<i>Lactobacillus mudanjiangensis </i>strains and cellulase derived therefrom
12351842 ยท 2025-07-08
Assignee
Inventors
Cpc classification
C12Y302/01004
CHEMISTRY; METALLURGY
A61K31/711
HUMAN NECESSITIES
C12N9/2437
CHEMISTRY; METALLURGY
C12P19/14
CHEMISTRY; METALLURGY
A23L33/135
HUMAN NECESSITIES
International classification
C12P19/14
CHEMISTRY; METALLURGY
Abstract
The present invention in particular relates to the identification of novel Lactobacillus mudanjiangensis strains which are characterized in having a whole genome GC content of less than 43%. Moreover, these strains are characterized by the expression of a novel cellulase enzyme, which has numerous applications in the fields of for example agriculture, bioconversion, detergents, fermentation, food, paper industry, or textile industry.
Claims
1. A cultured host cell containing a recombinant nucleic acid molecule comprising a nucleotide sequence having at least 95% sequence identity to the nucleotide sequence of SEQ ID NO: 1, and encoding a polypeptide having cellulase activity; wherein the recombinant nucleic acid molecule is heterologous to the host cell.
2. The cultured host cell containing the recombinant nucleic acid molecule as defined in claim 1, encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 2.
3. A method for degrading cellulose, the method comprising: growing an isolated bacterial strain of a Lactobacillus mudanjiangensis species comprising a nucleotide sequence having at least 95% sequence identity to the nucleotide sequence of SEQ ID NO: 1 in a culture medium; extracting a cell-free supernatant from the culture medium; contacting a sample comprising cellulose with the cell-free supernatant, whereby the cellulose in the sample is degraded.
4. The method according to claim 3, further comprising sterilizing the cell-free supernatant prior to the contacting step.
5. The method according to claim 3, wherein the sample comprising cellulose is selected from the group consisting of soil, wine, beer, fruit pomace, vegetable pomace, fruit juice, fruit puree, paper pulp, and textile fibers.
6. The method according to claim 3, wherein the nucleotide sequence encodes a polypeptide comprising an amino acid sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 2.
7. The method according to claim 3, wherein the Lactobacillus mudanjiangensis species is deposited as Lactobacillus mudanjiangensis AMBF249 under accession number LMG P-31215.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) With specific reference now to the figures, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the different embodiments of the present invention only. They are presented in the cause of providing what is believed to be the most useful and readily description of the principles and conceptual aspects of the invention. In this regard no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention. The description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION OF THE INVENTION
(7) In this study, the genome sequence of the L. mudanjiangensis type strain DSM 28402.sup.T was presented together with the genomes of three new L. mudanjiangensis strains, AMBF197, AMBF209 and AMBF249, which were isolated from three different spontaneous carrot juice fermentations. Since previous phylogenetic analysis of this species, using the 16S rRNA, pheS, and rpoA genes, showed a close genetic relatedness with the members of the L. plantarum group (Gu et al., 2013), it was decided to study these genomes in relation to the closely related members of the L. plantarum group with a comparative genomics approach. A maximum likelihood phylogenetic tree confirmed that L. mudanjiangensis was closely related to all other L. plantarum group members. Furthermore, pairwise ANI analysis confirmed that the three strains isolated from carrot juice fermentations were members of the L. mudanjiangensis species.
(8) The estimated genome size of L. mudanjiangensis was the second largest of the whole L. plantarum group found up to now. The same trend was found for the gene count per species. This means that L. mudanjiangensis harbored one of the largest genomes of the whole LGC, since L. plantarum and especially L. pentosus are known to be among the lactobacilli with the largest genome size and gene counts. For L. plantarum, this large genome and also its pangenome size have been coupled to a nomadic lifestyle. This lifestyle comes with a high genetic diversity, which is associated to the possibility to survive and thrive in many different ecosystems. This could possibly also be applied to L. mudanjiangensis, supported by the fact that L. mudanjiangensis showed a slightly larger number of Glycosyl Hydrolases (GH) than L. plantarum, indicating that this species is capable of transforming and metabolizing a broad spectrum of carbohydrate sources. This observation was confirmed by the fact that the type strain was found to be capable of producing organic acids from at least 21 different carbon sources (Gu et al., 2013).
(9) Furthermore, here, a putative polysaccharide-degrading enzyme, more specifically a cellulose-degrading enzyme, annotated as endoglucanase E1, was found in all four L. mudanjiangensis strains, which was not found in any other LGC genome so far. Moreover, cellulose-degrading enzymes were only very exceptionally found in beneficial or food-grade lactic acid bacteria (LAB) up to now. Cellulose is the most abundant organic polymer on earth, the most important skeletal component in plants in general and the most abundant crude fiber in carrots. Lactobacillus mudanjiangensis' putative capability to degrade this fiber into glucose might allow members of this species to survive in many different plant-related ecosystems. Fermented carrot juices and fermented pickles are examples of such ecosystems, where three and one of the strains studied were isolated from, respectively. Together, these results suggested that, similar to L. plantarum, a nomadic or otherwise a plant-adapted lifestyle could be assigned to L. mudanjiangesis. Moreover, the activity of the cellulase was experimentally tested and shown to degrade carboxymethylcellulose.
(10) Hence, in a first aspect, the present invention provides an isolated, recombinant or synthetic nucleic acid molecule comprising a nucleotide sequence having at least 70%, in particular at least 85%, even more in particular at least 90%, 95% or 99% sequence identity/homology to SEQ ID N 1. Said gene sequence corresponding to said novel cellulose-degrading gene. Accordingly, the present invention provides an isolated, recombinant or synthetic nucleic acid molecule comprising a nucleotide sequence having at least 95% sequence identity to SEQ ID N 1, and encoding a polypeptide having cellulase activity.
