SYNCITIN-1 FUSION PROTEINS AND USES THEREOF FOR CARGO DELIVERY INTO TARGET CELLS

Abstract

The inventors developed a new system to modify tropism of syncytins, envelope proteins, which can be used to functionalize particles such as virus particle or more particularly viral-like particles (VLPs), and used for gene transfer or other applications. In particular, they created a fusion protein containing the Syncytin-1 (SYN) signal sequence (SS), a targeting moiety (either natural or engineered), the SYN protein and a flexible linker between SYN and the targeting moiety to enhance transduction of the cell type expressing the receptor or the antigen targeted by the targeting moiety, for instance hematopoietic stem progenitor cells (HSPCs). The inventors demonstrated that the fusion strategy allows modification of syncytin tropism towards different receptors in order to target f the desired cell type. The system is adaptable to other desired antigens to retarget the fusion protein to a specific cell type.

Claims

1. A fusion protein wherein a syncytin-1 polypeptide is fused to one or more targeting-moieties, wherein the syncytin-1 polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:2 (SDGGGXXDXXR) and is capable of binding to ASCT1 receptor and/or to ASCT2 receptor.

2. The fusion protein of claim 1 wherein the syncytin-1 polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:3 (SDGGGVQDQAR).

3. The fusion protein of claim 2 wherein the syncytin-1 polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:3 (SDGGGVQDQAR) and further comprises at least 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, or 450 consecutive amino acids of SEQ ID NO:1.

4. The fusion protein of claim 2 wherein the syncintin-1 polypeptide comprises an amino acid sequence having at 70% identity with the amino acid sequence that ranges from the amino acid residue at position 21 to the amino acid residue at position 480 in SEQ ID NO:1, or a variant thereof wherein the arginine residue (R) at position 393 is substituted by a glutamine residue (Q) and the phenylalanine residue (F) are position 399 is substituted by an alanine residue (A).

5. (canceled)

6. The fusion protein according to claim 1, wherein the one or more targeting-moieties is selected from the group consisting of ligands, antibodies, antibody fragments; non-antibody-based recognition scaffolds; anticalins; designed ankyrin repeat domains (DARPins); binding sites of a cysteine-rich polypeptide avimers; and afflins, and is suitable for targeting a population of cells selected from the group consisting of immune cells, hematopoietic cells, and malignant cells.

7. (canceled)

8. The fusion protein according to claim 1, wherein the one or more targeting-moieties has binding affinity for a CD (cluster of differentiation) molecule selected from the group consisting of CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3delta, CD3epsilon, CD3gamma, CD4, CD5, CD6, CD7, CD8alpha, CD8beta, CD9, CD10, CD11a, CD11b, CD11c, CDw12, CD13, CD14, CD15u, CD16a, CD16b, CDw17, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42a, CD42b, CD42c, CD42d, CD43, CD44, CD44R, CD45, CD46, CD47R, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CD60a, CD60b, CD60c, CD61, CD62E, CD62L, CD62P, CD63, CD64, CD65, CD65s, CD66a, CD66b, CD66c, CD66d, CD66e, CD66f, CD68, CD69, CD70, CD71, CD72, CD73, CD74, CD75, CD75s, CD77, CD79a, CD79b, CD80, CD81, CD82, CD83, CD84, CD85, CD86, CD87, CD88, CD89, CD90, CD91, CD92, CDw93, CD94, CD95, CD96, CD97, CD98, CD99, CD100, CD101, CD102, CD103, CD104, CD105, CD106, CD107a, CD107b, CD108, CD109, CD110, CD111, CD112, CDw113, CD114, CD115, CD116, CD117, CD118, CDw119, CD120a, CD120b, CD121a, CDw121b, CD122, CD123, CD124, CDw125, CD126, CD127, CDw128a, CDw128b, CD129, CD130, CD131, CD132, CD133, CD134, CD135, CDw136, CDw137, CD138, CD139, CD140a, CD140b, CD141, CD142, CD143, CD144, CDw145, CD146, CD147, CD148, CDw149, CD150, CD151, CD152, CD153, CD154, CD155, CD156a, CD156b, CDw156C, CD157, CD158, CD159a, CD159c, CD160, CD161, CD162, CD162R, CD163, CD164, CD165, CD166, CD167a, CD168, CD169, CD170, CD171, CD172a, CD172b, CD172g, CD173, CD174, CD175, CD175s, CD176, CD177, CD178, CD179a, CD179b, CD180, CD181, CD182, CD183, CD184, CD185, CDw186, CD191, CD192, CD193, CD195, CD196, CD197, CDw198, CDw199, CDw197, CD200, CD201, CD202b, CD203c, CD204, CD205, CD206, CD207, CD208, CD209, CDw210, CD212, CD213a1, CD213a2, CDw217, CDw218a, CDw218b, CD220, CD221, CD222, CD223, CD224, CD225, CD226, CD227, CD228, CD229, CD230, CD231, CD232, CD233, CD234, CD235a, CD235b, CD235ab, CD236, CD236R, CD238, CD239, CD240CE, CD240D, CD240DCE, CD241, CD242, CD243, CD244, CD245, CD246, CD247, CD248, CD249, CD252, CD253, CD254, CD256, CD257, CD258, CD261, CD262, CD263, CD264, CD265, CD266, CD267, CD268, CD269, CD271, CD272, CD273, CD274, CD275, CD276, CD277, CD278, CD279, CD280, CD281, CD282, CD283, CD284, CD289, CD292, CDw293, CD294, CD295, CD296, CD297, CD298, CD299, CD300a, CD300c, CD300e, CD301, CD302, CD303, CD304, CD305, CD306, CD307, CD309, CD312, CD314, CD315, CD316, CD317, CD318, CD319, CD320, CD321, CD322, CD324, CDw325, CD326, CDw327, CDw328, CDw329, CD331, CD332, CD333, CD334, CD335, CD336, CD337, CDw338, and CD339.

9. The fusion protein according to claim 1, wherein the one or more targeting-moieties has biding affinity for a cell surface molecule selected from the group consisting of 2B4/CD244/SLAMF4, ABCG2, Aldehyde Dehydrogenase 1-A1/ALDH1A1, BMI-1, C1qR1/CD93, CD34, CD38, CD44, CD45, CD48/SLAMF2, CD90/Thy1, CD117/c-kit, CD133, CDCP1, CXCR4, Endoglin/CD105, EPCR, Erythropoietin R, ESAM, EVI-1, Integrin alpha 6/CD49f, SLAM/CD150, VCAM-1/CD 106 and VEGFR2/KDR/Flk-1

10. The fusion protein according to claim 1, wherein the one or more targeting-moieties is the Stem Cell Factor (SCF), which binds CD117 (c-kit) receptor comprising an amino acid sequence having at least 70% of identity with the amino acid sequence as set forth in SEQ ID NO:4; a single-chain fragment variant (scFv) directed against CD 133 receptor comprising an amino acid sequence having at least 70% of identity with the amino acid sequence as set forth in SEQ ID NO:5; a DARPin directed against CD4 comprising an amino acid sequence having at least 70% of identity with the amino acid sequence as set forth in SEQ ID NO:6; a single-chain fragment variant (scFv) directed against CD8 comprising an amino acid sequence having at least 70% of identity with the amino acid sequence as set forth in SEQ ID NO:7; a single-chain fragment variant (scFv) directed against IA-2 receptor comprising an amino acid sequence having at least 70% of identity with the amino acid sequence as set forth in SEQ ID NO:8; or GLP1 comprising an amino acid sequence having at least 70% of identity with the amino acid sequence as set forth in SEQ ID NO:9.

