AAV VECTOR ENCODING ANTI-VEGF-A AND ANG-2 BISPECIFIC ANTIBODY

Abstract

Provided are a bispecific antibody, an encoding nucleic acid thereof, an AAV virus vector containing the nucleic acid, and a virus particle. Further provided is a pharmaceutical composition containing the bispecific antibody, the encoding nucleic acid, the AAV virus vector, or the virus particle. The bispecific antibody comprises binding domains specific to VEGF-A and ANG-2, and can be used for treating wet age-related macular degeneration or diabetic macular edema of a subject.

Claims

1. A bispecific antibody comprising anti-VEGF-A and anti-ANG-2 binding domains, the heavy chain variable regions (VH) and light chain variable regions (VL) of the bispecific antibody are arranged from N-terminus to C-terminus in the following order: 1) VH.sub.anti-VEGF-A-VL.sub.anti-VEGF-A-VH.sub.anti-ANG-2-VL.sub.anti-ANG-2; 2) VL.sub.anti-ANG-2-VH.sub.anti-VEGF-A-VL.sub.anti-VEGF-A-VH.sub.anti-ANG-2; or 3) VL.sub.anti-VEGF-A-VH.sub.anti-ANG-2-VL.sub.anti-ANG-2-VH.sub.anti-VEGF-A; wherein the VH.sub.anti-VEGF-A comprises a CDR1 as depicted in SEQ ID NO: 1, a CDR2 as depicted in SEQ ID NO: 2, and a CDR3 as depicted in SEQ ID NO: 3; the VL.sub.anti-VEGF-A comprises a CDR1 as depicted in SEQ ID NO: 4, a CDR2 as depicted in SEQ ID NO: 5, and a CDR3 as depicted in SEQ ID NO: 6 or SEQ ID NO: 47; the VH.sub.anti-ANG-2 comprises a CDR1 as depicted in SEQ ID NO: 7, a CDR2 as depicted in SEQ ID NO: 8, and a CDR3 as depicted in SEQ ID NO: 9; the VL.sub.anti-ANG-2 comprises a CDR1 as depicted in SEQ ID NO: 10, a CDR2 as depicted in SEQ ID NO: 11, and a CDR3 as depicted in SEQ ID NO: 12.

2. The bispecific antibody of claim 1, wherein the VH.sub.anti-VEGF-A comprises a sequence as depicted in SEQ ID NO: 13 or a sequence that is 70%, 80%, 90%, 95% or 99% identical to the sequence of SEQ ID NO: 13; the VL.sub.anti-VEGF-A comprises a sequence as depicted in SEQ ID NO: 14 or a sequence that is 70%, 80%, 90%, 95% or 99% identical to the sequence of SEQ ID NO: 14 or SEQ ID NO: 48; the VH.sub.anti-ANG-2 comprises a sequence as depicted in SEQ ID NO: 15 or a sequence that is 70%, 80%, 90%, 95% or 99% identical to the sequence of SEQ ID NO: 15; the VL.sub.anti-ANG-2 comprises a sequence as depicted in SEQ ID NO: 16 or a sequence that is 70%, 80%, 90%, 95% or 99% identical to the sequence of SEQ ID NO: 16.

3. The bispecific antibody of claim 1, wherein the antibody comprises a sequence as depicted in SEQ ID NO: 17, 18, 19, 49, 51 or 53 or a sequence that is 70%, 80%, 90%, 95% or 99% identical to the sequence of SEQ ID NO: 17, 18, 19, 49, 51 or 53.

4. The bispecific antibody of claim 1, wherein the N-terminus of the bispecific antibody comprises a signal peptide sequence or a tag sequence, preferably the signal peptide sequence is a CD5-sp signal peptide as depicted in SEQ ID NO: 23.

5. The bispecific antibody of claim 4, wherein the antibody comprises a sequence as depicted in SEQ ID NO: 20, 21, 22, 50, 52 or 54 or a sequence that is 70%, 80%, 90%, 95% or 99% identical to the sequence of SEQ ID NO: 20, 21, 22, 50, 52 or 54.

6. The bispecific antibody of claim 1, wherein the heavy chain variable region (VH) and the light chain variable region (VL) are linked by (G.sub.4S)n, wherein n=any integer between 1 and 4.

7. The bispecific antibody of claim 1, wherein the structure of the bispecific antibody is: VH.sub.anti-VEGF-A-(G.sub.4S).sub.3-VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2-(G.sub.4S).sub.3-VL.sub.anti-ANG-2; VL.sub.anti-ANG-2-G.sub.4S-VH.sub.anti-VEGF-A-(G.sub.4S).sub.3-VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2; VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2-(G.sub.4S).sub.3-VL.sub.anti-ANG-2-G.sub.4S-VH.sub.anti-VEGF-A; CD5-sp-VH.sub.anti-VEGF-A-(G.sub.4S).sub.3-VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2-(G.sub.4S).sub.3-VL.sub.anti-ANG-2; CD5-sp-VL.sub.anti-ANG-2-G.sub.4S-VH.sub.anti-VEGF-A-(G.sub.4S).sub.3-VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2; or CD5-sp-VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2-(G.sub.4S).sub.3-VL.sub.anti-ANG-2-G.sub.4S-VH.sub.anti-VEGF-A.

8. A nucleic acid sequence encoding the bispecific antibody of claims 1-7.

9. A vector comprising a nucleic acid sequence encoding the bispecific antibody of claims 1-7, wherein the vector is preferably an AAV virus vector.

10. The AAV virus vector of claim 9, further comprising: a 5 ITR and a 3 ITR, a promoter, a polyA sequence.

11. An AAV virus particle comprising the AAV virus vector of claim 9 or 10 and a capsid protein.

12. The AAV virus particle of claim 11, wherein the serotype of the capsid protein is AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9.

13. A pharmaceutical composition comprising at least one of the bispecific antibody of claims 1-7, the nucleic acid sequence of claim 8, the vector of claim 9 or 10, the AAV virus particle of claim 11 or 12, and a pharmaceutically acceptable carrier.

14. Use of the bispecific antibody of claims 1-7, the nucleic acid sequence of claim 8, the vector of claim 9 or 10, the AAV virus particle of claim 11 or 12 or the pharmaceutical composition of claim 13 in the preparation of a medicament for treating or preventing cancer, intraocular neovascularization syndrome, rheumatoid arthritis, psoriasis, proliferative retinopathy, age-related macular degeneration or diabetic macular edema.

15. The use of claim 14, wherein the age-related macular degeneration is wet age-related macular degeneration.

16. The use of claim 14 or 15, wherein the medicament is administered by intravitreal, subretinal or suprachoroidal injection.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIG. 1 shows schematic structural diagrams of XMVA01, XMVA04, and XMVA09.

[0033] FIG. 2 shows vector information of pAAV9-XMVA09, ssAAV-XMVA09.

[0034] FIG. 3 shows expression levels of VEGF165 neutralizing proteins in cells after transfection by pAAV9-XMVA01, pAAV9-XMVA04 and pAAV9-XMVA09 vectors.

[0035] FIG. 4 shows effect of expressing XMVA01, XMVA04 and XMVA09 in cells on the proliferation of human retinal microvascular endothelial cells (HRMECs) under ECGS stimulation.

[0036] FIGS. 5, 6 show the effects of expressing XMVA01, XMVA04 and XMVA09 in cells on the tube formation of HRMECs.

[0037] FIG. 7 shows a schematic structural diagram of XMVA10.

[0038] FIG. 8 shows a schematic structural diagram of XMVA11.

[0039] FIG. 9 shows a schematic structural diagram of XMVA13.

[0040] FIG. 10 shows a schematic structural diagram of XMVA14.

[0041] FIG. 11 shows a schematic structural diagram of XMVA15.

[0042] FIG. 12 shows a fluorescein fundus angiography (FFA) images of laser-induced wAMD model mice after injection of AAV-XMVA09.

[0043] FIG. 13 shows percentage of grade 3 light spots and mean score of leakage light spots after laser-induced wAMD model mice were injected with AAV-XMVA09.

[0044] FIG. 14 shows the changes of grade IV light spots number and fluorescence leakage area in the laser-induced wAMD model rhesus monkey control group.

[0045] FIG. 15 shows the changes of grade IV light spots number and fluorescence leakage area in the laser-induced wAMD model rhesus monkey injected with AAV-XMVA09.

[0046] FIG. 16 shows the changes in retinal thickness of grade IV light spots in the laser-induced wAMD model rhesus monkey control group.

[0047] FIG. 17 shows the changes in retinal thickness of grade IV light spots in the laser-induced wAMD model rhesus monkey injected with AAV-XMVA09.

[0048] FIG. 18 shows the changes in permeability of high glucose induced HRMECs.

[0049] FIG. 19 shows the regulatory effect of XMVA09 on the permeability of HRMECs based on VE-cadherin indicator.

[0050] FIG. 20 shows regulatory effect of XMVA09 on the permeability of HRMECs based on the biotin-avidin system indicator.

[0051] FIG. 21 shows monitoring analysis of fasting blood glucose and body weight in diabetic model mice.

[0052] FIG. 22 shows images of retinal vascular leakage in diabetic model mouse.

[0053] FIG. 23 shows the changes in retinal vascular leakage area in diabetic model mice after injection of AAV-XMVA09.

DETAILED DESCRIPTION

[0054] The present invention will be described in detail below according to embodiments and in conjunction with the accompanying drawings. The above aspects of the invention and other aspects of the invention will be apparent in the following detailed description. The scope of the present invention is not limited to the following examples.

[0055] The antibodies in the present invention are multispecific, and can be humanized, single-chain, chimeric, synthetic, recombinant, heterozygous, mutant, and grafted antibodies; the antibody format in the present invention is a scFv spliced by antibody light chain variable regions (VL) and antibody heavy chain variable regions (VH), and the antibody can bind to two different antigens, such as VEGF-A and ANG-2.

[0056] The antibody light chain variable region (VL) and antibody heavy chain variable region (VH) can be further subdivided into hypervariable regions called complementarity determining regions (CDRs), and interspersed more conserved regions called framework regions (FWR). The CDRs of the antibodies and antigen-binding fragments disclosed herein are defined or identified by Kabat numbering. In one embodiment, each VH and VL generally includes 3 CDRs and 4 FWRs arranged in the following order from the amino end to the carboxy end: FWR1, CDR1, FWR2, CDR2, FWR3, CDR3, FWR4. The CDRs of the antibodies and antigen-binding fragments disclosed herein are defined or recognized by Kabat numbering.

[0057] As used herein, vector refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed.

[0058] The experimental methods in the following examples, unless otherwise specified, are all conventional methods.

EXAMPLES

Example 1. Construction of Plasmid Vector

Construction of AAV Vector Plasmid Expressing Anti-VEGF-A/Anti-ANG-2 Gene

[0059] The VH amino acid sequence and the VL amino acid sequence of anti-VEGF, the VH amino acid sequence and the VL amino acid sequence of anti-ANG-2 were linked with (G.sub.4S).sub.3, G.sub.4S, and (G.sub.4S).sub.3 peptide linkers, respectively, with a secretory signal peptide CD5-sp nucleotide sequence added to the N-terminus to form an open reading frame with a structure of CD5-sp-VH.sub.anti-VEGF-A-(G.sub.4S).sub.3-VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2-(G.sub.4S).sub.3-VL.sub.anti-ANG-2; the nucleotide sequences were designed according to human codon preference, with a BamH I cleavage site introduced at the 5 terminus, and an EcoR V cleavage site introduced at the 3 terminus, constructed according to the respective sequences in Table 1 and Table 2, and were named as XMVA01, XMVA04 and XMVA09 (the full-length genes were synthesized by Nanjing GenScript Biotech Corporation). The schematic diagrams of their structures are shown in FIG. 1.

[0060] The above constructs and pAAV9neo-CAG plasmid were double digested with BamH I/EcoR V, and pAAV9-XMVA01, pAAV9-XMVA04 and pAAV9-XMVA09 vectors were constructed respectively by conventional molecular biology operations such as ligation, transformation, cloning screening and identification; the information of pAAV9-XMVA09 vector was shown in FIG. 2A. High-quality plasmid DNA was obtained for later use by using an endotoxin-free plasmid extraction kit (MN).