(11) In a specific embodiment, the nucleotide sequence of the present invention encodes a polypeptide having cellulase activity and comprises an amino acid sequence having at least 70%, in particular at least 85%, even more in particular at least 90%, 95% or 99% sequence identity/homology to SEQ ID N 2; or an enzymatically active fragment thereof. Said amino acid sequence corresponding to said novel cellulose-degrading enzyme. Specifically, said nucleotide sequence may encode an enzymatically active fragment of a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID N 2.
(12) Where in the context of the present invention, the term sequence identity or sequence homology is used, this is meant to be calculated across the whole reference sequence and not over shorter fragments thereof.
(13) The present invention further provides a polypeptide having cellulase activity; said polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID N 2. Furthermore, the present invention provides an enzymatically active fragment of a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID N 2; said fragment having cellulase activity.
(14) In the context of the present invention the term cellulase is meant to be an enzyme capable of degrading cellulose to glucose. For commercial purposes, this enzyme is currently often produced using fungi, such as from the Trichoderma or Deuteromycota genus, however, the present invention provides a novel (bacterial) source for such enzymes, namely the Lactobacillus mudanjiangensis species.
(15) Since cellulose is one of the most abundant organic polymers on earth and being a crucial skeletal component in plants, this novel cellulose-degrading enzyme and Lactobacillus mudanjiangensis species expressing it, may have numerous applications, of which only some include: agriculture, bioconversion, detergents, fermentation, biocontrol, food industry, paper industry, textile industry, . . . ; wherein the Lactobacillus mudanjiangensis species themselves, may also be used as human or veterinary probiotics; or wherein the polypeptides or enzymatically active fragments thereof may be used as a human or veterinary postbiotic, or pharmabiotic.
(16) In the context of the present invention, the term postbiotic refers to a metabolic byproduct or (such as cellulase) or inactivated/inanimate formulation obtainable from a probiotic bacterial strain, having still a probiotic function. Such postbiotics seem to be responsible for many of the beneficial effects of the probiotics themselves. In the context of the present invention, the term pharmabiotic refers to a health-promoting agent.
(17) Hence, the present invention provides the use of a polypeptide or enzymatically active fragment thereof, as disclosed herein, as well as of an isolated bacterial strain of the Lactobacillus mudanjiangensis species or a composition comprising such strains; in agriculture, in bioconversion, in fermentation, in biocontrol, in food, in the paper industry, in the textile industry, or as a human or veterinary probiotic. More in particular, the present invention provides the use of the deposited isolated bacterial strain of the Lactobacillus mudanjiangensis species or strains having at least 94%, or alternatively 95% sequence identity/homology thereof; or a composition comprising such isolated bacterial strain; in agriculture, in bioconversion, in fermentation, in biocontrol, in food, in the paper industry, in the textile industry or as a human or veterinary probiotic.
(18) More specific applications for each of these industries may be identified as follows: AgricultureFor Example: Plant pathogen and disease control; generation of plant and fungal protoplasts; enhanced seed germination and improved root system; enhanced plant growth and flowering; improved soil quality; reduced dependence on mineral fertilizers BioconversionFor Example: Conversion of cellulosic materials to ethanol, other solvents, organic acids and single cell protein, and lipids; production of energy-rich animal feed; improved nutritional quality of animal feed; improved ruminant performance; improved feed digestion and absorption; preservation of high-quality fodder DetergentFor Example: Cellulase-based detergents; superior cleaning action without damaging fibers; improved color brightness and dirt removal; remove of rough protuberances in cotton fabrics; anti-redeposition of ink particles FermentationFor Example: Improved malting and mashing; improved pressing and color extraction of grapes; improved aroma of wines; improved primary fermentation and quality of beer; improved viscosity and filterability of wort; improved must clarification in wine production; improved filtration rate and wine stability Food IndustryFor Example: Release of the antioxidants from fruit and vegetable pomace; improvement of yields in starch and protein extraction; improved maceration, pressing, and color extraction of fruits and vegetables; clarification of fruit juices; improved texture and quality of bakery products; improved viscosity fruit purees; improved texture, flavor, aroma, and volatile properties of fruits and vegetables; controlled bitterness of citrus fruits Paper IndustryFor Example: Coadditive in pulp bleaching; biomechanical pulping; improved draining; enzymatic de-inking; reduced energy requirement; reduced chlorine requirement; improved fiber brightness, strength properties, and pulp freeness and cleanliness; improved drainage in paper mills; production of biodegradable cardboard, paper towels, and sanitary paper Textile IndustryFor Example: Biostoning of jeans; biopolishing of textile fibers; improved fabrics quality; improved absorbance property of fibers; softening of garments; improved stability of cellulosic fabrics; removal of excess dye from fabrics; restoration of color brightness Biocontrol: Conferring a health benefit to the plant by inhibiting a pathogenic microbe or stimulate innate immune responses or promoting plant growth Further potential applicationsFor example: Improved carotenoids extraction; improved oxidation and colour stability of carotenoids; improved olive oil extraction; improved malaxation of olive paste; improved quality of olive oil; reduced risk of biomass waste; production of hybrid molecules; production of designer cellulosomes
(19) Moreover, the present invention further provides an isolated bacterial strain of the Lactobacillus mudanjiangensis species; or a composition comprising such isolated bacterial strain for use in human or veterinary medicine. More in particular, the present invention provides the isolated deposited bacterial strain of the Lactobacillus mudanjiangensis species as defined herein, or a strain having at least 94%, or alternatively 95% sequence identity/homology thereof; or a composition comprising such isolated bacterial strain for use in human or veterinary medicine. Specifically, said strains comprise a cellulase gene having at least 95% sequence identity to the cellulase gene of the Lactobacillus mudanjiangensis strains as defined herein.