11. (canceled)

12. (canceled)

13. (canceled)

14. (canceled)

15. (canceled)

16. (canceled)

17. (canceled)

18. (canceled)

19. (canceled)

20. (canceled)

21. (canceled)

22. The fusion protein according to claim 1, wherein a C-terminal end of the one or more targeting-moieties is fused to an N-terminal end of the sycintin-1 polypeptide.

23. The fusion protein according to claim 1, wherein the syncytin-1 polypeptide and the one or more targeting-moieties are fused to each other directly or via a linker.

24. The fusion protein according to claim 1 that further comprises the sequence of a signal peptide.

25. The fusion protein according to claim 1 comprising the amino acid sequence as set forth in SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:19, SEQ ID NO:20 or SEQ ID NO:21.

26. (canceled)

27. A polynucleotide that encodes for the fusion protein according to claim 1, a vector comprising the polynucleotide or a host cell which has been transfected, infected or transformed by the polynucleotide and/or the vector.

28. (canceled)

29. (canceled)

30. A virus particle functionalized with or a virus-like particle pseudotyped with the fusion protein according to claim 1 and comprising one or more viral protein(s) and one more cargo(s); a cell line for producing the virus particle or the virus-like particle; or a pharmaceutical composition comprising a plurality of the virus particle or the virus-like particle.

31. (canceled)

32. The virus particle or the virus-like particle of claim 30 that comprises a Gag protein.

33. The virus particle or the virus-like particle of claim 30, wherein the one or more viral protein(s) has an amino acid sequence having at least 70% identity with the amino acid sequence a set forth in SEQ ID NO:22 or SEQ ID NO:23.

34. The virus particle or the virus-like particle according to claim 30, wherein the one more cargo(s) is selected from the group consisting of organic molecules, polymers, polypeptides, polynucleotides and small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons.

35. The virus particle or the virus-like particle of claim 34 wherein the one more cargo(s) is a polynucleotide.

36. (canceled)

37. The virus particle or the virus-like particle according to claim 30, wherein the one more cargo(s) is a polypeptide and the one or more viral protein(s) is a viral structural protein, and wherein the polypeptide is fused to the viral structural protein either directly or via a linker.

38. (canceled)

39. A cell line for producing the virus particle or the virus-like particle according to claim 30, comprising i) one or more polynucleotides encoding the structural viral proteins required for forming the said the virus particle, ii) a polynucleotide comprising an amino acid sequence having at least 70% of identity with the amino acid sequence as set forth in SEQ ID NO:7, and iii) one or more polynucleotide encoding for the cargo(s).

40. (canceled)

41. (canceled)

42. (canceled)

Description

FIGURES

[0176] FIG. 1: (A) Design of viral particles pseudotyped with SYN fused to a ligand. To gain specificity for CD117.sup.+ or CD133.sup.+ cells, a scFv antibody fragment against CD133 or the natural ligand of CD117 (stem cell factor (SCF)) were inserted between the signal sequence (SS) and the protein sequence of SYN. We inserted a GGGS flexible linker between the ligand and SYN. (B) CB HSPCs were transfected with lentiviral particles pseudotyped with different ratios of SYN fused to a ligand to WT SYN. Flow cytometry analysis of GFP-expression in CB HSPCs 48 h after transduction. Different ratios were obtaining by transfecting different stoichiometric ratios of a plasmid encoding SYN fused to a ligand (SCF or scFvCD133) to a plasmid expressing WT SYN. A VSV-G pseudotyped virus were used as control. We plotted the fold change compared to SYN WT LV. All LVs expressed GFP under the control of the phosphoglycerate kinase (PGK) promoter.

[0177] FIG. 2: (A) Design of viral particles pseudotyped with short mutant of SYN (SYN480) fused to a ligand. (B) Physical titers of LVs were measured by p24 ELISA and expresses as meanstandard deviation (n=3 for SYN480, scFv-SYN480 and SCF-SYN 480 LVs; n=2 for VSV-G). (C) Sorting strategy of CB HSPCs based on either CD117 or CD133 expression. CB HSPCs with low or high CD133 or CD117 cells were FACS-sorted. (D) Different CB HSPCs populations (CD133.sup.low, CD133.sup.high, CD117.sup.low or CD117.sup.high) were transduced with equal amounts of LVs pseudotyped with VSV-G, SYN480 or SYN480 fused to the ligand. Flow cytometry analysis of GFP-expression in CB HSPCs was performed 48 h after transduction. Quantifications are relative to the results observed in the population transduced with the LV pseudotyped with SYN480.

[0178] FIG. 3: (A) FACS analysis of CD133 and CD117 expression of HEK 293T cells. (B) HEK 293T cells were transduced with different volumes of LV (10, 5 and 1 l) with different pseudotypes, either VSVG, SYN480, scFvCD133-SYN480 or SCF-SYN480. Flow cytometry analysis of GFP expression in HEK 293T cells 48 h after transduction. (C) Quantification of GFP.sup.+ HEK 293T cells after transduction with LV pseudotyped with different envelopes.

[0179] FIG. 4: (A) CD117.sup.lo and CD117.sup.hi cells were transduced with LVs pseudotyped with VSVG, SYN480 or different ratio of SYN480 and SCF-SYN480 (33%, 67% and 100%) produced in HEK 293T cells transfected with different amounts of envelope plasmids (6 g, 12 g and 18 g). Flow cytometry analysis of GFP expression in CB HSPCs was performed 48 h after transduction. (B) Quantifications are relative to the results observed in the population transduced with LV pseudotyped with SYN480. Data are expressed as meanSD (n=3 biologically independent experiments). (C) Vector Copy Number (VCN) was analyzed in transduced cells 13 days after transduction. Data are expressed as meanSD (n=3 biologically independent experiments).

