattaatgcgcagg tagcaaaaagtcacaacattgctttgatatggaacgttaaagatttcatgtcattgtctgaacaa ctacgaaaacaaatacgtagtgctgctaaaaagaataacttaccttttaagttgacatgtgcaa ctactagacaagttgttaatgttgtaacaacaaagatagcacttaagggtggtaaaattgttaat aattggttgaagcagttaattaaagttacacttgtgttcctttttgttgctgctattttctatttaataa cacctgttcatgtcatgtctaaacatactgacttttcaagtgaaatcataggatacaaggctatt gatggtggtgtcactcgtgacatagcatctacagatacttgttttgctaacaaacatgctgatttt gacacatggtttagccagcgtggtggtagttatactaatgacaaagcttgcccattgattgctg cagtcataacaagagaagtgggttttgtcgtgcctggtttgcctggcacgatattacgcacaa ctaatggtgactttttgcatttcttacctagagtttttagtgcagttggtaacatctgttacacacca tcaaaacttatagagtacactgactttgcaacatcagcttgtgttttggctgctgaatgtacaatt tttaaagatgcttctggtaagccagtaccatattgttatgataccaatgtactagaaggttctgtt gcttatgaaagtttacgccctgacacacgttatgtgctcatggatggctctattattcaatttcct aacacctaccttgaaggttctgttagagtggtaacaacttttgattctgagtactgtaggcacg gcacttgtgaaagatcagaagctggtgtttgtgtatctactagtggtagatgggtacttaacaat gattattacagatctttaccaggagttttctgtggtgtagatgctgtaaatttacttactaatatgttt acaccactaattcaacctattggtgctttggacatatcagcatctatagtagctggtggtattgta gctatcgtagtaacatgccttgcctactattttatgaggtttagaagagcttttggtgaatacagt catgtagttgcctttaatactttactattccttatgtcattcactgtactctgtttaacaccagtttact cattcttacctggtgtttattctgttatttacttgtacttgacattttatcttactaatgatgtttctttttt agcacatattcagtggatggttatgttcacacctttagtacctttctggataacaattgcttatatc atttgtatttccacaaagcatttctattggttctttagtaattacctaaagagacgtgtagtctttaat ggtgtttcctttagtacttttgaagaagctgcgctgtgcacctttttgttaaataaagaaatgtatc taaagttgcgtagtgatgtgctattacctcttacgcaatataatagatacttagctctttataataa gtacaagtattttagtggagcaatggatacaactagctacagagaagctgcttgttgtcatctc gcaaaggctctcaatgacttcagtaactcaggttctgatgttctttaccaaccaccacaaacct ctatcacctcagctgttttgcagagtggttttagaaaaatggcattcccatctggtaaagttgag ggttgtatggtacaagtaacttgtggtacaactacacttaacggtctttggcttgatgacgtagt ttactgtccaagacatgtgatctgcacctctgaagacatgcttaaccctaattatgaagatttact cattcgtaagtctaatcataatttcttggtacaggctggtaatgttcaactcagggttattggaca ttctatgcaaaattgtgtacttaagcttaaggttgatacagccaatcctaagacacctaagtata agtttgttcgcattcaaccaggacagactttttcagtgttagcttgttacaatggttcaccatctg gtgtttaccaatgtgctatgaggcccaatttcactattaagggttcattccttaatggttcatgtg gtagtgttggttttaacatagattatgactgtgtctctttttgttacatgcaccatatggaattacca actggagttcatgctggcacagacttagaaggtaacttttatggaccttttgttgacaggcaaa cagcacaagcagctggtacggacacaactattacagttaatgttttagcttggttgtacgctgc tgttataaatggagacaggtggtttctcaatcgatttaccacaactcttaatgactttaaccttgt ggctatgaagtacaattatgaacctctaacacaagaccatgttgacatactaggacctctttct gctcaaactggaattgccgttttagatatgtgtgcttcattaaaagaattactgcaaaatggtat gaatggacgtaccatattgggtagtgctttattagaagatgaatttacaccttttgatgttgttag acaatgctcaggtgttactttccaaagtgcagtgaaaagaacaatcaagggtacacaccact ggttgttactcacaattttgacttcacttttagttttagtccagagtactcaatggtctttgttctttttt