TABLE-US-00001 TABLE1 SequenceinformationofXMVA09 Product Sequence aminoacid Number information sequence DNAsequence XMVA09 VH.sub.anti-VEGF-A DYWIH SEQID gactactggattcac SEQID (G6-23)- NO:1 NO:24 CDR1 VH.sub.anti-VEGF-A GITPAGGYTYYADS SEQID ggaatcaccccagcaggaggctacacatactatgccgacagcgt SEQID (G6-23)- VKG NO:2 gaagggc NO.25 CDR2 VH.sub.anti-VEGF-A FVFFLPYAMDY SEQID ttcgtgttcttcctgccatacgccatggattat SEQID (G6-23)- NO:3 NO:26 CDR3 VH.sub.anti-VEGF-A EVQLVESGGGLVQ SEQID gaggtgcagctggtggagagcggaggaggactggtgcagccagg SEQID (G6-23) PGGSLRLSCAASQF NO:13 aggctccctgcggctgtcttgcgccgccagcggctttaccatct NO:27 TISDYWIHWVRQA ccgactactggattcactgggtgagacaggcacctggcaaggga PGKGLEWVAGITP ctggagtgggtggcaggaatcaccccagcaggaggctacacata AGGYTYYADSVKG ctatgccgacagcgtgaagggccggttcaccatctccgccgatac RFTISADTSKNTAY ctctaagaacacagcctatctgcagatgaactccctgcgggccga LQMNSLRAEDTAV ggacacagccgtgtactattgcgccagatcgtgttcttcctgcca YYCARFVFFLPYA tacgccatggattattggggccagggcaccctggtgacagtgagc MDYWGQGTLVTV tcc SS VL.sub.anti-VEGF-A RASQDVSTAVA SEQID agagcaagccaggacgtgagcaccgcagtggca SEQID (G6-23)- NO:4 NO:28 CDR1 VL.sub.anti-VEGF-A SASFLYS SEQID tccgcctctttcctgtattct SEQID (G6-23)- NO:5 NO:29 CDR2 VL.sub.anti-VEGF-A KQGYANPWT SEQID aagcagggctatgccaatccatggacc SEQDD (G6-23)- NO:6 NO:30 CDR3 VL.sub.anti-VEGF-A DIQMTQSPSSLSAS SEQID gatattcagatgacacagtccccatctagcctgtctgccagcgt SEQID (G6-23) VGDRVTITCRASQ NO:14 gggcgacagggtgaccatcacatgtagagcaagccaggacgtga NO:31 DVSTAVAWYQQKP gcaccgcagtggcatggtaccagcagaagcctggcaaggcccca GKAPKLLIYSASFL aagctgctgatctactccgcctctttcctgtattctggcgtgcc YSGVPSRFSGSGSG aagcaggtttagcgggtccggatctggaaccgacttcaccctga TDFTLTISSLQPEDF caatctcctctctgcagcctgaggattttgccacatactattgc ATYYCKQGYANP aagcagggctatgccaatccatggaccttcggccagggcacaaa WTFGQGTKVEIKR ggtggagatcaagagg VH.sub.anti-ANG-2 NYGMH SEQID aactatggaatgcac SEQID (3.19.3)- NO:7 NO:32 CDR1 VH.sub.anti-ANG-2 VISHDGNNKYYVD SEQID gtgatcagccacgacggcaacaacaagtactacgtggacagcgt SEQID (3.19.3)- SVKG NO:8 gaagggc NO:33 CDR2 VH.sub.anti-ANG-2 EGIDFWSGLNWED SEQID gagggcatcgacttttggagcggcctgaattggttcgaccct SEQID (3.19.3)- P NO:9 NO:34 CDR3 VH.sub.anti-ANG-2 QVQLVESGGGVVQ SEQID caggtgcagctggttgaatctggtggcggagttgtgcagcctggc SEQID (3.19.3) PGRSLRLSCAASGF NO:15 agaagcctgagactgtcttgtgccgccagcggcttcaccttcacc NO:35 TFTNYGMHWGRQ aactatggaatgcactggggcagacaggcccctggcaaaggactt APGKGLEWVAVIS gaatgggtcgccgtgatcagccacgacggcaacaacaagtacta HDGNNKYYVDSV cgtggacagcgtgaagggcagattcaccatcagccgggacaac KGRFTISRDNSKNT agcaagaacaccctgtacctgcagatgaacagcctgagagccga LYLQMNSLRAEDT ggacaccgccgtgtactattgtgccagagagggcatcgacttttg AVYYCAREGIDFW gagcggcctgaattggttcgacccttggggacagggcaccctgg SGLNWFDPWGQG ttacagtttcttctgcc TLVTVSSA VL.sub.anti-ANG-2 RASQSITGSYLA SEQID agagccagccagagcatcaccggctcttacctggct SEQTD (3.19.3)- NO:10 NO:36 CDR1 VL.sub.anti-ANG-2 GASSWAT SEQID cgcgcctcttcttgggccacc SEQID (3.19.3)- NO:11 NO:37 CDR2 VL.sub.anti-ANG-2 QQYSSSPIT SEQID cagcagtacagcagcagccccatcacc SEQID (3.19.3)- NO:12 NO:38 CDR3 VL.sub.anti-ANG-2 EIVLTQSPGTLSLSP SEQID gagatcgtgctgacacagagccctggcacactgtcactgtctcc SEQID (3.19.3) GERATLSCRASQSI NO:16 aggcgaaagagccacactgagctgtagagccagccagagcatca NO:39 TGSYLAWYQQKPG ccggctcttacctggcttggtatcagcagaagcctggacaggcc QAPRLLICGASSWA cctagactgctgatttgtggcgcctcttcttgggccaccggcat TGIPDRFSGSGSGT tcccgatagattttctggcagcggctccggcaccgacttcaccc DFTLTISRLEPEDFA tgacaatcagcagactggaacccgaggacttcgccgtgtactac VYYCQQYSSSPITF tgccagcagtacagcagcagccccatcacctttggccagggcac GQGTRLEIKR aagactggaaatcaagcgg VH.sub.anti-VEGF-A- EVQLVESGGGLVQ SEQID gaggtgcagctggtggagagcggaggaggactggtgcagccagga SEQID (G.sub.4S).sub.3- PGGSLRLSCAASGE NO:17 ggctccctgcggctgtcttgcgccgccagcggctttaccatctc NO:40 VL.sub.anti-VEGF-A TISDYWIHWVRQA cgactactcgattcactgggtgagacaggcacctggcaagggac -G.sub.4S- PGKGLEWVAGITP tggagtggctggcaggaatcaccccagcaggaggctacacatac VH.sub.anti-ANG-2- AGGYTYYADSVKG tatgccgacagcgtgaagggccggttcaccatctccgccgatac (G.sub.4S).sub.3- RFTISADTSKNTAY ctctaagatcacagcctatctgcagatgaactccctgcgggccg VL.sub.anti-ANG-2 LQMNSLRAEDTAV aggacacagccgtgtactattgcgccagattcgtgttcttcctg YYCARFVFELPYA ccatacgccatggattattggggccagggcaccctggtgacagt MDYWGQGTLVTV gagctccggtggaggtggctccggtggcggtggcagcggcggtg SSGGGGSGGGGSG gcggctctgatattcagatgacacagtccccatctagcctgtct GGGSDIQMTQSPSS gccagcgtgggcgacagggtgaccatcacatgtagagcaagcca LSASVGDRVTITCR ggacgtgagcaccgcagtggcatggtaccagcagaagcctggca ASQDVSTAVAWYQ tggccccaaagctgctgatctactccgcctctttcctgtattct QKPGKAPKLLIYSA ggcgtgccaagcaggtttagcgggtccggatctggaaccgactt SFLYSGVPSRESGS caccctgacaatctcctctctgcagcctgaggattttgccacat GSGTDFTLTISSLQP actattgcaagcagggctatgccaatccatggaccttcggccag EDFATYYCKQGYA ggcacaaaggtggagalcaagaggggcggagggcgctctcaggt NPWTFGQGTKVEI gcagctggttgaatctggtggcggagttgtgcagcctggcagaa KRGGGGSQVQLVE gcctgagactgtcttgtgccgccagcggcttcaccttcaccaac SGGGVVQPGRSLR tatggaatgcactggggcagacaggcccctggcaaaggacttga LSCAASGFTFTNY atgggtcgccgtgatcagccacgacggcaacaacaagtactacg GMHWGRQAPGKG tggacagcgtgaagggcagattcaccatcagccgggacaacagc LEWVAVISHDGNN aagaacaccctgtacctgcagatgaacagcctgagagccgagga KYYVDSVKGRFTI caccgccgtgtactattgtgccagagagggcatcgacttttgga SRDNSKNILYLQM gcggcctgaattggttcgacccttggggacagggcaccctggtt NSLRAEDTAVYYC acagtttcttctgccggtggaggtggctccggtggcggtggcag AREGIDFWSGLNW cggcggtggcggctctgagatcgtgctgacacagagccctggca FDPWGQGTLVTVS cactgtcactgtctccaggcgaaagagccacactgagctgtaga SAGGGGGGGGSG gccagccagagcatcaccggctcttacctggcttggtatcagca GGGSEIVLTQSPGT gaagcctggacaggcccctagactgctgatttgtggcgcctctt LSLSPGERATLSCR cttgggccaccggcattcccgatagattttctggcagcggctcc ASQSITGSYLAWY ggcaccgacttcaccctgacaatcagcagactggaacccgagga QQKPGQAPRLLIC cttcgccgtgtactactgccagcagtacagcagcagccccatca GASSWATGIPDRFS cctttggccagggcacaagactggaaatcaagcgg GSGSGTDFTLTISR LEPEDFAVYYCQQ YSSSPITFGQGIRL EIKR CD5-sp- MPMGSLQPLATLY SEQID atgccaatggggtccctacaacccctggcaacactatatctgct SEQID VH.sub.anti-VEGF-A- LLGMLVASCLGEV NO:20 aggtatgctcgtggcctcctgtttaggagaggtgcagctggtgg NO:41 (G.sub.4S).sub.3- QLVESGGGLVQPG agagcggaggaggactggtgcagccaggaggctccctgcggctg VL.sub.anti-VEGF-A- GSLRLSCAASGFTI tcttgcgccgccagcggctttaccatctccgactactggattca G.sub.4S- SDYWIHWVRQAP ctgggtgagacaggcacctggcaagggactggagtggctggcag VH.sub.anti-ANG-2- GKGLEWVAGITPA gaatcaccccagcaggaggctacacatactatgccgacagcgtg (G.sub.4S).sub.3- GGYTYYADSVKGR aagggccggttcaccatctccgccgatacctctaagaacacagc VL.sub.anti-ANG-2 FTISADTSENTAYL ctatctgcagatgaactccctgcgggccgaggacacagccgtgt QMNSLRAEDTAVY actattgcgccagattcgtgttcttcctgccatacgccatggat YCARFVFFLPYAM tattggggccagggcaccctggtgacagtgagctccggtggagg DYWGQGTLVTVSS tggctccggtggcggtggcagcggcggtggcggctctgatattc GGGGSGGGGSGG agatgacacagtcccatctagcctgtctgccagcgtgggcgaca GGSDIQMTQSPSSL gggtgaccatcacatgtagagcaagccaggacgtgagcaccgca SASVGDRVTITCRA gtggcatggtaccagcagaagcctggcaaggccccaaagctgct SQDVSTAVAWYQQ gatctactccgcctctttcctgtattctggcgtgccaagcaggt KPGKAPKLLIYSAS ttagcgggtccggatctggaaccgacttcaccctgacaatctcc FLYSGVPSRFSGSG tctctgcagcctgaggattttgccacatactattgcaagcaggg SGTDFTLTISSLQPE ctatgccaatccatggaccttcggccagggcacaaaggtggaga DPATYYCKQGYAN tcaagaggggcggagggggctctcaggtgcagctggttgaatct PWTFGQGTKVEIK ggtggcggagttgtgcagcctggcagaagcctgagactgtcttg RGGGGSQVQLVES tgccgccagcggcttcaccttcaccaactatggaatgcactggg GGGVVQPGRSERL gcagacaggcccctggcaaaggacttgaatgggtcgccgtgatc SCAASGETFTNYG agccacgacggcaacaacaagtactacgtggacagcgtgaaggg MHWGRQAPGKGL cagattcaccatcagccgggacaacagcaagaacaccctgtacc EWVAVISHDGNNK tgcagatgaacagcctgagagccgaggacaccgccgtgtactat YYVDSVKGRFTISR tgtgccagagagggcatcgacttttggagcggcctgaattcgtt DNSKNTLYLQMNS cgacccttggggacagggcaccctggttacagtttcttctgccg LRAEDTAVYYCAR gtggaggtggctccggtggcggtggcagcggcggtggcggctct EGIDFWSGLNWFD gagatcgtgctgacacagagccctggcacactgtcactgtctcc PWGQGTLVTVSSA aggcgaaagagccacactgagctgtagagccagccagagcatca GGGGSGGGGSGG ccggctcttacctggcttggtatcagcagaagcctggacaggcc GGSEIVLTQSPGTL cctagactgctgatttgtggcgcctcttcttgggccaccggcat SLSPGERATLSCRA tcccgatagattttctggcagcggctccggcaccgacttcaccc SQSITQSYLAWYQ tgacaatcagcagactggaacccgaggacttcgccgtgtactac QKPGQAPRLLICG tgccagcagtacagcagcagccccatcacctttggccagggcac ASSWATGIPDRESG aagactggatatcatgcgg SGSGTDFTLTISRLE PEDFAVYYCQQYS SSPITFGQGTRLEIK R CD5-sp MPMGSLQPLATLY SEQID atgccaatggggtccctacaacccctggcaacactatatctgct SEQID signal LLGMLVASCLG NO:23 aggtatgctcgtggcctcctgtttagga NO:42 peptide