[0180] FIG. 5: (A) Design of viral particles pseudotyped with short mutant of SYN480 fused to a ligand targeting T cells. To gain specificity for CD4.sup.+ or CD8.sup.+ T cells, a DARPin against CD4 or an scFv antibody fragment against CD8 were inserted between the signal sequence (SS) and the protein sequence of SYN. (B) Flow cytometry analysis post-selection to analyze the purity of CD4.sup.+ and CD8.sup.+ T cells, respectively (C) CD4.sup.+ and CD8.sup.+ T cells were transduced with LVs pseudotyped with VSVG, SYN480 or different ratio of SYN480 and SYN480 fused to the proper ligand (33%, 67% and 100%). LVs were produced in HEK 293T cells transfected with different amounts of envelope plasmids (6 g, 12 g and 18 g). Flow cytometry analysis of GFP expression in T cells were performed 7 days after transduction. (D) Frequency of GFP.sup.+ cells observed one week after transduction. Data are expressed as meanSD (n=4 biologically independent experiments). (E) Quantifications are relative to the results observed in the population transduced with LV pseudotyped with SYN480. Data are expressed as meanSD (n=4 biologically independent experiments).

[0181] FIG. 6: (A) Design of viral particles pseudotyped with short mutant of SYN480 fused to a ligand to target IA2+ cells. To gain specificity for IA2+(also known as PTPRN) cells, an scFv antibody fragment against TA2 was inserted between the signal sequence (SS) and the protein sequence of SYN. (B) Flow cytometry analysis assessing IA2 expression in HEK 293T cells and HCT 116 cells. (C) HEK 293T cells and HCT 116 cells were transduced with LV pseudotyped with SYN or 33% of scFv-IA2-SYN480. LVs were produced in HEK 293T cells transfected with different amounts of envelope plasmids (6 g, 12 g and 18 g). Flow cytometry analysis of GFP expression in HEK 293T cells and HCT 116 cells were performed 48 hours after transduction. (D) Quantifications are relative to the results observed in the population transduced with LV pseudotyped with SYN480. Data are expressed as meanSD (n=3 biologically independent experiments). (E) Vector Copy Number (VCN) was analyzed 7 days after transduction. Data are expressed as meanSD (n=3 biologically independent experiments).

[0182] FIG. 7: (A) Design of viral particles pseudotyped with short mutant of SYN480 fused to a ligand to target Glp1R.sup.+ cells. To gain specificity for Glp1R.sup.+ cells, the natural ligand of Glp1R (GLP1) was inserted between the signal sequence (SS) and the protein sequence of SYN. To generate a Glp1R.sup.+ cells, Glp1R was overexpressed by transducing cells with an LV construct containing the Glp1R and the Hygromycin resistance (Hygro) genes. Stably transduced cells were selected using Hygromycin. (B) Flow cytometry analysis assessing Glp1R expression in HEK 293T cells and HCT 116 cells. (C) HEK 293T cells and HEK 293T Glp1R.sup.+ cells were transduced with LVs pseudotyped with SYN480 or 33% GLP1-SYN480. LVs were produced in HEK 293T cells transfected with different amounts of envelope plasmids (6 g, 12 g and 18 g). Flow cytometry analysis of GFP expression in HEK 293T cells and HEK 293T Glp1R.sup.+ cells were performed 48 hours after transduction. Data are expressed as meanSD (n=3 biologically independent experiments). (D) Quantifications are relative to the results observed in the population transduced with LV pseudotyped with SYN480 in HEK 293T Glp1R.sup.+ cells and HEK 293T Glp1R.sup.+ cells and HCT 116 Glp1R.sup.+ cells and HCT 116 Glp1R.sup.+ cells. Data are expressed as meanSD (n=3 biologically independent experiments).

TABLE-US-00012 TABLE 1 Titers of SYN480 and ligand-SYN480 pseudotyped LVs. Physical titers were measured by p24 ELISA. Data are expressed as mean SD (n = 3 independent batches). Vector Type ng p24/mL SYN480 6 ug 2.34E+06 2.25 33% Glp1L-SYN480 6 ug 1.39E+06 0.22 33% scFVIA2-SYN480 6 ug 1.39E+06 0.11 33% SCF-SYN480 6 ug 2.55E+06 1.77 33% CD4-SYN480 6 ug 1.28E+06 1.24 33% CD8-SYN480 6 ug 1.40E+06 1.59 SYN480 12 ug 1.51E+06 0.6 33% Glp1L-SYN480 12 ug 9.66E+05 0.1 33% scFVIA2-SYN480 12 ug 2.01E+06 1.38 33% SCF-SYN480 12 ug 2.06E+06 1.68 33% CD4-SYN480 12 ug 5.77E+05 0.62 33% CD8-SYN480 12 ug 6.01E+05 0.66 SYN480 18 ug 4.71E+05 0.24 33% Glp1L-SYN480 18 ug 5.79E+05 0.20 33% scFvIA2-SYN480 18 ug 7.59E+05 0.19 33% SCF-SYN480 18 ug 6.64E+05 0.13 33% CD4-SYN480 18 ug 6.57E+05 0.79 33% CD8-SYN480 18 ug 6.03E+05 0.71

EXAMPLE

Methods:

Plasmid Cloning:

TABLE-US-00013 SEQIDNO:24>scFvCD133-SYN:SignalsequenceofSYNisunderlined-HA epitopeisinitalicscFvCD133sequenceisdoubledunderlined-flexible linkersequenceisinbold-SYNsequenceisunderlinedindottedline. GACTATGGCCCTCCCTTATCATATTTTTCTCTTTACTGTTCTTTTACCCTCTTTCACTCTCACTTATCCATATGA TGTTCCAGATTATGCTATGGACATTGTTCTCTCCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAGAAGGT CACCATATCCTGCAGTGCCAGCTCAAGTGTAAGTTATATGTACTGGTACCAGCAGAAGCCAGGATCCTCCCCCAA ACCCTGGATTTATCGCACATCCAACCTGGCTTCTGGAGTCCCTGCTCGCTTCAGTGGCAGTGGGTCTGGGACCTC TTACTCTCTCACAATCAGCAGCATGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTATCATAGTTACCC ACCCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAATCCTCTGGTGGCGGTGGCTCGGGCGGTGGTGGGGGTGG TTCCTCTAGATCTTCCCTGGAAGTGAAGCTGGTGGAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAA GATCTCCTGCAAGGCTTCTGGTTATACCTTCACAGACTATTCAATGCACTGGGTGAATCAGGQTCCAGGAAAGGG TTTAAAGTGGATGGGCTGGATAAACACTGAGACTGGTGAGCCATCATATGCAGATGACTTCAAGGGACGGTTTGC CTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATA TTTCTGTGCTACCGATTACGGGGACTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGGCGG [00082] [00083] [00084] [00085] [00086] [00087] [00088] [00089] [00090] [00091] [00092] [00093] [00094] [00095] [00096] [00097] [00098] [00099] [00100] [00101] [00102] [00103] SEQIDNO:25>SCF-SYN:SignalsequenceofSYNisunderlined-HAepitopeis initalicSCFsequenceisdoubledunderlined-flexiblelinkersequenceis inbold-SYNsequenceisunderlinedindottedline. [00104] [00105] AAATCTTCCAAAAGACTACATGATAACCCTCAAATATGTCCCCGGGATGGATGTTTTGCCAAGTCATTGTTGGAT AAGCGAGATGGTAGTACAATTGTCAGACAGCTTGACTGATCTTCTGGACAAGTTTTCAAATATTTCTGAAGGCTT GAGTAATTATTCCATCATAGACAAACTTGTGAATATAGTGGATGACCTTGTGGAGTGCGTGAAAGAAAACTCATC TAAGGATCTAAAAAAATCATTCAAGAGCCCAGAACCCAGGCTCTTTACTCCTGAAGAATTCTTTAGAATTTTTAA TAGATCCATTGATGCCTTCAAGGACTTTGTAGTGGCATCTGAAACTAGTGATTGTGTGGTTTCTTCAACATTAAG [00106] [00107] [00108] [00109] [00110] [00111] [00112] [00113] [00114] [00115] [00116] [00117] [00118] [00119] [00120] [00121] [00122] [00123] [00124] [00125] [00126] [00127] [00128] SEQIDNO:26>DARPinCD4-SYN480:SignalsequenceofSYNisunderlined-HA epitopeisinitalicSCFsequenceisdoubledunderlined-flexiblelinker sequenceisinbold-SYNsequenceisunderlinedindottedline. [00129] [00130] [00131] [00132] [00133] [00134] [00135] [00136] [00137] [00138] [00139] [00140] [00141] [00142] [00143] [00144] [00145] [00146] [00147] [00148] [00149] [00150] [00151] [00152] [00153] [00154] SEQIDNO:27>scFvCD8-SYN480:SignalsequenceofSYNisunderlined-HA epitopeisinitalicSCFsequenceisdoubledunderlined-flexiblelinker sequenceisinbold-SYNsequenceisunderlinedindottedline. [00155] [00156] [00157] [00158] [00159] [00160] [00161] [00162] [00163] [00164] [00165] [00166] [00167] [00168] [00169] [00170] [00171] [00172] [00173] [00174] [00175] [00176] [00177] [00178] [00179] [00180] [00181] [00182] [00183] [00184] [00185] SEQIDNO:28>scFVIA2-SYN480:SignalsequenceofSYNisunderlined-HA epitopeisinitalicSCFsequenceisdoubledunderlined-flexiblelinker sequenceisinbold-SYNsequenceisunderlinedindottedline. [00186] [00187] [00188] [00189] [00190] [00191] [00192] [00193] [00194] [00195] [00196] [00197] [00198] [00199] [00200] [00201] [00202] [00203] [00204] [00205] [00206] [00207] [00208] [00209] [00210] [00211] [00212] [00213] [00214] [00215] [00216] SEQIDNO:29>GLP1-SYN480:SignalsequenceofSYNisunderlined-HAepitope isinitalicSCFsequenceisdoubledunderlined-flexiblelinkersequence isinbold-SYNsequenceisunderlinedindottedline. [00217] [00218] [00219] [00220] [00221] [00222] [00223] [00224] [00225] [00226] [00227] [00228] [00229] [00230] [00231] [00232] [00233] [00234] [00235] [00236] [00237] [00238]

[0183] The Syncytin 1 (SYN)-coding sequence was obtained from the Ensembl database (ENST00000493463) and two point mutations determining the R393Q and F399A amino acid substitutions) were inserted to increase immunosuppressive activity of SYN.sup.2. The scFvCD133-coding sequence was previously published.sup.3 and the SCF-coding sequence was obtained on gene database (Ensembl ENSG00000049130). The fragments containing scFvCD133, SYN WT and SCF were purchased by Twist Biosciences.

[0184] scFvCD133 insert was digested with EcoRI. scFvCD133-SYN insert was ligated into PMD2.G plasmid (Addgene #12259) digested with EcoRI to generate the scFvCD133-SYN plasmid. Plasmid integrity was verified by Sanger sequencing. In this plasmid, scFvCD133-SYN is under the control of a CMV promoter and enhancer.

[0185] SCF insert was digested with XbaI and BspEI. The SCF insert was ligated into the scFvCD133-SYN plasmid digested with XbaI and BspEI to generate the SCF-SYN plasmid. Plasmid integrity was verified by Sanger sequencing. In this plasmid, SCF-SYN is under the control of a CMV promoter.

[0186] SYN480 fused to SCF ligand or scFvCD133 was generated by PCR amplification of scFvCD133-SYN plasmid using the following primers:

TABLE-US-00014 PfshortCTD: (SEQIDNO:30) TGGGTCCGGAGGTGGCTC PrshortCTD: (SEQIDNO:31) CCTAACTCGAGGACTTGAGTCATTAGATTCTGG AAGAGACAAAGTTAAC

[0187] The PCR product was digested using BspEI and XhoI and inserted into scFvCD133-SYN or SCF-SYN plasmid digested with BspEI and XhoI to generate respectively scFvCD133-SYN480 and SCF-SYN480 plasmids. Plasmid integrity was verified by Sanger sequencing. SYN480 only was generated by PCR amplification of scFvCD133-SYN480 plasmid using the following primers.

TABLE-US-00015 Pf: (SEQIDNO:32) TTCCTTAAGACTATGGCCCTCCCTTATCATATTTTTCTCTTTACTGTTC TTTTACCCTCTTTCACTCTCACTGCACCCCCTCCATGCC PrshortCTD: (SEQIDNO:33) CCTAACTCGAGGACTTGAGTCATTAGATTCTGGAAG AGACAAAGTTAAC

[0188] The PCR product was digested with AflII and XhoI and inserted into scFvCD133-SYN480 plasmid digested with AflII and XhoI.

[0189] Both DARPin targeting CD4 and scFv targeting CD8 sequences were obtained from patent WO2018033544. The GLP1-coding sequence was obtained from the Ensembl database (ENSG00000115263). The scFv targeting sequence of IA2 was extracted from monoclonal antibody sequence previously published.sup.4.

[0190] DARPinCD4, scFvCD8, scFvIA2 and GLP1 inserts were digested with AflII or XbaI and BspEI. scFvCD133-SYN480 plasmid was also digested using the same enzymes. Each insert was ligated into scFvCD133-SYN480 plasmid. Plasmid integrity was verified by Sanger sequencing. In all these plasmids, Ligand-SYN480 are under the control of a CMV promoter.

[0191] PCR products were obtained using the Phusion High-Fidelity polymerase (New England Biolabs (NEB)). Restriction enzymes were purchased from NEB.

