VARIANTS OF TERMINAL DEOXYNUCLEOTIDYL TRANSFERASE AND USES THEREOF

20250223575 ยท 2025-07-10

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to variants of Terminal deoxynucleotidyl Transferase (TdT), each of which (i) has an amino acid sequence similarity to SEQ ID NO: 2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35 with corresponding amino acid substitutions, (ii) is capable of synthesizing a nucleic acid fragment without a template and (iii) is capable of incorporating a modified nucleotide into the nucleic acid fragment.

    Claims

    1. A variant of Terminal deoxynucleotidyl Transferase (TdT) which comprises an amino acid substitution at the position M63 or a functional equivalent thereof, wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 2, wherein the variant is capable of synthesizing a nucleic acid fragment without template, and wherein the variant is capable of incorporating a modified nucleotide into the nucleic acid fragment.

    2. The TdT variant of claim 1, wherein the TdT variant comprises an amino acid substitution at the position: (i) M63, wherein the position is numbered by reference to the amino acid sequences set forth in SEQ ID NOs: 2, 11, 13, 17, 19, 29, or 33 (ii) L62, wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 15; or (iii) R64, wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 21; or (iv) M73, wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 23; or (v) M64, wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 25; or (vi) M61, wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 27; or (vii) L63, wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 31; or (viii) M66, wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 35.

    3. The TdT variant of claim 2, wherein the TdT variant comprises: M63R/Q/G/A/V/D/N/H/E wherein the position is numbered by reference to the amino acid sequences set forth in SEQ ID NO: 2 11, 13, 17, 19, 29, or 33; or L62R/Q/G/A/V/D/N/H/E wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 15, or R64R/Q/G/A/V/D/N/H/E wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 21, or M74R/Q/G/A/V/D/N/H/E wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 23; or M64R/Q/G/A/V/D/N/H/E wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 25; or M61R/Q/G/A/V/D/N/H/E wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 27; or L63R/Q/G/A/V/D/N/H/E wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 31; or M66R/Q/G/A/V/D/N/H/E wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 35.

    4. The TdT variant of claim 1, wherein the TdT variant comprises at least one additional amino acid substitution at position R207, R325, and E328, or functional equivalent thereof, wherein the position is numbered by reference to the amino acid sequence set forth in SEQ ID NO: 2.

    5. The TdT variant of claim 1, wherein the TdT variant comprises at least one additional amino acid substitution selected from the group consisting of: R207L/N, R325P/N, and E328N/L/T/S.

    6. The TdT variant of claim 1, wherein the TdT variant comprises at least two additional mutations selected from the group consisting of: R207L/N, R325P/N, and E328N/L/T/S.

    7. A nucleic acid encoding a TdT variant as defined in claim 1.

    8. A method of producing a TdT variant comprising: (a) culturing a host cell comprising a nucleic acid according to claim 7 under conditions suitable to express the nucleic acid encoding the TdT variant; and optionally (b) recovering said TdT variant from the cell culture.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0034] FIG. 1: Purification assay of wild type (wt) TdT and different TdT variants of the invention. Protein samples were loaded on SDS-PAGE analysis gel and migrated through electrophoresis.

    [0035] FIG. 2: Comparative results of performances for an elongation assay using wt TdT and TdT variants of the invention. The assay involves fluorescent labeled primers and 3-O-amino reversible terminator modified nucleotides. The results represent mean value of n=3 experiments for each enzyme.

    [0036] FIG. 3: Mass spectrum analysis of the results obtained for the elongation assay with different TdT variants of the invention. Only the relevant part of the mass spectrum is shown. The arrow shows the peak (mass) for the expected elongated primer.

    DESCRIPTION OF THE INVENTION

    [0037] The DNA polymerase families are divided into seven families based on their sequence homology and crystal structure. Among them, the polymerases of PolX family represent a wide variety of polymerases from replicative polymerases to terminal transferase enzymes. Polymerases from PolX family are present across a very wide range of eukaryotic organisms. Polymerases from the PolX family are implicated in a vast variety of biological processes and in particular in DNA damage repair mechanisms or error correction mechanisms. The PolX family regroups polymerase (Pol ), (Pol ), , (Pol ), IV from yeast (Pol IV) and the Terminal deoxynucleotidyl Transferase (TdT). TdT is naturally implicated in DNA repair and maintenance mechanisms. In particular, TdT has the unique ability to conserve a nucleotide polymerization activity even in absence of template strand. In specific conditions and with natural nucleotides, TdT is able to elongate DNA fragments with several hundred nucleotides, in absence of any complementary strand. However, wild type TdT is totally unable to efficiently incorporate sugar-modified nucleotides.

    [0038] It is thus the purpose of the present invention to provide variants of TdT with targeted mutation(s) that allow them to incorporate modified nucleotides into a nucleic fragment during synthesize of said nucleotide fragment. More particularly, the inventors have identified specific amino acid residues that may be advantageously substituted, alone or in combination, to improve the ability of the enzyme to synthesize nucleic acid fragments of various length and with predetermined sequence, including by using modified nucleotides.

    Definitions

    [0039] As used therein, the terms mutant and variant may be used interchangeably to refer to polypeptides related to or derived from SEQ ID NOs:2, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27, 28, 29, 30, 31, 32, 33, 34 or 35 and comprising a modification or an alteration, i.e., a substitution, insertion, and/or deletion, at one or more (e.g., several) positions and having both a polymerase activity without template and ability to incorporate 3-O-modified nucleoside triphosphates into a nucleic acid chain. The variants may be obtained by various techniques well known in the art. In particular, examples of techniques for altering the DNA sequence encoding the wild-type protein, include, but are not limited to, site-directed mutagenesis, random mutagenesis and synthetic oligonucleotide construction. Mutagenesis activities consist in deleting, inserting or substituting one or several amino-acids in the sequence of a protein or in the case of the invention of a polymerase. Targeted amino-acids could be concomitant or distributed along the whole sequence of the polymerase. Specific motifs or structural features could be targeted for example.

    [0040] The terms modification or alteration as used herein in relation to a position or amino acid mean that the amino acid in the specific position has been modified compared to the amino acid of the wild-type protein.

    [0041] A substitution means that an amino acid residue is replaced by another amino acid residue. For example, the term substitution refers to the replacement of an amino acid residue by another selected from the naturally-occurring standard 20 amino acid residues, rare naturally occurring amino acid residues (e.g. hydroxyproline, hydroxylysine, allohydroxylysine, 6-N-methylysine, N-ethylglycine, N-methylglycine, N-ethylasparagine, allo-isoleucine, N-methylisoleucine, N-methylvaline, pyroglutamine, aminobutyric acid, ornithine, norleucine, norvaline), and non-naturally occurring amino acid residue, often made synthetically, (e.g. cyclohexyl-alanine). For example, the term substitution refers to the replacement of an amino acid residue by another selected from the naturally-occurring standard 20 amino acid residues. The sign + indicates a combination of substitutions.

    [0042] The amino acids are herein represented by their one-letter or three-letters code according to the following nomenclature: A: alanine (Ala); C: cysteine (Cys); D: aspartic acid (Asp); E: glutamic acid (Glu); F: phenylalanine (Phe); G: glycine (Gly); H: histidine (His); I: isoleucine (Ile); K: lysine (Lys); L: leucine (Leu); M: methionine (Met); N: asparagine (Asn); P: proline (Pro); Q: glutamine (Gln); R: arginine (Arg); S: serine (Ser); T: threonine (Thr); V: valine (Val); W: tryptophan (Trp) and Y: tyrosine (Tyr).

    [0043] In the present document, the following terminology is used to designate a substitution: L238A denotes that amino acid residue (Leucine, L) at position 238 of the parent sequence is changed to an Alanine (A). A132V/I/M denotes that amino acid residue (Alanine, A) at position 132 of the parent sequence is substituted by one of the following amino acids: Valine (V), Isoleucine (I), or Methionine (M). The substitution can be a conservative or non-conservative substitution. Examples of conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine, asparagine and threonine), hydrophobic amino acids (methionine, leucine, isoleucine, cysteine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine and serine).

    [0044] As used herein, the terms sequence identity or identity refer to the number (or fraction expressed as a percentage %) of matches (identical amino acid residues) between two polypeptide sequences. The sequence identity is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps. In particular, sequence identity may be determined using any of a number of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are aligned using a global alignment algorithm (e.g. Needleman and Wunsch algorithm; Needleman and Wunsch, 1970) which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are aligned using a local alignment algorithm (e.g. Smith and Waterman algorithm (Smith and Waterman, 1981) or Altschul algorithm (Altschul et al., 1997; Altschul et al., 2005)). Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software available on internet web sites such as http://blast.ncbi.nlm.nih.gov/or http://www.ebi.ac.uk/Tools/emboss/. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithm needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, % amino acid sequence identity values refer to values generated using the pair wise sequence alignment program EMBOSS Needle, that creates an optimal global alignment of two sequences using the Needleman-Wunsch algorithm, wherein all search parameters are set to default values, i.e. Scoring matrix=BLOSUM62, Gap open=10, Gap extend=0.5, End gap penalty=false, End gap open=10 and End gap extend=0.5.

    [0045] Herein, the terms peptide, polypeptide, protein, enzyme, refer to a chain of amino acids linked by peptide bonds, regardless of the number of amino acids forming said chain.

    [0046] Unless otherwise specified, the positions disclosed in the present application are numbered by reference to the amino acid sequence set forth in a specified SEQ ID NO.

    Variants of TdT

    [0047] The present invention provides variants of TdT enzyme that can be used for synthesizing polynucleotides of predetermined sequences, such as DNA or RNA, without the use of template strand. The TdT variants of the invention allow modified nucleotides, and more particularly 3O-modified nucleotides, to be used in an enzyme-mediated method of polynucleotide synthesis, such as described by Hiatt et al, U.S. Pat. No. 5,763,594.

    [0048] In some embodiments of the invention, modified Terminal desoxyribonucleotidyl Transferase, modified TdT, variants of Terminal desoxyribonucleotidyl Transferase and variants of TdT refer to enzymes that comprise an amino acid segment that shares at least 80% identity with an amino acid sequence of one of the amino acid sequences set forth in SEQ ID NOs:2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35, excepting at least one amino acid residue substitution. In some embodiments, the variant of TdT comprises an amino acid sequence that shares at least 90% identity with SEQ ID NOs:2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, and having at least one amino acid residue substitution. In still other embodiments, the variant of TdT comprises an amino acid sequence that shares at least 95% identity with SEQ ID NOs:2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, and having at least one amino acid residue substitution. In still other embodiments, the variant of TdT comprises an amino acid sequence that shares at least 98% identity with SEQ ID NOs:2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, and having at least one amino acid residue substitution.

    [0049] In some cases, variants of the present invention may be described according to their mutations on specific residues, whose positions are determined by alignment with or reference to the enzymatic sequence SEQ ID NO:1 or SEQ ID NO:2, which corresponds to the amino acid sequences of murine TdT and truncated murine TdT respectively. The variants of the invention may also be described directly with reference to SEQ ID numbers of corresponding reference sequences.

    [0050] By functionally equivalent residue is meant a residue in a sequence of a TdT of sequence homologous to SEQ ID NO:1 or to SEQ ID NO:2 and having an identical functional role. Functionally equivalent residues are identified by using sequence alignments, for example, using the Mutalin line alignment software (http://multalin.toulouse.inra.fr/multalin/multalin.html; 1988, Nucl. Acids Res., 16 (22), 10881-10890). After alignment, the functionally equivalent residues are at homologous positions on the different sequences considered. Sequence alignments and identification of functionally equivalent residues may be between any TdT and their natural variants, including inter-species.

    [0051] TdT can be found in many organisms or microorganisms. All those TdT are good candidates for performing the present invention. In particular, modifications to alter a particular TdT sequence to give said polymerase an increased ability to incorporate modified nucleotides, can target any other TdT sequence. Accordingly, mutations or combinations described herein by reference to SEQ ID NO:1, and more particularly to SEQ ID NO:2 that corresponds to amino acid residues 130 to 510 of SEQ ID NO:1, can be transposed to any other TdT sequence.

    [0052] In some embodiments, the invention comprises a variant of Terminal deoxynucleotidyl Transferase (TdT) that (i) comprises an amino acid sequence having at least 80%, such as at least 85%, 90%, 95% or 99% identity with an amino acid sequence selected from SEQ ID NO: 2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35, with at least an amino acid substitution at position corresponding to a functionally equivalent residue of residue C173 with respect to SEQ ID NO:11, (ii) is able to synthesize a nucleic acid fragment without template and (iii) is able to incorporate a modified nucleoside triphosphate, such as a 3-O-blocked nucleoside triphosphate, into the nucleic fragment.

    [0053] Indeed, the inventors have discovered that such substitution has a great impact on both surface and interaction properties of the enzyme with nucleotides, which may allow incorporation of 3O-modified nucleotides in a nucleic acid sequence.

    [0054] Further embodiments of TdT variants of the invention are listed as entries in Tables 1A through 1C (single substitutions), Tables 2A through 2C (two substitutions), Tables 3A through 3C (three substitutions), and Tables 4A through 4F (four substitutions), wherein each such variant TdT is defined by the indicated SEQ ID NO in the righthand column modified by the substitution(s) listed in the lefthand column of the same row as the SEQ ID NO. A non-wild type substitution means that the substitution may be any amino acid except for the amino acid at the indicated position in the wild type sequence, or equivalently, the sequence of the indicated SEQ ID NO.