TABLE-US-00002 TABLE2 SequenceinformationofXMVA01andXMVA04 Sequence Product informa- Number tion AAsequence DNAsequence XMVA01 VH.sub.anti-VEGF-A EVQLVESGGGLVQPGGSL gaggtgcagctggttgaatctggcggaggactggttcagcctggcggatc RLSCTASGESLIDYYYMT tctgagactgagctgtaccgccagcggcttcagcctgaccgactactact WVRQAPGKGLEWVGFID acatgacctgggtccgacaggcccctggcaaaggacttgagtgggtcgga PDDDPYYATWAKGRATIS ttcatcgaccccgacgacgatccttactacgccacatgggccaagggcag RDNSKNTLYLQMNSLRAE attcaccatcagccgggacaacagcaagaacaccctgtacctgcagatga DTAVYYCAGGDHNSGWG acagcctgagagccgaggacaccgccgtgtactattgtgccggcggagat LDIWGQGTLVTVSS cacaatagcggctggggccttgatatttggggccagggaacactggtcac cgtgtctagt VL.sub.anti-VEGF-A EIVMTQSPSTLSASVGDR gagatcgtgatgacacagagccccagcacactgtctgccagcgtgggaga VIITCQASEIIHSWLAWYQ cagagtgatcatcacatgccaggccagcgagatcatccacagctggctgg QKPGKAPKLLIYLASTLA cttggtatcagcagaagcctggcaaggcccctagctgctgatctacctgg SGVPSRFSGSGSGAEFTLT cctctacactggccagcggagtgcctagcagattttctggctctggatct ISSLQPDDFATYYCQNVY ggcgccgagttcaccctgaccatcagtagcctgcagcctgacgacttcgc LASTNGANFGQGTKLTVL cacctactactgccagaacgtgtacctggccagcaccaacggcgccaatt G ttggccagggcaccaagctgacagtgctggga VH.sub.anti-ANG-2 QVQLVQSGAEVKKPGAS caggttcagctggttcagtctggcgccgaagtgaagaaacctggcgcctc VKVSCKASGYTFTGYYM tgtgaaggtgtcctgcaaggccagcggctacacctttaccggctactaca HWVRQAPGQGLEWMGWI tgcactgggtccgacaggctccaggacagggacttgaatggatgggctgg NPNSGGTNYAQKFQGRVT atcaaccccaatagcggcggcaccaattacgcccagaaattccagggcag MTRDTSISTAYMELSRLR agtgaccatgaccagagacaccagcatcagcaccgcctacatggaactga SDDTAVYYCARSPNPYYY gccggctgagatccgatgacaccgccgtgtactactgcgccagatctccc DSSGYYYPGAFDIWGQGT aatccttactactacgacagcagcgggtactactacccaggcgccttcga MVTVSS tatttcgggccagggcacaatggtcaccgtgtctagt VL.sub.anti-ANG-2 SYVETQPPSVSVAPGQTAR agctacgtgctgacacagcctccatccgtgtctgtggctccaggacagac ITCGGNNIGSKSVHWYQQ cgccagaatcacatgcggcggcaacaacatcggcagcaagagcgtgcact KPGQAPVEVVYDDSDRPS ggtatcagcagaagcctggacaggctcctgtgctggtggtgtacgacgac GIPERFSGSNSGNTATLTI agcgatagacctagcggcatccccgagagattcagcggcagcaattccgg SRVEAGDEADYYCQVWDS caataccgccacactgaccatcagcagagtggaagctggcgacgaggccg SSDHWVFGGGTKLTVL actactactgccaagtgtgggacagcagcagcgaccactgggttttcggg gaggcacaaagctgacagtgctg VH.sub.anti-VEGF-A EVQLVESGGGLVQPGGSL gaggtgcagctggttgaatctggcggaggactggttcagcctggcggatc -(G.sub.4S).sub.3- RLSCTASGFSLIDYYYMT tctgagactgagctgtaccgccagcggcttcagcctgaccgactactact VL.sub.anti-VEGF-A WVRQAPGKGLEWVGFID acatgacctgggtccgacaggcccctggcaaaggacttgagtgggtcgga -G.sub.4S)- PDDDPYYATWAKGRATIS ttcatcgaccccgacgacgatccttactacgccacatgggccaagggcag VH.sub.anti-ANG-2- RDNSKNTLYLQMNSLRAE attcaccatcagccgggacaacagcaagaacaccctgtacctgcagatga (G.sub.4S).sub.3- DTAVYYCAGGDHNSGWG acagcctgagagccgaggacaccgccgtgtactattgtgccggcggagat VL.sub.anti-ANG-2 LDIWGQGTLVTVSSGGGG cacaatagcggctggggccttgatatttggggccagggttacactggtca SGGGGSGGGGSEIVMTQS ccgtgtctagtggtggaggtggctccggtggcggtggcagcggcggtggc PSTLSASVGDRVITCQAS ggctctgagatcgtgatgacacagagccccagcacactgtctgccagcgt EIIHSWLAWYQQKPGKAP gggagacagagtgatcatcacatgccaggccagcgagatcatccacagct KLLIYLASTLASGVPSRFS ggctggcttggtatcagcagaagcctggcaaggcccctaagctgctgatc GSGSGAEFTLTISSLQPDD tacctggcctctacactggccagcggagtgcctagcagattttctggctc FATYYCQNVYLASTNGA tggatctggcgccgagttcaccctgaccatcagtagcctgcagcctgacg NFGQGTKLTVLGGGGGS acttcgccacctactactgccagaacgtgtacctggccagcaccaacggc QVQLVQSGAEVKKPGAS gccaattttggccagggcaccaagctgacagtgctgggaggcggaggggg VKVSCKASGYTFTGYYM ctctcaggttcagctggttcagtctggcgccgaagtgaagaaacctggcg HWVRQAPGQGLEWMGW cctctgtgaaggtgtcctgcaaggccagcggctacacctttaccggctac INPNSGGTNYAQKFQGRV tacatgcactgggtccgacaggctccaggacagggacttgaatggatggg TMTRDTSISTAYMELSRLR ctggatcaaccccaatagcggcggcaccaattacgcccagaaattccagg SDDTAVYYCARSPNPYYY gcagagtgaccatgaccagagacaccagcatcagcaccgcctacatggaa DSSGYYYPGAFDIWGQGT ctgagccggctgagatccgatgacaccgccgtgtactactgcgccagatc MVTVSSGGGGGGGGSG tcccaatccttactactacgacagcagcggctactactacccaggcgcct GGGSSYVLTQPPSVSVAP tcgatatttggggccagggcacaatggtcaccgtgtctagtggtggagct GQTARITCGGNNIGSKSV ggctccggtggcgctggcagcggcggtcgcggctctagctacgtgctgac HWYQQKPGQAPVIVVYD acagcctccatccgtgtctgtggctccaggacagaccgccagaatcacat DSDRPSGIPERFSGSNSGN gcggcggcaacaacatcggcagcaagagcgtgcactggtatcagcagaag TATLTISRVEAGDEADYYC cctggacaggctcctgtgctggtggtgtacgacgacagcgatagacctag QVWDSSSDHWVFGGGTK cggcatccccgagagattcagcggcagcaattccggcaataccgccacac LTVI tgaccatcagcagagtggaagctggcgacgagggcgactactactgccaa gtgtgggacagcagcagcgaccactgggttttcggcggaggcacaaagct gacagtgctg CD5-sp- MPMGSLQPLATLYLLGML atgccaatggggtccctacaacccctggcaacactatatctgctaggtat VH.sub.anti-VEGF-A VASCLGEVQLVESGGGLV gctcgtggcctcctgtttaggagaggtgcagctggttgaatctggcggag (G.sub.4S).sub.3- QPGGSLRLSCTASGPSLTD gactggttcagcctggcggatctctgagactgagctgtaccgccagcggc VL.sub.anti-VEGF-A YYYMTWVRQAPGKGLE ttcagcctgaccgactactactacatgacctgggtccgacaggcccctgg -G.sub.4S- WVGFIDPDDDPYYATWA caaaggacttgagtgggtcggattcatcgaccccgacgacgatccttact VH.sub.anti-ANG-2 KGRFTISRDNSKNTLYLQ acgccacatgggccaagggcagattcaccatcagccgggacaacagcaag (G.sub.4S).sub.3- MNSLRAEDTAVYYCAGG aacaccctgtacctgcagatgaacagcctgagagccgaggacaccgccgt VL.sub.anti-ANG-2 DHNSGWGLDIWGQGTLV gtactattgtgccggcggagatcacaatagcggctggggccttgatattt TVSSGGGGSGGGGSGGG ggggccagggaacactggtcaccgtgtctagtggtggaggtggctccggt GSEIVMTQSPSTLSASVGD ggcggtggcagcggcggtggcggctctgagatcgtgatgacacagagccc RVUTCQASEIHSWLAWY cagcacactgtctcccagcgtgggagacagagtgatcatcacatgccagg QQKPGKAPKLLIYLASTL ccagcgagatcatccacagctggctggcttggtatcagcagaagcctggc ASGVPSRFSGSGSGAEFTL aaggcccctaagctgctgatctacctggcctctacactggccagcggagt TISSLQPDDFATYYCQNV gcctagcagattttctggctctggatctggcgccgagttcaccctgacca YLASTNGANFGQGTKLTV tcagtagcctgcagcctgacgacttcgccacctactactgccagaacgtg LGGGGGSQVQLVQSGAE tacctggccagcaccaacggcgccaattttggccagggcaccaagctgac VKKPGASVKVSCKASGY agtgctgggaggcggagggggctctcaggttcagctcgttcagtctggcg TFTGYYMHWVRQAPGQG ccgaagtgaagttaacctggcgcctctgtgaaggtgtcctgcaaggccgg LEWMGWINPNSGGTNYA cggctacacctttaccggctactacatgcactgggtccgacaggctccag QKFQGRVTMTRDTSISTA gacagggacttgaatggatgggctggatcaaccccaatagcggcggcacc YMELSRLRSDDTAVYYCA aattacgcccagaaattccagggcagagtgaccatgaccagagacaccag RSPNPYYYDSSGYYYPGA catcagcaccgcctacatggaactgagccggctgagatccgatgacaccg FDIWGQGTMVTVSSGQG ccgtgtactactgcgccagatctcccaatccttactactacgacagcagc GSGGGGSGGGGSSYVETQ gggtactactacccaggcgccttcgatatttggggccagggcacagctct PPSVSVAPGQTARITCGGN agctacgtgctgacacagcctccatccgtgtctgtggctccaggacagac NIGSKSVHWYQQKPGQA cgccagaatcacatgcggcggcaacaacatcggcagcaagagcgtgcact PVLVVYDDSDRPSGIPERF ggtatcagcagaagcctggacaggctcctgtgctggtggtgtacgacgac SGSNSGNTATLTISRVEAG agcgatagacctagcggcatccccgagagattcagcggcagcaattccgg DEADYYCQVWDSSSDHW caataccgccacactgaccatcagcagagtggaagctggcgacgaggccg VFGGGTKLIVL actactactgccaagtgtgggacagcagcagcgaccactgggttttcggc ggaggcacaaagctgacagtgctg XMVA04 VH.sub.anti-VEGF-A EVQLVESGGGLVQPGGSL gaggtgcagctggtggagagcggaggaggactggtgcagccaggaggctc (G6-23) RLSCAASGFTISDYWIHW cctgcggctgtcttgcgccgccagcggctttaccatctccgactactgga VRQAPGKGLEWVAGITPA ttcactgggtgagacaggcacctggcaagggactggagtgggtcgcagga GGYTYYADSVKGRFTISA atcaccccagcaggaggctacacatactatgccgacagcgtgaagggccg DTSKNTAYLQMNSLRAED gttcaccatctccgccgatacctctaagaacacagcctatctgcagatga TAVYYCARFVFFLPYAMD actccctgcgggccgaggacacagccgtgtactattgcgccagattcgtg YWGQGTLVTVSS ttcttcctgccatacgccatggattattggggccagggcaccctggtgac agtgagctcc VL.sub.anti-VEGF-A DIQMTQSPSSLSASVGDR gatattcagatgacacagtccccatctagcctgtctgccagcgtgggcga (G6-23) VTITCRASQDVSTAVAWY cagcgtgaccatcacatgtagagcaagccaggacgtgagcaccgcagtgg QQKPGKAPKLLIYSASFLY catggtaccagcagaagcctggcaaggccccaaagctgctgatctactcc SGVPSRFSGSGSGTDFTLT gcctctttcctgtattctggcgtgccaagcaggtttagcgggtccggatc ISSLQPEDFATYYCKQGYA tggaaccgacttcaccctgacaatctcctctctgcagcctgaggattttg NPWTFGQGTKVEIKR ccacatactattgcaagcagggctatgccaatccatggaccttcggccag ggcacaaaggtggagatcaagagg VH.sub.anti-ANG-2 QVQLVQSGAEVKKPGAS caggttcagctggttcagtctggcgccgaagtgaagaaacctggcgcctc VKVSCKASGYTFTGYYM tgtgaaggtgtcctgcaaggccagcggctacacctttaccggctactaca HWVRQAPGQGLEWMGWI tgcactgggtccgacaggctccaggacagggacttgaatggatgggctgg NPNSGGTNYAQKFQGRVT atcaaccccaatagcggcggcaccaattacgcccagaaattccagggcag MTRDTSISTAYMELSRLR agtgaccatgaccagagacaccagcatcagcaccgcctacatggaactga SDDTAVYYCARSPNPYYY gccggctgagatccgatgacaccgccgtgtactactgcgccagatctccc DSSGYYYPGAFDIWGQGT aatccttactactacgacagcagcgggtactactacccaggcgccttcga MVTVSS tatttggggccagggcacaatggtcaccgtgtctagt VL.sub.anti-ANG-2 SYVETQPPSVSVAPGQTAR agctacgtgctgacacagcctccatccgtgtctgtggctccaggacagac ITCGGNNIGSKSVHWYQQ cgccagaatcacatgcggcggcancancatcggcagcaagagcgtgcact KPGQAPVLVVYDDSDRPS ggtatcagcagaagcctggacaggctcctgtgctggtggtgtacgacgac GIPERFSGSNSGNTATLT agcgatagacctagcggcatccccgagagattcagcggcagcaattccgg ISRVEAGDEADYYCQVWD caataccgccacactgaccatcagcagagtggaagctcgcgacgaggccg SSSDHWVFGGGTKLTVL actactactgccaagtgtgggacagcagcagcgaccactgggttttcggc ggaggcacaaagctgacagtgctg VH.sub.anti-VEGF-A- EVQLVESGGGLVQPGGSL gaggtgcagctggtggagagcggaggaggactggtgcagccaggaggctc (G.sub.4S).sub.3- RLSCAASGETISDYWIHW cctgcggctgtcttgcgccgccagcggctttaccatctccgactactgga VL.sub.anti-VEGF-A- VRQAPGKGLEWVAGITPA ttcactgggtgagacaggcacctggcaagggactggagtgggtggcagga G.sub.4S- GGYTYYADSVKGRFTISA atcaccccagcaggaggctacacatactatgccgacagcgtgaagggccg VH.sub.anti-ANG-2- DESKNTAYLQMNSLRAED gttcaccatctccgccgatacctctaagttacacagcctatctgcagatg (G.sub.4S).sub.3- TAVYYCARFVEFLPYAMD aactccctgcgggccgaggacacagccgtgtactattgcgccagattcgt VL.sub.anti-ANG-2 YWGQGTLVTVSSGGGGS gttcttcctgccatacgccatggattattggggccagggcaccctggtga GGGGSGGGGSDIQMTQSP cagtgagctccggtggaggtggctccggtggcggtggcagcggcggtggc SSLSASVGDRVTITCRAS ggctctgatattcagatgacacagtccccatctagcctgtctgccagcgt QDVSTAVAWYQQKPGKAP gggcgacagggtgaccatcacatgtagagcaagccaggacgtgagcaccg KLLIYSASFLYSGVPSRFS cagtggcatggtaccagcagaagcctggcaaggccccaaagctgctgatc GSGSGTDFTLTISSLQPED tactccgcctctttcctgtattctggcgtgccaagcaggtttagcgggtc FATYYCKQGYANPWTFG cggatctggaaccgacttcaccctgacaatctcctctctgcagcctgagg QGTKVEIKRGGGGSQVQL attttgccacatactattgcaagcagggctatgccaatccatggaccttc VQSGAEVKKPGASVKVS ggccagggcacaaaggtggagatcaagaggggggagggggctctcaggtt CKASGYTFTGYYMHWVR cagctggttcagtctggcgccgangtgBagaaacctcgcgcctctgtgaa QAPGQGLEWMGWINPNS ggtgtcctgcaaggccagcggctacacctttaccggctactacatgcact GGTNYAQKPQGRVTMTRD gggtccgacaggctccaggacagggacttgaatggatgggctggatcaac TSISTAYMELSRERSDDT cccaatagcggcggcaccaattacgcccagaaattccagggcagagtgac AVYYCARSPNPYYYDSSG catgaccagagacaccagcatcagcaccgcctacatggaactgagccggc YYYPGAFDIWGQGTMVT tgagatccgatgacaccgccgtgtactactgcgccagatctcccaatcct VSSGGGGSGGGGSGGGG tactactacgacagcagcgggtactgaggtggctccggtggcggtggcag SSYVLTQPPSVSVAPGQTA cgacggtcgcggctctagctacgtgctgacacagcctccatccgtgtctg RITCGGNNIGSKSVHWYQ tggctccaggacagaccgccagaatcacatgcggcggcaacaacatcggc QKPGQAPVLVVYDDSDRP agcaagagcgtgcactggtatcagcagaagcctggacaggctcctgtgct SGIPERFSGSNSGNTATLT ggtggtgtacgacgacagcgatagacctagcggcatccccgagagattca ISRVEAGDEADYYCQVW gcggcagcaattccggcaataccgccacactgaccatcagcagagtcgaa DSSSDHWVFGGGTKLTVL gctggcgacgaggccgactactactgccaagtgtgggacagcagcagcga ccactgggttttcggcggaggcacaaagctgacagtgctg CD5-sp- MPMGSLQPLATLYLLGML atgccaatggggtccctacaacccctggcaacactatatctgctaggtat VH.sub.anti-VEGF-A- VASCLGEVQLVESGGGLV gctcgtggcctcctgtttaggagaggtgcagctggtggagagcggaggag (G.sub.4S).sub.3- QPGGSLRLSCAASGFTISD gactggtgcagccaggaggctccctgcggctgtcttgcgccgccagcggc VL.sub.anti-VEGF-A- YWIHWVRQAPGKGLEW tttaccatctccgactactggattcactgggtgagacaggcacctggcaa G.sub.4S- VAGITPAGGYTYYADSVK gggactggagtgggtggcaggaatcaccccagcaggaggctacacatact VH.sub.anti-ANG-2- GRFTISADTSKNTAYLQM atgccgacagcgtgaagggccggttcaccatctccgccgatacctctaag (G.sub.4S).sub.3- NSLRAEDTAVYYCARFVF aacacagcctatctgcagatgaactccctgcgggccgaggacacagccgt VL.sub.anti-ANG-2 FLPYAMDYWGQGTLVTV gtactattgcgccagattcgtgttcttcctgccatacgccatggattatt SSGGGGSGGGGSGQGGS gcggccagggcaccctggtgacagtgagctccggtggaggtggctccggt DIQMTQSPSSLSASVGDR ggcggtggcagcggcgctggcggctctgatattcagatgacacagtcccc VTITCRASQDVSTAVAWY atctagcctgtctgccagcgtgggcgacagggtgaccatcacatgtagag QQKPGKAPKLLIYSASFLY caagccaggacgtgagcaccgcagtggcatggtaccagcagaagcctggc SGVPSRFSGSGSGTDFILT aaggccccaaagctgctgatctactccgcctctttcctgtattctggcgt ISSLQPEDFATYYCKQGYA gccaagcaggttttagcgggtccggatctcgaaccgacttcaccctgaca NPWTPGQGTKVEIKRGG atctcctctctgcagcctgaggattttgccacatactattgcaagcaggg GGSQVQLVQSGAEVKKP ctatgccaatccatggaccttcggccagcgcacaaaggtggagatcaaga GASVKVSCKASGYTFTGY ggggcggagggggctctcaggttcagctggttcagtctggcgccgaagtg YMHWVRQAPGQGLEWM angBancctggcgcctctgtgaaggtgtcctgcaaggccagcggctacac GWINPNSGGTNYAQKFQ ctttaccggctactacatgcactgggtccgacaggctccnggacagggnc GRVTMTRDTSISTAYMEL ttgaatggatgggctggatcaaccccaatagcggcggcaccaattacgcc SRLRSDDTAVYYCARSPN cagaaattccagggcagagtgaccatgaccagagacaccagcatcagcac PYYYDSSGYYYPGAFDIW cgcctacatggaactgagccggctgagatccgatgacaccgccgtgtact GQGTMVTVSSGGGGSGG actgcgccagatctcccaatccttactactacgacagcagcgggtactac GGSGGGGSSYVETQPPSV tacccaggcgccttcgatatttggggccagggcacaatggtcaccgtgtc SVAPGQTARITCGGNNIGS tagtgctggagctggctccggtggcggtggcagcggcggtcgcggctcta KSVHWYQQKPGQAPVLV gctacgtgctgacacagcctccatccgtgtctgtggctccaggacagacc VYDDSDRPSGIPERFSGSN gccagaatcacatgcggcggcaacaacatcggcagcaagagcgtgcactg SGNTATLTISRVEAGDEAD gtatcagcagaagcctggacaggctcctgtgctggtggtgtacgacgaca YYCQVWDSSSDHWVFGG gcgatagacctagcggcatccccgagagattcagcggcagcaattccggc GTKLTVL aataccgccacactgaccatcagcagagtggaagctggcgacgaggccga ctactactgccaagtgtgggacagcagcagcgaccactgggttttcggcg gaggcacaaagctgacagtgctg