TABLE-US-00016 SEQIDNO:34>Glp1R-P2A-Hygro.sup.R:G1P1Risunderlined-P2Alinkersequence isinbold-Hygromycinsequenceisdoubleunderlined. [00239] [00240] [00241] [00242] [00243] [00244] [00245] [00246] [00247] [00248] [00249] [00250] [00251] [00252] [00253] [00254] [00255] [00256] [00257] [00258] [00259] [00260] [00261] [00262] [00263] [00264] [00265] [00266] [00267] [00268] [00269]

[0192] GlP1R transgene: The Glp1R-coding sequence was obtained from the Ensembl database (ENSG00000112164). The Glp1R-P2A-Hygro.sup.R sequence and hygromycin insert were purchased from Twist Biosciences. PGK-GFP plasmid and Glp1R-P2A-Hygro.sup.R sequence (Addgene, 19070) were digested with AgeI and SalI. Glp1R-P2A insert was ligated into the PGK-GFP plasmid. Plasmid integrity was verified by Sanger sequencing.

[0193] PCR products were obtained using the Phusion High-Fidelity polymerase (NEB). Restriction enzymes were purchased from NEB.

LV Production

[0194] HEK 293T cells were cultured in DMEM+Glutamax supplemented with Glutamax (Gibco), Non-Essential Amino Acid (Gibco) and Pen/Strep (Gibco). The medium was changed 2 h before transfection. 293T cells were transfected when they reach 80 to 90% of confluency with the following plasmids: (i) Envelope-expressing plasmid (0.7 g for P60 plates (21 cm.sup.2) and 6 g or 12 g or 18 g for P150 plates (152 cm.sup.2)), (ii) pRSV-Rev plasmid (Addgene, 12253) (1.1 g for P60 plates (21 cm.sup.2) and 7.25 g for P150 plate (152 cm.sup.2)); (iii) pMDlg/pRRE plasmid (Addgene, 12251) (2.2 g for P60 plates (21 cm.sup.2) and 14.5 g for P150 plate (152 cm.sup.2)); and (iv) PGK-GFP transfer plasmid (Addgene, 19070) (3 g for P60 plates (21 cm.sup.2) and 18 g for P150 plate (152 cm.sup.2)). We used PEI as a transfection reagent at a 1:3 DNA:PEI ratio. The transfection mix was prepared in DMEM and added dropwise on HEK 293T cells. Media was changed between 12 to 16 h after transfection. Viral supernatant was collected 24 h later, centrifuged 5 min at 500 g, filtered using 0.45 m filters and concentrated by ultracentrifugation for 2 h at 100,000 g at 4 C. Viral pellet was resuspended in the media used for viral transduction (StemSpan or X-VIVO 20 or PBS) and either used directly or stored at 80 C.

LV Titration:

[0195] Physical particle titers of VSV-G- or SYN-pseudotyped LVs were determined by p24 ELISA (Alliance HIV-1 Elisa kit, Perkin-Elmer, Villebon/Yvette, France).

Cell Culture and Transduction:

[0196] We obtained human CB CD34.sup.+ HSPCs from healthy donors. CB samples eligible for research purposes were obtained because of a convention with the CB bank of Saint Louis Hospital (Paris, France).

[0197] HSPCs were purified by Ficoll gradient centrifugation (Eurobio, les Ulis, France) and by CD34.sup.+ magnetic beads sorting (Miltenyi Biotec, Bergisch Gladbach, Germany). Cells were stored in liquid nitrogen. HSPCs were thawed from 48 h to 96 h before transduction and cultured in X-VIVO or StemSpan (STEMCELL Technologies) medium supplemented with the following cytokines (Pepro Tech): stem cell factor (SCF) (300 ng/ml), Flt-3L (300 ng/ml), thrombopoietin (TPO) (100 ng/ml), interleukin-3 (IL-3) (60 ng/ml) and StemReginin1 (250 nM) (STEMCELL Technologies).

[0198] If required, HSPCs were stained with anti-CD117 or anti-CD133 (Miltenyi Biotech) antibodies and FACS-sorted using SH800 Cell Sorter (Sony Biotechnology). Cells (10.sup.6 cells/mL) were transduced overnight with LVs in the presence of VF1 (12 g/mL) (Miltenyi Biotech), then washed with PBS and resuspended in fresh X-VIVO 20 supplemented with cytokines mentioned above. The following day, HSPCs were analyzed for GFP expression by flow cytometry on a Fortessa X20 (BD Biosciences) analyzer using Diva and FlowJo v10 (BD-Biosciences) softwares.

[0199] 200,000 to 250,000 HEK 293T cells were transduced overnight with LV in the presence of VF1 (12 g/mL). The following day, the medium was removed and replaced by fresh medium. The third day, 293T HEK cells were analyzed for GFP expression by flow cytometry on a Fortessa X20 (BD Biosciences) analyzer using Diva and FlowJo v10 (BD-Biosciences) softwares.

[0200] CD4.sup.+ and CD8.sup.+ T cells were purified by Ficoll gradient centrifugation (Eurobio, les Ulis, France) and by CD4 or CD8 magnetic beads sorting (Miltenyi Biotec, Bergisch Gladbach, Germany). Cells were activated during 3 days with PHA (2.5 g/mL, MilliporeSigma) in Panserin 401 (Pan Biotech) supplemented with 5% human AB serum (Bio West), penicillin (100 UT/mL), and streptomycin (100 g/mL). After 3 days, dead cells were removed by Ficoll gradient centrifugation, and cells were cultured in RPMI1640+10% FBS+IL-2 (100 UI/mL). 100,000 Cells (10.sup.6 cells/mL) were transduced overnight with LVs in the presence of VF1 (12 g/mL) (Miltenyi Biotech), then washed with PBS and resuspended in fresh medium supplemented with IL-2 as mentioned above. The seventh day, CD4.sup.+ and CD8.sup.+ T cells were analyzed for GFP expression by flow cytometry on a Fortessa X20 (BD Biosciences) analyzer using Diva and FlowJo v10 (BD-Biosciences) softwares.

Flow Cytometry Staining

[0201] 300.000 HEK 293T cells or HCT 116 were stained with either anti-IA2 (ThermoFischer) or anti-Glp1R antibodies (ThermoFischer). Stained cells were incubated with secondary antibodies (anti-Rabbit IgG) coupled with Alexa Fluor 647. 200,000 CD4.sup.+ and CD8.sup.+ T cells were stained with either anti-CD4 (BioLegend) or anti-CD8 (BioLegend) antibodies. Cells were analyzed for respective marker expression by flow cytometry on a Fortessa X20 (BD Biosciences) analyzer using Diva and FlowJo v10 (BD-Biosciences) softwares.