ttgtatgaaaatgcctttttaccttttgctatgggtattattgctatgtctgcttttgcaatgatgtttg tcaaacataagcatgcatttctctgtttgtttttgttaccttctcttgccactgtagcttattttaatat ggtctatatgcctgctagttgggtgatgcgtattatgacatggttggatatggttgatactagttt gtctggttttaagctaaaagactgtgttatgtatgcatcagctgtagtgttactaatccttatgaca gcaagaactgtgtatgatgatggtgctaggagagtgtggacacttatgaatgtcttgacactc gtttataaagtttattatggtaatgctttagatcaagccatttccatgtgggctcttataatctctgtt acttctaactactcaggtgtagttacaactgtcatgtttttggccagaggtattgtttttatgtgtgt tgagtattgccctattttcttcataactggtaatacacttcagtgtataatgctagtttattgtttctta ggctatttttgtacttgttactttggcctcttttgtttactcaaccgctactttagactgactcttggt gtttatgattacttagtttctacacaggagtttagatatatgaattcacagggactactcccaccc aagaatagcatagatgccttcaaactcaacattaaattgttgggtgttggtggcaaaccttgtat caaagtagccactgtacagtctaaaatgtcagatgtaaagtgcacatcagtagtcttactctca gttttgcaacaactcagagtagaatcatcatctaaattgtgggctcaatgtgtccagttacacaa tgacattctcttagctaaagatactactgaagcctttgaaaaaatggtttcactactttctgttttg ctttccatgcagggtgctgtagacataaacaagctttgtgaagaaatgctggacaacagggc aaccttacaagctatagcctcagagtttagttcccttccatcatatgcagcttttgctactgctca agaagcttatgagcaggctgttgctaatggtgattctgaagttgttcttaaaaagttgaagaagt ctttgaatgtggctaaatctgaatttgaccgtgatgcagccatgcaacgtaagttggaaaagat ggctgatcaagctatgacccaaatgtataaacaggctagatctgaggacaagagggcaaaa gttactagtgctatgcagacaatgcttttcactatgcttagaaagttggataatgatgcactcaa caacattatcaacaatgcaagagatggttgtgttcccttgaacataatacctcttacaacagca gccaaactaatggttgtcataccagactataacacatataaaaatacgtgtgatggtacaacat ttacttatgcatcagcattgtgggaaatccaacaggttgtagatgcagatagtaaaattgttcaa cttagtgaaattagtatggacaattcacctaatttagcatggcctcttattgtaacagctttaagg gccaattctgctgtcaaattacagaataatgagcttagtcctgttgcactacgacagatgtcttg tgctgccggtactacacaaactgcttgcactgatgacaatgcgttagcttactacaacacaac aaagggaggtaggtttgtacttgcactgttatccgatttacaggatttgaaatgggctagattcc ctaagagtgatggaactggtactatctatacagaactggaaccaccttgtaggtttgttacaga cacacctaaaggtcctaaagtgaagtatttatactttattaaaggattaaacaacctaaatagag gtatggtacttggtagtttagctgccacagtacgtctacaagctggtaatgcaacagaagtgc ctgccaattcaactgtattatctttctgtgcttttgctgtagatgctgctaaagcttacaaagattat ctagctagtgggggacaaccaatcactaattgtgttaagatgttgtgtacacacactggtactg gtcaggcaataacagttacaccggaagccaatatggatcaagaatcctttggtggtgcatcgt gttgtctgtactgccgttgccacatagatcatccaaatcctaaaggattttgtgacttaaaaggt aagtatgtacaaatacctacaacttgtgctaatgaccctgtgggttttacacttaaaaacacagt ctgtaccgtctgcggtatgtggaaaggttatggctgtagttgtgatcaactccgcgaacccat gcttcagtcagctgatgcacaatcgtttttaaacgggtttgcggtgtaagtgcagcccgtctta caccgtgcggcacaggcactagtactgatgtcgtatacagggcttttgacatctacaatgata aagtagctggttttgctaaattcctaaaaactaattgttgtcgcttccaagaaaaggacgaaga tgacaatttaattgattcttactttgtagttaagagacacactttctctaactaccaacatgaagaa acaatttataatttacttaaggattgtccagctgttgctaaacatgacttctttaagtttagaatag acggtgacatggtaccacatatatcacgtcaacgtcttactaaatacacaatggcagacctcg