Example 2. Measurement of Expression of XMVA01, XMVA04, and XMVA09 in Cells

[0061] The HEK293T cells were transfected with pAAV9-XMVA01, pAAV9-XMVA04 and pAAV9-XMVA09 plasmids respectively, the supernatant was collected, and the expression of proteins in the supernatant was detected by ELISA. The specific operation is as follows: 293T cells were resuspended in complete culture medium of DMEM containing 10% fetal bovine serum, inoculated into a culture dish, and cultured at 37 C. in 5% CO.sub.2 incubator until the confluence of the cells reaches 70%-90%, then the plasmid was transfected using Lipofectamine 2000 (Invitrogen) transfection reagent according to the instructions thereof. The culture was continued for 72 hours, and then the supernatant was collected and stored at 80 C. for later use.

[0062] The specific detection method of ELISA was as follows: an ELISA plate (Thermo) was coated with 0.1 g/mL VEGF165 (proteintech) protein, 100 L per well, incubated overnight at 4 C., and the ELISA plate was washed three times with PBS containing 0.05% Tween (Sangon) for 3 minutes each time. The plates were blocked with PBS 200 L/well containing 2% BSA (MikeBio) for 1 hour at room temperature and washed three times again. Conbercept (10 mg/mL) standard and the cell supernatants collected after transfecting HEK293T cells with pAAV9-XMVA01, pAAV9-XMVA04, and pAAV9-XMVA09 plasmids were added to the ELISA plate. The standard was diluted at 8 continuous dilutions starting at 312.5 ng/mL from the first well, and the supernatants to be tested were diluted at 1:10 or 1:50, the data were averaged, and a cell supernatant without plasmid transfection was used as a Control group, and the plate was incubated at 37 C. for 1 hour, and washed three times. A 1:5000 dilutions of goat anti-human IgG antibody (Jackson Immuno Research) labeled with horseradish peroxidase was added to each well, and the plate was incubated at 37 C. for 1 hour, and then washed three times. 100 L/well of TMB chromogen solution (Beyotime) was added to each well, and reacted for 6 minutes at room temperature in the dark, and 100 L/well of stop solution (Beyotime) was added to the above wells to terminate the reaction. A microplate reader was used to detect the OD value at 450 nm, and the contents of the sample to be tested were calculated. The results are shown in FIG. 3. Cells transfected with pAAV9-XMVA01, pAAV9-XMVA04 and pAAV9-XMVA09 vectors can effectively express VEGF165 neutralizing protein, with significant differences compared with the Control group.

Example 3. Effects of Expressing XMVA01, XMVA04, and XMVA09 in Cells on the Proliferation of Human Retinal Microvascular Endothelial Cells (HRMEC)

[0063] The cell density of HRMECs was adjusted to 410.sup.4/mL with complete culture medium (Science Cell) of the ECM containing 1% ECGS, and the cells were inoculated 100 L/well into a flat-bottom 96-well plate; after the pAAV9-XMVA01, pAAV9-XMVA04 and pAAV9-XMVA09 plasmids were transfected into HEK293T cells, respectively, the collected cell supernatants were added into the wells at 100 L/well, and the cell supernatant without transfected plasmids was used as a Control group, and the cells were cultured for 72 hours at 37 C. in a 5% CO.sub.2 incubator. 20 L/well of CCK-8 solution was added to the experimental group and control group respectively according to the instructions of Cell Counting Kit-8 (CCK-8, Biosharp). After incubation for 4 hours, a microplate reader was used to detect the OD value at 450 nm wavelength. The results are shown in FIG. 4. The protein expressed by pAAV9-XMVA09 can effectively inhibit the proliferation of HRMECs under the stimulation of ECGS, and the inhibition effect is significantly better than that of pAAV9-XMVA01 and pAAV9-XMVA04.

Example 4. Effects of Expressing XMVA01, XMVA04, and XMVA09 in Cells on the Tube Formation of HRMECS

[0064] The thawed matrigel (Corning) was uniformly spreaded in a flat-bottom 96-well plate, 50 L/well, and then the plate was incubated at 37 C. for 1 hour in a 5% CO.sub.2 incubator; after the pAAV9-XMVA01, pAAV9-XMVA04 and pAAV9-XMVA09 plasmids were transfected into HEK293T cells, respectively, the collected cell supernatants were used to treat HRMECs, the cell supernatant without transfected plasmids was used as a control group, and the cells were resuspended with a basal medium of ECM without growth factors and serum after cultured for 48 hours, adjusted the cell density to 210.sup.5/mL, and inoculated at 100 L/well in a 96-well plate containing matrigel, and cultured in a 5% CO.sub.2 incubator at 37 C., and observed once every 2 hours; after 4 to 8 hours, the cells were observed and photographed under a microscope, and the influence of the supernatants to be tested on the formation of HRMECs tubes were recorded. The results are shown in FIG. 5. The protein expressed by pAAV9-XMVA09 can effectively inhibit the formation of HRMECs tubes, and the inhibition effect is significantly better than that of pAAV9-XMVA01 and pAAV9-XMVA04.

Example 5. Construction of Other Plasmid Vectors

Scheme 1

[0065] The VH amino acid sequence and the VL amino acid sequence of anti-VEGF, the VH amino acid sequence and the VL amino acid sequence of anti-ANG-2 were linked with G.sub.4S, (G.sub.4S).sub.3 and G.sub.4S peptide linkers, respectively, with a secretory signal peptide CD5-sp nucleotide sequence added to the N-terminus to form an open reading frame with the structure of CD5-sp-VL.sub.anti-ANG-2-G.sub.4S-VH.sub.anti-VEGF-A-(G.sub.4S).sub.3-VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2; the nucleotide sequence was designed according to human codon preference, with a BamH I cleavage site introduced at the 5 terminus, and an EcoR V cleavage site introduced at the 3 terminus, and was named as XMVA10 (FIG. 7). The VH amino acid sequence and the VL amino acid sequence of anti-VEGF, the VH amino acid sequence and the VL amino acid sequence of anti-ANG-2 were identical to XMVA09.

Scheme 2

[0066] The VH amino acid sequence and the VL amino acid sequence of anti-VEGF, the VH amino acid sequence and the VL amino acid sequence of anti-ANG-2 were linked with G.sub.4S, (G.sub.4S).sub.3 and G.sub.4S peptide linkers, respectively, with a secretory signal peptide CD5-sp nucleotide sequence added to the N-terminus to form an open reading frame with the structure of CD5-sp-VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2-(G.sub.4S).sub.3-VL.sub.anti-ANG-2-G.sub.4S-VH.sub.anti-VEGF-A; the nucleotide sequence was designed according to human codon preference, with a the BamH I cleavage site introduced at the 5 terminus, and an EcoR V cleavage site introduced at the 3 terminus, and was named as XMVA11 (FIG. 8). The VH amino acid sequence and the VL amino acid sequence of anti-VEGF, the VH amino acid sequence and the VL amino acid sequence of anti-ANG-2 were identical to XMVA09.

Scheme 3

[0067] The VH amino acid sequence and the VL amino acid sequence of anti-VEGF, the VH amino acid sequence and the VL amino acid sequence of anti-ANG-2 were linked with (G(S).sub.3, G.sub.4S and (G.sub.4S).sub.3 peptide linkers, respectively, with a secretory signal peptide CD5-sp nucleotide sequence added to the N-terminus to form an open reading frame with the structure CD5-sp-VH.sub.anti-VEGF-A-(G.sub.4S).sub.3-VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2-(G.sub.4S).sub.3-VL.sub.anti-ANG-2; the nucleotide sequence was designed according to human codon preference, with a BamH I cleavage site introduced at the 5 terminus, and an EcoR. V cleavage site introduced at the 3 terminus, and was named as XMVA13 (FIG. 9).

Scheme 4

[0068] The VH amino acid sequence and the VL amino acid sequence of anti-VEGF, the VH amino acid sequence and the VL amino acid sequence of anti-ANG-2 were linked with G.sub.4S, (G.sub.4S).sub.3 and G.sub.4S peptide linkers, respectively, with a secretory signal peptide CD5-sp nucleotide sequence added to the N-terminus to form an open reading frame with the structure of CD5-sp-VL.sub.anti-ANG-2-G.sub.4S-VH.sub.anti-VEGF-A-(G.sub.4S).sub.3-VL anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2; the nucleotide sequence was designed according to human codon preference, with a BamH I cleavage site introduced at the 5 terminus, and an EcoR V cleavage site introduced at the 3 terminus, and was named as XMVA14 (FIG. 10). The VH amino acid sequence and the VL amino acid sequence of anti-VEGF, the VH amino acid sequence and the VL amino acid sequence of anti-ANG-2 were identical to XMVA13.

Scheme 5

[0069] The VH amino acid sequence and the VL amino acid sequence of anti-VEGF, the VH amino acid sequence and the VL amino acid sequence of anti-ANG-2 were linked with G.sub.4S, (G.sub.4S).sub.3 and G.sub.4S peptide linkers, respectively, with a secretory signal peptide CD5-sp nucleotide sequence added to the N-terminus to form an open reading frame with the structure of CD5-sp-VL.sub.anti-VEGF-A-G.sub.4S-VH.sub.anti-ANG-2-(G.sub.4S).sub.3-VL.sub.anti-ANG-2-G.sub.4S-VH.sub.anti-VEGF-A; the nucleotide sequence was designed according to human codon preference, with a BamH I cleavage site introduced at the 5 terminus, and an EcoR V cleavage site introduced at the 3 terminus, and was named as XMVA15 (FIG. 11). The VH amino acid sequence and the VL amino acid sequence of anti-VEGF, the VH amino acid sequence and the VL amino acid sequence of anti-ANG-2 were identical to XMVA13.

[0070] XMVA10, XMVA11, XMVA13, XMVA14 and XMVA15 vectors were constructed through conventional molecular biology operations such as ligation, transformation, cloning screening and identification, and high-quality plasmid DNA was obtained for later use by using an endotoxin-free plasmid extraction kit (MN).

[0071] According to the method described in Example 2, plasmids were transfected into HEK293T cells, respectively, supernatants were collected, and expression of protein in supernatant was detected by ELISA. The effect of expressing the above vectors in cells on the proliferation of HRMECs was detected according to the method described in Example 3. The effect of expressing the above plasmids in cells on HRMECs tube formation was detected according to the method described in Example 4. Recombinant AAV viruses were prepared and identified according to the method described in Example 5.