    TABLE-US-00001 TABLE 1A TdT variants at position C173 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Non-wild type substitution at SEQ ID NO C173 2 C313 10 C173 11 C302 12 C173 13 C302 14 C172 15 C304 16 C173 17 C304 18 C173 19 C293 20 C173 21 C282 22 C178 23 C304 24 C174 25 C300 26 C171 27 C305 28 C173 29 C302 30 C173 31 C313 32 C182 33 C271 34 C176 35

    TABLE-US-00002 TABLE 1B Further TdT variants at position C173 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Substitution SEQ ID NO C173/G/R/P/A/V/S/N/Q/D 2 C313/G/R/P/A/V/S/N/Q/D 10 C173/G/R/P/A/V/S/N/Q/D 11 C302/G/R/P/A/V/S/N/Q/D 12 C173/G/R/P/A/V/S/N/Q/D 13 C302/G/R/P/A/V/S/N/Q/D 14 C172/G/R/P/A/V/S/N/Q/D 15 C304/G/R/P/A/V/S/N/Q/D 16 C173/G/R/P/A/V/S/N/Q/D 17 C304/G/R/P/A/V/S/N/Q/D 18 C173/G/R/P/A/V/S/N/Q/D 19 C293/G/R/P/A/V/S/N/Q/D 20 C173/G/R/P/A/V/S/N/Q/D 21 C282/G/R/P/A/V/S/N/Q/D 22 C178/G/R/P/A/V/S/N/Q/D 23 C304/G/R/P/A/V/S/N/Q/D 24 C174/G/R/P/A/V/S/N/Q/D 25 C300/G/R/P/A/V/S/N/Q/D 26 C171/G/R/P/A/V/S/N/Q/D 27 C305/G/R/P/A/V/S/N/Q/D 28 C173/G/R/P/A/V/S/N/Q/D 29 C302/G/R/P/A/V/S/N/Q/D 30 C173/G/R/P/A/V/S/N/Q/D 31 C313/G/R/P/A/V/S/N/Q/D 32 C182/G/R/P/A/V/S/N/Q/D 33 C271/G/R/P/A/V/S/N/Q/D 34 C176/G/R/P/A/V/S/N/Q/D 35

    TABLE-US-00003 TABLE 1C Further TdT variants at position C173 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Substitutions SEQ ID NO C173/G/R 2 C313/G/R 10 C173/G/R 11 C302/G/R 12 C173/G/R 13 C302/G/R 14 C172/G/R 15 C304/G/R 16 C173/G/R 17 C304/G/R 18 C173/G/R 19 C293/G/R 20 C173/G/R 21 C282/G/R 22 C178/G/R 23 C304/G/R 24 C174/G/R 25 C300/G/R 26 C171/G/R 27 C305/G/R 28 C173/G/R 29 C302/G/R 30 C173/G/R 31 C313/G/R 32 C182/G/R 33 C271/G/R 34 C176/G/R 35

    TABLE-US-00004 TABLE 2A Further TdT variants at position C173 (SEQ ID NO: 2) and position M63 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Non-wildtype substitutions at locations SEQ ID NO M63 + C173 2 M63 + C173 11 M63 + C173 13 L62 + C172 15 M63 + C173 17 M63 + C173 19 R64 + C173 21 M73 + C178 23 M64 + C174 25 M61 + C171 27 M63 + C173 29 L63 + C173 31 M63 + C182 33 M66 + C176 35

    TABLE-US-00005 TABLE 2B Further TdT variants at position C173 (SEQ ID NO: 2) and position M63 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Substitutions and substitution positions SEQ ID NO M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D 2 M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D 11 M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D 13 L62R/Q/G/A/V/D/N/H/E + C172G/R/P/A/V/S/N/Q/D 15 M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D 17 M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D 19 R64R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D 21 M73R/Q/G/A/V/D/N/H/E + C178G/R/P/A/V/S/N/Q/D 23 M64R/Q/G/A/V/D/N/H/E + C174G/R/P/A/V/S/N/Q/D 25 M61R/Q/G/A/V/D/N/H/E + C171G/R/P/A/V/S/N/Q/D 27 M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D 29 L63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D 31 M63R/Q/G/A/V/D/N/H/E + C182G/R/P/A/V/S/N/Q/D 33 M66R/Q/G/A/V/D/N/H/E + C176G/R/P/A/V/S/N/Q/D 35

    TABLE-US-00006 TABLE 2C Further TdT variants at position C173 (SEQ ID NO: 2) and position M63 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Substitutions and substitution positions SEQ ID NO M63R/Q + C173G/R 2 M63R/Q + C173G/R 11 M63R/Q + C173G/R 13 L62R/Q + C172G/R 15 M63R/Q + C173G/R 17 M63R/Q + C173G/R 19 R64R/Q + C173G/R 21 M73R/Q + C178G/R 23 M64R/Q + C174G/R 25 M61R/Q + C171G/R 27 M63R/Q + C173G/R 29 L63R/Q + C173G/R 31 M63R/Q + C182G/R 33 M66R/Q + C176G/R 35

    TABLE-US-00007 TABLE 3A Further TdT variants at positions C173 (SEQ ID NO: 2), M63 (SEQ ID NO: 2) and R207 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Mutations SEQ ID NO M63 + C173 + R207 2 M63 + C173 + R207 11 M63 + C173 + R207 13 L62 + C172 + R206 15 M63 + C173 + R207 17 M63 + C173 + R207 19 R64 + C173 + R208 21 M73 + C178 + R207 23 M64 + C174 + R208 25 M61 + C171 + R205 27 M63 + C173 + R207 29 L63 + C173 + R207 31 M63 + C182 + R216 33 M66 + C176 + R210 35

    TABLE-US-00008 TABLE 3B Further TdT variants at positions C173 (SEQ ID NO: 2), M63 (SEQ ID NO: 2) and R207 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Mutations SEQ ID NO M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 2 R207N/L/K/H/G/D/A/P M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 11 R207 N/L/K/H/G/D/A/P M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 13 R207 N/L/K/H/G/D/A/P L62R/Q/G/A/V/D/N/H/E + C172G/R/P/A/V/S/N/Q/D + 15 R206 N/L/K/H/G/D/A/P M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 17 R207 N/L/K/H/G/D/A/P M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 19 R207 N/L/K/H/G/D/A/P R64Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 21 R208 N/L/K/H/G/D/A/P M73R/Q/G/A/V/D/N/H/E + C178G/R/P/A/V/S/N/Q/D + 23 R207 N/L/K/H/G/D/A/P M64R/Q/G/A/V/D/N/H/E + C174G/R/P/A/V/S/N/Q/D + 25 R208 N/L/K/H/G/D/A/P M61R/Q/G/A/V/D/N/H/E + C171G/R/P/A/V/S/N/Q/D + 27 R205 N/L/K/H/G/D/A/P M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 29 R207 N/L/K/H/G/D/A/P L63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 31 R207N/L/K/H/G/D/A/P M63R/Q/G/A/V/D/N/H/E + C182G/R/P/A/V/S/N/Q/D 2 + 33 R216N/L/K/H/G/D/A/P M66R/Q/G/A/V/D/N/H/E + C176G/R/P/A/V/S/N/Q/D + 35 R210N/L/K/H/G/D/A/P

    TABLE-US-00009 TABLE 3C Further TdT variants at positions C173 (SEQ ID NO: 2), M63 (SEQ ID NO: 2) and R207 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Mutations SEQ ID NO M63R/Q + C173G/R + R207L/N 2 M63R/Q + C173G/R + R207L/N 11 M63R/Q + C173G/R + R207L/N 13 M62R/Q + C172G/R + R206L/N 15 M63R/Q + C173G/R + R207L/N 17 M63R/Q + C173G/R + R207L/N 19 R64Q + C173G/R + R208L/N 21 M73R/Q + C178G/R + R207N/L 23 M64R/Q + C174G/R + R208 N/L 25 M61R/Q + C171G/R + R205N/L 27 M63R/Q + C173G/R + R207L/N 29 L63R/Q + C173G/R + R207L/N 31 M63R/Q + C182G/R + R216N/L 33 M66R/Q + C176G/R + R210N/L 35

    TABLE-US-00010 TABLE 4A Further TdT variants at positions C173 (SEQ ID NO: 2), M63 (SEQ ID NO: 2), R207 (SEQ ID NO: 2) and R325 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Mutations SEQ ID NO M63 + C173 + R207 + R325 2 M63 + C173 + R207 + R324 11 M63 + C173 + R207 + R324 13 L62 + C172 + R206 + R320 15 M63 + C173 + R207 + R331 17 M63 + C173 + R207 + P325 19 R64 + C173 + R208 + T331 21 M73 + C178 + R207 + R325 23 M64 + C174 + R208 + P326 25 M61 + C171 + R205 + R323 27 M63 + C173 + R207 + R328 29 L63 + C173 + R207 + R325 31 M63 + C182 + R216 + R338 33 M66 + C176 + R210 + R328 35

    TABLE-US-00011 TABLE 4B Further TdT variants at positions C173 (SEQ ID NO: 2), M63 (SEQ ID NO: 2), R207 (SEQ ID NO: 2) and R325 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Mutations SEQ ID NO M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 2 R207N/L/K/H/G/D/A/P + R325P/N/A/L/K/H/G/D M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 11 R207 N/L/K/H/G/D/A/P + R324P/N/A/L/K/H/G/D M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 13 R207 N/L/K/H/G/D/A/P + R324P/N/A/L/K/H/G/D L62R/Q/G/A/V/D/N/H/E + C172G/R/P/A/V/S/N/Q/D + 15 R206 N/L/K/H/G/D/A/P + R320P/N/A/L/K/H/G/D M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 17 R207 N/L/K/H/G/D/A/P + R331P/N/A/L/K/H/G/D M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 19 R207 N/L/K/H/G/D/A/P + P325N/A/L/K/H/G/D R64Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 21 R208 N/L/K/H/G/D/A/P + T331P/N/A/L/K/H/G/D M73R/Q/G/A/V/D/N/H/E + C178G/R/P/A/V/S/N/Q/D + 23 R207 N/L/K/H/G/D/A/P + R325P/N/A/L/K/H/G/D M64R/Q/G/A/V/D/N/H/E + C174G/R/P/A/V/S/N/Q/D + 25 R208 N/L/K/H/G/D/A/P + P326N/A/L/K/H/G/D M61R/Q/G/A/V/D/N/H/E + C171G/R/P/A/V/S/N/Q/D + 27 R205 N/L/K/H/G/D/A/P + R323P/N/A/L/K/H/G/D M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 29 R207 N/L/K/H/G/D/A/P + R328P/N/A/L/K/H/G/D L63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 31 R207N/L/K/H/G/D/A/P + R325P/N/A/L/K/H/G/D M63R/Q/G/A/V/D/N/H/E + C182G/R/P/A/V/S/N/Q/D + 33 R216N/L/K/H/G/D/A/P + R338P/N/A/L/K/H/G/D M66R/Q/G/A/V/D/N/H/E + C176G/R/P/A/V/S/N/Q/D + 35 R210N/L/K/H/G/D/A/P + R328P/N/A/L/K/H/G/D

    TABLE-US-00012 TABLE 4C Further TdT variants at positions C173 (SEQ ID NO: 2), M63 (SEQ ID NO: 2), R207 (SEQ ID NO: 2) and R325 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Mutations SEQ ID NO M63R/Q + C173G/R + R207N/L + R325P/N 2 M63R/Q + C173G/R + R207N/L + R324P/N 11 M63R/Q + C173G/R + R207N/L + R324P/N 13 L62R/Q + C172G/R + R206N/L + R320P/N 15 M63R/Q + C173G/R + R207N/L + R331P/N 17 M63R/Q + C173G/R + R207N/L + P325N 19 R64Q/G + C173G/R + R208N/L + T331P/N 21 M73R/Q/G + C178G/R + R207N/L + R325P/N 23 M64R/Q + C174G/R + R208N/L + P326N 25 M61R/Q + C171G/R + R205N/L + R323P/N 27 M63R/Q + C173G/R + R207N/L + R328P/N 29 L63R/Q + C173G/R + R207N/L + R325P/N 31 M63R/Q + C182G/R + R216N/L + R338P/N 33 M66R/Q + C176G/R + R210N/L + R328P/N 35

    TABLE-US-00013 TABLE 4D Further TdT variants at positions C173 (SEQ ID NO: 2), M63 (SEQ ID NO: 2), R207 (SEQ ID NO: 2) and E328 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Mutations SEQ ID NO M63 + C173 + R207 + E328 2 M63 + C173 + R207 + E327 11 M63 + C173 + R207 + E327 13 L62 + C172 + R206 + G323 15 M63 + C173 + R207 + E334 17 M63 + C173 + R207 + E327 19 R64 + C173 + R208 + E334 21 M73 + C178 + R207 + E328 23 M64 + C174 + R208 + E329 25 M61 + C171 + R205 + E326 27 M63 + C173 + R207 + E331 29 L63 + C173 + R207 + E328 31 M63 + C182 + R216 + E341 33 M66 + C176 + R210 + E331 35

    TABLE-US-00014 TABLE 4E Further TdT variants at positions C173 (SEQ ID NO: 2), M63 (SEQ ID NO: 2), R207 (SEQ ID NO: 2) and E328 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Mutations SEQ ID NO M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 2 R207N/L/K/H/G/D/A/P + E328N/L/T/S M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 11 R207 N/L/K/H/G/D/A/P + E327N/L/T/S M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 13 R207 N/L/K/H/G/D/A/P + E327N/L/T/S L62R/Q/G/A/V/D/N/H/E + C172G/R/P/A/V/S/N/Q/D + 15 R206 N/L/K/H/G/D/A/P + G323N/L/T/S M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 17 R207 N/L/K/H/G/D/A/P + E334N/L/T/S M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 19 R207 N/L/K/H/G/D/A/P + E327N/L/T/S R64Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 21 R208 N/L/K/H/G/D/A/P + E334N/L/T/S M73R/Q/G/A/V/D/N/H/E + C178G/R/P/A/V/S/N/Q/D + 23 R207 N/L/K/H/G/D/A/P + E328N/L/T/S M64R/Q/G/A/V/D/N/H/E + C174G/R/P/A/V/S/N/Q/D + 25 R208 N/L/K/H/G/D/A/P + E329N/L/T/S M61R/Q/G/A/V/D/N/H/E + C171G/R/P/A/V/S/N/Q/D + 27 R205 N/L/K/H/G/D/A/P + E326N/L/T/S M63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 29 R207 N/L/K/H/G/D/A/P + E331N/L/T/S L63R/Q/G/A/V/D/N/H/E + C173G/R/P/A/V/S/N/Q/D + 31 R207N/L/K/H/G/D/A/P + E328N/L/T/S M63R/Q/G/A/V/D/N/H/E + C182G/R/P/A/V/S/N/Q/D + 33 R216N/L/K/H/G/D/A/P + E341N/L/T/S M66R/Q/G/A/V/D/N/H/E + C176G/R/P/A/V/S/N/Q/D + 35 R210N/L/K/H/G/D/A/P + E331N/L/T/S

    TABLE-US-00015 TABLE 4F Further TdT variants at positions C173 (SEQ ID NO: 2), M63 (SEQ ID NO: 2), R207 (SEQ ID NO: 2) and E328 (SEQ ID NO: 2) or functionally equivalent positions of the indicated SEQ ID NO Mutations SEQ ID NO M63R/Q + C173G/R + R207N/L + E328N/L/T/S 2 M63R/Q + C173G/R + R207 N/L + E327N/L/T/S 11 M63R/Q + C173G/R + R207N/L + E327N/L/T/S 13 L62R/Q + C172G/R + R206N/L + G323N/L/T/S 15 M63R/Q + C173G/R + R207N/L + E334N/L/T/S 17 M63R/Q + C173G/R + R207N/L + E327N/L/T/S 19 R64Q/G + C173G/R + R208N/L + E334N/L/T/S 21 M73R/Q + C178G/R + R207N/L + E328N/L/T/S 23 M64R/Q + C174G/R + R208N/L + E329N/L/T/S 25 M61R/Q + C171G/R + R205N/L + E326N/L/T/S 27 M63R/Q/G + C173G/R + R207N/L + E331N/L/T/S 29 L63R/Q + C173G/R + R207N/L + E328N/L/T/S 31 M63R/Q + C182G/R + R216N/L + E341N/L/T/S 33 M66R/Q + C176G/R + R210N/L + E331N/L/T/S 35

    [0055] Advantageously, the substitution is selected from CzzzG/R/P/A/V/S/N/Q/D, where Czzz represents an amino acid residue number functionally equivalent to C173 of SEQ ID NO:2 in SEQ ID NOs:11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 and 35, respectively, and such as from CzzzG/R, where Czzz represents an amino acid residue number functionally equivalent to C173 of SEQ ID NO: 2 in SEQ ID NOs:11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 and 35, respectively.