Overexpressing Cell Lines

[0202] LV were produced as mentioned above but transfer plasmid PGK-Glp1R-P2A-BleoR was used. Viral supernatant was collected, centrifuged and filtered as mentioned above. 5.105 I HEK 293T cells or HCT116 cells were transduced with fresh viral supernatant collected after 24 h. 48 h after transduction, hygromycin was added (300 g/mL) for selection for 14 days. GlP1R expression was confirmed by flow cytometry analysis.

Vector Copy Number

[0203] Genomic DNA (gDNA) was extracted using PureLink Genomic DNA kit according to manufacturer's instructions (Invitrogen). For CB HSPCs, digital droplet dPCR (ddPCR) was performed 13 days post transduction. VCN was analyzed according to the protocol described by Corre et al..sup.8.

[0204] For HEK 293T cells and HCT 116 cells, ddPCR was performed 7 days after transduction. Amplification of the human ALB gene with Alb For, Alb Rev and Alb Pro was used to determine the number of diploid genomes. GFP For, GFP Rev and GFP PRO were used to determine the vector copies.

[0205] Primers and probe sequences are reported below:

TABLE-US-00017 (SEQIDNO:35) AlbFor:5-GCTGTCATCTCTTGTGGGCTGT-3 (SEQIDNO:36) AlbRev:5-ACTCATGGGAGCTGCTGGTTC-3 (SEQIDNO:37) AlbPro:5-CCTGTCATGCCCACACAAATCTCTCC-3[VIC] (SEQIDNO:38) GFPFor:5-ATGGTGAGCAAGGGCGAGGA-3 (SEQIDNO:39) GFPRev:5-CTTCAGGGTCAGCTTGCCGTA-3 (SEQIDNO:40) GFPPro:[FAM]5-AAACGGCCACAAGTTCAG CGTGTCC-3[MGBEQ]

[0206] The reaction was performed on the Biorad system (Biorad QX200 autoDG) according to the manufacturer recommendations using 10 units of the DraI restriction enzyme in the mix (Biorad ddPCR Supermix for Probes (No dUTP)) and 30 ng of gDNA was used for each reaction.

Results:

[0207] We developed a new system to modify tropism of syncytins, envelope proteins, which can be used to pseudotype viruses or viral-like particles (VLPs), and used for gene transfer or other applications. Syncytins are encoded by genes from endogenous retroviruses, which have entered the germline of mammalian hosts.sup.5. The structure of syncytins resembles that of a typical retroviral envelope glycoprotein. In addition, syncytins have immunosuppressive properties, which make them relevant for potential in vivo well-tolerated gene delivery.

LVs Specifically Human HSPCs

[0208] We created a fusion protein containing the Syncytin-1 (SYN) signal sequence (SS), a ligand (either natural or engineered), the SYN protein and a flexible linker between SYN and the ligand (FIG. 1A) to enhance transduction of the cell type expressing the receptor or the antigen targeted by the ligand, for instance hematopoietic stem progenitor cells (HSPCs). We use as ligands either Stem Cell Factor (SCF), which binds CD 117 (c-kit) receptor or a single-chain fragment variant (scFv) directed against CD133 receptor (scFvCD133). Both ligands are known markers of HSPCs.sup.6,3. In order to evaluate the efficiency of our strategy and to determine the best envelope configuration, we transduced Cord Blood (CB) HSPCs with lentiviral particles containing a GFP-encoding mRNA and pseudotyped with different ratios of our fusion protein to wild-type SYN. To this aim, we produced lentiviral vectors (LVs) by transfecting HEK 293T cells with different stoichiometric ratios of the plasmid encoding for wild type (WT) SYN to either the SCF-SYN- or the scFvCD133-SYN-expressing plasmid. The lentiviral particles produced using 33%, 67% or 100% ratios were selected based on the natural conformation of SYN, which is a trimeric protein. Thus, we hypothesized that, using these ratios, each envelope protein would be composed of one (33% ratio), two (67% ratio), or three (100%) ligand-SYN monomer, the remaining monomers being WT SYN.

[0209] We observed a low transduction efficiency in HSPCs using WT SYN (17%) compared to VSV-G pseudotyped LV, but a substantial increase when SYN was fused to a ligand. Independently of the ratio, fusion of SCF or scFvCD133 with SYN increased the percentage of GFP.sup.+ CB HSPCs by almost two-fold (FIG. 1B), indicating that addition of the ligand can increase LV transduction if cells harbor the targeted receptor or antigen on their surface. Interestingly, lentiviral particles harboring only the ligand-SYN envelope (100%) were able to efficiently transduce HSPCs. Therefore, to potentially increase the specificity of these LVs, we used LVs produced using a 100% ratio for the following experiments.

[0210] It has been previously reported that deletion of the last amino acids of SYN's cytoplasmic tail increased its fusion capacity.sup.7,8. Therefore, we designed new fusion proteins by replacing SYN with its C-terminally truncated form, containing 480 instead of 538 amino acids (SYN480; FIG. 2A). LVs pseudotyped with these different engineered envelope proteins (scFvCD133- and SCF-SYN480) showed titers similar to VSV-G pseudotyped LVs and roughly two-fold higher compared to SYN480 pseudotyped LVs, as measured by p24 ELISA (FIG. 2B). Noteworthy, batches of LVs pseudotyped with SYN480 could not be produced by pooling two consecutive harvests from the same producing cells collected 48 and 72 h post-transfection, due to fusion of HEK 293T cells transfected with SYN480-expressing plasmids (data not shown), as previously reported with WT SYN.sup.9. On the contrary, HEK 293T cells transfected SCF-SYN480- and scFvCD133-SYN480-expressing plasmids do not fuse or only modestly (data not shown), allowing consecutive lentiviral harvests from the same producing HEK 293T cells. Thus, adding a ligand to SYN facilitates LV production, by increasing viral titers and by allowing multiple harvests from the same producing cells.

[0211] To evaluate the preferential targeting of cells expressing CD117 or CD133 by SCF-SYN480 and scFvCD133-SYN480, respectively, we compared transductions levels in CB HPSC subpopulations expressing different CD117 or CD133 levels. CB HSPCs were sorted according to either CD133 or CD117 expression levels and transduced with the different LVs (FIG. 2C). Transduction of the CD133.sup.high population with scFvCD133-SYN480 LV resulted in a 69% increase of GFP.sup.+ cells (FIG. 2D). Similar results were observed in CD117.sup.low and CD117.sup.high cell populations, with SCF-SYN480 LV showing an increased transduction efficiency in CD117.sup.high CB HSPCs (55% increase). Therefore, addition of a ligand to SYN480 resulted in an increased specificity towards the desired cell type expressing the targeted antigen.