TABLE-US-00003 TABLE3 SequenceinformationofXMVA10-XMVAIS Sequence Product informa- Number tion AAsequence DNAsequence XMVA10 VL.sub.anti-ANG-2- EIVLTQSPGTLSLSPGERA SEQ gagatcgtgctgacacagagccctggcacactgtcactgtctccag SEQ G.sub.4S- TLSCRASQSITGSYLAWYQ ID gcgaaagagccacactgagctgtagagccagccagagcatcaccg ID VH.sub.anti-VEGF-A- QKPGQAPRLLICGASSWAT NO: gctcttacctggcttggtatcagcagaagcctggacaggcccctaga NO: (G.sub.4S).sub.3- GIPDRESGSGSGTDFTLTI 18 ctgctgatttgtggcgcctcttcttgggccaccggcattcccgatagat 43 VL.sub.anti-VEGF-A- SRLEPEDFAVYYCQQYSSS tttctggcagcggctccggcaccgacttcaccctgacaatcagcaga G.sub.4S- PITFGQGTRLEIKRGGGGS ctggaacccgaggacttcgccgtgtactactgccagcagtacagca VH.sub.anti-ANG-2 EVQLVESGGGLVQPGGSL gcagccccatcacctttggccagggcacaagactggaaatcaagc RISCAASGFTISDYWIHW ggggcggagggggctctgaggtgcagctggtggagagcggagg VRQAPGKGLEWVAGITPA aggactggtgcagccaggaggctccctgcggctgtcttgcgccgcc GQYTYYADSVKQRFTISA agcggctttaccatctccgactactggattcactgggtgagacaggc DISKNTAYLQMNSERAED acctggcaagggactggagtgggtggcaggaatcaccccagcag TAVYYCARFVFFLPYAMD gaggctacacatactatgccgacagcgtgaagggccggttcaccat YWGQGTLVTVSSGGGGS ctccgccgatacctctaagaacacagcctatctgcagatgaactccct GGGGSGGGGSDIQMTQSP gcgggccgaggacacagccgtgtactattgcgccagattcgtgttct SSLSASVGDRVTITCRASQ tcctgccatacgccatggattattggggccagggcaccctggtgaca DVSTAVAWYQQKPGKAP gtgagctccggtggaggtggctccggtggcggtggcagcggcggt KLLIYSASFLYSGVPSRES ggcggctctgatattcagatgacacagtccccatctagcctgtctgcc GSGSGTDFTLTISSLQPED agcgtgggcgacagggtgaccatcacatgtagagcaagccaggac FATYYCKQGYANPWTFGQ gtgagcaccgcagtggcatggtaccagcagaagcctggcaaggcc GTKVEIKRGGGGSQVQLV ccaaagctgctgatctactccgcctctttcctgtattctggcgtgccaa ESGGGVVQPGRSLRLSCA gcaggtttagcgggtccggatctggaaccgacttcaccctgacaatc ASGFTFINYGMHWGRQA tcctctctgcagcctgaggattttgccacatactattgraagcagggct PGKGLEWVAVISHDGNNK atgccaatccatggaccttcggccagggcacaaagctggagatcaa YYVDSVKGRFTISRDNSK gaggggcggagggggctctcaggtgcagctggttgaatctggtgg NTLYLQMNSLRAEDTAVY cggagttgtgcagcctggcagaagcctgagactgtcttgtgccgcc YCAREGIDFWSGLNWFDP agcggcttcaccttcaccaactatggaatgcactggggcagacagg WGQGTLVTVSSA cccctggcaaaggacttgaatgggtcgccgtgatcagccacgacg gcaacaacaagtactacgtggacagcgtgaagggcagattcaccat cagccgggacaacagcaagaacaccctgtacctgcagatgaacag cctgagagccgaggacaccgccgtgtactattgtgccagagaggg catcgacttttggagcggcctgaattggttcgacccttggggacagg gcaccctggttacagtttcttctgcc CD5-sp- MPMGSLQPLATLYLLGMLV SEQ atgccaatggggtccctacaacccctggcaacactatatctgctaggt SEQ VL.sub.anti-ANG-2- ASCLGEIVLTQSPGTLSLS ID atgctcgtggcctcctgtttaggagagatcgtgctgacacagagccc ID G.sub.4S- PGERATLSCRASQSITGSY NO: tggcacactgtcactgtctccaggcgaaagagccacactgagctgta NO: VH.sub.anti-VEGF-A- LAWYQQKPGQAPRLLICG 21 gagccagccagagcatcaccggctctacctggcttggtatcagca 44 (G.sub.4S).sub.3- ASSWATGIPDRESGSGSGT gaagcctggacaggcccctagactgctgatttgtggcgcctcttcttg VL.sub.anti-VEGF-A- DFTLTISRLEPEDFAVYYC ggccaccggcattcccgatagattttctggcagcggctccggcacc G.sub.4S- QQYSSSPITPGQGTRLEIK gacttcaccctgacaatcagcagactggaacccgaggacttcgccg VH.sub.anti-ANG-2 RGGGGSEVQLVESGGGLV tgtactactgccagcagtacagcagcagccccatcacctttggccag QPGGSERLSCAASGFTISD ggcacaagactggaaatcaagcggggcggagggggctctgaggt YWIHWVRQAPGKGLEWV gcagctggtggagagcggaggaggaatggtgcagccaggaggct AGITPAGGYTYYADSVKG ccctgcggctgtcttgcgccgccagcggctttaccatctccgactact RFTISADTSKNTAYLQMNS ggattcactgggtgagacaggcacctggcaagggactggagtggg LRAEDTAVYYCARFVFFL tggcaggaatcaccccagcaggaggctacacatactatgccgaca PYAMDYWGQGTLVTVSS gcgtgaagggccggttcaccatctccgccgatacctctaagaacac GGGGSGGGGSGGGGSDIQ agcctatctgcagatgaactccctgcgggccgaggacacagccgtg MTQSPSSLSASVGDRVTIT tactattgcgccagattcgtgttcttcctgccatacgccatggattattg CRASQDVSTAVAWYQQKP gggccagggcaccctggtgacagtgagctccggtggaggtggctc GKAPKLLIYSASFLYSGVP cggtggcggtggcagcggcggtggcggctctgatattcagatgaca SRFSGSGSGTDFTLTISSL cagtccccatctagcctgtctgccagcgtgggcgacagggtgacca QPEDFATYYCKQGYANPWT tcacatgtagagcaagccaggacgtgagcaccgcagtggcatggt FGQGTKVEIKRGGGGSQV accagcagaagcctggcaaggccccaaagctgctgatctactccgc QLVESGGGVVQPGRSLRL ctctttcctgtattctggcgtgccaagcaggtttagcgggtccggatct SCAASQFTFTNYGMHWG ggaaccgacttcaccctgacaatctcctctctgcagcctgaggatttt RQAPGKGLEWVAVISHDG gccacatactattgcaagcagggctatgccaatccatggaccttcgg NNKYYVDSVKGRFTISRD ccagggcacaaaggtggagatcaagaggggcggagggggctctc NSKNILYLQMNSLRAEDT aggtgcagctggttgaatctggtggcggagttgtgcagcctggcag AVYYCAREGIDFWSGLN aagcctgagactgtcttgtgccgccagcggcttcaccttcaccaacta WEDPWGQGTLVTVSSA tggaatgcactggggcagacaggcccctggcaaaggacttgaatg ggtcgccgtgatcagccacgacggcaacaacaagtactacgtgga cagcgtgaagggcagattcaccatcagccgggacaacagcaagaa caccctgtaccrgcagatgaacagcctgagagccgaggacaccgc cgtgtactattgtgccagagagggcatcgacttttggagcggcctga attggttcgacccttggggacagggcaccctggttacagtttcttctgc c XMVAII VL.sub.anti-VEGF-A DIQMTQSPSSLSASVGDRV SEQ gatattcagatgacacagtccccatctagcctgtctgccagcgtggg SEQ -G.sub.4S- TITCRASQDVSTAVAWYQ ID cgacagggtgaccatcacatgtagagcaagccaggacgtgagcac ID VH.sub.anti-ANG-2 QKPGKAPKLLIYSASFLYS NO: cgcagtggcatggtaccagcagaagcctggcaaggccccaaagct NO: -(G.sub.4S).sub.3- GVPSRFSGSGSGTDETLTI 19 gctgatctactccgcctctttcctgtattctggcgtgccaagcaggttta 45 VL.sub.anti-ANG-2 SSLQPEDFATYYCKQGYAN gcgggtccggatctggaaccgacttcaccctgacaatctcctctctg G.sub.4S- PWTFGQGTKVEIKRGGGG cagcctgaggattttgccacatactattgcaagcagggctatgccaat VH.sub.anti-VEGF-A SQVQLVESGGGVVQPGRS ccatggaccttcggccagggcacaaaggtggagatcaagagggg LRLSCAASGFTETNYGMH cggagggggctctcaggtgcagctggtttgaatctggtggcggagtt WGRQAPGKGLEWVAVISH gtgcagcctggcagaagcctgagactgtcttgtgccgccagcggct DGNNKYYVDSVKGRFTIS tcaccttcaccaactatggaatgcactggggcagacaggcccctgg RDNSKNTLYLQMNSLRAE caaaggacttgaatgggtcgccgtgatcagccacgacggcaacaa DTAVYYCAREGIDFWSGL caagtactacgtggacagcgtgaagggcagattcaccatcagccgg NWEDPWGQGTLVTVSSA gacaacagcaagaacaccctgtacctgcagatgaacagcctgaga GGGGSGGGGSGGGGSEIV gccgaggacaccgccgtgtactattgtgccagagagggcatcgact LTQSPGTLSLSPGERATLS tttggagcggcctgaattggttcgacccttggggacagggcaccctg CRASQSITGSYLAWYQQKP gttacagtttcttctgccggtggaggtggctccggtggcggtggcag GQAPRLLICGASSWATGIP cggcggtggcggctctgagatcgtgctgacacagagccctggcac DRFSGSGSGTDFTLTISRL actgtcactgtctccaggcgaaagagccacactgagctgtagagcc EPEDFAVYYCQQYSSSPIT agccagagcatcaccggctcttacctggcttggtatcagcagaagcc FGQGTRLEIKRGGGGSEV tggacaggcccctagactgctgatttgtggcgcctcttcttgggccac QLVESGGQLVQPGGSLRL cggcattcccgatagattttctggcagcggctccggcaccgacttca SCAASGETISDYWIHWVR ccctgacaatcagcagactggaacccgaggacttcgccgtgtacta QAPGKGLEWVAGITPAGG ctgccagcagtacagcagcagccccatcacctttggccagggcaca YTYYADSVKGRFTISADTS agactggaBatcaagcggggggagggggctctgaggtgcagct KNTAYLQMNSLRAEDTAV ggtggagagcggaggaggactggtgcagccaggaggctccctgc YYCARFVPFLPYAMDYW ggctgtcttgcgccgccagcggctttaccatctccgactactggattc GQGTLVTVSS actgggtgagacaggcacctggcaagggactggagtggctggca ggaatcaccccagcaggaggctacacatactatgccgacagcgtg aagggccggttcaccatctccgccgatacctctaagaacacagccta tctgcagatgaactccctgcgggccgaggacacagccgtgtactatt gcgccagattcgtgttcttcctgccatacgccatggattattggggcc agggcaccctggtgacagtgagctcc CD5-sp- MPMGSLQPLATLYLLGML SEQ atgccaatggggtccctacaacccctggcaacactatatctgctaggt SEQ VL.sub.anti-VEGF-A- VASCLGDIQMTQSPSSLSA ID atgctcgtcgcctcctgtttaggagatattcagatgacacagtccccat ID G.sub.4S- SVGDRVTITCRASQDVSTA NO: ctagcctgtctgccagcgtgggcgacagggtgaccatcacatgtag NO: VH.sub.anti-ANG-2- VAWYQQKPGKAPKLLIYS 22 agcaagccaggacgtgagcaccgcagtggcatggtaccagcaga 46 (G.sub.4S).sub.3- ASFLYSGVPSRESGSGSGT agcctggcaaggccccaaagctgctgatctactccgcctctttcctgt VL.sub.anti-ANG-2- DFTLTISSLQPEDFATYYC attctggcgtgccaagcaggtttagcgggtccggatctggaaccga G.sub.4S- KQGYANPWTFGQGTKVEI cttcaccctgacaatctcctctctgcagcctgaggattttgccacatac VH.sub.anti-VEGF-A KRGGGGSQVQLVESGGG tattgcaagcagggctatgccaatccatggaccttcggccagggca VVQPGRSLRLSCAASGFT caaaggtggagatcaagaggggcggagggggctctcaggtgcag FTNYGMHWGRQAPGKGL ctgcttgaatctggtggcggagttgtgcagcctggcagaagcctga EWVAVISHDGNNKYYVDS gactgtcttgtgccgccagcggcttcaccttcaccaactatggaatgc VKGRFTISRDNSKNTLYLQ actggggcagacaggcccctggcaRaggacttgaatgggtcgccg MNSLRAEDTAVYYCAREG tgatcagccacgacggcaacaacaagtactacgtggacagcgtga IDFWSGLNWEDPWGQGT agggcagattcaccatcagccgggacaacagcaagaacaccctgt LVTVSSAGGGGSGGGGSG acctgcagatgaacagcctgagagccgaggacaccgccgtgtact GGGSEIVLTQSPGTLSLSP attgtgccagagagggcatcgacttttggagcggcctgaattggttc GERATLSCRASQSITGSYL gacccatggggacagggcaccctggttacagttttctttctgccggtgg AWYQQKPGQAPRLLICGA aggtggctccggtggcggtggcagcggcggtggcggctctgagat SSWATGIPDRESGSGSGTD cgtgctgacacagagccctggcacactgtcactgtctccaggcgaa FTLTISRLEPEDFAVYYCQ agagccacactgagctgtagagccagccagagcatcaccggctctt QYSSSPITFGQGTRLEIKR acctggcttggtatcagcagaagcctggacaggcccctagactgct GGGGSEVQLVESGGGLVQ gatttgtggcgcctcttcttgggccaccggcattcccgatagattttct PGGSLRLSCAASGFTISDY ggcagcggctccggcaccgacttcaccctgacaatcagcagactg WIHWVRQAPGKGLEWVA gaacccgaggacttcgccgtgtactactgccagcagtacagcagca GITPAGGYTYYADSVKGR gccccatcacctttggccagggcacaagactggaaatcaagcgcg FTISADTSKNTAYLQMNSL gcggagggggctctgaggtgcagctggtggagagcggaggagg RAEDTAVYYCARFVFELP actggtgcagccaggaggctccctgcggctgtcttgcgccgccagc YAMDYWGQGTLVTVSS ggctttaccatctccgactactggattcactgggtgagacaggcacct ggcaagggactggagtgggtggcaggaatcaccccagcaggagg ctacacatactatgccgacagcgtgaagggccggttcaccatctccg ccgatacctctaagaacacagcctatctgcagatgaactccctgcgg gccgaggacacagccgtgtactattgcgccagattcgtgttcttcctg ccatacgccatggattattggggccagggcaccctggtgacagtga gctcc XMVA13 VH.sub.anti-VEGF-A DYWIH SEQ gactactggattcac SEQ (G6-31)- ID ID CDR1 NO: NO: 1 24 VH.sub.anti-VEGF-A GITPAGGYTYYADSVKG SEQ ggaatcaccccagcaggaggctacacatactatgccgacagcgtg SEQ (G6-31)- ID ID CDR2 NO: NO: 2 25 VH.sub.anti-VEGF-A FVFFLPYAMDY SEQ ttcgtgttcttcctgccatacgccatggattat SEQ (G6-33)- ED ID CDR3 NO: NO: 3 26 VH.sub.anti-VEGF-A EVQLVESGGGLVQPGGSL SEQ gaggtgcagctggtggagagcggaggaggactggtgcagccagga SEQ (G6-31) RLSCAASGFTISDYWIHW ID ggctccctgcggctgtcttgcgccgccagcggctttaccatctccg ID VRQAPGKGLEWVAGITPA NO: actactggattcactgggtgagacaggcacctggcaagggactgga NO: GGYTYYADSVKGRFTISA 13 gtgggtggcaggaatcaccccagcaggaggctacacatactatgcc 27 DTSKNTAYLQMNSLRAED gacagcgtgaagggccggttcaccatctccgccgatacctctaaga TAVYYCARFVFFLPYAMD acacagcctatctgcagatgaactccctgcgggccgaggacacagcc YWGQGTLVTVSS gtgtactattgcgccagattcgtgttcttcctgccatacgccatgga ttattggggccagggcaccctggtgacagtgagctcc VL.sub.anti-VEGF-A RASQDVSTAVA SEQ agagcaagccaggacgtgagcaccgcagtggca SEQ (G6-31)- ID ID CDR1 NO: NO: 4 28 VL.sub.anti-VEGF-A SASFLYS SEQ SEQ (G6-31)- ID ID CDR2 NO: NO: 5 29 VL.sub.anti-VEGF-A QQGYGNPFT SEQ cagcagggctatggcaatccattcacc SEQ (G6-31)- ID ID CDR3 NO: NO: 47 55 VL.sub.anti-VEGF-A DIQMTQSPSSLSASVGDRV SEQ gatattcagatgacacagtccccatctagcctgtctgccagcgtggg SEQ (G6-31) TITCRASQDVSTAVAWYQ ID cgacagggtgaccatcacatgtagagcaagccaggacgtgagcac ID QKPGKAPKLLIYSASFLYS NO: cgcagtggcatggtaccagcagaagcctggcaaggccccaaagct NO: GVPSRFSGSGSGTDETLTI 48 gctgatctactccgcctctttcctgtattctggcgtcccaagcaggttta 56 SSLQPEDFATYYCQQGYGN gcgggtccggatctggaaccgacttcaccctgacaatctcctctctg PFTFGQGTKVEIKR cagcctgaggattttgccacatactattgccagcagggctatggcaat ccattcacctttggccagggcacaaaggtggagatcaagagg VH.sub.anti-ANG-2 QVQLVESGGGVVQPGRSL SEQ caggtgcagctggttgaatctggtggcggagttgtgcagcctggca SEQ (3.19.3) RESCAASGFTFTNYGMH ID gaagcctgagactgtcttgtgccgccagcggcttcaccttcaccaac NO: WGRQAPGKGLEWVAVISH NO: tatggaatgcactggggcagacaggcccctggcaaaggacttgaat 35 DGNNKYYVDSVKGRETIS 15 gggtcgccgtgatcagccacgacggcaacaacaagtactacgtgg RDNSKNTLYLQMNSLRAE acagcgtgaagggcagattcaccatcagccgggacaacagcaaga DTAVYYCAREGIDFWSGL acaccctgtacctgcagatgaacagcctgagagccgaggacaccg NWFDPWGQGTLVTVSSA ccgtgtactattgtgccagagagggcatcgacttttggagcggcctg aattggttcgacccttggggacagggcaccctggttacagtttcttctg CC VL.sub.anti-ANG-2 EIVLTQSPGILSLSPGERAT SEQ gagatcgtgctgacacagagccctggcacactgtcactgtctccag SEQ (3.19.3) LSCRASQSITGSYLAWYQ ID gcgaaagagccacactgagctgtagagccagccagagcatcaccg ID QKPGQAPRLLICGASSWAT NO: gctcttacctggcttggtatcagcagaagcctggacaggcccctaga NO: GIPDRPSGSGSGTDFTLTI 16 ctgctgatttctggcgcctcttcttgggccaccggcattcccgatagat 39 SRLEPEDPAVYYCQQYSSS ttctggcagcggctccggcaccgacttcaccctgacaatcagcaga PITFGQGTRLEIKR ctggaacccgaggacttcgccgtgtactactgccagcagtacagca gcagccccatcacctttggccagggcacaagactggaaatcaagc gg VH.sub.anti-VEGF-A EVQLVESGGGLVQPGGSL SEQ gaggtgcagctggtggagagcggaggaggactggtgcagccagg SEQ -(G.sub.4S).sub.3- RISCAASGFTISDYWIHW ID aggctccctgcggctgtcttgcgccgccagcggctttaccatctccg ID VL.sub.anti-VEGF-A VRQAPGKGLEWVAGITPA NO: actactggattcactgggtgagacaggcacctggcaagggactgga NO: -G.sub.4S- GGYTYYADSVKGRFTISA 49 gtgggtggcaggaatcaccccagcaggaggctacacatactatgcc 57 VH.sub.anti-ANG-2 DTSKNTAYLQMNSERAED gacagcgtgaagggccggttcaccatctccgccgatacctctaaga 2-(G.sub.4S).sub.3- TAVYYCARFVFFLPYAMD acacagcctatctgcagatgaactccctgcgggccgaggacacag VL.sub.anti-ANG-2 YWGQGTLVTVSSGGGGS ccgtgtactattgcgccagattcgtgttcttcctgccatacgccatgga GGGGSGGGGSDIQMTQSP tattggggccagggcaccctggtgacagtgagctccggtggaggt SSLSASVGDRVTITCRASQ ggctccggtggcggtggcagcggcggtggcggctctgatattcag DVSTAVAWYQQKPGKAP atgacacagtccccatctagcctgtctgccagcgtgggcgacaggg KLLIYSASFLYSGVPSRFS