    [0056] In a particular embodiment, the variant further comprises at least one amino acid substitution at position corresponding to functionally equivalent residues of residues selected from M63, R207, R324 and E327, of SEQ ID NO:11.

    [0057] According to the invention, all variants of TdT as disclosed above are able to both synthesize a nucleic acid fragment without template and incorporate a modified nucleotide into the nucleic acid fragment. Advantageously, said variants have an increased ability to incorporate a modified nucleotide, such as a 3O-modified nucleotide, into a nucleic acid fragment as compared to a TdT of SEQ ID NOs:2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 and 35.

    [0058] In some of the embodiments described above, the efficiency of a variant TdT in incorporating a 3O-modified nucleoside triphosphate is at least 110 percent that of a wild type TdT of sequence SEQ ID NO:2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 and 35 in other embodiments, the efficiency of a variant TdT in incorporating a 3O-modified nucleoside triphosphate is at least 150 percent that of a wild type TdT of sequence SEQ ID NOs:2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 and 35; in other embodiments, the efficiency of a variant TdT in incorporating a 3O-modified nucleoside triphosphate is at least 200 percent that of a wild type TdT of sequence SEQ ID NOs:2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 and 35.

    [0059] The present invention further provides a variant of TdT having the amino acid sequence as set forth in SEQ ID NO:2 or functionally equivalent sequence, with at least one substitution or combination of substitutions as listed in Table 5 or Table 6. The variants of the invention comprise at least the amino acid substitutions listed in the left column and called Variable Mutations, or functionally equivalent residues, and optionally one or both combination of substitutions listed in the right column and called Optional Constant Mutations, or functionally equivalent sequence.