(20) The present invention further provides an isolated bacterial strain of the Lactobacillus mudanjiangensis species comprising a nucleic acid molecule and/or a polypeptide as defined herein; more in particular, said Lactobacillus mudanjiangensis species may be characterized by having a whole genome GC content of less than 43%.
(21) As detailed above, the Lactobacillus mudanjiangensis type strain was initially identified in China in 2013 (Gu et al., 2013). While, at that time, the GC content of this strain was estimated to be about 45.1 mol % based on thermal melting protocols, no full genome sequencing of this strain was performed at that time. The current inventors have for the first time fully sequenced the genome of this strain, and accurately determined its GC content as being 43.06%. The Lactobacillus mudanjiangensis species of the present invention are characterized in having a GC content of less than 43%, namely AMBF197 (42,85%), AMBF209 (42.73%) and AMBF249 (42.83%). Moreover, the Lactobacillus mudanjiangensis species of the present invention further differ from the Chinese Lactobacillus mudanjiangensis type strain in having a longer 16S rRNA sequence. All 3 strains of the present invention have a 16S rRNA sequence of 1571 basepairs compared to only 1458 basepairs for the Chinese type strain.
(22) The present invention further provides an isolated bacterial strain of the Lactobacillus mudanjiangensis species deposited as Lactobacillus mudanjiangensis AMBF249 under accession number LMG P-31215 (deposited at BCCM on Jan. 15, 2019) or a strain having at least 95% sequence identity thereto; more in particular, said Lactobacillus mudanjiangensis species may be characterized by a whole genome GC content of less than 43%. Specifically, said strains comprise a cellulase gene having at least 95% sequence identity to the cellulase gene of a Lactobacillus mudanjiangensis AMBF249 strain.
(23) Moreover, it was found that some of the identified Lactobacillus mudanjiangensis species are further characterized in comprising a conjugative plasmid, predicted to encode functions that promote survival and adaptation in fermented vegetable. This would render the strains highly suitable for use as a starter culture, moreover, the plasmid itself could have further applications in the field of microbiology.
(24) Conjugation is one of the main drivers of horizontal gene transfer and is commonly associated with conjugative plasmids (Cury et al., 2017). Here, two of the five conjugative regions found were plasmid-associated and the two plasmids found were exactly the same for both L. mudanjiangensis AMBF209 and AMBF249, although these strains were isolated from different household carrot juice fermentations (HF08 and HF27, respectively). Previous studies also identified and described conjugative plasmids in other Lactobacillus species, such as Lactobacillus brevis, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus hokkaidonensis, L. plantarum and Lactobacillus reuteri. Genes on these plasmids often code for proteins involved in detoxification, virulence, antibiotic resistance and ecological interactions, which could give them a fitness advantage in certain environments. Here, apart from the conjugation-related genes, many genes were annotated as hypothetical proteins on the conjugative plasmid. However, since this plasmid showed great similarity with a plasmid from a Leuconostoc strain, which was isolated from fermented kimchi (Jung et al., 2012), it could potentially harbor genes that are beneficial for survival on plants or in a fermented vegetable environment. In that respect, it was found that strains harboring this predicted conjugative plasmid (L. mudanjiangensis AMBF209 and AMBF249) expressed a higher level of gentamycin resistance, compared to the other two strains lacking the plasmid (L. mudanjiangensis AMBF197 and DSM 28402.sup.T).
(25) Furthermore, SEM analysis revealed the presence of pili or fimbriae in three of the four L. mudanjiangensis strains studied. In this study, the observation of pili in L. mudanjiangensis was associated with bacterial conjugation. Three of the four strains were found to carry at least one complete putative conjugation region, including a gene that possibly codes for a VirB2 homolog, the major subunit of a conjugation-related pilus. The three strains that harbored this conjugation region all showed pili formation on the SEM images, whereas this was not the case for strain AMBF197, which lacked this region. These results suggested that the detected pili might play a role in cell to cell contact during the conjugation process, although this was not yet experimentally validated.
(26) Finally, the putative cellulase activity was tested enzymatically. These tests showed that the three new L. mudanjiangensis strains (AMBF197, AMBF209 and AMBF249) as discussed herein above, have cellulase activity. A carboxymethyl cellulose assay allowed semi-quantitative determination of the cellulose-degrading activity and proved the cellulose degrading activity of the three novel L. mudanjiangensis strains, whereas the prior art identified L. mudanjiangensis strain (DSM 28402.sup.T) did not show this activity. To confirm that this activity resulted from the aforementioned genes, heterologous expression in Escherichia coli was performed.