tgaccatcacatgtagagcaagccaggacgtgagcaccgcagtgg GSGSGTDFTLTISSLQPEDP catggtaccagcagaagcctggcaaggccccaaagctgctgatcta ATYYCQQGYGNPFTFGQG ctccgcctctttcctgtattctggcgtgccaagcaggtttagcgggtcc TKVEIKRGGGGSQVQLVE ggatctggaaccgacttcaccctgacaatctcctctctgcagcctgag SGGGVVQPGRSLRLSCAA gattttgccacatactattgccagcagggctatggcaatccattcacct SGFTFTNYGMHWGRQAP ttggccagggcacaRaggtggagatcaagaggggggaggggg GKGLEWVAVISHDGNNKY ctctcaggtgcagctggttgaatctggtggcggagttgtgcagcctg YVDSVKGRFTISRDNSKN gcagaagcctgagactgtcttgtgccgccagcggcttcaccttcacc TLYLQMNSLRAEDTAVYY aactatggaatgcactggggcagacaggcccctggcaaaggactt CAREGIDFWSGLNWEDP gaatgggtcgccgtgatcagccacgacggcaacaacaagtactac WQQGTLVTVSSAGGGGS gtggacagcgtgaagggcagattcaccatcagccgggacaacagc GGGGSGGGGSEIVLTQSP aagaacaccctgtacctgcagatgaacagcctgagagccgaggac GTLSLSPGERATLSCRASQ accgccgtgtactattgtgccagagagggcatcgactttggagcgg SITGSYLAWYQQKPGQAP cctgaattggttcgacccttggggacagggcaccctggttacagtttc RELICGASSWATGIPDRES ttctgccggtggaggtggctccggtggcggtggcagcggcggtgg GSGSGTDFTLTISRLEPED cggctctgagatcatgctgacacagagccctggcacactgtcactgt FAVYYCQQYSSSPITFGQG ctccaggcgaaagagccacactgagctgtagagccagccagagca TRLEIKR tcaccggctcttacctggcttcgtatcagcagaagcctggacaggcc cctagactgctgatttgtggcgcctcttcttgggccaccggcattccc gatagattttctggcagcggctccggcaccgacttcaccctgacaat cagcagactggaacccgaggacttcgccgtgtactactgccagcag tacagcagcagccccatcacctttggccagggcacaagactggaaa tcaagcgg CD5-sp- MPMGSLQPLATLYLLGML SEQ atgccaatggggtccctacaacccctggcaacactatatctgctaggt SEQ VH.sub.anti-VEGF-A VASCLGEVQLVESGGGLV ID atgctcgtggcctcctgtttaggagaggtgcagctggtggagagcg ID -(G.sub.4S).sub.3- QPGGSLRLSCAASGFTISD NO: gaggaggactggtgcagccaggaggctccctgcggctgtcttgcg NO: VL.sub.anti-VEGF-A YWIHWVRQAPGKGLEWV 50 ccgccagcggctttaccatctccgactactggattcactgggtgaga 58 -G.sub.4S- AGITPAGGYTYYADSVKG caggcacctggcaagggactggagtgggtggcaggaatcacccc VH.sub.anti-ANG-2 RFTISADTSKNTAYLQMNS agcaggaggctacacatactatgccgacagcgtgaagggccggtt -(G.sub.4S).sub.3- LRAEDTAVYYCARFVFFL caccatctccgccgatacctctaagaacacagcctatctgcagatga VL.sub.anti-ANG-2 PYAMDYWGQGTLVTVSS actccctgcgggccgaggacacagccgtgtactattgcgccagatt GGGGSGGGGSGGGGSDIQ cgtgttcttcctgccatacgccatggattattggggccagggcaccct MTQSPSSLSASVGDRVTIT ggtgacagtgagctccggtggaggtggctccggtggcggtggcag CRASQDVSTAVAWYQQKP cggcggtggcggctctgatattcagatgacacagtccccatctagcc GKAPKLLIYSASFLYSGVP tgtctgccagcgtgggcgacagggtgaccatcacatgtagagcaag SRFSGSGSGTDFTLTISSL ccaggacgtgagcaccgcagtggcatggtaccagcagaagcctgg QPEDEATYYCQQGYGNPFT caaggccccaaagctgctgatctactccgcctctttcctgtattctggc FGQGTKVEIKRGGGGSQV gtgccaagcaggtttagcgggtccggatctggaaccgacttcaccct QLVESGGGVVQPGRSLRL gacaatctcctctctgcagcctgaggattttgccacatactattgccag SCAASGFTFTNYGMHWG cagggctatggcaatccattcacctttggccagggcacaaaggtgg RQAPGKGLEWVAVISHDG agatcaagaggggcggagggggctctcaggtgcagctagttgaat NNKYYVDSVKGRFTISRD ctggtggcggagttgtgcagcctggcagaagcctgagactgtcttgt NSKNTLYLQMNSLRAEDT gccgccagcggcttcaccttcaccaactatggaatgcactggggca AVYYCAREGIDFWSGLN gacaggcccctggcaaaggacttgaatgggtcgccgtgatcagcc WEDPWGQGTLVTVSSAG acgacggcaacaacaagtactacgtggacagcgtgaagggcagat GGGSGGGGSGGGGSEIVL tcaccatcagccgggacaacagcaagaacaccctgtacctgcagat TQSPGTLSLSPGERATLSC gaacagcctgagagccgaggacaccgccgtgtactattgtgccaga RASQSITGSYLAWYQQKP gagggcatcgacttttggagcggcctgaattggttcgacccttgggg GQAPRELICGASSWATGIP acagggcaccctggttacagtttcttctgccggtggaggtcgctccg DRPSGSGSGTDFTLTISRL gtggcggtggcagcggcggtggcggctctgagatcgtgctgacac EPEDFAVYYCQQYSSSPIT agagccctggcacactgtcactgtctccaggcgaaagagccacact PGQGTRLEIKR gagctgtagagccagccagagcatcaccggctcttacctggcttggt atcagcagaagcctggacaggcccctagactgctgatttgtggcgc ctcttcttgggccaccggcattcccgatagattttctggcagcggctc cggcaccgacttcaccctgacaatcagcagactggaacccgagga cttcgccgtgtactactgccagcagtacagcagcagccccatcacct ttggccagggcacaagactggaaatcaagcgg XMVA14 VL.sub.anti-ANG-2- EIVLTQSPGTLSLSPGERA SEQ gagatcgtgctgacacagagccctggcacactgtcactgtctccag SEQ G.sub.4S- TLSCRASQSITGSYLAWYQ ID gcgaaagagccacactgagctgtagagccagccagagcatcaccg ID VH.sub.anti-VEGF-A QKPGQAPRLLICGASSWAT NO: gctcttacctggcttggtatcagcagaagcctggacaggcccctaga NO: -(G.sub.4S).sub.3- GIPDRFSGSGSGTDFTILT 51 ctgctgatttctggcgcctcttcttgggccaccggcattcccgatagat 59 VL.sub.anti-VEGF-A ISRLEPEDFAVYYCQQYSS tttctggcagcggctccggcaccgacttcaccctgacaatcagcaga -G.sub.4S- SPITFGQGTRLEIKRGGGG ctggaacccgaggacttcgccgtgtactactgccagcagtacagca VH.sub.anti-ANG-2 SEVQLVESGGGLVQPGGSL gcagccccatcacctttggccagggcacaagactggaaatcaagc RESCAASGFTISDYWIHW ggggcggagggggctctgaggtgcagctggtggagagcggagg VRQAPGKGLEWVAGITPA aggactggtgcagccaggaggctccctgcggctgtcttgcgccgcc GGYTYYADSVKGRFTISA agcggctttaccatctccgactactggattcactgcgtgagacaggc DTSKNTAYLQMNSLRAED acctggcaagggactggagtgggtggcaggaatcaccccagcag TAVYYCARFVFFLPYAMD gaggctacacatactatgccgacagcgtgaagggccggttcaccat YWGQGTLVTVSSGGGGS ctccgccgatacctctaagaacacagcctatctgcagatgaactccct GGGGSGGGGSDIQMTQSP gcgggccgaggacacagccgtgtactattgcgccagattcgtgttct SSLSASVGDRVTITCRASQ tcctgccatacgccatggattattggggccagggcaccctggtgaca DVSTAVAWYQQKPGKAP gtgagctccggtggaggtggctccggtggcggtggcagcggcggt KLLIYSASFLYSGVPSRES ggcggctctgatattcagatgacacagtccccatctagcctgtctgcc GSGSGTDFILTISSLQPED agcgtgggcgacagcgtgaccatcacatgtagagcaagccaggac FATYYCQQGYGNPFTFGQG gtgagcaccgcagtggcatggtaccagcagaagcctggcaaggcc TKVEIKRGGGGSQVQLVE ccaaagctgctgatctactccgcctctttcctgtattctggcgtgccaa SGGGVVQPGRSLRISCAA gcaggtttagcgggtccggatctggaaccgacttcaccctgacaatc SGFTFTNYGMHWGRQAP tcctctctgcagcctgaggattttgccacatactattgccagcagggct GKGLEWVAVISHDGNNKY atggcaatccattcacctttggccagggcacaaaggtggagatcaa YVDSVKGRFTISRDNSKN gaggggcggagggggctctcaggtgcagctgcttgaatctggtgg TLYLQMNSLRAEDTAVYY cggagtgtgcagcctggcagaagcctgagactgtcttgtgccgcc CAREGIDFWSGLNWFDP agcggcttcaccttcaccaactatggaatgcactggggcagacagg WGQGTLVTVSSA cccctggcaaaggacttgaatgggtcgccgtgatcagccacgacg gcaacaacaagtactacgtggacagcgtgaagggcagattcaccat caaccgggacaacagcaagaacaccctgtacctgcagatgaacag cctgagagccgaggacaccgccgtgtactattgtgccagagaggg catcgacttttggagcggcctgaattggttcgacccttggggacagg gcaccctggttacagtttcttctgcc CD5-sp- MPMGSLQPLATLYLLGMLV SEQ atgccaatggggtccctacaacccctggcaacactatatctgctaggt SEQ VL.sub.anti-ANG-2- ASCLGEIVLTQSPGTLSLS ID atgctcgtggcctcctgtttaggagagatcgtgctgacacagagccc ID G.sub.4S- PGERATLSCRASQSITQSY NO: tggcacactgtcactgtctccaggcgaaagagccacactgagctgta NO: VH.sub.anti-VEGF-A LAWYQQKPGQAPRLLICG 52 gagccagccagagcatcaccggctcttacctggcttggtatcagca 60 (G.sub.4S).sub.3- ASSWATGIPDRESGSGSGT gaagcctggacaggcccctagactgctgatttgtggcgcctcttcttg VL.sub.anti-VEGF-A DFTLTISRLEPEDFAVYYC ggccaccggcattcccgatagattttctggcagcggctccggcacc -G.sub.4S- QQYSSSPITFGQGTRLEIK gacttcaccctgacaatcagcagactggaacccgaggacttcgccg VH.sub.anti-ANG-2 RGGGGSEVQLVESGGGLV tgtactactgccagcagtacagcagcagccccatcacctttggccag QPGGSLRLSCAASGFTISD ggcacaagactggaaatcaagcggggggagggggctctgaggt YWIHWVRQAPGKGLEWV gcagctggtggagagcggaggaggactggtgcagccaggaggct AGITPAGGYTYYADSVKG ccctgcggctgtcttgcgccgccagcggctttaccatctccgactact RFTISADTSENTAYLQMNS ggattcactgggtgagacaggcacctggcaagggactggagtggg LRAEDTAVYYCARFVFEL tggcaggaatcaccccagcaggaggctacacatactatgccgaca PYAMDYWGQGTLVTVSS gcgtgaagggccggttcaccatctccgccgatacctctaagaacac GGGGSGGGGSGGGGSDIQ agcctatctgcagatgaactccctgcgcgccgaggacacagccgtg MTQSPSSLSASVGDRVTIT tactattgcgccagattcgtgttcttcctgccatacgccatggattattg CRASQDVSTAVAWYQQKP cggccagggcaccctggtgacagtgagctccgctggagctggctc GKAPKLLIYSASFLYSGVP cggtggcggtggcagcggcggtggcggctctgatattcagatgaca SRFSGSGSGIDFTLTISSL cagtccccatctagcctgtctgccagcgtgggcgacagggtgacca QPEDFATYYCQQGYGNPFT tcacatgtagagcaagccaggacgtgagcaccgcagtggcatggt PGQGTKVEIKRGGGGSQV accagcagaagcctggcaaggccccaaagctgctgatctactccgc QLVESGGGVVQPGRSLRL ctctttcctgtattctggcgtgccaagcaggtttagcgggtccggatct SCAASGFTFTNYGMHWG ggaaccgacttcaccctgacaatctcctctctgcagcctgaggatttt RQAPGKGLEWVAVISHDG gccacatactattgccagcagggctatcgcaatccattcacctttggc NNKYYVDSVKGRFTISRD cagggcacaaaggtggagatcaagaggggcggagggggctctca NSKNTLYLQMNSLRAEDT ggtgcagctggttgaatctggtggcggagttgtgcagcctggcaga AVYYCAREGIDFWSGLN agcctgagactgtcttgtgccgccagcggcttcaccttcaccaactat WEDPWGQGTLVTVSSA ggaatgcactggggcagacaggcccctggcaaaggacttgaatgg gtcgccgtgatcagccacgacggcaacaacaagtactacgtggac agcgtgaagggcagattcaccatcagccgggacaacagcaagaac accctgtacctgcagatgttacagcctgagagccgaggacaccgcc gtgtactattgtgccagagagcgcatcgacttttggagcggcctgaat tgcttcgacccttggggacagggcaccctggttacagtttcttctgcc XMVA15 VL.sub.anti-VEGF-A DIQMTQSPSSLSASVGDRV SEQ gatattcagatgacacagtccccatctagcctgtctgccagcgtggg SEQ -G.sub.4S- TITCRASQDVSTAVAWYQ ID cgacagggtgaccatcacatgtagagcaagccaggacgtgagcac ID VH.sub.anti-ANG-2 QKPGKAPKLLIYSASFLYS NO: cgcagtggcatggtaccagcagaagcctggcaaggccccaaagct NO: -(G.sub.4S).sub.3- GVPSRFSGSGSGTDFTLTI 53 gctgatctactccgcctctttcctgtattctggcgtgccaagcaggttta 61 VL.sub.anti-ANG-2- SSLQPEDFATYYCQQGYGN gcgggtccggatctggaaccgaattcaccctgacaatctcctctctg G.sub.4S- PFTPGQGTKVEIKRGGGG cagcctgaggattttgccacatactattgccagcagggctatggcaat VH.sub.anti-VEGF-A SQVQLVESGGGVVQPGRS ccattcacctttggccagggcacaaaggtggagatcaagaggggc LRLSCAASGFTETNYGMH ggagggggctctcaggtgcagctggttgaatctgctggcggagttg WGRQAPGKGLEWVAVISH tgcagcctggcagttagcctgagactgtcttgtgccgccagcggcttc DGNNKYYVDSVKGRFTIS accttcaccaactatggaatgcactggggcagacaggcccctggca RDNSKNTLYLQMNSLRAE Baggacttgaatgggtcgccgtgatcagccacgacggcaacaaca DTAVYYCAREGIDFWSGL agtactacgtggacagcgtgaagggcagattcaccatcagccggg NWFDPWGQGTLVTVSSA acaacagcaagaacaccctgtacctgcagatgaacagcctgagag GGGGSGGGGSGGGGSEIV ccgaggacaccgccgtgtactattgtgccagagagggcatcgacttt LTQSPGTLSLSPGERATLS tggagcggcctgaattcgttcgaccctttggggacagcgcaccctgg CRASQSITGSYLAWYQQK ttacagtttcttctgccggtggaggtggctccggtggcggtggcagc PGQAPRLLICGASSWATGI ggcggtggcggctctgagatcgtgctgacacagagccctggcaca PDRFSGSGSGTDFTLTISRL ctgtcactgtctccaggcgaaagagccacactgagctgtagagcca EPEDFAVYYCQQYSSSPIT gccagagcatcaccggctcttacctggcttggtatcagcagaagcct FGQGTRLEIKRGGGGSEV ggacaggcccctagactgctgatttgtggcgcctcttcttgcgccac QLVESGGGLVQPGGSLRL cggcattcccgatagattttctggcagcggctccggcaccgacttca SCAASQFTISDYWIHWVR ccctgacaatcagcagactggaacccgaggacttcgccgtgtacta QAPGKGLEWVAGITPAGG ctgccagcagtacagcagcagccccatcacctttggccagggcaca YTYYADSVKGRFTISADTS agactggaaatcaagcggggggagggggctctgaggtgcagct KNTAYLQMNSLRAEDTAV ggtggagagcggaggaggactggtgcagccaggaggctccctgc YYCARFVFFLPYAMDYW ggctgtcttgcgccgccagcggctttaccatctccgactactggattc GQGTLVTVSS actgggtgagacaggcacctggcaagggactggagtggctggca ggaatcaccccagcaggaggctacacatactatgccgacagcgtg aagggccggttcaccatctccgccgatacctctaagaacacagccta tctgcagatgaactccctgcgggccgaggacacagccgtgtactatt gcgccagattcgtgttcttcctgccatacgccatggattattggggcc agggcaccctggtgacagtgagctcc CD5-sp- MPMGSLQPLATLYLLGML SEQ atgccaatggggtccctacaacccctggcaacactatatctgctaggt SEQ VL.sub.anti-VEGF-A VASCLGDIQMTQSPSSLSA ID atgctcgtggcctcctgtttaggagatattcagatgacacagtccccat ID -G.sub.4S- SVGDRVTITCRASQDVSTA NO: ctagcctgtctgccagcgtgggcgacagggtgaccatcacatgtag NO: VH.sub.anti-ANG-2 VAWYQQKPGKAPKLLIYS 54 agcaagccaggacgtgagcaccgcagtggcatggtaccagcaga 62 -(G.sub.4S).sub.3- ASFLYSGVPSRFSGSGSGT Bgcctggcaaggccccaaagctgctgatctactccgcctctttcctgt VL.sub.anti-ANG-2 DFTLTISSLQPEDFATYYC attctggcgtgccaagcaggtttagcgggtccggatctggaaccga -G.sub.4S- QQGYGNPFTFGQGTKVEI cttcaccctgacaatctcctctctgcagcctgaggattttgccacatac VH.sub.anti-VEGF-A KRGGGGSQVQLVESGGG tattgccagcagggctatggcaatccattcacctttggccagggcac VVQPGRSLRLSCAASGFT aaaggtggagatcaagaggggggagggggctctcaggtgcagc FTNYGMHWGRQAPGKGL tggttgaatctggtggcggagttgtgcagcctggcagaagcctgag EWVAVISHDGNNKYYVDS actgtcttgtgccgccagcggcttcaccttcaccaactatggaatgca VKGRFTISRDNSKNTLYLQ ctggggcagacaggcccctggcaaaggacttgaatgggtcgccgt MNSLRAEDTAVYYCAREG gatcagccacgacggcaacaacaagtactacgtggacagcgtgaa IDFWSGLNWEDPWGQGT gggcagattcaccatcagccgggacaacagcaagaacaccctgta LVTVSSAGGGGSGGGGSG cctgcagatgaacagcctgagagccgaggacaccgccgtgtactat GGGSEIVLTQSPGTLSLSP tgtgccagagagggcatcgacttttggagcggcctgaattggttcga GERATLSCRASQSITQSYL cccttggggacagggcaccctggttacagtttcttctgccggtggag AWYQQKPGQAPRLLICGA gtggctccggtggcggtggcagcggcggtggcggctctgagatcg SSWATGIPDRFSGSGSGTD tgctgacacagagccctggcacactgtcactgtctccaggcgaaag FILTISRLEPEDFAVYYCQ agccacactgagctgtagagccagccagagcatcaccggctcttac QYSSSPITFGQGTRLEIKR ctggcttggtatcagcagaagcctggacaggcccctagactgctgat GGGGSEVQLVESGGGLVQ ttgtcgcgcctcttcttgggccaccggcattcccgatagattttctggc PGGSLRISCAASGFTISDY agcggctccggcaccgacttcaccctgacaatcagcagactggaac WIHWVRQAPGKGLEWVA ccgaggacttcgccgtgtactactgccagcagtacagcagcagccc GITPAGGYTYYADSVKGR catcacctttggccagggcacaagactggaaatcaagcggggcgg FTISADTSKNTAYLQMNSL agggggctctgaggtgcagctggtggagagcggaggaggactgc RAEDTAVYYCARFVFFLP tgcagccaggaggctccctgcggctgtcttgcgccgccagcggctt YAMDYWGQGTLVTVSS taccatctccgactactggattcactgggtgagacaggcacctggca agggactggagtggctggcaggaatcaccccagcaggaggctac acatactatgccgacagcgtgaagggccggttcaccatctccgccg atacctctaagaacacagcctatctgcagatgaactccctgcgggcc gaggacacagccgtgtactattgcgccagattcgtgttcttcctgcca tacgccatggattattggggccagggcaccctggtgacagtgagct