tctatgctttaaggcattttgatgaaggtaattgtgacacattaaaagaaatacttgtcacataca attgttgtgatgatgattatttcaataaaaaggactggtatgattttgtagaaaacccagatatatt acgcgtatacgccaacttaggtgaacgtgtacgccaagctttgttaaaaacagtacaattctgt gatgccatgcgaaatgctggtattgttggtgtactgacattagataatcaagatctcaatggta actggtatgatttcggtgatttcatacaaaccacgccaggtagtggagttcctgttgtagattctt attattcattgttaatgcctatattaaccttgaccagggctttaactgcagagtcacatgttgaca ctgacttaacaaagccttacattaagtgggatttgttaaaatatgacttcacggaagagaggtt aaaactctttgaccgttattttaaatattgggatcagacataccacccaaattgtgttaactgtttg gatgacagatgcattctgcattgtgcaaactttaatgttttattctctacagtgttcccacctacaa gttttggaccactagtgagaaaaatatttgttgatggtgttccatttgtagtttcaactggatacc acttcagagagctaggtgttgtacataatcaggatgtaaacttacatagctctagacttagtttta aggaattacttgtgtatgctgctgaccctgctatgcacgctgcttctggtaatctattactagata aacgcactacgtgcttttcagtagctgcacttactaacaatgttgcttttcaaactgtcaaaccc ggtaattttaacaaagacttctatgactttgctgtgtctaagggtttctttaaggaaggaagttct gttgaattaaaacacttcttctttgctcaggatggtaatgctgctatcagcgattatgactactat cgttataatctaccaacaatgtgtgatatcagacaactactatttgtagttgaagttgttgataag tactttgattgttacgatggtggctgtattaatgctaaccaagtcatcgtcaacaacctagacaa atcagctggttttccatttaataaatggggtaaggctagactttattatgattcaatgagttatga ggatcaagatgcacttttcgcatatacaaaacgtaatgtcatccctactataactcaaatgaatc ttaagtatgccattagtgcaaagaatagagctcgcaccgtagctggtgtctctatctgtagtact atgaccaatagacagtttcatcaaaaattattgaaatcaatagccgccactagaggagctact gtagtaattggaacaagcaaattctatggtggttggcacaacatgttaaaaactgtttatagtga tgtagaaaaccctcaccttatgggttgggattatcctaaatgtgatagagccatgcctaacatg cttagaattatggcctcacttgttcttgctcgcaaacatacaacgtgttgtagcttgtcacaccgt ttctatagattagctaatgagtgtgctcaagtattgagtgaaatggtcatgtgtggcggttcact atatgttaaaccaggtggaacctcatcaggagatgccacaactgcttatgctaatagtgttttta acatttgtcaagctgtcacggccaatgttaatgcacttttatctactgatggtaacaaaattgcc gataagtatgtccgcaatttacaacacagactttatgagtgtctctatagaaatagagatgttga cacagactttgtgaatgagttttacgcatatttgcgtaaacatttctcaatgatgatactctctgac gatgctgttgtgtgtttcaatagcacttatgcatctcaaggtctagtggctagcataaagaacttt aagtcagttctttattatcaaaacaatgtttttatgtctgaagcaaaatgttggactgagactgac cttactaaaggacctcatgaattttgctctcaacatacaatgctagttaaacagggtgatgatta tgtgtaccttccttacccagatccatcaagaatcctaggggccggctgttttgtagatgatatcg taaaaacagatggtacacttatgattgaacggttcgtgtctttagctatagatgcttacccactta ctaaacatcctaatcaggagtatgctgatgtctttcatttgtacttacaatacataagaaagctac atgatgagttaacaggacacatgttagacatgtattctgttatgcttactaatgataacacttcaa ggtattgggaacctgagttttatgaggctatgtacacaccgcatacagtcttacaggctgttgg ggcttgtgttctttgcaattcacagacttcattaagatgtggtgcttgcatacgtagaccattctta tgttgtaaatgctgttacgaccatgtcatatcaacatcacataaattagtcttgtctgttaatccgt atgtttgcaatgctccaggttgtgatgtcacagatgtgactcaactttacttaggaggtatgagc tattattgtaaatcacataaaccacccattagttttccattgtgtgctaatggacaagtttttggttt atataaaaatacatgtgttggtagcgataatgttactgactttaatgcaattgcaacatgtgactg