    TABLE-US-00016 TABLE 5 Variants of TdT having the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence within a specified percent sequence identity thereof, with at least a substitution on residue C173 and other residues as indicated (wherein the amino acid position numbers are with respect to SEQ ID NO: 2). Name Variable Mutations Optional Constant Mutations DS1 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325P + G284L/S + H287D + E289A E328L DS2 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325P + G284L/S + H287D + E289A E328N DS3 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325P G284L/S + H287D + E289A DS4 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325A + G284L/S + H287D + E289A E328L DS5 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325A + G284L/S + H287D + E289A E328N DS6 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325A G284L/S + H287D + E289A DS7 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + E328L G284L/S + H287D + E289A DS8 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + E328N G284L/S + H287D + E289A DS9 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V G284L/S + H287D + E289A DS10 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + R325P + E328L G284L/S + H287D + E289A DS11 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + R325P + E328N G284L/S + H287D + E289A DS12 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + R325P G284L/S + H287D + E289A DS13 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + R325A + E328L G284L/S + H287D + E289A DS14 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + R325A + E328N G284L/S + H287D + E289A DS15 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + R325A G284L/S + H287D + E289A DS16 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + E328L G284L/S + H287D + E289A DS17 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L + E328N G284L/S + H287D + E289A DS18 M63R + L131P + C173R + L52F + A108V + R354K and/or R207L G284L/S + H287D + E289A DS19 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325P + G284L/S + H287D + E289A E328L DS20 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325P + G284L/S + H287D + E289A E328N DS21 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325P G284L/S + H287D + E289A DS22 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325A + G284L/S + H287D + E289A E328L DS23 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325A + G284L/S + H287D + E289A E328N DS24 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325A G284L/S + H287D + E289A DS25 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + E328L G284L/S + H287D + E289A DS26 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + E328N G284L/S + H287D + E289A DS27 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V G284L/S + H287D + E289A DS28 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + R325P + E328L G284L/S + H287D + E289A DS29 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + R325P + E328N G284L/S + H287D + E289A DS30 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + R325P G284L/S + H287D + E289A DS31 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + R325A + E328L G284L/S + H287D + E289A DS32 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + R325A + E328N G284L/S + H287D + E289A DS33 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + R325A G284L/S + H287D + E289A DS34 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + E328L G284L/S + H287D + E289A DS35 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N + E328N G284L/S + H287D + E289A DS36 M63R + L131P + C173R + L52F + A108V + R354K and/or R207N G284L/S + H287D + E289A DS37 M63R + L131P + C173R + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS38 M63R + L131P + C173R + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS39 M63R + L131P + C173R + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS40 M63R + L131P + C173R + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS41 M63R + L131P + C173R + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS42 M63R + L131P + C173R + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS43 M63R + L131P + C173R + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS44 M63R + L131P + C173R + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS45 M63R + L131P + C173R + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS46 M63R + L131P + C173R + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS47 M63R + L131P + C173R + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS48 M63R + L131P + C173R + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS49 M63R + L131P + C173R + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS50 M63R + L131P + C173R + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS51 M63R + L131P + C173R + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS52 M63R + L131P + C173R + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS53 M63R + L131P + C173R + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS54 M63R + L131P + C173R L52F + A108V + R354K and/or G284L/S + H287D + E289A DS55 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325P + G284L/S + H287D + E289A E328L DS56 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325P + G284L/S + H287D + E289A E328N DS57 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325P G284L/S + H287D + E289A DS58 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325A + G284L/S + H287D + E289A E328L DS59 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325A + G284L/S + H287D + E289A E328N DS60 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325A G284L/S + H287D + E289A DS61 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + E328L G284L/S + H287D + E289A DS62 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + E328N G284L/S + H287D + E289A DS63 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V G284L/S + H287D + E289A DS64 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + R325P + E328L G284L/S + H287D + E289A DS65 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + R325P + E328N G284L/S + H287D + E289A DS66 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + R325P G284L/S + H287D + E289A DS67 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + R325A + E328L G284L/S + H287D + E289A DS68 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + R325A + E328N G284L/S + H287D + E289A DS69 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + R325A G284L/S + H287D + E289A DS70 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + E328L G284L/S + H287D + E289A DS71 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L + E328N G284L/S + H287D + E289A DS72 M63R + L131P + C173G + L52F + A108V + R354K and/or R207L G284L/S + H287D + E289A DS73 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325P + G284L/S + H287D + E289A E328L DS74 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325P + G284L/S + H287D + E289A E328N DS75 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325P G284L/S + H287D + E289A DS76 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325A + G284L/S + H287D + E289A E328L DS77 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325A + G284L/S + H287D + E289A E328N DS78 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325A G284L/S + H287D + E289A DS79 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + E328L G284L/S + H287D + E289A DS80 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + E328N G284L/S + H287D + E289A DS81 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V G284L/S + H287D + E289A DS82 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + R325P + E328L G284L/S + H287D + E289A DS83 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + R325P + E328N G284L/S + H287D + E289A DS84 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + R325P G284L/S + H287D + E289A DS85 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + R325A + E328L G284L/S + H287D + E289A DS86 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + R325A + E328N G284L/S + H287D + E289A DS87 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + R325A G284L/S + H287D + E289A DS88 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + E328L G284L/S + H287D + E289A DS89 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N + E328N G284L/S + H287D + E289A DS90 M63R + L131P + C173G + L52F + A108V + R354K and/or R207N G284L/S + H287D + E289A DS91 M63R + L131P + C173G + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS92 M63R + L131P + C173G + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS93 M63R + L131P + C173G + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS94 M63R + L131P + C173G + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS95 M63R + L131P + C173G + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS96 M63R + L131P + C173G + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS97 M63R + L131P + C173G + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS98 M63R + L131P + C173G + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS99 M63R + L131P + C173G + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS100 M63R + L131P + C173G + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS101 M63R + L131P + C173G + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS102 M63R + L131P + C173G + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS103 M63R + L131P + C173G + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS104 M63R + L131P + C173G + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS105 M63R + L131P + C173G + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS106 M63R + L131P + C173G + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS107 M63R + L131P + C173G + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS108 M63R + L131P + C173G L52F + A108V + R354K and/or G284L/S + H287D + E289A DS163 M63R + C173R + R207L + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS164 M63R + C173R + R207L + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS165 M63R + C173R + R207L + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS166 M63R + C173R + R207L + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS167 M63R + C173R + R207L + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS168 M63R + C173R + R207L + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS169 M63R + C173R + R207L + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS170 M63R + C173R + R207L + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS171 M63R + C173R + R207L + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS172 M63R + C173R + R207L + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS173 M63R + C173R + R207L + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS174 M63R + C173R + R207L + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS175 M63R + C173R + R207L + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS176 M63R + C173R + R207L + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS177 M63R + C173R + R207L + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS178 M63R + C173R + R207L + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS179 M63R + C173R + R207L + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS180 M63R + C173R + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS52 M63R + C173R + R207N + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS182 M63R + C173R + R207N + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS183 M63R + C173R + R207N + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS184 M63R + C173R + R207N + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS185 M63R + C173R + R207N + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS186 M63R + C173R + R207N + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS187 M63R + C173R + R207N + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS188 M63R + C173R + R207N + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS189 M63R + C173R + R207N + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS190 M63R + C173R + R207N + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS191 M63R + C173R + R207N + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS63 M63R + C173R + R207N + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS193 M63R + C173R + R207N + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS194 M63R + C173R + R207N + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS195 M63R + C173R + R207N + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS196 M63R + C173R + R207N + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS197 M63R + C173R + R207N + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS198 M63R + C173R + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS199 M63R + C173R + D250V + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS200 M63R + C173R + D250V + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS201 M63R + C173R + D250V + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS202 M63R + C173R + D250V + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS203 M63R + C173R + D250V + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS204 M63R + C173R + D250V + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS205 M63R + C173R + D250V + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS206 M63R + C173R + D250V + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS207 M63R + C173R + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS208 M63R + C173R + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS209 M63R + C173R + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS210 M63R + C173R + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS211 M63R + C173R + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS212 M63R + C173R + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS213 M63R + C173R + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS214 M63R + C173R + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS215 M63R + C173R + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS216 M63R + C173R L52F + A108V + R354K and/or G284L/S + H287D + E289A DS217 M63R + C173G + R207L + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS218 M63R + C173G + R207L + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS219 M63R + C173G + R207L + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS220 M63R + C173G + R207L + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS221 M63R + C173G + R207L + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS222 M63R + C173G + R207L + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS223 M63R + C173G + R207L + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS224 M63R + C173G + R207L + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS225 M63R + C173G + R207L + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS226 M63R + C173G + R207L + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS227 M63R + C173G + R207L + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS228 M63R + C173G + R207L + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS229 M63R + C173G + R207L + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS230 M63R + C173G + R207L + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS231 M63R + C173G + R207L + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS232 M63R + C173G + R207L + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS233 M63R + C173G + R207L + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS234 M63R + C173G + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS235 M63R + C173G + R207N + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS236 M63R + C173G + R207N + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS108 M63R + C173G + R207N + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS238 M63R + C173G + R207N + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS239 M63R + C173G + R207N + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS240 M63R + C173G + R207N + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS241 M63R + C173G + R207N + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS242 M63R + C173G + R207N + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS243 M63R + C173G + R207N + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS244 M63R + C173G + R207N + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS245 M63R + C173G + R207N + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS246 M63R + C173G + R207N + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS247 M63R + C173G + R207N + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS248 M63R + C173G + R207N + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS249 M63R + C173G + R207N + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS250 M63R + C173G + R207N + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS251 M63R + C173G + R207N + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS252 M63R + C173G + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS253 M63R + C173G + D250V + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS254 M63R + C173G + D250V + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS255 M63R + C173G + D250V + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS256 M63R + C173G + D250V + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS257 M63R + C173G + D250V + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS258 M63R + C173G + D250V + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS259 M63R + C173G + D250V + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS131 M63R + C173G + D250V + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS261 M63R + C173G + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS262 M63R + C173G + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS263 M63R + C173G + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS264 M63R + C173G + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS265 M63R + C173G + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS266 M63R + C173G + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS267 M63R + C173G + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS268 M63R + C173G + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS269 M63R + C173G + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS270 M63R + C173G L52F + A108V + R354K and/or G284L/S + H287D + E289A DS325 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325P + G284L/S + H287D + E289A E328L DS326 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325P + G284L/S + H287D + E289A E328N DS327 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325P G284L/S + H287D + E289A DS328 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325A + G284L/S + H287D + E289A E328L DS329 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325A + G284L/S + H287D + E289A E328N DS330 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + R325A G284L/S + H287D + E289A DS331 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + E328L G284L/S + H287D + E289A DS332 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V + E328N G284L/S + H287D + E289A DS333 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + D250V G284L/S + H287D + E289A DS334 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + R325P + E328L G284L/S + H287D + E289A DS335 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + R325P + E328N G284L/S + H287D + E289A DS207 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + R325P G284L/S + H287D + E289A DS337 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + R325A + E328L G284L/S + H287D + E289A DS338 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + R325A + E328N G284L/S + H287D + E289A DS339 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + R325A G284L/S + H287D + E289A DS340 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + E328L G284L/S + H287D + E289A DS341 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L + E328N G284L/S + H287D + E289A DS342 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207L G284L/S + H287D + E289A DS343 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325P + G284L/S + H287D + E289A E328L DS344 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325P + G284L/S + H287D + E289A E328N DS345 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325P G284L/S + H287D + E289A DS346 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325A + G284L/S + H287D + E289A E328L DS347 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325A + G284L/S + H287D + E289A E328N DS348 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + R325A G284L/S + H287D + E289A DS349 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + E328L G284L/S + H287D + E289A DS350 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V + E328N G284L/S + H287D + E289A DS351 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + D250V G284L/S + H287D + E289A DS352 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + R325P + E328L G284L/S + H287D + E289A DS353 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + R325P + E328N G284L/S + H287D + E289A DS354 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + R325P G284L/S + H287D + E289A DS355 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + R325A + E328L G284L/S + H287D + E289A DS356 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + R325A + E328N G284L/S + H287D + E289A DS357 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + R325A G284L/S + H287D + E289A DS358 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + E328L G284L/S + H287D + E289A DS359 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N + E328N G284L/S + H287D + E289A DS360 M63Q + L131P + C173R + L52F + A108V + R354K and/or R207N G284L/S + H287D + E289A DS361 M63Q + L131P + C173R + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS362 M63Q + L131P + C173R + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS363 M63Q + L131P + C173R + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS364 M63Q + L131P + C173R + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS365 M63Q + L131P + C173R + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS366 M63Q + L131P + C173R + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS367 M63Q + L131P + C173R + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS368 M63Q + L131P + C173R + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS369 M63Q + L131P + C173R + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS370 M63Q + L131P + C173R + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS371 M63Q + L131P + C173R + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS372 M63Q + L131P + C173R + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS373 M63Q + L131P + C173R + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS374 M63Q + L131P + C173R + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS375 M63Q + L131P + C173R + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS376 M63Q + L131P + C173R + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS377 M63Q + L131P + C173R + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS378 M63Q + L131P + C173R L52F + A108V + R354K and/or G284L/S + H287D + E289A DS250 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325P + G284L/S + H287D + E289A E328L DS380 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325P + G284L/S + H287D + E289A E328N DS381 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325P G284L/S + H287D + E289A DS382 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325A + G284L/S + H287D + E289A E328L DS383 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325A + G284L/S + H287D + E289A E328N DS384 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + R325A G284L/S + H287D + E289A DS385 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + E328L G284L/S + H287D + E289A DS386 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V + E328N G284L/S + H287D + E289A DS387 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + D250V G284L/S + H287D + E289A DS388 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + R325P + E328L G284L/S + H287D + E289A DS389 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + R325P + E328N G284L/S + H287D + E289A DS390 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + R325P G284L/S + H287D + E289A DS391 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + R325A + E328L G284L/S + H287D + E289A DS392 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + R325A + E328N G284L/S + H287D + E289A DS393 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + R325A G284L/S + H287D + E289A DS394 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + E328L G284L/S + H287D + E289A DS395 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L + E328N G284L/S + H287D + E289A DS396 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207L G284L/S + H287D + E289A DS397 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325P + G284L/S + H287D + E289A E328L DS398 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325P + G284L/S + H287D + E289A E328N DS399 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325P G284L/S + H287D + E289A DS400 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325A + G284L/S + H287D + E289A E328L DS401 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325A + G284L/S + H287D + E289A E328N DS402 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + R325A G284L/S + H287D + E289A DS403 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + E328L G284L/S + H287D + E289A DS404 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V + E328N G284L/S + H287D + E289A DS405 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + D250V G284L/S + H287D + E289A DS406 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + R325P + E328L G284L/S + H287D + E289A DS407 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + R325P + E328N G284L/S + H287D + E289A DS408 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + R325P G284L/S + H287D + E289A DS409 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + R325A + E328L G284L/S + H287D + E289A DS410 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + R325A + E328N G284L/S + H287D + E289A DS411 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + R325A G284L/S + H287D + E289A DS412 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + E328L G284L/S + H287D + E289A DS284 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N + E328N G284L/S + H287D + E289A DS414 M63Q + L131P + C173G + L52F + A108V + R354K and/or R207N G284L/S + H287D + E289A DS415 M63Q + L131P + C173G + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS287 M63Q + L131P + C173G + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS417 M63Q + L131P + C173G + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS289 M63Q + L131P + C173G + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS419 M63Q + L131P + C173G + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS420 M63Q + L131P + C173G + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS421 M63Q + L131P + C173G + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS422 M63Q + L131P + C173G + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS423 M63Q + L131P + C173G + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS424 M63Q + L131P + C173G + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS425 M63Q + L131P + C173G + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS426 M63Q + L131P + C173G + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS427 M63Q + L131P + C173G + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS428 M63Q + L131P + C173G + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS429 M63Q + L131P + C173G + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS430 M63Q + L131P + C173G + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS431 M63Q + L131P + C173G + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS432 M63Q + L131P + C173G L52F + A108V + R354K and/or G284L/S + H287D + E289A DS487 M63Q + C173R + R207L + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS488 M63Q + C173R + R207L + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS489 M63Q + C173R + R207L + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS490 M63Q + C173R + R207L + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS491 M63Q + C173R + R207L + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS492 M63Q + C173R + R207L + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS493 M63Q + C173R + R207L + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS494 M63Q + C173R + R207L + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS495 M63Q + C173R + R207L + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS496 M63Q + C173R + R207L + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS497 M63Q + C173R + R207L + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS498 M63Q + C173R + R207L + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS499 M63Q + C173R + R207L + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS500 M63Q + C173R + R207L + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS501 M63Q + C173R + R207L + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS502 M63Q + C173R + R207L + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS503 M63Q + C173R + R207L + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS504 M63Q + C173R + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS505 M63Q + C173R + R207N + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS506 M63Q + C173R + R207N + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS507 M63Q + C173R + R207N + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS508 M63Q + C173R + R207N + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS509 M63Q + C173R + R207N + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS510 M63Q + C173R + R207N + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS511 M63Q + C173R + R207N + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS512 M63Q + C173R + R207N + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS513 M63Q + C173R + R207N + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS514 M63Q + C173R + R207N + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS515 M63Q + C173R + R207N + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS516 M63Q + C173R + R207N + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS517 M63Q + C173R + R207N + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS518 M63Q + C173R + R207N + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS519 M63Q + C173R + R207N + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS520 M63Q + C173R + R207N + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS521 M63Q + C173R + R207N + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS522 M63Q + C173R + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS523 M63Q + C173R + D250V + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS524 M63Q + C173R + D250V + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS525 M63Q + C173R + D250V + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS526 M63Q + C173R + D250V + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS527 M63Q + C173R + D250V + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS528 M63Q + C173R + D250V + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS529 M63Q + C173R + D250V + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS530 M63Q + C173R + D250V + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS531 M63Q + C173R + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS532 M63Q + C173R + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS533 M63Q + C173R + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS534 M63Q + C173R + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS535 M63Q + C173R + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS536 M63Q + C173R + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS537 M63Q + C173R + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS538 M63Q + C173R + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS539 M63Q + C173R + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS540 M63Q + C173R L52F + A108V + R354K and/or G284L/S + H287D + E289A DS541 M63Q + C173G + R207L + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS542 M63Q + C173G + R207L + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS543 M63Q + C173G + R207L + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS544 M63Q + C173G + R207L + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS545 M63Q + C173G + R207L + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS546 M63Q + C173G + R207L + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS547 M63Q + C173G + R207L + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS548 M63Q + C173G + R207L + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS549 M63Q + C173G + R207L + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS550 M63Q + C173G + R207L + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS551 M63Q + C173G + R207L + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS552 M63Q + C173G + R207L + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS553 M63Q + C173G + R207L + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS554 M63Q + C173G + R207L + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS555 M63Q + C173G + R207L + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS556 M63Q + C173G + R207L + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS557 M63Q + C173G + R207L + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS558 M63Q + C173G + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS559 M63Q + C173G + R207N + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS560 M63Q + C173G + R207N + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS561 M63Q + C173G + R207N + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS562 M63Q + C173G + R207N + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS563 M63Q + C173G + R207N + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS564 M63Q + C173G + R207N + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS565 M63Q + C173G + R207N + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS566 M63Q + C173G + R207N + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS567 M63Q + C173G + R207N + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS568 M63Q + C173G + R207N + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS569 M63Q + C173G + R207N + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS570 M63Q + C173G + R207N + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS571 M63Q + C173G + R207N + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS572 M63Q + C173G + R207N + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS573 M63Q + C173G + R207N + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS574 M63Q + C173G + R207N + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS575 M63Q + C173G + R207N + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS576 M63Q + C173G + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS577 M63Q + C173G + D250V + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS578 M63Q + C173G + D250V + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS579 M63Q + C173G + D250V + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS580 M63Q + C173G + D250V + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS581 M63Q + C173G + D250V + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS582 M63Q + C173G + D250V + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS583 M63Q + C173G + D250V + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS584 M63Q + C173G + D250V + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS585 M63Q + C173G + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS586 M63Q + C173G + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS587 M63Q + C173G + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS588 M63Q + C173G + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS589 M63Q + C173G + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS590 M63Q + C173G + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS591 M63Q + C173G + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS592 M63Q + C173G + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS593 M63Q + C173G + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS594 M63Q + C173G L52F + A108V + R354K and/or G284L/S + H287D + E289A DS649 L131P + C173R + R207L + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS650 L131P + C173R + R207L + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS651 L131P + C173R + R207L + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS652 L131P + C173R + R207L + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS653 L131P + C173R + R207L + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS654 L131P + C173R + R207L + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS655 L131P + C173R + R207L + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS656 L131P + C173R + R207L + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS657 L131P + C173R + R207L + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS658 L131P + C173R + R207L + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS659 L131P + C173R + R207L + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS660 L131P + C173R + R207L + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS661 L131P + C173R + R207L + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS662 L131P + C173R + R207L + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS663 L131P + C173R + R207L + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS664 L131P + C173R + R207L + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS665 L131P + C173R + R207L + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS666 L131P + C173R + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS667 L131P + C173R + R207N + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS668 L131P + C173R + R207N + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS669 L131P + C173R + R207N + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS670 L131P + C173R + R207N + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS671 L131P + C173R + R207N + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS672 L131P + C173R + R207N + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS673 L131P + C173R + R207N + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS674 L131P + C173R + R207N + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS675 L131P + C173R + R207N + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS676 L131P + C173R + R207N + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS677 L131P + C173R + R207N + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS678 L131P + C173R + R207N + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS679 L131P + C173R + R207N + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS680 L131P + C173R + R207N + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS681 L131P + C173R + R207N + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS682 L131P + C173R + R207N + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS683 L131P + C173R + R207N + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS684 L131P + C173R + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS685 L131P + C173R + D250V + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS686 L131P + C173R + D250V + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS687 L131P + C173R + D250V + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS688 L131P + C173R + D250V + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS689 L131P + C173R + D250V + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS690 L131P + C173R + D250V + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS691 L131P + C173R + D250V + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS692 L131P + C173R + D250V + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS693 L131P + C173R + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS694 L131P + C173R + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS695 L131P + C173R + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS696 L131P + C173R + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS697 L131P + C173R + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS698 L131P + C173R + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS699 L131P + C173R + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS700 L131P + C173R + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS701 L131P + C173R + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS702 L131P + C173R L52F + A108V + R354K and/or G284L/S + H287D + E289A DS703 L131P + C173G + R207L + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS704 L131P + C173G + R207L + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS705 L131P + C173G + R207L + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS706 L131P + C173G + R207L + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS707 L131P + C173G + R207L + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS708 L131P + C173G + R207L + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS709 L131P + C173G + R207L + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS710 L131P + C173G + R207L + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS711 L131P + C173G + R207L + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS712 L131P + C173G + R207L + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS713 L131P + C173G + R207L + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS714 L131P + C173G + R207L + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS715 L131P + C173G + R207L + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS716 L131P + C173G + R207L + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS717 L131P + C173G + R207L + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS718 L131P + C173G + R207L + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS719 L131P + C173G + R207L + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS720 L131P + C173G + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS721 L131P + C173G + R207N + L52F + A108V + R354K and/or D250V + R325P + E328L G284L/S + H287D + E289A DS722 L131P + C173G + R207N + L52F + A108V + R354K and/or D250V + R325P + E328N G284L/S + H287D + E289A DS723 L131P + C173G + R207N + L52F + A108V + R354K and/or D250V + R325P G284L/S + H287D + E289A DS724 L131P + C173G + R207N + L52F + A108V + R354K and/or D250V + R325A + E328L G284L/S + H287D + E289A DS725 L131P + C173G + R207N + L52F + A108V + R354K and/or D250V + R325A + E328N G284L/S + H287D + E289A DS726 L131P + C173G + R207N + L52F + A108V + R354K and/or D250V + R325A G284L/S + H287D + E289A DS727 L131P + C173G + R207N + L52F + A108V + R354K and/or D250V + E328L G284L/S + H287D + E289A DS728 L131P + C173G + R207N + L52F + A108V + R354K and/or D250V + E328N G284L/S + H287D + E289A DS729 L131P + C173G + R207N + L52F + A108V + R354K and/or D250V G284L/S + H287D + E289A DS730 L131P + C173G + R207N + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS731 L131P + C173G + R207N + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS732 L131P + C173G + R207N + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS733 L131P + C173G + R207N + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS734 L131P + C173G + R207N + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS735 L131P + C173G + R207N + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS736 L131P + C173G + R207N + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS737 L131P + C173G + R207N + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS738 L131P + C173G + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS739 L131P + C173G + D250V + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS740 L131P + C173G + D250V + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS741 L131P + C173G + D250V + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS742 L131P + C173G + D250V + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS743 L131P + C173G + D250V + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS744 L131P + C173G + D250V + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS745 L131P + C173G + D250V + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS746 L131P + C173G + D250V + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS747 L131P + C173G + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS748 L131P + C173G + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS749 L131P + C173G + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS750 L131P + C173G + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS751 L131P + C173G + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS752 L131P + C173G + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS753 L131P + C173G + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS754 L131P + C173G + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS755 L131P + C173G + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS756 L131P + C173G L52F + A108V + R354K and/or G284L/S + H287D + E289A DS811 C173R + R207L + D250V + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS812 C173R + R207L + D250V + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS813 C173R + R207L + D250V + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS814 C173R + R207L + D250V + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS815 C173R + R207L + D250V + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS816 C173R + R207L + D250V + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS817 C173R + R207L + D250V + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS818 C173R + R207L + D250V + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS819 C173R + R207L + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS820 C173R + R207L + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS821 C173R + R207L + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS822 C173R + R207L + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS823 C173R + R207L + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS824 C173R + R207L + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS825 C173R + R207L + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS826 C173R + R207L + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS827 C173R + R207L + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS828 C173R + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS829 C173R + R207N + D250V + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS830 C173R + R207N + D250V + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS831 C173R + R207N + D250V + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS832 C173R + R207N + D250V + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS833 C173R + R207N + D250V + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS834 C173R + R207N + D250V + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS835 C173R + R207N + D250V + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS836 C173R + R207N + D250V + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS837 C173R + R207N + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS838 C173R + R207N + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS839 C173R + R207N + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS840 C173R + R207N + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS841 C173R + R207N + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS842 C173R + R207N + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS843 C173R + R207N + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS844 C173R + R207N + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS845 C173R + R207N + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS846 C173R + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS847 C173R + D250V + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS848 C173R + D250V + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS849 C173R + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS850 C173R + D250V + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS851 C173R + D250V + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS852 C173R + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS853 C173R + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS854 C173R + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS855 C173R + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS856 C173R + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS857 C173R + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS858 C173R + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS859 C173R + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS860 C173R + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS861 C173R + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS862 C173R + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS863 C173R + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS864 C173R L52F + A108V + R354K and/or G284L/S + H287D + E289A DS865 C173G + R207L + D250V + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS866 C173G + R207L + D250V + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS867 C173G + R207L + D250V + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS868 C173G + R207L + D250V + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS869 C173G + R207L + D250V + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS870 C173G + R207L + D250V + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS871 C173G + R207L + D250V + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS872 C173G + R207L + D250V + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS873 C173G + R207L + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS874 C173G + R207L + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS875 C173G + R207L + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS876 C173G + R207L + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS877 C173G + R207L + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS878 C173G + R207L + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS879 C173G + R207L + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS880 C173G + R207L + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS881 C173G + R207L + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS882 C173G + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS883 C173G + R207N + D250V + L52F + A108V + R354K and/or R325P + E328L G284L/S + H287D + E289A DS884 C173G + R207N + D250V + L52F + A108V + R354K and/or R325P + E328N G284L/S + H287D + E289A DS885 C173G + R207N + D250V + L52F + A108V + R354K and/or R325P G284L/S + H287D + E289A DS886 C173G + R207N + D250V + L52F + A108V + R354K and/or R325A + E328L G284L/S + H287D + E289A DS887 C173G + R207N + D250V + L52F + A108V + R354K and/or R325A + E328N G284L/S + H287D + E289A DS888 C173G + R207N + D250V + L52F + A108V + R354K and/or R325A G284L/S + H287D + E289A DS889 C173G + R207N + D250V + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS890 C173G + R207N + D250V + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS891 C173G + R207N + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS892 C173G + R207N + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS893 C173G + R207N + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS894 C173G + R207N + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS895 C173G + R207N + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS896 C173G + R207N + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS897 C173G + R207N + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS898 C173G + R207N + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS899 C173G + R207N + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS900 C173G + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS901 C173G + D250V + R325P + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS902 C173G + D250V + R325P + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS903 C173G + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS904 C173G + D250V + R325A + L52F + A108V + R354K and/or E328L G284L/S + H287D + E289A DS905 C173G + D250V + R325A + L52F + A108V + R354K and/or E328N G284L/S + H287D + E289A DS906 C173G + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS907 C173G + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS908 C173G + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS909 C173G + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS910 C173G + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS911 C173G + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS912 C173G + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS913 C173G + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS914 C173G + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS915 C173G + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS916 C173G + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS917 C173G + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS918 C173G L52F + A108V + R354K and/or G284L/S + H287D + E289A