Example 6. Preparation and Identification of Recombinant AAV Virus

[0072] The XMVA09 construct and ssAAV plasmid were double digested with BamH I/EcoR V, and ssAAV-XMVA09 vector was constructed by conventional molecular biology operations such as ligation, transformation, cloning screening and identification, and the vector information is shown in FIG. 2B. High-quality plasmid DNA was obtained for later use by using an endotoxin-free plasmid extraction kit (MN), and recombinant AAV virus was prepared by using a three-plasmid packaging system, a helper plasmid (phelper), a Cap and Rep protein expression plasmid of AAV, a plasmid expressing the target gene (ssAAV-XMVA09) in a mass ratio of 2:1:1 were used to form a transfection complex with PEI transfection promoter, and were transfected into HEK293T cells to conduct AAV-XMVA09 packaging. The supernatant was collected twice at day 3 and day 7 after transfection to obtain AAV particles containing the target gene. Density gradient centrifugation (Beckman's ultracentrifuge) was performed with different gradients of iodoxanol (15%, 25%, 40% and 60%) to obtain purified AAV virans. The AAV quality was identified by transmission electron microscopy and the AAV virus titer was quantified by qPCR.

Example 7. Inhibitory Effect of XMVA09 on Laser-Induced CNV in wAMD Model Mice the Animal Model of CNV Induced by Retinal High-Energy Laser Photocoagulation is a Commonly Used Animal

[0073] model at home and abroad, and is a standard animal model in most treatment evaluation experiments at present. It selectively destroys the photoreceptor outer segment disc membrane, Bruch membrane, retinal pigment epithelium and part of the anterior choroidal capillary network are selectively damaged, followed by a damage repair reaction, including invasion and growth of fibroblast, retinal pigment epithelial cell and vascular endothelial cell, and finally, neovascularization is formed in a photocoagulation area.

[0074] Thirty SPF grade 68 weeks male C57 BL/6J mice (purchased from Beijing Vital River Laboratories Experimental Animal Technology Co., Ltd.), weighing 22-25 g were used, and the specific administration scheme is shown in Table 4 below:

TABLE-US-00004 TABLE 4 Administration scheme medicine administration administration medicine concentration volume dosage administration number of group administered (vg/mL) (L) (vg/eye) route animals control PBS 2.5 intravitreal 15 injection XMVA09 AAV- 2.5 10.sup.12 2.5 6.25 10.sup.9 intravitreal 15 XMVA09 injection

[0075] Since the expression of the target gene reached a stable level after a certain period of time after AA V injection, intravitreal injection was performed on day 1, and binocular funduslaser photocoagulation was performed on the successfully injected animals on day 22 to induce CNV model.