gacaaatgctggtgattacattttagctaacacctgtactgaaagactcaagctttttgcagca gaaacgctcaaagctactgaggagacatttaaactgtcttatggtattgctactgtacgtgaag tgctgtctgacagagaattacatctttcatgggaagttggtaaacctagaccaccacttaaccg aaattatgtctttactggttatcgtgtaactaaaaacagtaaagtacaaataggagagtacacct ttgaaaaaggtgactatggtgatgctgttgtttaccgaggtacaacaacttacaaattaaatgtt ggtgattattttgtgctgacatcacatacagtaatgccattaagtgcacctacactagtgccaca agagcactatgttagaattactggcttatacccaacactcaatatctcagatgagttttctagca atgttgcaaattatcaaaaggttggtatgcaaaagtattctacactccagggaccacctggtac tggtaagagtcattttgctattggcctagctctctactacccttctgctcgcatagtgtatacagc ttgctctcatgccgctgttgatgcactatgtgagaaggcattaaaatatttgcctatagataaat gtagtagaattatacctgcacgtgctcgtgtagagtgttttgataaattcaaagtgaattcaaca ttagaacagtatgtcttttgtactgtaaatgcattgcctgagacgacagcagatatagttgtcttt gatgaaatttcaatggccacaaattatgatttgagtgttgtcaatgccagattacgtgctaagca ctatgtgtacattggcgaccctgctcaattacctgcaccacgcacattgctaactaagggcac actagaaccagaatatttcaattcagtgtgtagacttatgaaaactataggtccagacatgttcc tcggaacttgtcggcgttgtcctgctgaaattgttgacactgtgagtgctttggtttatgataata agcttaaagcacataaagacaaatcagctcaatgctttaaaatgttttataagggtgttatcacg catgatgtttcatctgcaattaacaggccacaaataggcgtggtaagagaattccttacacgta accctgcttggagaaaagctgtctttatttcaccttataattcacagaatgctgtagcctcaaag attttgggactaccaactcaaactgttgattcatcacagggctcagaatatgactatgtcatatt cactcaaaccactgaaacagctcactcttgtaatgtaaacagatttaatgttgctattaccagag caaaagtaggcatactttgcataatgtctgatagagacctttatgacaagttgcaatttacaagt cttgaaattccacgtaggaatgtggcaactttacaagctgaaaatgtaacaggactctttaaag attgtagtaaggtaatcactgggttacatcctacacaggcacctacacacctcagtgttgaca ctaaattcaaaactgaaggtttatgtgttgacatacctggcatacctaaggacatgacctatag aagactcatctctatgatgggttttaaaatgaattatcaagttaatggttaccctaacatgtttatc acccgcgaagaagctataagacatgtacgtgcatggattggcttcgatgtcgaggggtgtca tgctactagagaagctgttggtaccaatttacctttacagctaggtttttctacaggtgttaacct agttgctgtacctacaggttatgttgatacacctaataatacagatttttccagagttagtgctaa accaccgcctggagatcaatttaaacacctcataccacttatgtacaaaggacttccttggaat gtagtgcgtataaagattgtacaaatgttaagtgacacacttaaaaatctctctgacagagtcg tatttgtcttatgggcacatggctttgagttgacatctatgaagtattttgtgaaaataggacctg agcgcacctgttgtctatgtgatagacgtgccacatgcttttccactgcttcagacacttatgcc tgttggcatcattctattggatttgattacgtctataatccgtttatgattgatgttcaacaatgggg ttttacaggtaacctacaaagcaaccatgatctgtattgtcaagtccatggtaatgcacatgtag ctagttgtgatgcaatcatgactaggtgtctagctgtccacgagtgctttgttaagcgtgttgac tggactattgaatatcctataattggtgatgaactgaagattaatgcggcttgtagaaaggttca acacatggttgttaaagctgcattattagcagacaaattcccagttcttcacgacattggtaacc ctaaagctattaagtgtgtacctcaagctgatgtagaatggaagttctatgatgcacagccttgt agtgacaaagcttataaaatagaagaattattctattcttatgccacacattctgacaaattcaca gatggtgtatgcctattttggaattgcaatgtcgatagatatcctgctaattccattgtttgtagatt tgacactagagtgctatctaaccttaacttgcctggttgtgatggtggcagtttgtatgtaaataa acatgcattccacacaccagcttttgataaaagtgcttttgttaatttaaaacaattaccatttttct