[0212] Finally, we asked whether the fusion of SYN480 to a ligand affects SYN480 binding to a cell type not expressing the receptor targeted by the ligand. Therefore, we assessed the transduction efficiency of scFvCD133-SYN480 or SCF-SYN480 LV in HEK 293T cells, which do not express CD133 and express low CD117 levels (39% positive cells) (FIG. 3A). SYN480 LVs showed a transduction efficiency of 35%, which is higher compared to that previously reported for WT SYN (25%).sup.9. Fusion of scFvCD133 to SYN480 almost abolished binding of SYN480 to HEK 293T cells, with transduction frequency dropping from 35% to <1% (FIGS. 3B and 3C), indicating a full retargeting of SYN480's tropism. Moreover, SCF-SYN480 lentiviral particles showed a decreased transduction efficiency compare to SYN480 LV (from 35% to 15%), indicating that SCF-SYN480 might bind only to HEK 293T cells expressing CD 117 on their surface (FIGS. 3B and 3C) and suggesting a partial retargeting of SYN480's tropism.

[0213] As we observed GFP.sup.+ transduced HSPCs but with low fluorescence intensity (FIGS. 1 and 2), we asked whether we could improve GFP intensity signal in transduced cells. It has been shown with several viral envelope proteins that the amount of plasmid used to produced viral particles affect the titer and infectivity.sup.10. Therefore, we decided to transfect HEK 293T cells with different amounts of envelope plasmids to produce our LVs (6 g, 12 g and 18 g). The lentiviral particles produced using 33%, 67% or 100% ratios were selected based on the natural conformation of SYN, which is a trimeric protein, as mentioned earlier.

[0214] Following the same strategy as before, we tested our new LVs in CB HPSCs subpopulations expressing different CD117 levels. We also focused our analysis on GFP.sup.+ cells with higher fluorescence intensity. Using SYN480, we observed a low transduction efficiency in CD117.sup.high HSPCs that increased in a dose-dependent manner, ranging from 30.8% to 82% with 6 g and 18 g as amount of plasmid used to produce the viral particles, respectively (FIGS. 4A and 4B). LVs produced using the highest amount of plasmid seems to have better ability to transduce HSPCs, despite a lower titer compared to the LV produced using the lowest amount of plasmid (Table 1). By fusing SYN480 to a ligand, we observed a substantial increase in transduction efficiency. Using 33% of SCF-SYN480 envelope, we were able to increase the percentage of GFP.sup.+ CD117.sup.high HSPCs by at least two-fold, independently of the amount of plasmid used to pseudotype the LV (FIGS. 4A and 4B). The transduction efficiency increased with the increase of the amount of SCF-SYN480 envelope plasmid used, as observed with SYN480 LVs. While 33% of SCF-SYN480 envelope was able to increase transduction efficiency, we observed very low levels of GFP.sup.+ cells using 67% of SCF-SYN480 and no GFP.sup.+ cells using 100% of SCF-SYN480, suggesting than having two or three SYN480 chain fused to a ligand affects the infectivity of the LV.

[0215] We observed a similar trend in CD117.sup.low HSPCs transduced with SYN480 only, with an increase of transduction levels with the highest amount of plasmid used to produce the LVs. On the contrary, the percentage of GFP.sup.+ CD117.sup.low w cells was strongly decrease using 33% of SCF-SYN480 envelope independently of the amount of envelope plasmid used, partially preventing SYN480 envelope to binds to its natural receptor. Regarding the 67% and 100% ratios between SCF-SYN480 and SYN480, we obtained extremely low levels of transduction efficiency or no transduction efficiency, respectively (FIGS. 4A and 4B).

[0216] Finally, we assessed transduction efficiency and proviral integration in the genome by analyzing vector copy number (VCN) in both CD117.sup.high and CD117.sup.low HSPCs 13 days after transduction with LVs pseudotyped either with SYN480 or with 33% of SCF-SYN480. We used a protocol to specifically quantify proviral integration events and not episomal, non-integrated proviruses (i.e., pseudotransduction).sup.11. We observed consistent increase of VCN in CD117.sup.high using 33% SCF-SYN480 compared to SYN480, independently of the amount of envelope plasmid used, which is consistent with our flow cytometry analysis (FIGS. 4A, 4B and 4C). Increased fold changes in VCN levels were consistent with those observed for GFP.sup.+ cells, confirming increased transduction efficiency and retargeting of natural SYN480's tropism by addition of a ligand targeting a receptor present on the target cells' surface. Lastly, we observed higher VCN using the highest envelope plasmid amount (FIG. 4C). VCN observed in CD117.sup.low HSPCs were decreased using 6 and 12 g of SCF-SYN480 envelope compared to SYN480 envelope, confirming flow cytometry data and the retargeting of SYN's tropism towards CD117.sup.high HSPCs. Noteworthy, decrease of VCN was not as strong as the decrease of the percentage of GFP.sup.+ cells.

LVs Specifically Human T Cells

[0217] To demonstrate that our approach could be applied to target other cell types using ligands targeting their specific cell surface receptors, we decided to focus on immune T cells, notably CD4.sup.+ and CD8.sup.+ cells.

[0218] To this aim, we developed fusion protein containing either a DARPin against the CD4 receptor or an scFv against the CD8 receptor to target CD4.sup.+ and CD8.sup.+ T cells, respectively, using the previously described strategy (FIG. 5A). We collected peripheral blood mononuclear cells (PBMC) from healthy individuals and purified CD4.sup.+ and CD8.sup.+ T cells (FIG. 5B). To confirm the previous results observed with CB HSPCs, we produced LV batches with different types of envelopes by using different amounts of envelope plasmids and different stoichiometric ratios between SYN480 and SYN480 fused to a ligand. SYN480 envelope showed very poor ability to transduce both CD4.sup.+ and CD8.sup.+ T cells, ranging typically from less than 1% to 8% using LV produced with 18 g and 6 g of envelope plasmid, respectively (FIGS. 5C and 5D). Surprisingly, addition of a ligand strongly increased the transduction efficiency using either 33% of DARPinCD4-SYN480 or 33% of scFvCD8-SYN480 envelope to transduce CD4.sup.+ or CD8.sup.+ T cells, respectively (FIGS. 5C and 5D). We observed between 8010% up to 957% of GFP.sup.+ cells using 33% DARPinCD4-SYN480 LVs depending on the amount on plasmid using to produce LVs (FIGS. 5C and 5D). Overall, addition of a DARPin targeting CD4.sup.+ T cells and use of 33% of the DARPinCD4-SYN480 envelope plasmid allowed a significant increase (at least 25-fold change) in the average transduction efficiency in CD4.sup.+ T cells compared to SYN480 LV (FIG. 5E). Noteworthy, we observed very low transduction levels or no transduction using 67% or 100% of DARPinCD4-SYN480 ratios, confirming results obtained in CB HSPCs.