    [0060] In a particular embodiment, the variants of the invention comprise the amino acid sequence of SEQ ID NO:2 (or functionally equivalent sequence) and optionally additional amino acid fragments at the C-ter or N-ter. In another embodiment, the variants of the invention consist solely on the amino acid sequence of SEQ ID NO:2 (or functionally equivalent sequence). More particularly, in a particular embodiment, the variants of the invention are deprived of the BRTC-like domain, which corresponds to residues 1 to 129 of SEQ ID NO:1.

    [0061] According to a second aspect of the invention, the variant of Terminal deoxynucleotidyl Transferase (TdT) (i) comprises an amino acid sequence as set forth in SEQ ID NO:2 or a functionally equivalent sequence (such as, SEQ ID NOs:11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35) or an amino acid sequence having a specified percent sequence identity of any of the foregoing sequences, with at least three amino acid substitutions selected from M63R/Q, L131P, C173G/R, R207L/N, D250V, R325P/N and E328N/L/T/S, or a functionally equivalent residue, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO:1 or as set forth directly elsewhere herein in respect of their individual SEQ ID NOs, (ii) is able to synthesize a nucleic acid fragment without template and (iii) is able to incorporate a modified nucleotide, such as a 3-O-modified nucleotide, into the nucleic fragment.

    [0062] For instance, the variant of TdT comprises an amino acid sequence within a specified percent sequence identity of SEQ ID NO:2 and a combination of substitutions selected from M63R+L131P+R207L, M63R+L131P+R207N, M63R+L131P+D250V, M63R+L131P+R325P, M63R+L131P+R325A, M63R+L131P+E328L, M63R+L131P+E328N, M63R+R207L+D250V, M63R+R207L+R325P, M63R+R207L+R325A, M63R+R207L+E328L, M63R+R207L+E328N, M63R+R207N+D250V, M63R+R207N+R325P, M63R+R207N+R325A, M63R+R207N+E328L, M63R+R207N+E328N, M63R+D250V+R325P, M63R+D250V+R325A, M63R+R325P+E328L, M63R+R325P+E328N, M63R+R325A+E328L, M63R+R325A+E328N, M63Q+L131P+R207L, M63Q+L131P+R207N, M63Q+L131P+D250V, M63Q+L131P+R325P, M63Q+L131P+R325A, M63Q+L131P+E328L, M63Q+L131P+E328N, M63Q+R207L+D250V, M63Q+R207L+R325P, M63Q+R207L+R325A, M63Q+R207L+E328L, M63Q+R207L+E328N, M63Q+D250V+R325P, M63Q+D250V+R325A, M63Q+D250V+E328L, M63Q+D250V+E328N, M63Q+R325P+E328L, M63Q+R325P+E328N, M63Q+R325A+E328L, M63Q+R325A+E328N, L131P+R207L+D250V, L131P+R207L+R325A, L131P+R207L+E328L, L131P+R207L+E328N, L131P+R207N+D250V, L131P+R207N+R325P, L131P+R207N+R325A, L131P+R207N+E328L, L131P+R207N+E328N, L131P+D250V+R325P, L131P+D250V+R325A, L131P+D250V+E328L, L131P+D250V+E328N, L131P+R325P+E328L, L131P+R325P+E328N, L131P+R325A+E328L, L131P+R325A+E328N, R207L+D250V+R325P, R207L+D250V+R325A, R207L+D250V+E328L, R207L+D250V+E328N, R207L+R325P+E328L, R207L+R325P+E328N, R207L+R325A+E328L, R207L+R325A+E328N, R207N+D250V+R325P, R207N+D250V+R325A, R207N+D250V+E328L, R207N+D250V+E328N, R207N+R325P+E328L, R207N+R325P+E328N, R207N+R325A+E328L, R207N+R325A+E328N, D250V+R325P+E328L, D250V+R325P+E328N, D250V+R325A+E328L, D250V+R325A+E328N and R207L+D250V+R325P, or functionally equivalent residue(s) wherein the above position numbers are with respect to SEQ ID NO:2.

    [0063] In a particular embodiment, the variant of TdT comprises an amino acid sequence within a specified percent sequence identity of SEQ ID NO:2, or functionally equivalent sequence, with the combination of substitutions R207L+R325P+E328L (DS928), or functionally equivalent residues.

    [0064] In a particular embodiment, the variant of TdT comprises an amino acid sequence within a specified percent sequence identity of SEQ ID NO:2, or functionally equivalent sequence, with the combination of substitutions R207N+R325A+E328N (DS950), or functionally equivalent residues.

    [0065] Such variant may further comprise at least one substitution at position corresponding to residues selected from L52, A108, L131, T340, G284, H287, E289, W450, R354 and A510, or functionally equivalent residue(s).

    [0066] As exposed above, said variant may also comprise the combination of constant mutations L52F+A108V+R354K and/or G284L/S+H287D+E289A, or functionally equivalent residue(s).

    [0067] According to a further aspect, the invention provides a variant of Terminal deoxynucleotidyl Transferase (TdT) which (i) comprises an amino acid sequence within a specified percent sequence identity of SEQ ID NO:2 or a functionally equivalent sequence, with at least one amino acid substitution selected from M63R, M63Q, L131P, R207L, R207N, D250V, R325P, R325A, E328L, E328N, or functionally equivalent residue(s), (ii) is able to synthesize a nucleic acid fragment without a template and (iii) is able to incorporate a 3-O-modified nucleotide into the nucleic fragment.

    [0068] In another aspect, the invention provides a variant of Terminal deoxynucleotidyl Transferase (TdT) which (i) comprises an amino acid sequence within a specified percent sequence identity of SEQ ID NO:2 or a functionally equivalent sequence, with at least the combination of substitutions selected from M63R+L131P, M63R+R207L, M63R+R207N, M63R+D250V, M63R+R325P, M63R+R325A, M63R+E328L, M63R+E328N, M63Q+L131P, M63Q+R207L, M63Q+R207N, M63Q+D250V, M63Q+R325P, M63Q+R325A, M63Q+E328L, M63Q+E328N, L131P+R207L, L131P+R207N, L131P+D250V, L131P+R325P, L131P+R325A, L131P+E328L, L131P+E328N, R207L+D250V, R207L+R325P, R207L+R325A, R207L+E328L, R207L+E328N, R207N+D250V, R207N+R325P, R207N+R325A, R207N+E328L, R207N+E328N, D250V+R325P, D250V+R325A, D250V+E328L, D250V+E328N, R325P+E328L, R325P+E328N, R325A+E328L and R325A+E328N, or functionally equivalent residue(s), wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO:2, (ii) is able to synthesize a nucleic acid fragment without a template and (iii) is able to incorporate a 3-O-modified nucleotide into the nucleic fragment.

    [0069] It is thus an object of the invention to provide a TdT variant having an amino acid sequence within a specified percent sequence identity of SEQ ID NO:2, or functionally equivalent sequence, with any substitution or combination of substitutions listed in Table 6, listed as Variable Mutations, or functionally equivalent residue(s) and optionally one or both combinations of constant mutations L52F+A18V+R354K an G284L/S+H287D+E289A, or functionally equivalent residue(s).

    [0070] According to a particular embodiment, the variant comprises at least one substitution or combination of substitutions as listed in Table 6, and optionally one or more additional mutation(s).