attactctgacagtccatgtgagtctcatggaaaacaagtagtgtcagatatagattatgtacc actaaagtctgctacgtgtataacacgttgcaatttaggtggtgctgtctgtagacatcatgcta atgagtacagattgtatctcgatgcttataacatgatgatctcagctggctttagcttgtgggttt acaaacaatttgatacttataacctctggaacacttttacaagacttcagagtttagaaaatgtg gcttttaatgttgtaaataagggacactttgatggacaacagggtgaagtaccagtttctatcat taataacactgtttacacaaaagttgatggtgttgatgtagaattgtttgaaaataaaacaacatt acctgttaatgtagcatttgagctttgggctaagcgcaacattaaaccagtaccagaggtgaa aatactcaataatttgggtgtggacattgctgctaatactgtgatctgggactacaaaagagat gctccagcacatatatctactattggtgtttgttctatgactgacatagccaagaaaccaactga aacgatttgtgcaccactcactgtcttttttgatggtagagttgatggtcaagtagacttatttag aaatgcccgtaatggtgttcttattacagaaggtagtgttaaaggtttacaaccatctgtaggtc ccaaacaagctagtcttaatggagtcacattaattggagaagccgtaaaaacacagttcaatt attataagaaagttgatggtgttgtccaacaattacctgaaacttactttactcagagtagaaatt tacaagaatttaaacccaggagtcaaatggaaattgatttcttagaattagctatggatgaattc attgaacggtataaattagaaggctatgccttcgaacatatcgtttatggagattttagtcatagt cagttaggtggtttacatctactgattggactagctaaacgttttaaggaatcaccttttgaatta gaagattttattcctatggacagtacagttaaaaactatttcataacagatgcgcaaacaggttc atctaagtgtgtgtgttctgttattgatttattacttgatgattttgttgaaataataaaatcccaaga tttatctgtagtttctaaggttgtcaaagtgactattgactatacagaaatttcatttatgctttggtg taaagatggccatgtagaaacattttacccaaaattacaatctagtcaagcgtggcaaccggg tgttgctatgcctaatctttacaaaatgcaaagaatgctattagaaaagtgtgaccttcaaaatta tggtgatagtgcaacattacctaaaggcataatgatgaatgtcgcaaaatatactcaactgtgt caatatttaaacacattaacattagctgtaccctataatatgagagttatacattttggtgctggtt ctgataaaggagttgcaccaggtacagctgttttaagacagtggttgcctacgggtacgctgc ttgtcgattcagatcttaatgactttgtctctgatgcagattcaactttgattggtgattgtgcaact gtacatacagctaataaatgggatctcattattagtgatatgtacgaccctaagactaaaaatgt tacaaaagaaaatgactctaaagagggttttttcacttacatttgtgggtttatacaacaaaagc tagctcttggaggttccgtggctataaagataacagaacattcttggaatgctgatctttataag ctcatgggacacttcgcatggtggacagcctttgttactaatgtgaatgcgtcatcatctgaag catttttaattggatgtaattatcttggcaaaccacgcgaacaaatagatggttatgtcatgcatg caaattacatattttggaggaatacaaatccaattcagttgtcttcctattctttatttgacatgagt aaatttccccttaaattaaggggtactgctgttatgtctttaaaagaaggtcaaatcaatgatatg attttatctcttcttagtaaaggtagacttataattagagaaaacaacagagttgttatttctagtg atgttcttgttaacaactaaacgaacaatgtttgtttttcttgttttattgccactagtctctagtcag tgtgttaatcttacaaccagaactcaattaccccctgcatacactaattctttcacacgtggtgttt attaccctgacaaagttttcagatcctcagttttacattcaactcaggacttgttcttacctttctttt ccaatgttacttggttccatgctatacatgtctctgggaccaatggtactaagaggtttgataac cctgtcctaccatttaatgatggtgtttattttgcttccactgagaagtctaacataataagaggc tggatttttggtactactttagattcgaagacccagtccctacttattgttaataacgctactaatg ttgttattaaagtctgtgaatttcaattttgtaatgatccatttttgggtgtttattaccacaaaaaca acaaaagttggatggaaagtgagttcagagtttattctagtgcgaataattgcacttttgaatat