[0219] Similarly, fusion of a scFv targeting CD8.sup.+ enhanced transduction efficiency of CD8.sup.+ T cells (FIG. 5C). Using 33% scFvCD8-SYN480 LVs, we were able to transduce CD8.sup.+ T cells with an efficiency ranging from 62% using 12 g of envelope plasmid to 95% using 6 g of envelope plasmid (FIG. 5D). Thus, regardless of the amount of envelope used to pseudotype LVs, the 33% ratio of scFvCD8-SYN480 envelope allowed efficient transduction of CD8.sup.+ T cells. We observed at least a 22-fold increase in the percentage of GFP.sup.+ cells compared to SYN480 LV (FIG. 5E). The use of 67% and 100% of scFvCD8-SYN480 did not result in elevated levels of transduction (FIGS. 5C and 5D). Importantly, the use of the 33% DARPinCD4-SYN480 LVs and 33% scFvCD8-SYN480 LVs did not result in transduction of CD8.sup.+ T and CD4.sup.+ T cells, confirming the specificity of the engineered envelopes for the cell harboring the targeted cell-surface receptor. Of note, both 67% and 100% ratio of DARPinCD4-SYN480 and scFvCD8-SYN480 were failed to transduce CD8.sup.+ T and CD4.sup.+ T, respectively (data not shown).

LVs Targeting Human GLP1.sup.+ or IA2.sup.+ Cells

[0220] Lastly, we designed fusion proteins containing either the glucagon ligand (GLP1) or an scFv targeting IA2, a well-known receptor overexpressed on pancreatic cells from patients with type 1 diabetes; autoantibodies against IA2 are found in the vast majority of these patients.sup.12,13 (FIG. 6A & FIG. 7A). HEK 293T cells and HCT 116 cells naturally expressed IA2 on their surface as shown by flow cytometry analysis (FIG. 6B). Based on our previous results, we decided to test only the 33% scFvIA2-SYN480 ratio with the different amounts of envelope plasmids. Fusion of scFvIA2 consistently increased transduction (compared to SYN480 alone) in both HEK 293T cells and HCT 116 cells by at least 50% and up to 95%, depending of the envelope plasmid amount used for LV production (FIGS. 6C and 6D). As observed with CB HSPCs, the higher amount of envelope plasmid was used, the higher was the percentage of GFP.sup.+ cells, despite the decrease in the viral titer (Table 1). We also evaluated transduction efficiency by analyzing proviral integration one week after transduction. We observed an increased VCN using 33% scFvIA2-SYN480 LVs compared to SYN480 LVs in both HEK 293T cells and HCT 116 cells, confirming the results observed by flow cytometry (FIG. 6E). Therefore, we were again able to modify SYN's tropism using an alternative ligand/receptor combination on a new cell type.

[0221] In order to target pancreatic cells using an alternative receptor, we developed a fusion protein containing GLP1 between the SS and SYN480 sequences (FIG. 7A). HEK 293T cells and HCT 116 cells do not naturally express the Glp1R receptor on their surface, thus we stably transduced them with a construct to overexpress both Glp1R and hygromycin as a selection marker (FIG. 7B). Following the same strategy used with IA2 receptor, we transduced both Glp1R.sup.+ and Glp1R.sup. cells with either SYN480 or 33% GLP1-SYN480 LVs. We observed a reduced transduction efficiency of HEK 293T cells and HCT 116 cells (Glp1R) with 33% GLP1-SYN480 LVs compared to SYN480 LV, regardless of the different amount used to produce LVs (FIGS. 7C and 7D). We did not observe gain in transduction efficiency in Glp1R.sup.+ using 33% GLP1-SYN480 LVs compared to the SYN480 LVs, but rather a rescue of the reduced transduction efficiency observed in Glp1R.sup. cells (FIGS. 7C and 7D)

[0222] Overall, we developed a fusion strategy that allows modification of SYN's tropism towards different receptors in order to target the desired cell type. We demonstrated that we were able to transduce several different cell types using an appropriate ligand to target them. As shown, our system is adaptable to multiple desired antigens to retarget syncytin to a cell type of interest.

REFERENCES

[0223] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure. [0224] 1. Urlaub, G. & Chasin, L. A. Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity. Proc Natl Acad Sci USA 77, 4216-4220 (1980). [0225] 2. Mangeney, M. et al. Placental syncytins: Genetic disjunction between the fusogenic and immunosuppressive activity of retroviral envelope proteins. Proc Natl Acad Sci USA 104, 20534-20539 (2007). [0226] 3. Swaminathan, S. K. et al. Identification and characterization of a novel scFv recognizing human and mouse CD133. Drug Deliv Transl Res 3, 143-151 (2013). [0227] 4. Kolm-Litty, V. et al. Human monoclonal antibodies isolated from type I diabetes patients define multiple epitopes in the protein tyrosine phosphatase-like IA-2 antigen. J Immunol 165, 4676-4684 (2000). [0228] 5. Grandi, N. & Tramontano, E. HERV Envelope Proteins: Physiological Role and Pathogenic Potential in Cancer and Autoimmunity. Front Microbiol 9, 462 (2018). [0229] 6. Verhoeyen, E. et al. Stem cell factor-displaying simian immunodeficiency viral vectors together with a low conditioning regimen allow for long-term engraftment of gene-marked autologous hematopoietic stem cells in macaques. Hum Gene Ther 23, 754-768 (2012). [0230] 7. Drewlo, S., Leyting, S., Kokozidou, M., Mallet, F. & Ptgens, A. J. G. C-Terminal truncations of syncytin-1 (ERVWE1 envelope) that increase its fusogenicity. Biol Chem 387, 1113-1120 (2006). [0231] 8. Chang, C., Chen, P.-T., Chang, G.-D., Huang, C.-J. & Chen, H. Functional characterization of the placental fusogenic membrane protein syncytin. Biol Reprod 71, 1956-1962 (2004). [0232] 9. Coquin, Y., Ferrand, M., Seye, A., Menu, L. & Galy, A. Syncytins enable novel possibilities to transduce human or mouse primary B cells and to achieve well-tolerated in vivo gene transfer. http://biorxiv.org/lookup/doi/10.1101/816223 (2019) doi:10.1101/816223. [0233] 10. Logan, A. C. et al. Factors influencing the titer and infectivity of lentiviral vectors. Hum Gene Ther 15, 976-988 (2004). [0234] 11. Corre, G. et al. Lentiviral standards to determine the sensitivity of assays that quantify lentiviral vector copy numbers and genomic insertion sites in cells. Gene Ther 29, 536-543 (2022). [0235] 12. Aanstoot, H. J. et al. Identification and characterization of glima 38, a glycosylated islet cell membrane antigen, which together with GAD65 and IA2 marks the early phases of autoimmune response in type 1 diabetes. J Clin Invest 97, 2772-2783 (1996). [0236] 13. Roep, B. O. & Peakman, M. Antigen targets of type 1 diabetes autoimmunity. Cold Spring Harb Perspect Med 2, a007781 (2012).