EXAMPLES
Materials And Methods
(27) Sequencing of the Lactobacillus mudanjiangensis Type Strain and Downloading of Publicly available Assemblies
(28) The type strain of L. mudanjiangensis [L. mudanjiangensis DSM 28402.sup.T (=LMG 27194.sup.T=CCUG 62991.sup.T)] was purchased from a public microorganism collection (BCCM-LMG, Ghent, Belgium). The strain was grown overnight in de Man-Rogosa-Sharpe (MRS) medium (Carl Roth, Karlsruhe, Germany) and DNA was extracted using the NucleoSpin 96 tissue kit (Macherey-Nagel, Dren, Germany), with an extra cell lysis step using 20 mg/mL of lysozyme (Sigma-Aldrich, St. Louis, M.O., USA) and 100 U/mL of mutanolysin (Sigma-Aldrich). Whole-genome sequencing was performed using the Nextera XT DNA Sample Preparation kit (Illumina, San Diego, C.A., USA) and the Illumina MiSeq platform, using 2250 cycles, at the Laboratory of Medical Microbiology (University of Antwerp, Antwerp, Belgium). Assembly of the genome sequence was performed using SPAdes v 3.12.0. In addition, all genome sequences annotated as putative L. mudanjiangensis were added to this analysis. Finally, all genome sequences annotated as L. fabifermentans, L. herbarum, L. paraplantarum, L. pentosus, L. plantarum and L. xiangfangensis were downloaded from the National Center for Biotechnology Information (NCBI) Assembly database on 24 Jul. 2018, using in-house scripts. In total, 310 genomes were used as an input for quality control.
(29) Quality Control and Annotation
(30) Basic genome characteristics, including genome size, GC content and the N50 value, were estimated using Quast 4.6.3. The quality of the genome assemblies was evaluated using the Quast output. After visualization of several quality control parameters using ggplot2, genomes with a N50 value <25,000 bp and a number of undefined nucleotides (N) per 100,000 bases >500 were discarded. A total of 304 assemblies passed the quality control, among which a genome sequence for the type strain of L. mudanjiangensis and three of the four fermented carrot juice strains putatively classified as L. mudanjiangensis. Finally, Prokka 1.12 was used to predict and annotate genes for all genome sequences. In addition to its internal databases, a customized genus-specific BLAST database was used for higher quality annotation with Prokka's-usegenus option. This database was created using BLAST and all complete Lactobacillus genomes found in the NCBI Assembly database.
(31) Defining the Pangenomes of all Lactobacillus plantarum Group Species
(32) To define the pangenome, all genes were clustered into orthogroups using OrthoFinder 2.2.6 and further analyzed in R (R Core Team, 2015). Here, a core orthogroup is defined as an orthogroup present in more than 95% of a set of genomes. All other orthogroups are defined as accessory orthogroups. An upset plot was created using the R package UpSetR. Unique orthogroups belonging to L. mudanjiangensis were further annotated using EggNOG-mapper and visualized using ggplot2.
(33) Phylogenetic Tree Construction
(34) Single-copy core orthogroups found by Orthofinder were used as input for the construction of a phylogenetic tree. Lactobacillus algidus DSM 15638 (NCBI Assembly accession number GCA_001434695) served as an outgroup, as it is the species most closely related to the L. plantarum group. The first protein sequence of each fasta file of the single-copy core orthogroups was compared with a BLAST database of all genome proteins of the outgroup's genome sequence. All hits with a coverage >75% and a percentage similarity >50% were added to the alignment of each orthogroup. These alignments, on amino acid level, were concatenated into a supermatrix that was used in RaxML 8.2.9, to build a maximum likelihood phylogenetic tree with thea option, which combines a rapid bootstrap algorithm with an extensive search of the tree space, starting from multiple different starting trees. The tree and subtrees were plotted with the R package ggtree.
(35) Average Nucleotide Identity
(36) All pairwise average nucleotide identity (ANI) values were calculated with the Python pyani package, using a BLASTN approach based on the methodology described by Goris et al. (2007).
(37) Plasmid Identification
(38) Detection and reconstruction of plasmids in the different L. mudanjiangensis strains was performed using Recycler v0.7, with the original fastq files and SPAdes assembly graphs as input. The assembled plasmids were annotated with Prokka and further characterized by scanning against the EggNOG database, as described above. The presence of a conjugation system was confirmed with CONJScan, as described above. The percentage identity between the different plasmids found was assessed using BLAST. The similarity with any previously described plasmid was checked by performing a BLAST search against the NCBI nucleotide (nt) database. A plasmid map was created using Geneious v8.
(39) Delimitation of Integrative and Conjugative Elements
(40) The presence of ICEs was explored by a similar approach as the pipeline described previously (Cury et al., 2017). Briefly, all strict core genes, i.e. genes present in all strains of L. mudanjiangensis were found using the Orthofinder output (see above). Next, all flanking core genes of each conjugative region were identified. Since within one species an ICE is expected to be found between the same core orthogroups, the flanking core genes of each conjugative region found were evaluated to determine whether or not it could be defined as an ICE.
(41) Scanning Electron Microscopy
(42) To assess the presence or absence of pili or fimbriae on the cell surface of L. mudanjiangensis strains AMBF197, AMBF209, AMBF249 and DSM 28402.sup.T, scanning electron microscopy (SEM) was performed. To this end, the bacterial strains were grown overnight (MRS medium, 37 C.), gently washed with phosphate-buffered saline (per liter: 56 g of NaCl, 1.4 g of KCl, 10.48 g of Na.sub.2HPO.sub.4, 1.68 g of KH.sub.2PO.sub.4; pH 7.4) and spotted on a gold-coated membrane [(approximately 510.sup.7 colony forming units (CFU) per membrane]. Bacterial spots were fixed with 2.5% (m/v) glutaraldehyde in 0.1 M sodium cacodylate buffer (2.5% glutaraldehyde, 0.1 M sodium cacodylate, 0.05% CaCl.sub.2.2H.sub.2O; pH 7.4) by gently shaking the membrane for 1 h at room temperature, followed by a further overnight fixation at 4 C. After fixation, the membranes were washed three times for 20 min with cacodylate buffer (containing 7.5% [m/v] saccharose). Subsequently, the bacteria were dehydrated in an ascending series of ethanol (50%, 70%, 90% and 95%, each for 30 min at room temperature and 100% for 21 h and 130 min) and dried in a Leica EM CPD030 (Leica Microsystems Belgium, Diegem, Belgium). The membranes were mounted on a stub and coated with 5 nm of carbon (Leica Microsystems Belgium) in a Leica EM Ace 600 coater (Leica Microsystems Belgium). SEM imaging was performed using a Quanta FEG250 SEM system (Thermo Fisher, Asse, Belgium) at the Antwerp Centre for Advanced Microscopy (ACAM, University of Antwerp) and Electron Microscopy for Material Science group (EMAT, University of Antwerp).