gtctctcagccttttcttatggaccttgaaggaaaacagggtaatttcaaaaatcttagggaattt gtgtttaagaatattgatggttattttaaaatatattctaagcacacgcctattaatttagtgcgtga tctccctcagggtttttcggctttagaaccattggtagatttgccaataggtattaacatcactag gtttcaaactttacttgctttacatagaagttatttgactcctggtgattcttcttcaggttggacag ctggtgctgcagcttattatgtgggttatcttcaacctaggacttttctattaaaatataatgaaaa tggaaccattacagatgctgtagactgtgcacttgaccctctctcagaaacaaagtgtacgttg aaatccttcactgtagaaaaaggaatctatcaaacttctaactttagagtccaaccaacagaat ctattgttagatttcctaatattacaaacttgtgcccttttggtgaagtttttaacgccaccagattt gcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctatat aattccgcatcattttccacttttaagtgttatggagtgtctcctactaaattaaatgatctctgcttt actaatgtctatgcagattcatttgtaattagaggtgatgaagtcagacaaatcgctccagggc aaactggaaagattgctgattataattataaattaccagatgattttacaggctgcgttatagctt ggaattctaacaatcttgattctaaggttggtggtaattataattacctgtatagattgtttaggaa gtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtagcacacctt gtaatggtgttgaaggttttaattgttactttcctttacaatcatatggtttccaacccactaatggt gttggttaccaaccatacagagtagtagtactttcttttgaacttctacatgcaccagcaactgtt tgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggttta acaggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagag acattgctgacactactgatgctgtccgtgatccacagacacttgagattcttgacattacacc atgttcttttggtggtgtcagtgttataacaccaggaacaaatacttctaaccaggttgctgttctt tatcaggatgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcctacttg gcgtgtttattctacaggttctaatgtttttcaaacacgtgcaggctgtttaataggggctgaaca tgtcaacaactcatatgagtgtgacatacccattggtgcaggtatatgcgctagttatcagact cagactaattctcctcggcgggcacgtagtgtagctagtcaatccatcattgcctacactatgt cacttggtgcagaaaattcagttgcttactctaataactctattgccatacccacaaattttactat tagtgttaccacagaaattctaccagtgtctatgaccaagacatcagtagattgtacaatgtac atttgtggtgattcaactgaatgcagcaatcttttgttgcaatatggcagtttttgtacacaattaa accgtgctttaactggaatagctgttgaacaagacaaaaacacccaagaagtttttgcacaag tcaaacaaatttacaaaacaccaccaattaaagattttggtggttttaatttttcacaaatattacc agatccatcaaaaccaagcaagaggtcatttattgaagatctacttttcaacaaagtgacactt gcagatgctggcttcatcaaacaatatggtgattgccttggtgatattgctgctagagacctca tttgtgcacaaaagtttaacggccttactgttttgccacctttgctcacagatgaaatgattgctc aatacacttctgcactgttagcgggtacaatcacttctggttggacctttggtgcaggtgctgc attacaaataccatttgctatgcaaatggcttataggtttaatggtattggagttacacagaatgt tctctatgagaaccaaaaattgattgccaaccaatttaatagtgctattggcaaaattcaagact cactttcttccacagcaagtgcacttggaaaacttcaagatgtggtcaaccaaaatgcacaag ctttaaacacgcttgttaaacaacttagctccaattttggtgcaatttcaagtgttttaaatgatatc ctttcacgtcttgacaaagttgaggctgaagtgcaaattgataggttgatcacaggcagacttc aaagtttgcagacatatgtgactcaacaattaattagagctgcagaaatcagagcttctgctaa tcttgctgctactaaaatgtcagagtgtgtacttggacaatcaaaaagagttgatttttgtggaa agggctatcatcttatgtccttccctcagtcagcacctcatggtgtagtcttcttgcatgtgactt atgtccctgcacaagaaaagaacttcacaactgctcctgccatttgtcatgatggaaaagcac