    TABLE-US-00017 TABLE 2 Variants of TdT having the amino acid sequence of SEQ ID NO: 2, or an amino acid sequence within a specified percent sequence identity thereof, and further including the following Variable Mutations and Optional Constant Mutations (wherein amino acid position numbers are with respect to SEQ ID NO: 2). Name Variable Mutations Optional Constant Mutations DS109 M63R + L131P + R207L + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS110 M63R + L131P + R207L + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS111 M63R + L131P + R207L + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS112 M63R + L131P + R207L + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS113 M63R + L131P + R207L + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS114 M63R + L131P + R207L + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS115 M63R + L131P + R207L + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS116 M63R + L131P + R207L + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS117 M63R + L131P + R207L + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS118 M63R + L131P + R207L + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS119 M63R + L131P + R207L + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS120 M63R + L131P + R207L + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS121 M63R + L131P + R207L + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS122 M63R + L131P + R207L + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS123 M63R + L131P + R207L + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS124 M63R + L131P + R207L + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS125 M63R + L131P + R207L + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS126 M63R + L131P + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS127 M63R + L131P + R207N + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS128 M63R + L131P + R207N + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS129 M63R + L131P + R207N + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS130 M63R + L131P + R207N + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS131 M63R + L131P + R207N + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS132 M63R + L131P + R207N + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS133 M63R + L131P + R207N + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS134 M63R + L131P + R207N + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS135 M63R + L131P + R207N + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS136 M63R + L131P + R207N + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS137 M63R + L131P + R207N + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS138 M63R + L131P + R207N + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS139 M63R + L131P + R207N + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS140 M63R + L131P + R207N + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS141 M63R + L131P + R207N + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS142 M63R + L131P + R207N + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS143 M63R + L131P + R207N + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS144 M63R + L131P + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS145 M63R + L131P + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS146 M63R + L131P + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS147 M63R + L131P + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS148 M63R + L131P + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS149 M63R + L131P + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS150 M63R + L131P + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS151 M63R + L131P + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS152 M63R + L131P + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS153 M63R + L131P + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS154 M63R + L131P + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS155 M63R + L131P + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS156 M63R + L131P + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS157 M63R + L131P + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS158 M63R + L131P + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS159 M63R + L131P + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS160 M63R + L131P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS161 M63R + L131P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS162 M63R + L131P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS271 M63R + R207L + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS272 M63R + R207L + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS273 M63R + R207L + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS274 M63R + R207L + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS275 M63R + R207L + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS276 M63R + R207L + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS277 M63R + R207L + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS278 M63R + R207L + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS279 M63R + R207L + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS280 M63R + R207L + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS281 M63R + R207L + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS282 M63R + R207L + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS283 M63R + R207L + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS284 M63R + R207L + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS285 M63R + R207L + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS286 M63R + R207L + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS287 M63R + R207L + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS288 M63R + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS289 M63R + R207N + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS290 M63R + R207N + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS291 M63R + R207N + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS292 M63R + R207N + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS293 M63R + R207N + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS294 M63R + R207N + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS295 M63R + R207N + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS296 M63R + R207N + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS297 M63R + R207N + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS298 M63R + R207N + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS299 M63R + R207N + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS300 M63R + R207N + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS301 M63R + R207N + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS173 M63R + R207N + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS303 M63R + R207N + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS304 M63R + R207N + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS305 M63R + R207N + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS306 M63R + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS307 M63R + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS308 M63R + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS309 M63R + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS310 M63R + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS311 M63R + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS312 M63R + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS313 M63R + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS314 M63R + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS315 M63R + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS316 M63R + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS317 M63R + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS318 M63R + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS319 M63R + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS320 M63R + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS321 M63R + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS322 M63R + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS323 M63R + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS324 M63R L52F + A108V + R354K and/or G284L/S + H287D + E289A DS433 M63Q + L131P + R207L + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS434 M63Q + L131P + R207L + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS435 M63Q + L131P + R207L + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS436 M63Q + L131P + R207L + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS437 M63Q + L131P + R207L + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS438 M63Q + L131P + R207L + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS439 M63Q + L131P + R207L + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS440 M63Q + L131P + R207L + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS441 M63Q + L131P + R207L + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS442 M63Q + L131P + R207L + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS443 M63Q + L131P + R207L + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS444 M63Q + L131P + R207L + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS445 M63Q + L131P + R207L + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS446 M63Q + L131P + R207L + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS447 M63Q + L131P + R207L + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS448 M63Q + L131P + R207L + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS449 M63Q + L131P + R207L + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS450 M63Q + L131P + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS451 M63Q + L131P + R207N + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS452 M63Q + L131P + R207N + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS453 M63Q + L131P + R207N + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS325 M63Q + L131P + R207N + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS455 M63Q + L131P + R207N + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS456 M63Q + L131P + R207N + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS328 M63Q + L131P + R207N + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS458 M63Q + L131P + R207N + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS459 M63Q + L131P + R207N + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS460 M63Q + L131P + R207N + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS461 M63Q + L131P + R207N + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS462 M63Q + L131P + R207N + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS463 M63Q + L131P + R207N + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS464 M63Q + L131P + R207N + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS465 M63Q + L131P + R207N + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS466 M63Q + L131P + R207N + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS467 M63Q + L131P + R207N + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS468 M63Q + L131P + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS469 M63Q + L131P + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS470 M63Q + L131P + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS471 M63Q + L131P + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS472 M63Q + L131P + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS473 M63Q + L131P + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS474 M63Q + L131P + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS475 M63Q + L131P + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS476 M63Q + L131P + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS477 M63Q + L131P + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS478 M63Q + L131P + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS479 M63Q + L131P + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS354 M63Q + L131P + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS481 M63Q + L131P + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS482 M63Q + L131P + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS483 M63Q + L131P + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS484 M63Q + L131P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS485 M63Q + L131P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS486 M63Q + L131P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS595 M63Q + R207L + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS596 M63Q + R207L + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS597 M63Q + R207L + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS598 M63Q + R207L + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS599 M63Q + R207L + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS600 M63Q + R207L + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS601 M63Q + R207L + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS602 M63Q + R207L + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS603 M63Q + R207L + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS604 M63Q + R207L + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS605 M63Q + R207L + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS606 M63Q + R207L + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS607 M63Q + R207L + R325A+ E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS608 M63Q + R207L + R325A+ E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS609 M63Q + R207L + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS610 M63Q + R207L + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS611 M63Q + R207L + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS612 M63Q + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS613 M63Q + R207N + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS614 M63Q + R207N + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS615 M63Q + R207N + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS616 M63Q + R207N + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS617 M63Q + R207N + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS618 M63Q + R207N + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS619 M63Q + R207N + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS620 M63Q + R207N + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS621 M63Q + R207N + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS622 M63Q + R207N + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS623 M63Q + R207N + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS624 M63Q + R207N + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS625 M63Q + R207N + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS626 M63Q + R207N + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS627 M63Q + R207N + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS628 M63Q + R207N + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS629 M63Q + R207N + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS630 M63Q + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS631 M63Q + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS632 M63Q + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS633 M63Q + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS634 M63Q + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS635 M63Q + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS636 M63Q + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS637 M63Q + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS638 M63Q + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS639 M63Q + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS640 M63Q + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS641 M63Q + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS642 M63Q + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS643 M63Q + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS644 M63Q + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS645 M63Q + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS646 M63Q + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS647 M63Q + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS648 M63Q L52F + A108V + R354K and/or G284L/S + H287D + E289A DS757 L131P + R207L + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS758 L131P + R207L + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS759 L131P + R207L + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS760 L131P + R207L + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS761 L131P + R207L + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS762 L131P + R207L + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS763 L131P + R207L + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS764 L131P + R207L + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS765 L131P + R207L + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS766 L131P + R207L + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS767 L131P + R207L + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS768 L131P + R207L + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS769 L131P + R207L + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS770 L131P + R207L + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS771 L131P + R207L + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS772 L131P + R207L + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS773 L131P + R207L + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS774 L131P + R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS775 L131P + R207N + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS776 L131P + R207N + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS777 L131P + R207N + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS778 L131P + R207N + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS779 L131P + R207N + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS780 L131P + R207N + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS781 L131P + R207N + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS782 L131P + R207N + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS783 L131P + R207N + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS784 L131P + R207N + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS785 L131P + R207N + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS786 L131P + R207N + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS787 L131P + R207N + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS788 L131P + R207N + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS789 L131P + R207N + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS790 L131P + R207N + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS791 L131P + R207N + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS792 L131P + R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS793 L131P + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS794 L131P + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS795 L131P + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS796 L131P + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS797 L131P + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS798 L131P + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS799 L131P + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS800 L131P + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS801 L131P + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS802 L131P + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS803 L131P + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS804 L131P + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS805 L131P + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS806 L131P + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS807 L131P + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS808 L131P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS809 L131P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS810 L131P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS921 R207L + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS922 R207L + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS923 R207L + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS924 R207L + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS925 R207L + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS926 R207L + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS927 R207L + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS928 R207L + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS929 R207L + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS930 R207L + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS931 R207L + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS932 R207L + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS933 R207L + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS934 R207L + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS935 R207L + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS936 R207L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS937 R207N + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS938 R207N + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS939 R207N + D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS940 R207N + D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS941 R207N + D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS942 R207N + D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS943 R207N + D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS944 R207N + D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS945 R207N + D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS946 R207N + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS947 R207N + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS948 R207N + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS949 R207N + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS950 R207N + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS951 R207N + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS952 R207N + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS953 R207N + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS954 R207N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS955 D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS956 D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS957 D250V + R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS958 D250V + R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS959 D250V + R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS960 D250V + R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS961 D250V + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS962 D250V + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS963 D250V L52F + A108V + R354K and/or G284L/S + H287D + E289A DS964 R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS965 R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS966 R325P L52F + A108V + R354K and/or G284L/S + H287D + E289A DS967 R325A + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS968 R325A + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS969 R325A L52F + A108V + R354K and/or G284L/S + H287D + E289A DS970 E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS971 E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A DS919 R207L + D250V + R325P + E328L L52F + A108V + R354K and/or G284L/S + H287D + E289A DS920 R207L + D250V + R325P + E328N L52F + A108V + R354K and/or G284L/S + H287D + E289A

    [0071] According to some embodiments, a variant of TdT has a substitution or combination of substitutions described above and has an amino acid sequence within at least 80% identity with SEQ ID NO:2 or with a functionally equivalent sequence (such as, SEQ ID NOs:11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35); in some embodiments, such amino acid sequence is within at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:2 or functionally equivalent sequence (such as, SEQ ID NOs:11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35).

    Additional Modifications

    [0072] In an embodiment, the variant of TdT further includes any type of tagging peptide in its N-terminal, C-terminal or both extremity, such as a His-tag sequence. Said tagging peptide could be used for purification, identification, increasing expression, secretability or increasing catalytic activity. It will be understood that such different tags are extensively described in the literature and thus all tag known to a skilled person are covered by the present invention.

    [0073] The variants of the invention can also include one or more exogenous or heterologous features at the N- and/or C-terminal regions of the protein for use, e.g., in the purification of the recombinant polymerase.

    [0074] The variant of the invention may further comprise a substitution of residues between positions C378 to L406, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO1, or functionally equivalent residues, by residues H363 to C390 of the Pol polymerase of sequence SEQ ID NO:3, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO:3 or functionally equivalent residues.

    [0075] Advantageously, the variant of TdT comprises at least the amino acid sequence SEQ ID NO:2, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35, with the disclosed substitution(s) and percent sequence identity values.

    Nucleic Acids, Expression Cassette, Vector

    [0076] It is also the purpose of the invention to provide a nucleic acid molecule encoding a variant of the invention. As used herein, the term nucleic acid, nucleic sequence, polynucleotide, oligonucleotide and nucleotide sequence are used interchangeably and refer to a sequence of deoxyribonucleotides and/or ribonucleotides. In one embodiment, the nucleic acid is a DNA. In an alternative embodiment, the nucleic acid is RNA. In an alternative embodiment, the nucleic acid is XNA.

    [0077] The nucleic acids can be in single stranded form or in duplex form or a mixture of the two. It can be of recombinant, artificial and/or synthetic origin and it can comprise modified nucleotides. Such modifications could be natural modifications such as epigenetic modifications, or unnatural modification such as labels, modified bond, a modified purine or pyrimidine base, or a modified sugar. In one embodiment, nucleic acid molecules are DNA, RNA or XNA bearing naturally occurring epigenetic modifications such as methylation, hydfroxymethylation, formylation or 5-carboxylation. In one embodiment, nucleic acid molecules are DNA, RNA or XNA bearing unnaturally occurring modifications such as fluorescent tag, fluorescent label, interaction groups.

    [0078] The nucleic acids of the invention can be in isolated or purified form, and made, isolated and/or manipulated by techniques known per se in the art, e.g., cloning and expression of cDNA libraries, amplification, enzymatic synthesis or recombinant technology. The nucleic acids can also be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Belousov (1997) Nucleic Acids Res. 25:3440-3444.

    [0079] The invention also encompasses nucleic acids which hybridize, under stringent conditions, to a nucleic acid encoding a TdT variant as defined above. Such stringent conditions include incubations of hybridization filters at about 42 C. for about 2.5 hours in 2SSC/0.1% SDS, followed by washing of the filters four times of 15 minutes in 1SSC/0.1% SDS at 65 C. Protocols used are described in such reference as Sambrook et al. (Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor N.Y. (1988)) and Ausubel (Current Protocols in Molecular Biology (1989)).

    [0080] The invention also encompasses nucleic acids encoding a TdT variant of the invention, wherein the sequence of said nucleic acids, or a portion of said sequence at least, has been engineered using optimized codon usage.

    [0081] Alternatively, the nucleic acids according to the invention may be deduced from the sequence of the TdT variant according to the invention and codon usage may be adapted according to the host cell in which the nucleic acids shall be transcribed. These steps may be carried out according to methods well known to one skilled in the art and some of which are described in the reference manual Sambrook et al. (Sambrook et al., 2001).

    [0082] In one embodiment, nucleic acid molecules are polymeric molecules having length of more than 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1 000, 2 000, 3 000, 4 000, 5 000, 6 000, 7 000, 8 000, 9 000, 10 000, 15 000, 20 000, 30 000, 40 000, 50 000 or 100 000 nucleotides.

    [0083] Nucleic acids of the invention may further comprise additional nucleotide sequences, such as regulatory regions, i.e., promoters, enhancers, silencers, terminators, signal peptides and the like that can be used to cause or regulate expression of the polypeptide in a selected host cell or system.

    [0084] The present invention further relates to an expression cassette comprising a nucleic acid according to the invention operably linked to one or more control sequences that direct the expression of said nucleic acid in a suitable host cell. Typically, the expression cassette comprises, or consists of, a nucleic acid according to the invention operably linked to a control sequence such as transcriptional promoter and/or transcription terminator. The control sequence may include a promoter that is recognized by a host cell or an in vitro expression system for expression of a nucleic acid encoding a TdT variant of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the enzyme. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator is operably linked to the 3-terminus of the nucleic acid encoding the esterase. Any terminator that is functional in the host cell may be used in the present invention. Typically, the expression cassette comprises, or consists of, a nucleic acid according to the invention operably linked to a transcriptional promoter and a transcription terminator.

    [0085] The invention also relates to a vector comprising a nucleic acid or an expression cassette as defined above.

    [0086] The term vector refers to DNA molecule used as a vehicle to transfer recombinant genetic material into a host cell. The major types of vectors are plasmids, bacteriophages, viruses, cosmids, and artificial chromosomes. The vector itself is generally a DNA sequence that consists of an insert (a heterologous nucleic acid sequence, transgene) and a larger sequence that serves as the backbone of the vector. The purpose of a vector which transfers genetic information to the host is typically to isolate, multiply, or express the insert in the target cell. Vectors called expression vectors (expression constructs) are specifically adapted for the expression of the heterologous sequences in the target cell, and generally have a promoter sequence that drives expression of the heterologous sequences encoding a polypeptide. Generally, the regulatory elements that are present in an expression vector include a transcriptional promoter, a ribosome binding site, a terminator, and optionally present operator. An expression vector can also contain an origin of replication for autonomous replication in a host cell, a selectable marker, a limited number of useful restriction enzyme sites, and a potential for high copy number. Examples of expression vectors are cloning vectors, modified cloning vectors, specifically designed plasmids and viruses. Expression vectors providing suitable levels of polypeptide expression in different hosts are well known in the art. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.

    [0087] It is another object of the invention to provide a host cell comprising a nucleic acid, an expression cassette or a vector as described above. The present invention thus relates to the use of a nucleic acid, expression cassette or vector according to the invention to transform, transfect or transduce a host cell. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which it must be introduced.