(43) Detection of Genomic Clusters Encoding Pili or Fimbriae
(44) To screen for the presence of the spaCBA gene cluster, the gene cluster that is responsible for expression of the fimbriae in L. rhamnosus GG, a BLAST search on protein level was performed against a BLAST database constructed for each genome separately. The gene sequences of spaA (NCBI GenBank accession number BAI40953.1), spaB (BAI40954.1) and spaC (BAI40955.1) were used as queries. Furthermore, the genomes were screened for genes encoding pili-related protein secretion systems, using the predicted amino acid sequences as query and the TXSScan definitions and profile models (Abby et al., 2016) as references in MacSyFinder v1.0.5. As only genes related to conjugation systems were found, all protein sequences of all genomes were again scanned, this time using the CONJScan definitions and profile models (Cury et al., 2017; Guglielmini et al., 2011) using MacSyFinder. In brief, a conjugation region was only considered if the conjugation genes were separated by less than 31 genes, except for genes encoding relaxases that can be separated by maximal 60 genes. The region was considered conjugative when it contained genes coding for (i) a VirB4/TraU homolog, (ii) a relaxase, (iii) a type 4 coupling protein (T4CP) and (iv) a minimum number of mating-pair formation (MPF) type-specific genes (Cury et al., 2017). For both scans, hits with alignments covering >50% of the protein profile and with an independent E-value<10.sup.3 were kept for further analysis (default parameters) in R (R Core Team, 2015). Conserved domain analysis of genes of interest was performed using the NCBI Conserved Domain web interface The gene regions were visualized using the R package gggenes.
(45) Accession Number(s) and Data Availability
(46) Sequencing data and genome assemblies are available at the European Nucleotide Archive under the accession number ERP111972.
(47) Heterlogous Expression of the Putative Cellulose Degrading Enzyme in E. coli
(48) The sequence SEQ ID N 2 was expressed heterologous in E. coli BL21(DE3)pLysS using the plasmid synthesis service of GeneArt Gene Synthesis (ThermoFisher, Germany). An IPTG inducible plasmid is used. After heat shock transformation, the plasmid was confirmed using Sanger sequencing and SDS-PAGE. To express the protein, different temperatures (25 C. and 37 C.) and induction times (OD.sub.600 of 0.3 and 0.8) were used before induction with IPTG (Sigma-Aldrich, Diegem, Belgium). After overnight induction production, the cells were treated as discussed in the next paragraph.
(49) Testing for Carboxymethyl Cellulose Activity
(50) Cellulase activity was measured using plate assay containing carboxymethyl cellulose (CMC), a compound that will be degraded by an endoglucanase (Liang et al., 2014). The different strains were grown at 30 C. in MRS. Different conditions were tested on the CMC agar containing CMC (Carl Roth GmbH, Karlsruhe, Germany); NaNO.sub.3 (Sigma-Aldrich, Diegem, Belgium), K.sub.2HPO.sub.4 (Sigma-Aldrich, Diegem, Belgium), KCI (Sigma-Aldrich, Diegem, Belgium), MgSO.sub.4 (Sigma-Aldrich, Diegem, Belgium), Yeast extract (VWR International, Leuven, Belgium), Bacteriological Agar(Sigma-Aldrich, Diegem, Belgium).
(51) For the Lactobacillus plantarum WCFS1 and L. mudanjiangensis strains: 1. Concentrated overnight culture (10 concentrated at 4000g at 4 C.), 2. Cell free supernatant: Using overnight culture, the supernatant was extracted after centrifugation at 4000 g at 4 C. and was sterilized. The pH of the Lactobacillus supernatant was measured. 3. Cell free supernatant corrected for pH: Condition for the supernatant of the E. coli that expressed the cellulase. Supernatant was corrected to the average pH of the Lactobacillus pH (pH=4.0) 4. Lysed cells: After production of cellulase by E. coli, or after overnight culture of Lactobacillus spp., The cells were lysed by freeze thawing followed by sonification. After centrifuging at 10,000g for 10 minutes, the supernatant containing the intracellular proteins were extracted 5. Lysed cells corrected for pH: The pH of the supernatant containing the intracellular protein of condition 4 was corrected to a pH of 4.0.
(52) The aforementioned conditions were added to the CMC agar and incubated at 37 C. for 48h. Afterwards, the plates were stained with 0.1% Congo Red (Carl Roth GmbH, Karlsruhe, Germany) for 30 minutes, washed by 1 M NaCl for 15 minutes twice, subsequently, 0.1% acetic acid (CHEM LAB, Zedelgem, Belgium) was added. When cellulase activity is present, Congo Red is unable to bind to the agar, leaving a clear spot on the plate. To relatively quantify the activity, the diameter of the spot was measured.
Results
(53) The genome assembly of the type strain L. mudanjiangensis DSM 28402.sup.T was analyzed together with the genome sequences of three of four putative L. mudanjiangensis strains isolated from carrot juice fermentations, namely AMBF197, AMBF209 and AMBF249, to confirm their putative classification as L. mudanjiangensis members. The genome sequence of the fourth strain, L. mudanjiangensis AMBF198, was discarded due to stricter quality control parameters.