actttcctcgtgaaggtgtctttgtttcaaatggcacacactggtttgtaacacaaaggaattttt atgaaccacaaatcattactacagacaacacatttgtgtctggtaactgtgatgttgtaatagga attgtcaacaacacagtttatgatcctttgcaacctgaattagactcattcaaggaggagttaga taaatattttaagaatcatacatcaccagatgttgatttaggtgacatctctggcattaatgcttca gttgtaaacattcaaaaagaaattgaccgcctcaatgaggttgccaagaatttaaatgaatctc tcatcgatctccaagaacttggaaagtatgagcagtatataaaatggccatggtacatttggct aggttttatagctggcttgattgccatagtaatggtgacaattatgctttgctgtatgaccagttg ctgtagttgtctcaagggctgttgttcttgtggatcctgctgcaaatttgatgaagacgactctg agccagtgctcaaaggagtcaaattacattacacataaacgaacttatggatttgtttatgaga atcttcacaattggaactgtaactttgaagcaaggtgaaatcaaggatgctactccttcagattt tgttcgcgctactgcaacgataccgatacaagcctcactccctttcggatggcttattgttggc gttgcacttcttgctgtttttcagagcgcttccaaaatcataaccctcaaaaagagatggcaact agcactctccaagggtgttcactttgtttgcaacttgctgttgttgtttgtaacagtttactcacac cttttgctcgttgctgctggccttgaagccccttttctctatctttatgctttagtctacttcttgcag agtataaactttgtaagaataataatgaggctttggctttgctggaaatgccgttccaaaaacc cattactttatgatgccaactattttctttgctggcatactaattgttacgactattgtataccttaca atagtgtaacttcttcaattgtcattacttcaggtgatggcacaacaagtcctatttctgaacatg actaccagattggtggttatactgaaaaatgggaatctggagtaaaagactgtgttgtattaca cagttacttcacttcagactattaccagctgtactcaactcaattgagtacagacactggtgttg aacatgttaccttcttcatctacaataaaattgttgatgagcctgaagaacatgtccaaattcac acaatcgacggttcatccggagttgttaatccagtaatggaaccaatttatgatgaaccgacg acgactactagcgtgcctttgtaagcacaagctgatgagtacgaacttatgtactcattcgtttc ggaagagacaggtacgttaatagttaatagcgtacttctttttcttgctttcgtggtattcttgcta gttacactagccatccttactgcgcttcgattgtgtgcgtactgctgcaatattgttaacgtgagt cttgtaaaaccttctttttacgtttactctcgtgttaaaaatctgaattcttctagagttcctgatcttc tggtctaaacgaactaaatattatattagtttttctgtttggaactttaattttagccatggcagatt ccaacggtactattaccgttgaagagcttaaaaagctccttgaacaatggaacctagtaatag gtttcctattccttacatggatttgtcttctacaatttgcctatgccaacaggaataggtttttgtat ataattaagttaattttcctctggctgttatggccagtaactttagcttgttttgtgcttgctgctgttt acagaataaattggatcaccggtggaattgctatcgcaatggcttgtcttgtaggcttgatgtg gctcagctacttcattgcttctttcagactgtttgcgcgtacgcgttccatgtggtcattcaatcc agaaactaacattcttctcaacgtgccactccatggcactattctgaccagaccgcttctagaa agtgaactcgtaatcggagctgtgatccttcgtggacatcttcgtattgctggacaccatctag gacgctgtgacatcaaggacctgcctaaagaaatcactgttgctacatcacgaacgctttctt attacaaattgggagcttcgcagcgtgtagcaggtgactcaggttttgctgcatacagtcgct acaggattggcaactataaattaaacacagaccattccagtagcagtgacaatattgctttgct tgtacagtaagtgacaacagatgtttcatctcgttgactttcaggttactatagcagagatattac taattattatgaggacttttaaagtttccatttggaatcttgattacatcataaacctcataattaaa aatttatctaagtcactaactgagaataaatattctcaattagatgaagagcaaccaatggaga ttgattaaacgaacatgaaaattattcttttcttggcactgataacactcgctacttgtgagcttta tcactaccaagagtgtgttagaggtacaacagtacttttaaaagaaccttgctcttctggaacat acgagggcaattcaccatttcatcctctagctgataacaaatttgcactgacttgctttagcact