[0076] Establishment of mouse CNV model: The pupils of both eyes of the mice were dilated with 1-2 drops of topicamide eye drops, and 5% chloral hydrate was injected intramuscularly for anesthesia. After anesthesia, carbomer eye drops were dropped in both eyes, a fundus laser scope was placed, and photocoagulation was performed around the optic papilla at a distance of about 1.5-2 PD from the optic disc avoiding blood vessels. Laser parameters were as follows: wavelength 532 nm, energy 80 mW, spot size 50 m, exposure time 100 ms, and erythromycin eye ointement were applied to both eyes of the animal after photocoagulation.

[0077] On day 29, fluorescein fundus angiography (FFA) detection was performed on mice: fluorescein sodium injection (15 mg/mL, 10 mL/kg) was intraperitoneally injected, several clear pictures of both eyes were collected at early (within 1.5 minutes) and late (after 3 minutes) stages after the fluorescein sodium injection, the fluorescence leakage degree of the effective light spots were rated, and the percentage of grade 3 leakage light spots and the mean score of leakage light spots were calculated. The results are shown in FIG. 12 and FIG. 13. In the laser-induced wAMD model mice, the formation of CNV was significantly inhibited after a single intravitreal injection of AAV- XMVA09.

[0078] Effective light spot refers to a light spot that has no severe retinal hemorrhage nearby and can be completely displayed in the FFA. The grading standards of spots fluorescence leakage are as follows: grade 0 (no fluorescence leakage), grade 1 (mild fluorescence leakage, with a leakage area of 1-50% of the laser spot size), grade 2 (moderate fluorescence leakage, with a leakage area of 50-100% of the laser spot size), grade 3 (severe fluorescence leakage, with a leakage area larger than the laser spot size).

Percentage (%) of light spots of each grade=total number of light spots of the corresponding gradetotal number of 4 types of light spots100%.

Mean score of leakage light spot=[(number of grade 0 light spots0)+(number of grade 1 light spots1)+(number of grade 2 light spots2)+(number of grade 3 light spots3)]total number of 4 types of light spots.

Example 8. Inhibitory Effect of XMVA09 on CNV in Laser-Induced wAMD Model Rhesus Monkeys

[0079] Seven male rhesus monkeys (purchased from Ya'an Primed Bio-tech Co., Ltd.) with a common grade (qualified in quarantine before test) of 5-6 years old were used, and the specific administration scheme is shown in table 5 below:

TABLE-US-00005 TABLE 5 Administration scheme medicine administration administration medicine concentration volume dosage administration number of group administered (vg/mL) (L) (vg/eye) route animals control PBS 50 intravitreal 3 injection XMVA09 AAV- 1.94 10.sup.12 50 9.7 10.sup.10 intravitreal 4 XMVA09 injection

[0080] XMVA09 Group: AAV-XMVA09 (50 L/eye) was administered by intravitreal injection in both eyes on day 21 before laser modeling, and CNV was induced in both eyes by fundus laser on days 0.

[0081] Control group: CNV was induced in both eyes by fundus laser on day 0, and PBS (50 L/eye) was administered by intravitreal injection in both eyes on day 21.

[0082] All animals were examined by optical coherence tomography (OCT) prior to laser modeling and fundus photography (FP), FFA and OCT examinations were performed on day 19 and day 77 of laser modeling; and the number, leakage area and retinal thickness of grade IV light spots were used as main efficacy evaluation indicators. Establishment of the rhesus monkey CNV model: animals were anesthetized by intramuscular injection of ketamine hydrochloride (20 mg/kg) and dexmedetomidine hydrochloride (0.03 mg/kg), and the pupils of both eyes were dilated with Midori (compound tropicamide eye drops) drops. After the pupils of both eyes were larger than 6 mm, the head of the animal was fixed in front of an ophthalmic laser photocoagulator, and after the retinal structure was peculated through a fundus scope, laser photocoagulating was carried out at an optic disc distance around the center of the macula, with 9 points in each eye. The laser parameters were: wavelength 532 nm, energy 650 mW-700 mW, spot size 50 m, exposure time 0.1 second. Fluorescein leakage area was measured by FP and FFA, and the specific examination method was as follows: (1) animals were anesthetized by intramuscular injection of ketamine hydrochloride (20 mg/kg) and dexmedetomidine hydrochloride (0.03 mg/kg). (2) The pupils of both eyes were dilated with 1-2 drops of compound tropicamide eye drops. (3) The pupil of the animal was observed after pupil dilation, if the pupil was greater than 6 mm under light, a colour photograph of the fundus centered on the macula was taken by a fundus camera. (4) After that, a 0.075 mL/kg dose of 10% fluorescein sodium injection (Fluorescite, Alcon) was rapidly injected from the saphenous vein of the lower limb. FFA photographs centered on the macula were taken by fundus cameras at early (within 1 minute), medium (5 minutes) and late (10 minutes) stages after fluorescein injection. (6) The fluorescein leakage area of the grade IV spot in the late stage (10 min) of FFA photo was automatically measured by Image J software (version 1.53e, NIH, Wayne, Raband, USA) as an evaluation indicator of the efficacy of FFA. The fluorescein leakage grading standard of the laser spot is: grade I (the light spot has no high fluorescence), grade II (the light spot has high fluorescence without leakage), grade III (the light spot has high fluorescence with slight fluorescein leakage, but leakage does not exceed the edge of the light spot), grade IV (the light spot has high fluorescence with significant fluorescein leakage, and leakage exceeds the edge of the light spot).

[0083] Retinal thickness changes were measured by OCT, and the specific examination method is as follows: (1) after completing the FP and FFA examination, the animals were placed in front of an OCT instrument, and the animal's eyes were adjusted to look directly at the scanning lens. (2) Multi-layer linear scanning was performed by adopting a follow-up mode centered on the macula, with the scanning area covered all laser points. (3) A layer with the most obvious retinal thickness change and clear retinal boundary after modeling was selected, and the maximum retinal thickness value of the region was measured by using measurement software carried by the instrument to serve as an OCT efficacy evaluation indicator.

[0084] The results are shown in FIG. 14, FIG. 15, FIG. 16 and FIG. 17. On the day 19 and day 77 of the laser modeling in each group of animals, FFA examination showed that different fluorescence leakage performance at the laser spots in the fundus. Compared with the control group, a single intravitreal injection of AAV-XMVA09 has an obvious improvement effect on the number, leakage area and retinal thickness of grade IV light spots of CNV in laser-induced wAMD rhesus monkey model.

Example 9. High Glucose-Induced Increase in HRMECs Permeability Model

[0085] The 24-well plate was pre-treated with 0.1% gelatin at 37 C. for 1-2 bouts and then dried for several minutes; then the HRMECs were resuspended in complete culture medium of ECM (Sciencell) containing 10% FBS+1% PS+1% ECGS, and spread evenly in the well plate according to the standard of 310.sup.5/well; on the next day, starvation treatment was initiated with a low-serum culture medium containing 0.5% FBS for 7 hours; then the HRMECs were exposed to 30 mM high glucose environment overnight; the control group was not treated with high glucose, on the next day, immunofluorescence co-staining of cells for membrane protein with VE-cadherin and nuclear with DAPI was performed, for fluorescence microscope observation and photography. The results are shown in FIG. 18. The cell membrane continuity of HRMECs treated with high glucose was disrupted, resulting in intercellular enlargement and increased permeability.

[0086] Steps of immunofluorescence staining: discarding the supernatant of the culture medium so that the remaining volume was 200 L, and adding 200 L of 4% PFA to start the gradient fixation for 20 minutes at room temperature; after discarding the supernatant, directly adding 200 L of PFA, and continuing to fix at room temperature for 10 minutes; after discarding the fixation solution, washing with PBS for 3 times, each time for 5 minutes; diluting VE-cadherin (Santa Cruz Biotechnology Inc) at 1:150 with PBS, then adding 300 L/well, and incubating at room temperature for 2 hours; discarding the supernatant, washing with PBS for 3 times, each time for 5 minutes; diluting the Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Invitrogen) at 1:200 with PBS, adding 200 L per well, and incubating at 37 C. for 1 hour; discarding the supernatant, washing with PBS for 3 times, each time for 5 minutes; and finally adding DAPI-containing mounting agent (Beyotime), 100 L/well, and observing and photographing under a fluorescence microscope.

Example 10. Determining the Regulatory Effect of XMVA09 Protein on the Permeability of HRMECs Based on VE-Cadherin Indicator

[0087] The 24-well plate was pre-coated with 0.1% gelatin at 4 C. overnight or at 37 C. for 2 hours; the coating solution was discarded, and HRMECs cells were inoculated 310.sup.5/well; on the next day, when the monolayer cells reached a certain confluence, starvation treatment was initiated with a low-serum medium containing 0.5% FBS for 7 hours; the supernatant of untransfected HEK293T cells and the supernatant of HEK293T cells transfected with ssAAV-XMVA09 plasmid were co-incubated with high glucose (30 mM glucose), respectively. HRMECs were treated overnight, and the control group was a non-modeling group without high glucose treatment. Immunofluorescence staining of VE-cadherin was performed, and the detailed steps were as in Example 9, and photographic analysis was performed under a fluorescence microscope. The results are shown in FIG. 19. The protein expressed by ssAAV-XMVA09 has a significant inhibitory effect on the increase of permeability of HRMECs after high glucose treatment.

Example 11. Determining the Regulatory Effect of XMVA09 Protein on the Permeability of HRMECs Based on Biotin-Avidin System Indicator

[0088] Gelatin was treated with EZ-Link NHS-LC-LC-biotin to obtain biotinylated gelatin; the biotinylated gelatin was used to coat a cell culture plate at 4 C. overnight of 37 C. for 2 hours; HRMECs were directly inoculated in the culture plate, and the inoculation amount of cells was 310.sup.5/well; on the next day, starvation treatment was first initiated with a low-serum medium containing 0.5% FBS for 7 hours; then the supernatant of untransfected HEK293T cells and the supernatant of HEK293T cells transfected with ssAAV-XMVA09 plasmid were co-incubated with high glucose (30 mM glucose), respectively, HRMECs were treated for 17 hours, and the control group was a non-modeling group without high glucose treatment. After staining with FITC-avidin and fixation with 4% PFA, staining with AF594-phaloidin (Invitrogen A12381) was started, then an anti-fluorescence quencher containing DAPI was added, and photographical analysis was performed under a fluorescence microscope. The results are shown in FIG. 20. The protein expressed by ssAAV-XMVA09 has a significant inhibitory effect on the increase of permeability of HRMECs after high glucose treatment.

Example 12. Construction of Diabetic Mouse Model

[0089] Drug induction is one of the current methods for establishing diabetic animal models, which can better simulate clinical pathological manifestations and clinical characteristics of diabetes. Streptozotocin (STZ) is the most commonly used medicament for inducing diabetes, and it mainly causes hyperglycemia by destroying pancreatic beta cells, which in turn causes pericapillary cell loss, vascular layer thinning and blood-retinal barrier destruction, further causes vessel leakage, and it is a good model for studying DME.

Establishment of Diabetic Mouse Model:

[0090] Eighty SPF grade 68 weeks male C57 BL/6J mice (purchased from Zhejiang Vital River Laboratories Experimental Animal Technology Co., Ltd.), weighing 20-25 g, were randomly divided into blank group, DME model control group, and DME modeling group. Before modeling, fasting blood glucose and body weight of three groups of mice were measured; after fasting for 6 hours (with free access to water), blood was collected at the tail tip for blood glucose measurement and the mice were weighed, on day 0 of modeling. Modeling was started on day 1, and mice were fasted (with free access to water) for 6 hours. The Blank group was not treated, the DME model control group recieved a single intraperitoneal injection of 50 mM sodium citrate solution (Sigma) 60 mg/kg for 5 continuous days, and the DME model group recieved a single intraperitoneal injection of STZ (Sigma) 60 mg/kg for 5 continuous days. The mice were free to eat and drink, blood glucose and body weight were measured and recorded regularly, and the modeling lasted for 135 days.

[0091] Results are shown in FIG. 21. On day 19 after modeling, the fasting blood glucose values of mice were higher than 16.7 mmol/L for about three weeks, indicating the diabetic mice model was successfully constructed.

Example 13. Phenotypic Validation of DME in Diabetic Mouse Model

[0092] On day 81 after modeling, a portion of mice in each of the three groups of mice in Example 12 were injected with Evans Blue by tail vein injection, the retinas were dissected and separated, and vascular leakage was observed under a fluorescence microscope. The specific operations are as follows: 50 mg/mL of Evans blue (Sigma) was injected 50 L/mouse into the tail vein; after 1.5 hours of blood circulation, the mice were euthanized, both eyes were enucleated and fixed for 45 minutes in 4% paraformaldehyde (Biosharp), the retina of the eyeball was peeled off and spread, and observed and photographed under a fluorescence microscope.

[0093] Results are shown in FIG. 22. The retinal vessel leakage of the DME model group was obviously increased compared with the DME model control group and the Blank group, there was no obvious difference between the retinas of the DME model control group and the Blank group, and the diabetic mouse models had a DME phenotype.

Example 14. Inhibitory Effect of XMVA09 on Retinal Vascular Leakage in Diabetic Mouse Model

[0094] The DME model mice in Example 12 were administered by injection on day 95 after molding, and the specific administration scheme is shown in Table 6 below:

TABLE-US-00006 TABLE 6 Administration Scheme medicine administration administration medicine concentration volume dosage administration number of group administered (vg/mL) (L) (vg/eye) route animals Control PBS 2.5 intravitreal 6 injection XMVA09 AAV- 2.5 10.sup.12 2.5 6.25 10.sup.9 intravitreal 6 XMVA09 injection

[0095] On day 29 after injection, mice in the above XMVA09 group, Control group and mice in the DME model control group in Example 12 were injected with Evans blue by tail vein injection and dissect the retina to observe blood vessel leakage under fluorescence microscope.

[0096] The results are shown in FIG. 23. The percentage of retinal vascular leakage in the DME model control group is significantly lower than that in the Control group, and the percentage of retinal vascular leakage in the XMVA09 group is significantly lower than that in the Control group, which indicates that a single intravitreal injection of AAV-XMVA09 has a significant inhibition effect on retinal vascular leakage in the diabetic mouse model.

Statistical Analysis

[0097] GraphPad Prism 8.0 software was used for data processing and statistical analysis. The statistical level was set to 5% or p0.05, and the average number and standard error (MeanSEM) of each analysis indicator were calculated, where p0.05 means the difference is statistically significant.