(54) Furthermore, to allow comparison with other closely related Lactobacillus species and detection of L. mudanjiangensis species-specific properties, all publicly available genome sequences (NCBI Assembly database, 24 Jul. 2018) of L. plantarum group members were included in this comparative genomics study, totaling the number of genomes analyzed to 304.
(55) Phylogeny of the Lactobacillus plantarum Group
(56) To obtain a detailed view on the phylogeny of L. mudanjiangensis in relationship to the whole L. plantarum group, a maximum likelihood phylogenetic tree was constructed, based on 612 single-copy core orthogroups, found with Orthofinder, of which the most relevant part in respect of this application may be found in
(57) As evident from
(58) Low Intraclade ANI Values for Lactobacillus pentosus and Lactobacillus plantarum
(59) To confirm that each major phylogenetic Glade represented at least one different species, the pairwise ANI values of all genome assemblies were calculated (
(60) Genomic Features of Lactobacillus mudanjiangensis
(61) Our results confirmed that strains AMBF197, AMBF209 and AMBF249 were members of the L. mudanjiangensis species. Therefore, here, the first four genomes of this species were presented. Their genome size varied between 3.4 Mb (strain DSM 28402.sup.T) and 3.6 Mb (strain AMBF209), whereas their GC content varied between 42.73% (strain AMBF209) and 43.06% (strain DSM 28402.sup.T) Finally, a high number of transfer RNA (tRNA) genes were found in all four strains (Table 1).
(62) TABLE-US-00001 TABLE 1 Genome characteristics of Lactobacillus mudanjiangensis strains. GC content # Coding # tRNA Genome Total length (bp) (%) sequences genes AMBF197 3,501,388 42.85 3,463 65 AMBF209 3,589,692 42.73 3,586 63 AMBF249 3,554,025 42.83 3,503 71 DSM 28402 3,389,962 43.06 3,346 66
(63) From the above table, it is evident that the novel Lactobacillus mudanjiangensis strains (AMBF197, AMBF209, AMBF249) from the present invention differ from the type strain (DSM 28402) in multiple aspects such as having a total genomic length of above 3,500,000 bp and having a GC content of less than 43%.
(64) A substantial difference in total genome length between the different species of the L. plantarum group was found (
(65) Presence of a putative conjugative system in Lactobacillus mudanjiangensis
(66) The second most abundant category of L. mudanjiangensis-specific orthogroups, excluding category S (function unknown), were genes related to cell wall, membrane, or envelope biogenesis (category M). Examination of the annotation of the genes belonging to these orthogroups did not reveal any new insights, as many of them were annotated as hypothetical proteins. Therefore, SEM was performed to screen the cell surfaces of these four strains in more detail. This analysis revealed that three of the four strains (L. mudanjiangensis DSM28402.sup.T, AMBF209 and AMBF249) formed pili or fimbriae, connecting different cells to each other as well as cells to an undefined structure.
(67) To identify the genes encoding these pili, all genome sequences of L. mudanjiangensis were screened for the presence of genes associated with these kinds of phenotypes. These included the spaCBA gene cluster, which has been linked with probiotic properties in L. rhamnosus, due to better adhesion to intestinal epithelial cells, as well as secretion systems based on pili, such as the type II and type IV secretion systems (Abby et al., 2016). In this study, no spaCBA gene cluster was found. However, further exploration revealed the presence of a conjugation system in at least three of the four L. mudanjiangensis strains examined (AMBF209, AMBF249 and DSM 284021).
(68) Two complete conjugation systems containing all three mandatory parts (
(69) Further analysis of the genes surrounding the annotated conjugation genes showed that this genomic region contained 18 to 19 open reading frames, most of them annotated as hypothetical proteins (
(70) Finally, genome analysis of all other L. plantarum group members showed that, in contrast to an initial belief, the presence of a complete conjugation system was not unique to L. mudanjiangensis. All three necessary genes were also found in 58 of 275 L. plantarum strains, two of seven L. paraplantarum strains and four of twelve L. pentosus strains. In contrast, the system was completely absent in clade5a, L. herbarum, L. xiangfangensis and L. fabifermentans.
(71) Plasmid Reconstruction from Genome Data
(72) Many conjugation systems are coded on plasmids. Therefore, all four L. mudanjiangensis genomes were screened for plasmid presence using Recycler. Plasmids were only found in two of four genome assemblies, namely L. mudanjiangensis AMBF209 and AMBF249 (
(73) Since only two of five conjugation regions (
(74) Lactobacillus mudanjiangensis Harbors a Potential Cellulose-Degrading Enzyme
(75) Carbohydrate transport and metabolism (category G) was found to be the most abundantly characterized category among the L. mudanjiangensis species-specific orthogroups. Further examination of the 14 unique orthogroups that were detected in this category, revealed the presence of a gene in all four strains annotated as endoglucanase E1, which is involved in the conversion of cellulose polymers into simple saccharides. A BLAST search of the DNA sequences of this gene to the NCBI nt database showed a best scoring hit (26% coverage and 69% identity) with a member of the Herbinix species (GenBank accession number LN879430). The Herbinix genus contains cellulose-degrading bacteria. This result also showed that this gene was not found in any other member of the Lactobacillus Genus Complex (LGC), or any other LAB (Lactococcus, Streptococcus, Bifidobacterium . . . ), and confirmed its uniqueness to L. mudanjiangensis. Since endoglucanases are classified as glycosyl hydrolases (GHs), this endoglucanase E1 gene was compared to the CAZY database. Indeed, for all four strains, this gene was classified as belonging to the GH5_1 family, which was a family uniquely found in L. mudanjiangensis. Although this GH family showed some degree of polyspecificity, the majority of enzymes (22 of 24 enzymes characterized) are reported as endoglucanases. Together, these results thus pointed towards the presence of a novel putative cellulose-degrading enzyme in all four L. mudanjiangensis strains.