caatttgcttttgcttgtcctgacggcgtaaaacacgtctatcagttacgtgccagatcagtttca cctaaactgttcatcagacaagaggaagttcaagaactttactctccaatttttcttattgttgcg gcaatagtgtttataacactttgcttcacactcaaaagaaagacagaatgattgaactttcatta attgacttctatttgtgctttttagcctttctgctattccttgttttaattatgcttattatcttttggttctc acttgaactgcaagatcataatgaaacttgtcacgcctaaacgaacatgaaatttcttgttttctt aggaatcatcacaactgtagctgcatttcaccaagaatgtagtttacagtcatgtactcaacat caaccatatgtagttgatgacccgtgtcctattcacttctattctaaatggtatattagagtagga gctagaaaatcagcacctttaattgaattgtgcgtggatgaggctggttctaaatcacccattc agtacatcgatatcggtaattatacagtttcctgtttaccttttacaattaattgccaggaacctaa attgggtagtcttgtagtgcgttgttcgttctatgaagactttttagagtatcatgacgttcgtgtt gttttagatttcatctaaacgaacaaactaaaatgtctgataatggaccccaaaatcagcgaaa tgcaccccgcattacgtttggtggaccctcagattcaactggcagtaaccagaatggagaac gcagtggggcgcgatcaaaacaacgtcggccccaaggtttacccaataatactgcgtcttg gttcaccgctctcactcaacatggcaaggaagaccttaaattccctcgaggacaaggcgttc caattaacaccaatagcagtccagatgaccaaattggctactaccgaagagctaccagacg aattcgtggtggtgacggtaaaatgaaagatctcagtccaagatggtatttctactacctagga actgggccagaagctggacttccctatggtgctaacaaagacggcatcatatgggttgcaac tgagggagccttgaatacaccaaaagatcacattggcacccgcaatcctgctaacaatgctg caatcgtgctacaacttcctcaaggaacaacattgccaaaaggcttctacgcagaagggag cagaggcggcagtcaagcctcttctcgttcctcatcacgtagtcgcaacagttcaagaaattc aactccaggcagcagtaggggaacttctcctgctagaatggctggcaatggcggtgatgct gctcttgctttgctgctgcttgacagattgaaccagcttgagagcaaaatgtctggtaaaggcc aacaacaacaaggccaaactgtcactaagaaatctgctgctgaggcttctaagaagcctcg gcaaaaacgtactgccactaaagcatacaatgtaacacaagctttcggcagacgtggtcca gaacaaacccaaggaaattttggggaccaggaactaatcagacaaggaactgattacaaac attggccgcaaattgcacaatttgcccccagcgcttcagcgttcttcggaatgtcgcgcattg gcatggaagtcacaccttcgggaacgtggttgacctacacaggtgccatcaaattggatgac aaagatccaaatttcaaagatcaagtcattttgctgaataagcatattgacgcatacaaaacatt cccaccaacagagcctaaaaaggacaaaaagaagaaggctgatgaaactcaagccttacc gcagagacagaagaaacagcaaactgtgactcttcttcctgctgcagatttggatgatttctcc aaacaattgcaacaatccatgagcagtgctgactcaactcaggcctaaactcatgcagacca cacaaggcagatgggctatataaacgttttcgcttttccgtttacgatatatagtctactcttgtg cagaatgaattctcgtaactacatagcacaagtagatgtagttaactttaatctcacatagcaat ctttaatcagtgtgtaacattagggaggacttgaaagagccaccacattttcaccgaggccac gcggagtacgatcgagtgtacagtgaacaatgctagggagagctgcctatatggaagagc cctaatgtgtaaaattaattttagtagtgctatccccatgtgattttaatagcttcttaggagaatg acaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa .sup.+ln = Locked nucleic acid (LNA) = [00259]embedded imagewherein Ry is a nucleobase; lnA = Locked nucleic acid (LNA) A; ln(5m)C = ln(5m)C = Locked nucleic acid (LNA)-5 methyl C; lnG = Locked nucleic acid (LNA) G; lnT = Locked nucleic acid (LNA) T; (5m)C = 5 methyl C; scp = = spirocyclopropyl; scp(5m)C = cyclopropyl-5 methyl C; (5OH)C = [00260]embedded imagepo = phosphodiester linkage; ps = phosphorothioate linkage