    [0088] According to the invention, the host cell may be transformed, transfected or transduced in a transient or stable manner. The expression cassette or vector of the invention is introduced into a host cell so that the cassette or vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector. The term host cell also encompasses any progeny of a parent host cell that is not identical to the parent host cell due to mutations that occur during replication. The host cell may be any cell useful in the production of a variant of the present invention, e.g., a prokaryote or a eukaryote. The prokaryotic host cell may be any Gram-positive or Gram-negative bacterium. The host cell may also be an eukaryotic cell, such as a yeast, fungal, mammalian, insect or plant cell.

    [0089] The nucleic acid, expression cassette or expression vector according to the invention may be introduced into the host cell by any method known by the skilled person, such as electroporation, conjugation, transduction, competent cell transformation, protoplast transformation, protoplast fusion, biolistic gene gun transformation, PEG-mediated transformation, lipid-assisted transformation or transfection, chemically mediated transfection, lithium acetate-mediated transformation, liposome-mediated transformation,

    [0090] Optionally, more than one copy of a nucleic acid, cassette or vector of the present invention may be inserted into a host cell to increase production of the variant.

    Modified Nucleotides

    [0091] According to the invention, the variants of TdT are able to incorporate modified nucleotides, such as modified 3O-nucleotides, including 3O-blocked nucleotides.

    [0092] In the context of the invention, the expression Modified Nucleotide refers to a molecule containing a nucleoside (i.e. a base attached to a deoxyribose or ribose sugar molecule) bound to three phosphate groups which has at least one additional group on one of its extremity: 2, 3, 5 or base. Said additional group blocks further addition of nucleotides by preventing the formation of any phosphodiester bond (3O-modification, 2 or 2O modifications) or by sterically preventing the polymerase to attach to any nucleic acid fragments that comprises on its 3 extremity such modified nucleotide (5 or base modification). Furtherly, said additional group has advantagesoulsy a reversible nature allowing that group to be removed through a specific cleaving reaction.

    [0093] Nucleosides or nucleotide triphosphates include deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP) or deoxythymidine triphosphate (dTTP) for examples of nucleotide containing deoxyribose. Adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP) or uridine triphosphate (UTP) are further examples of nucleotide triphosphates containing ribose. Other types of nucleosides may be bound to three phosphates to form nucleotide triphosphates, such as naturally occurring modified nucleosides and artificial nucleosides.

    [0094] In a particular embodiment, the modified nucleotide is a 3O-blocked nucleotide, which comprises a group reversibly attached to the 3 end of the nucleotide triphosphate to prevent further nucleotide addition. Said group could have diverse chemical natures, such as azidomethyl, aminoxy, and allyl.

    [0095] Advantageously, the modified nucleotide is selected from a 3-ONH.sub.2-nucleoside triphosphate, a 3-O-azidomethyl-nucleoside triphosphate, a 3-O-allyl-nucleoside triphosphate, a 3O-(2-nitrobenzyl)-nucleoside triphosphate, or a 3-O-propargyl-nucleoside triphosphate.

    [0096] In some embodiments, the modified nucleotides comprise a modified nucleotide or nucleoside molecule comprising a purine or pyrimidine base and a ribose or deoxyribose sugar moiety having a removable 3-OH blocking group covalently attached thereto, such that the 3 carbon atom has attached a group of the structure:


    OZ

    wherein Z is any of C(R)2-0-R, C(R)2-N(R)2, C(R)2-N(H)R, C(R)2-SR and C(R)2-F, wherein each R is or is part of a removable protecting group; each R is independently a hydrogen atom, an alkyl, substituted alkyl, arylalkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclic, acyl, cyano, alkoxy, aryloxy, heteroaryloxy or amido group, or a detectable label attached through a linking group; with the proviso that in some embodiments such substituents have up to 10 carbon atoms and/or up to 5 oxygen or nitrogen heteroatoms; or (R)2 represents an alkylidene group of formula C(R)2 wherein each R may be the same or different and is selected from the group comprising hydrogen and halogen atoms and alkyl groups, with the proviso that in some embodiments the alkyl of each R has from 1 to 3 carbon atoms; and wherein the molecule may be reacted to yield an intermediate in which each R is exchanged for H or, where Z is (R)2-F, the F is exchanged for OH, SH or NH2, preferably OH, which intermediate dissociates under aqueous conditions to afford a molecule with a free 3-OH; with the proviso that where Z is C(R)2-SR, both R groups are not H. In certain embodiments, R of the modified nucleotide or nucleoside is an alkyl or substituted alkyl, with the proviso that such alkyl or substituted alkyl has from 1 to 10 carbon atoms and from 0 to 4 oxygen or nitrogen heteroatoms. In certain embodiments, Z of the modified nucleotide or nucleoside is of formula C(R).sub.2N3. In certain embodiments, Z is an azidomethyl group.

    [0097] In some embodiments, Z is a cleavable organic moiety with or without heteroatoms having a molecular weight of 200 or less. In other embodiments, Z is a cleavable organic moiety with or without heteroatoms having a molecular weight of 100 or less. In other embodiments, Z is a cleavable organic moiety with or without heteroatoms having a molecular weight of 50 or less.

    [0098] In a further particular embodiment, 3O modified nucleotide refers to nucleotide triphosphate bearing at the 3 extremity either a 3-O-methyl, 3-azido, 3-O-azidomethyl, 3-O-amino, 3-aminoxy or 3-O-allyl group. In a further embodiment, the 3-blocked nucleotide triphosphate is blocked by either a 3-O-azidomethyl, 3-aminoxy or 3-O-allyl group. In other embodiments, 3O modified nucleotide refers to nucleotide triphosphate bearing at the 3 extremity either esters, ethers, carbonitriles, phosphates, carbonates, carbamates, hydroxylamine, borates, nitrates, sugars, phosphoramide, phosphoramidates, phenylsulfenates, sulfates, sulfones or amino acids. In some embodiments, the foregoing 3-O-blocking groups have a molecule weight of 100 or less.

    [0099] In another embodiments, 3-O-blocking groups of the invention include methyl, 3-O-(2-nitrobenzyl), allyl, amine, azidomethyl, tert-butoxy ethoxy, or propargyl.

    [0100] In further particular embodiment, 3O modified nucleotide refers to a nucleotide triphosphate having a terminator effector modifying group such as those described in WO2016034807.

    [0101] Interestingly, the variants of the invention exhibit an increased affinity for modified nucleotides, as compared to wild type TdT, and thereby an increased ability to incorporate such modified nucleotide in a nucleic acid sequence during nucleic acid synthesis. More particularly, the variants of the invention are able to use and incorporate modified 3O-nucleotides (and more particularly, 3O-blocked nucleotide) in nucleic acid sequence, which is not possible with wild type TdT (see Knapp et al. Chem. Eur. J., 2011, 17:2903).

    [0102] According to a particular aspect, the invention relates to variants of TdT able to work with modified nucleotides in a nucleic acids enzymatic synthesis process, particularly with 3O-modified nucleotides (e.g., 3O-blocked nucleotide), and having the ability to produce long length nucleic acid molecules or derivative of nucleic acid molecules.

    Enzymatic Synthesis of Nucleic Acid

    [0103] It is the purpose of the present invention to provide variants of TdT that may be used for the synthesis of nucleic acid, such as described in Ybert et al, WO2015/159023; Jensen et al, Biochemistry, 57: 1821-1832 (2018); Hiatt et al, U.S. Pat. No. 5,808,045. More particularly, it is the purpose of the present invention to provide variants of TdT suitable to add modified nucleotides to an initiating nucleic acid strand. The blocking group may be then removed for allowing a new addition of modified nucleotide.

    [0104] According to the invention, by use of a variant of the invention, it is possible to implement successive cycles comprising additions and deprotections. This process will therefore allow by multiple cycles of addition of a reversible modified nucleotide and further removal of the blocking group to allow the controlled extension of an initiating nucleic acid strand into a defined sequence.

    [0105] The present invention contemplates the use of modified TdT according to the present invention in any enzymatic nucleic acid synthesis process.

    [0106] It is thus an object of the present invention to provide a method of synthesizing a polynucleotide having a predetermined sequence, comprising the steps of: [0107] a) providing an initiator having a 3-terminal nucleotide having a free 3-hydroxyl; [0108] b) repeating cycles of (i) contacting under elongation conditions the initiator or elongated fragments having free 3-O-hydroxyls with a 3-O-blocked nucleoside triphosphate and a TdT variant of the present invention, so that the initiator or elongated fragments are elongated by incorporation of a 3-O-blocked nucleoside triphosphate to form 3-O-blocked elongated fragments, and (ii) deblocking the elongated fragments to form elongated fragments having free 3-hydroxyls, until the polynucleotide is formed.

    [0109] It is also the purpose of the present invention to provide a process for synthesizing a nucleic acid molecule without template, comprising a step of contacting a nucleic acid primer with both at least one nucleotide, such as at least one 3O-modified nucleotide, and a variant of the invention.

    [0110] The present invention contemplates the concept of enzymatic nucleic acids synthesis process. In such process, nucleic acids molecules are de novo synthesized in absence of any template strand. Accordingly, ordered sequence of nucleotides are coupled to an initiator nucleic acid fragment with the help of the variant of the invention. It will be understood that quantitative coupling and more generally high coupling efficiency of each nucleotide to the growing nucleic acid chain is of great importance. It will also be understood that non-terminator nucleotides, such as natural nucleotides or permanent labeled nucleotides, will not permit any control over the sequence synthesized and will result, for example, in uncontrolled and undesired poly-additions.

    [0111] In some embodiments, the method of synthesizing a polynucleotide comprises the steps of (a) providing an initiator having a free 3-hydroxyl; (b) reacting under extension conditions the initiator or an extension intermediate having a free 3-hydroxyl with a variant TdT of the invention in the presence of a 3-O-blocked nucleoside triphosphate to produce a 3-O-blocked extension intermediate; (c) deblocking the extension intermediate to produce an extension intermediate with a free 3-hydroxyl; and (d) repeating steps (b) and (c) until the polynucleotide is synthesized.

    [0112] In some embodiments, the method of synthesizing a polynucleotide comprises the steps of (a) providing an initiator attached to a solid support, the iniator being an oligonucleotide having a free 3-hydroxyl; (b) reacting under extension conditions the initiator or an extension intermediate having a free 3-hydroxyl with a variant TdT of the invention in the presence of a 3-O-blocked nucleoside triphosphate to produce a 3-O-blocked extension intermediate; (c) washing the solid support to remove unincorporated 3-O-blocked nucleoside triphosphate; (d) deblocking the extension intermediate by exposing the solid support to a deblocking agent to produce an extension intermediate having a free 3-hydroxyl; and (e) repeating steps (b) and (d) until the polynucleotide is synthesized. The method may include a further step of cleaving the completed polynucleotide from the solid support.

    [0113] In some embodiments, for TdT catalyzed addition reactions, the enzymatic conditions may contain from about 0.20 and about 200 M of the nucleotide having the removable blocking moiety protecting the 3-hydroxyl and from about 0.20 to 200 M of free and unmodified 3-hydroxyls derived from the initiating substrate. In some embodiments, the reaction buffer contains from about 10 to about 500 mM potassium cacodylate buffer (pH between 6.5 and 7.5). and from about 0.01 to about 10 mM of a divalent cation (e.g. CoCl.sub.2 or MnCl.sub.2). Other buffer compositions and components may be suitable for particular desired embodiment of the present invention.

    [0114] In the context of the invention, the expression cleaving reaction refers to any action of substance or physical conditions, which is able to cleave the additional group previously described on reversible modified nucleotides. A person skilled in the art is able to determine a cleaving reaction for any previously listed group.

    [0115] In one embodiment, the cleaving agent is a chemical cleaving agent. In an alternative embodiment, the cleaving agent is an enzymatic cleaving agent.

    [0116] It will be understood by the person skilled in the art that the selection of cleaving agent is dependent on the type of 3-nucleotide blocking group used. For example, tris(2-carboxyethyl)phosphine (TCEP) can be used to cleave a 3O-azidomethyl groups, palladium complexes can be used to cleave a 3O-allyl groups, or sodium nitrite can be used to cleave a 3-O-amino group. In particular embodiment, the cleaving reaction is involving: TCEP, a palladium complex or sodium nitrite.

    [0117] In particular embodimentd, the cleaving reaction is performed in the presence of additional components such as denaturant (urea, guanidinium chloride, formamide or betaine for example). In a further embodiment, the cleavage reaction is performed with one or more buffers. It will be understood by the person skilled in the art that the choice of buffer is dependent on the exact mechanism of reaction.

    [0118] The present invention relates to variants of TdT with the capacity to incorporate, in a quantitative way, modified nucleotides. By quantitative way or quantitative reaction, it is meant a reaction that goes to completion, i.e. in which reactants are totally converted into the product. Polymerase that incorporates in a quantitative way reversible modified nucleotide is a polymerase able to elongate every fragment of nucleic acid with all the nucleotides available leading to the conversion of all the initiating fragments of length n, to fragments of length n+1.

    [0119] As used herein, initiating fragment refers to a short oligonucleotide sequence with a free 3-end, which can be further elongated. In one embodiment, the initiating fragment is a DNA initiating fragment. In an alternative embodiment, the initiating fragment is an RNA initiating fragment.

    [0120] In one embodiment, the initiating fragment possesses between 3 and 100 nucleotides, in particular between 3 and 20 nucleotides.

    [0121] In one embodiment, the initiating fragment is single-stranded. In an alternative embodiment, the initiating fragment is double-stranded.

    [0122] In one embodiment, the initiating fragment is immobilized on a solid support. The initiating fragment may be attached with various method to a solid support resulting in a stable under the various enzymatic or synthesis reaction conditions that the fragment will undergo.

    [0123] In one embodiment, the initiating fragment is immobilized on a solid support via a reversible interacting moiety, such as a chemically-cleavable linker, an antibody/immunogenic epitope, a biotin/biotin-binding protein or glutathione-GST tag. In a further embodiment, the initiating fragment is immobilized on a solid support via a chemically-cleavable linker, such as a disulfide, allyl, or azide-masked hemiaminal ether linker.

    [0124] In an initiating fragment, the immobilized part contains at least one restriction site. The use of restriction enzymes and restriction sites to selectively hydrolyze nucleic acids chain at a specific site is describe in the literature. Any skilled person will be able to choose the appropriate restriction enzyme that will match the initiating fragment cleaving site sequence.

    [0125] In an alternative embodiment, the initiating fragment contains at least one uridine. Treatment with uracil-DNA glycosylase (UDG) generates an abasic site. Treatment on an appropriate substrate with an apurinic/apyrimidinic (AP) site endonuclease will extract the nucleic acid strand.