(76) Characterization of the Cellulose Degrading Enzyme
(77) In Table 2, the activity of the cellulose degrading enzyme is shown. The three L. mudanjiangensis strains (AMBF197, AMBF209 and AMBF249) isolated from Flemish carrot fermentations showed degradation activity of carboxymethyl cellulose (CMC). Both the cells as the lysed of three L. mudanjiangensis strains (AMBF197, AMBF209, and AMBF249) showed degradation of CMC, indicating its cellulase activity. The negative control (L. plantarum WCFS1) did not show this activity as well as the L. mudanjiangensis DSM 28401.sup.T. The cell free supernatant did not show any cellulase activity.
(78) TABLE-US-00002 TABLE 2 Carboxymethyl cellulose assay of all known L. mudanjiangensis strains and L. plantarum WCFS1 reference strain. Diameter of the halos in mm show the enzyme activity semi-quantitatively. The different L. mudanjiangensis strains (DSM 24802.sup.T, AMBF197, AMBF209 and AMBF249) and reference L. plantarum WCFS1 are shown. Different conditions were used: Cell = concentrated cells; CFS = Cell Free Supernatant; Lys = Lysed cells; Lys pH = Lysed cells pH adjusted to the pH of the CFS. Cell halo Lys halo Lys pH halo Strain (mm) (mm) (mm) WCFS1 0 0 0 DSM 28402 0 0 0 AMBF197 8.3 8.7 9 AMBF209 7.3 7.45 7.7 AMBF249 8 9 10.5
(79) The lysed cells expressing the putative cellulase showed a larger halo, indicating the activity of the heterologously expressed protein. When the pH correction to the pH of the CFS of L. mudanjiangensis, the mean increase was lower, but not significant. No cellulase activity was shown for the live concentrated E. coli cells or both the pH uncorrected and corrected cell free supernatant.
(80) TABLE-US-00003 TABLE 3 Carboxymethyl cellulose assay of the heterologously expressed cellulase in E. coli BL21 pLysS. Increase in diameter of the halos in mm show the enzyme activity semi-quantitatively. SE is the standard error of the mean. Lys: lysate of the cellulose producing E. coli BL21 pLysS cells. Lys pH4: pH of the lysate was corrected to a pH of 4 to mimic the CFS of L. mudanjiangensis. Lys Lys pH4 Mean increase halo SE (mm) 1.94 0.83 1.20 0.51
CONCLUSION
(81) Herein, the genome sequences of four L. mudanjiangensis strains were studied in relation to the closely related members of the L. plantarum group. Comparative genome analysis of this phylogenetic group found two wrongly annotated genome assemblies and intraclade ANI values below the commonly used species delimitation threshold for L. plantarum and L. pentosus. Furthermore, L. mudanjiangensis harbored one of the largest genomes and the highest gene counts of the L. plantarum group. Three of the four L. mudanjiangensis strains studied showed the presence of pili on SEM images, which were linked to conjugative gene regions. Most interestingly, a broad repertoire of GHs and a capability to degrade cellulose was shown. Therefore, a nomadic or plant-adapted lifestyle could be assigned to L. mudanjiangensis. Finally, the putative cellulase activity is supported by experimental indication of its carboxymethyl cellulose degrading capacity.
REFERENCES
(82) Abby, S. S., Cury, J., Guglielmini, J., Nron, B., Touchon, M., & Rocha, E. P. C. (2016). Identification of protein secretion systems in bacterial genomes. Scientific Reports, 6(1), 23080. Cury, J., Touchon, M., & Rocha, E. P. C. (2017). Integrative and conjugative elements and their hosts: composition, distribution and organization. Nucleic Acids Research, 45(15), 8943-8956. Goris, J., Konstantinidis, K. T., Klappenbach, J. A., Coenye, T., Vandamme, P., & Tiedje, J. M. (2007). DNA-DNA hybridization values and their relationship to whole-genome sequence similarities. International Journal of Systematic and Evolutionary Microbiology, 57(Pt 1), 81-91. Gu, C. T., Li, C. Y., Yang, L. J., & Huo, G. C. (2013). Lactobacillus mudanjiangensis sp. nov., Lactobacillus songhuajiangensis sp. nov. and Lactobacillus nenjiangensis sp. nov., isolated from Chinese traditional pickle and sourdough. International Journal of Systematic and Evolutionary Microbiology, 63(Pt 12), 4698-4706. Guglielmini, J., Quintais, L., Garcilln-Barcia, M. P., Cruz, F. de la, & Rocha, E. P. (2011). The repertoire of ice in prokaryotes underscores the unity, diversity, and ubiquity of conjugation. PLoS Genetics, 7(8). Jung, J. Y., Lee, S. H., & Jeon, C. O. (2012). Complete genome sequence of Leuconostoc carnosum strain JB16, isolated from kimchi. Journal of Bacteriology, 194(23), 6672-6673. Liang, Y. L., Zhang, Z., Wu, M., Wu, Y. & Feng, J. X. (2014). Isolation, screening, and identification of cellulolytic bacteria from natural reserves in the subtropical region of China and optimization of cellulase production by Paenibacillus terrae ME27-1. BioMed Research International 2014. Omadjela, O., Narahari, A., Strumillo, J., Mlida, H., Mazur, O., Bulone, V. & Zimmer, J. (2013). BcsA and BcsB form the catalytically active core of bacterial cellulose synthase sufficient for in vitro cellulose synthesis. Proceedings of the National Academy of Sciences of the United States of America 110, 17856-17861.
SEQUENCE LISTING
(83) TABLE-US-00004 <210>1 <211>1263 <212>DNA <213>Lactobacillusmudanjiangensis <223>CellulaseGene <400>1 atgaagtggcgcattgggttgttgacacttattgcaggtttggcactggggagtgtcggt 60 ggtcaggcagcgagtcgacctaagagtgactggttgcatgcaaagggtaatcgaattgtg 120 gatgcacggggcaaaacggttcggattacggggttaaattggtttgggtataacactggg 180 accaatacgtttgatggactatggaccgcgaacttagataagacggttaaatcggtggct 240 aatcatggatttaatacgattcgggtgccattttctgttcaattggtaaaagcttggtca 300 cagaaaaagtatcccaaggcgaacattaatttaagtaccaatgccgctttgaagggcaaa 360 aatagtttacagatctggcaacggttcttggctgattgccagaaaaatgggattaaagtc 420 atcattgatatgcatagtgccaagagtgatccacaaggccacaatgcaccattatggaaa 480 tccggtaaatataccactaaagactattatgcggcgttaacttggttagctaagcgttac 540 aagaagaatgatacgatcattggttatgacttgaagaatgaaccacatggtctcgtgact 600 gatgccagctatgcgaaatgggacggctccaaagcaagtaacaactggcgctatatcgct 660 gctcaagcgggtaagaaagtgttgaaagctaatccgcatgcgttgatcttcgtcgaaggg 720 gttcaaagcaccccgaagagttggaagactggctataagaagtcagcgcaatacaactac 780 acgttgtggggtgccaacttacgtggggtcgctaaatatccagtcaaggtgaagaagtca 840 caactggtctattcgattcatgattacggtcctagtgtggcaccagggagctcatggtta 900 caaggtaactttacttacaattcattgatgaagaactactggcggccgaactggtacttt 960 attcatgcgaagaagaccgcaccattgtacattggtgaatggggcggctacttaaccggt 1020 agcaatctgaaatggatgaaagctgaacgtaagttgattacgacgcataagttgaacttt 1080 acgttctggtgcttgaataacaactccggtgatactggtggcttgttgaatagcgactgg 1140 acgacttggaatagcaagttatacaagttcgtgaaaccgactctttggcaatcgaagaag 1200 ggtcaattctacagtctagacggtcaagttaaattggggaccaaaggcttacggaaacca 1260 taa 1263 <210>2 <211>420 <212>PRT <213>Lactobacillusmudanjiangensis <223>CellulaseEnzyme <400>2 MetLysTrpArgIleGlyLeuLeuThrLeuIleAlaGlyLeuAlaLeu 151015 GlySerValGlyGlyGlnAlaAlaSerArgProLysSerAspTrpLeu 202530 HisAlaLysGlyAsnArgIleValAspAlaArgGlyLysThrValArg 354045 IleThrGlyLeuAsnTrpPheGlyTyrAsnThrGlyThrAsnThrPhe 505560 AspGlyLeuTrpThrAlaAsnLeuAspLysThrValLysSerValAla 65707580 AsnHisGlyPheAsnThrIleArgValProPheSerValGlnLeuVal 859095 LysAlaTrpSerGlnLysLysTyrProLysAlaAsnIleAsnLeuSer 100105110 ThrAsnAlaAlaLeuLysGlyLysAsnSerLeuGlnIleTrpGlnArg 115120125 PheLeuAlaAspCysGlnLysAsnGlyIleLysValIleIleAspMet 130135140 HisSerAlaLysSerAspProGlnGlyHisAsnAlaProLeuTrpLys 145150155160 SerGlyLysTyrThrThrLysAspTyrTyrAlaAlaLeuThrTrpLeu 165170175 AlaLysArgTyrLysLysAsnAspThrIleIleGlyTyrAspLeuLys 180185190 AsnGluProHisGlyLeuValThrAspAlaSerTyrAlaLysTrpAsp 195200205 GlySerLysAlaSerAsnAsnTrpArgTyrIleAlaAlaGlnAlaGly 210215220 LysLysValLeuLysAlaAsnProHisAlaLeuIlePheValGluGly 225230235240 ValGlnSerThrProLysSerTrpLysThrGlyTyrLysLysSerAla 245250255 GlnTyrAsnTyrThrLeuTrpGlyAlaAsnLeuArgGlyValAlaLys 260265270 TyrProValLysValLysLysSerGlnLeuValTyrSerIleHisAsp 275280285 TyrGlyProSerValAlaProGlySerSerTrpLeuGlnGlyAsnPhe 290295300 ThrTyrAsnSerLeuMetLysAsnTyrTrpArgProAsnTrpTyrPhe 305310315320 IleHisAlaLysLysThrAlaProLeuTyrIleGlyGluTrpGlyGly 325330335 TyrLeuThrGlySerAsnLeuLysTrpMetLysAlaGluArgLysLeu 340345350 IleThrThrHisLysLeuAsnPheThrPheTrpCysLeuAsnAsnAsn 355360365 SerGlyAspThrGlyGlyLeuLeuAsnSerAspTrpThrThrTrpAsn 370375380 SerLysLeuTyrLysPheValLysProThrLeuTrpGlnSerLysLys 385390395400 GlyGlnPheTyrSerLeuAspGlyGlnValLysLeuGlyThrLysGly 405410415 LeuArgLysPro 420