    Applications

    [0126] Described herein is the use of variants of TdT to be used for nucleic acid synthesis, oligonucleotide synthesis, probe synthesis, tagging, nucleic acid amplification, aptamers, therapeutic nucleic acid molecules, drug target discovery and validation, disease diagnosis, metabolic engineering, data storage, crops improvement, library design, sequencing pools, nucleic acid labeling or attachment or any other application that is involving nucleic acid molecules.

    Production of Variant TdTs

    [0127] Variants of the invention may be produced by mutating known reference or wild type TdT-coding polynucleotides, then expressing it using conventional molecular biology techniques. For example, the mouse TdT gene (SEQ ID NO:1) may be assembled from synthetic fragments using conventional molecular biology techniques, e.g. using protocols described by Stemmer et al, Gene, 164: 49-53 (1995); Kodumal et al, Proc. Natl. Acad. Sci., 101: 15573-15578 (2004); or the like, or it may be directly cloned from mouse cells using protocols described by Boule et al, Mol. Biotechnology, 10: 199-208 (1998), or Bentolila et al, EMBO J., 14: 4221-4229 (1995); or the like.

    [0128] For example, an isolated TdT gene may be inserted into an expression vector, such as pET32 (Novagen) to give a vector pCTdT which then may be used to make and express variant TdT proteins using conventional protocols. Vectors with the correct sequence may be transformed in E. coli producer strains.

    [0129] Transformed strains are cultured using conventional techniques to pellets from which TdT protein is extracted. For example, previously prepared pellets are thawed in 30 to 37 C. water bath. Once fully thawed, pellets are resuspended in lysis buffer composed of 50 mM tris-HCL (Sigma) pH 7.5, 150 mM NaCl (Sigma), 0.5 mM mercaptoethanol (Sigma), 5% glycerol (Sigma), 20 mM imidazole (Sigma) and 1 tab for 100 mL of protease cocktail inhibitor (Thermofisher). Careful resuspension is carried out in order to avoid premature lysis and remaining of aggregates. Resuspended cells are lysed through several cycles of French press, until full color homogeneity is obtained. Usual pressure used is 14,000 psi. Lysate is then centrifuged for 1 h to 1 h30 at 10,000 rpm. Centrifugate is pass through a 0.2 m filter to remove any debris before column purification.

    [0130] TdT protein may be purified from the centrifugate in a one-step affinity procedure. For example, Ni-NTA affinity column (GE Healthcare) is used to bind the polymerases. Initially the column has been washed and equilibrated with 15 column volumes of 50 mM tris-HCL (Sigma) pH 7.5, 150 mM NaCl (Sigma) and 20 mM imidazole (Sigma). Polymerases are bound to the column after equilibration. Then a washing buffer, composed of 50 mM tris-HCL (Sigma) pH 7.5, 500 mM NaCl (Sigma) and 20 mM imidazole (Sigma), is applied to the column for 15 column volumes. After wash the polymerases are eluted with 50 mM tris-HCL (Sigma) pH 7.5, 500 mM NaCl (Sigma) and 0.5M imidazole (Sigma). Fractions corresponding to the highest concentration of polymerases of interest are collected and pooled in a single sample. The pooled fractions are dialyzed against the dialysis buffer (20 mM Tris-HCl, pH 6.8, 200 mM Na Cl, 50 mM MgOAc, 100 mM [NH4]2SO4). The dialysate is subsequently concentrated with the help of concentration filters (Amicon Ultra-30, Merk Millipore). Concentrated enzyme is distributed in small aliquots, 50% glycerol final is added, and those aliquots are then frozen at 20 C. and stored for long term. 5 L of various fraction of the purified enzymes are analyzed in SDSPAGE gels.

    Kits, Enzyme and Nucleotide Composition

    [0131] A particular aspect of the invention is relative to the composition and the use of kits comprising a variant of TdT according to the invention, or to any particular aspect of the present invention, with optionally any combination of one or more components selected from: an initiating fragment, one or more reversible terminator nucleotides, additional enzyme and reagents used in a cleaving reaction. Said kits can be used in a method of enzymatic nucleic acid synthesis.

    [0132] The present invention covers the composition of matter comprising variants of TdT according to the invention, or to any particular aspect of the present invention, with reversible modified nucleotide in a mix with appropriate buffer and ratio concentration.

    EXAMPLES

    Example 1Generation, Expression and Purification of Variants of TdT According to the Invention

    Expression Strain Generation

    [0133] The TdT mouse gene has been generated from the pET28 plasmid described in [Boul et al., 1998, Mol. Biotechnol. 10, 199-208]. Sequence SEQ ID No 4 (Tag TdT) has been amplified by using the following primers: [0134] T7-pro: TAATACGACTCACTATAGGG (SEQ ID NO:5) [0135] T7-ter: GCTAGTTATTGCTCAGCGG (SEQ ID NO:6)
    through standard molecular biology techniques. The sequence is then cloned into plasmid pET32 backbone to give the new pCTdT plasmid.

    [0136] After sequencing pCTdT is transformed into commercial E. coli cells, BL21 (DE3, from Novagen). Growing colonies on plate with kanamycin are isolated and named Ec-CTdT.

    Polymerase Variants Generation

    [0137] The pCTdT vector is used as starting vector. Specific primers comprising one or several point mutations have been generated from Agilent online software (http://www.genomics.agilent.com:80/primerDesignProgram.jsp). The commercially available kit QuickChange II (Agilent) has been used to generate the desired modified polymerase comprising the targeted mutations. Experimental procedure has followed the supplier's protocol. After generation of the different vectors, each of them have been sequenced. Vectors with the correct sequence have been transformed in E. coli producer strains, as described before. Clones able to grow on kanamycin LB-agar plates are isolated.

    Expression

    [0138] The Ec-CTdT and Ec-DSi or Ec-DSi strains have been used for inoculating 250 mL erlens with 50 mL of LB media supplemented with appropriate amount of kanamycin. After overnight growth at 37 C., appropriate volumes of these pre-cultures have been used to inoculate 5 L erlens with 2 L LB media with kanamycin. The initial OD for the 5 L cultures is chosen to be 0.01. The erlens are put at 37 C. under strong agitation and the OD of the different cultures are regularly checked. After reaching an OD comprised between 0.6 and 0.9 each erlen is supplemented by the addition of 1 mL of 1M IPTG (Isopropyl -D-1-thiogalactopyranoside, Sigma). The erlens are put back to agitation under a controlled temperature of 37 C. After overnight expression, the cells are harvested in several pellets. Pellets expressing the same variants are pooled and stored at 20 C., eventually for several months.

    Extraction

    [0139] Previously prepared pellets are thawed in 30 to 37 C. water bath. Once fully thawed, pellets are resuspended in lysis buffer composed of 50 mM tris-HCL (Sigma) pH 7.5, 150 mM NaCl (Sigma), 0.5 mM mercaptoethanol (Sigma), 5% glycerol (Sigma), 20 mM imidazole (Sigma) and 1 tab for 100 mL of protease cocktail inhibitor (Thermofisher). Careful resuspension is carried out in order to avoid premature lysis and remaining of aggregates. Resuspended cells are lysed through several cycles of French press, until full color homogeneity is obtained. Usual pressure used is 14,000 psi. Lysate is then centrifuged for 1 h to 1 h30 at 10,000 rpm. Centrifugate is pass through a 0.2 m filter to remove any debris before column purification.

    Purification

    [0140] A one-step affinity procedure is used to purify the produced and extracted polymerase enzymes. A Ni-NTA affinity column (GE Healthcare) is used to bind the polymerases. Initially the column has been washed and equilibrated with 15 column volumes of 50 mM tris-HCL (Sigma) pH 7.5, 150 mM NaCl (Sigma) and 20 mM imidazole (Sigma). Polymerases are bound to the column after equilibration. Then a washing buffer, composed of 50 mM tris-HCL (Sigma) pH 7.5, 500 mM NaCl (Sigma) and 20 mM imidazole (Sigma), is applied to the column for 15 column volumes. After wash the polymerases are eluted with 50 mM tris-HCL (Sigma) pH 7.5, 500 mM NaCl (Sigma) and 0.5M imidazole (Sigma). Fractions corresponding to the highest concentration of polymerases of interest are collected and pooled in a single sample. The pooled fractions are dialyzed against the dialysis buffer (20 mM Tris-HCl, pH 6.8, 200 mM Na Cl, 50 mM MgOAc, 100 mM [NH.sub.4].sub.2SO.sub.4). The dialysate is subsequently concentrated with the help of concentration filters (Amicon Ultra-30, Merk Millipore). Concentrated enzyme is distributed in small aliquots, 50% glycerol final is added, and those aliquots are then frozen at 20 C. and stored for long term. 5 L of various fraction of the purified enzymes are analyzed in SDS-PAGE gels.

    [0141] Results are presented by FIG. 1. The gel shows, for each TdT (both variants and wild-type), the column flowthrough (FT) and the different fractions F1 to F4, corresponding to the elution peaks. A molecular weight marker (M) was also loaded in the gel. FIG. 1 shows that the variants of TdT according to the invention present a high purity level (about 90%) and a good expression as compared to TdT wild-type (see columns F2 and/or F3).

    Example 2Evaluation of the Activity of Variants of TdT with Fluorescent Primers Activity Test

    [0142] Elongation performance of TdT variants of SEQ ID NO: 2: DS11 (M63R+L131P+C173R+R207L+R325P+E328N) DS29 (M63R+L131P+C173R+R207N+R325P+E328N), DS173 (M63R+C173R+R207L+R325P+E328N), DS659 (L131P+C173R+R207L+R325P+E328N), DS874 (C173G+R207L+R325P+E328L) generated, expressed and purified according to example 1 is evaluated through the following assay. All the results are compared with each other and with the wild type TdT enzyme (SEQ ID No 1) and to a control tube lacking any polymerase enzyme.

    TABLE-US-00018 TABLE 7 Activity test Reagent Concentration Volume H.sub.2O 12 L Activity Buffer 10 2 L dNTP 250 M 2 L Purified enzyme 20 M 2 L Fluorescent primer DNA 500 nM 2 L

    [0143] The Activity buffer comprises, for example, TdT reaction buffer (available from New England Biolabs) supplemented with CoCl.sub.2. Primer used is the following:

    TABLE-US-00019 (SEQIDNO:7) 5-AAAAAAAAAAAAAAGGGG-3

    [0144] The primer has also an ATTO fluorescent dye on the 5 extremity.

    [0145] Nucleotides used (noted as dNTP in table 7) are 3-O-amino-2,3-dideoxynucleotides-5-triphosphate (ONH.sub.2, Firebird Biosciences) such as 3-O-amino-2,3-dideoxyadenosine-5-triphosphate for example.

    [0146] For each different variant tested, one tube is used for the reaction. The reagents are added in the tube, starting from water, and then in the order of Table 7. After 30 min at 37 C. the reaction is stopped by addition of formamide (Sigma).

    Analysis

    [0147] The analysis is involving polyacrylamide gel analysis. Samples from activity test are analyzed through polyacrylamide 16% (biorad) denaturing gel. Gels are made just before the analysis by pouring polyacrylamide inside glass plates and let it polymerize. The gel inside the glass plates is mounted on an adapted tank filed with TBE buffer (Sigma) for the electrophoresis step. The samples to be analyzed are loaded on the top of the gel. A tension of 500 to 2,000V is applied between the top and bottom of the gel for 3 to 6 h at room temperature. Once migrated according to the sample target size, system is dismounted, and gel fluorescence is scanned through the use of Typhoon instrument (GE Life Sciences). After image acquisition, ImageJ software (imagej.nih.gov/ij/) is used to analyze the percentage of incorporation of the modified nucleotides.

    [0148] Results are showed on FIG. 2. For each variant, on the x-axis, the extension percentage has been evaluated as the quantity of expected elongated product over the total quantity of DNA loaded on the gel. Each experiment has been performed in triplicates. The bar hight, y-axis, corresponds to the mean value of those three exepriments. All the variants according to the invention show more than a 10-fold increase of activity compared to the wt enzyme, confirming the possibility of developing a nucleic acid synthesis technology with these variants.

    Example 3Evaluation of the Activity of Variants of TdT with Unlabeled Primer Activity Test

    [0149] Elongation performance of variants of SEQ ID NO: 2: DS928 (R207L+R325P+E328L) and DS950 (R207N+R325A+E328N) generated, expressed and purified according to example 1 was evaluated through the following assay. All the results are compared with a reference variant (SEQ ID No 9) obtained from previous research and to a control tube lacking any polymerase enzyme.

    TABLE-US-00020 TABLE 8 Activity test Reagent Concentration Volume H.sub.2O 12 L Activity Buffer 10 2 L dNTP 250 M 2 L Purified enzyme 20 M 2 L Fluorescent primer DNA 500 nM 2 L
    Primer used is the following:

    TABLE-US-00021 (SEQIDNO:8) 5-TTTTTTTTTTTTAAATAAGG-3

    [0150] Nucleotides used (noted as dNTP in table 8) were 3-O-amino-2,3-dideoxynucleotides-5-triphosphate (ONH2, Firebird Biosciences) such as 3-O-amino-2,3-dideoxyadenosine-5-triphosphate for example.

    [0151] For each variant tested one tube was used for the reaction. The reagents were added in the tube starting from the water and then in the order of Table 8. After 30 min at 37 C. the reaction was stopped by addition of formamide (Sigma).

    Analysis

    [0152] The analysis used liquid chromatography and mass spectrometer detection and quantification (LC/MS). Samples from activity test were analyzed through LC/MS. Samples were loaded into the LC/MS instrument and a standard oligonucleotide separation method was performed. Acquisition of data was followed by deconvolution and spectrum calculation.

    [0153] Results are showed on FIG. 3. The spectrums correspond to the extension analysis of variants DS928, DS950 and references respectively. Initial primer mass is around 6114 and the expected extended product mass is around 6447 (emphasized by the arrows). The intensity of the signal (i.e., the hight of the peaks) may be directly correlated to the quantity of material. Both variants DS928, DS950 show significant improvement in the elongation of the starting primer as compared to the reference variant. These results confirm that the new variants according to the invention bring indisputable improvement over the TdT of the prior art.