Recombinant <i>Escherichia coli </i>for producing l-tyrosine and application thereof

Abstract

Disclosed is recombinant Escherichia coli for producing L-tyrosine and application thereof, and belongs to the technical fields of genetic engineering and bioengineering. According to the present disclosure, genes aroP and tyrP are knocked out, expresses the endogenous gene yddG of E. coli, then heterologously expresses fpk from Bifidobacterium adolescentis, expresses the endogenous genes ppsA and tktA of E. coli, and then expresses aroG.sup.fbr and tyrA.sup.fbr. Knocking out tyrR, trpE and pheA, so that the synthesis flux of L-tyrosine is increased. Finally, an endogenous gene poxB is knocked out to realize stable fermentation performance at high glucose concentration.

Claims

1. A recombinant Escherichia coli for synthesis of L-tyrosine, wherein the recombinant E. coli possesses a genome in which several first genes are knocked out, and comprises several added second genes that are expressed or overexpressed, wherein the first genes knocked out consist of: pheA encoding a fusion of chorismate mutase/prephenate dehydratase, trpE encoding an anthranilate synthetase subunit TrpE, tyrR encoding a DNA binding transcription double regulator TyrR, poxB encoding pyruvate oxidase, aroP encoding permease of an aromatic amino acid transporter AroP, and tyrP encoding a tyrosine and H (+) symporter, wherein the second genes added consist of: aroG.sup.fbr encoding 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase, tyrA.sup.fbr encoding chorismate mutase and prephenate dehydrogenase, fpk encoding phosphoketolase, and yddG encoding an amino acid exportin YddG; and wherein: the pheA gene has the nucleotide sequence set forth in SEQ ID NO:1, the trpE gene has the nucleotide sequence set forth in SEQ ID NO:2, the aroG.sup.fbr gene has the nucleotide sequence set forth in SEQ ID NO:3, the tyrA.sup.fbr gene has the nucleotide sequence set forth in SEQ ID NO:4, the tyrR gene has the nucleotide sequence set forth in SEQ ID NO:5, the fpk gene has the nucleotide sequence set forth in SEQ ID NO:8, the poxB gene has the nucleotide sequence set forth in SEQ ID NO:9, the aroP gene has the nucleotide sequence set forth in SEQ ID NO:10, the tyrP gene has the nucleotide sequence set forth in SEQ ID NO:11, and the yddG gene has the nucleotide sequence set forth in SEQ ID NO: 12; wherein the recombinant E. coli genome additionally comprises integrated therein two genes consisting of: ppsA expressing phosphoenolpyruvate synthetase, and tktA encoding transketolase 1; and wherein the ppsA gene has the nucleotide sequence set forth in SEQ ID NO:6, wherein the tktA gene has the nucleotide sequence set forth in SEQ ID NO:7; wherein the ppsA gene is integrated into the genome at a site ykgh-betA, and wherein the tktA gene is integrated into the genome at a site dadx-cvra.

2. The recombinant E. coli according to claim 1, wherein the ppsA gene and the tktA gene are initially expressed by a promoter PJ.sub.231119.

3. The recombinant E. coli according to claim 1, wherein the E. coli further comprises a heat induced expression vector pAP-B03.

4. The recombinant E. coli according to claim 1, wherein the E. coli is E. coli strain K12, BL21, DH5, JM109, or WSH-Z06.

5. A method for producing L-tyrosine, which comprises: fermenting the recombinant E. coli according to claim 1 under conditions conducive to fermentation of the recombinant E. coli.

6. The method according to claim 5, wherein said conditions conducive to fermentation comprises: inoculating the recombinant E. coli into a fermentation system, culturing the fermentation system at 32 C. to 34 C. for 3 hours to 12 hours, and incubating with agitation at 200 rpm to 220 rpm and at a temperature of 36 C. to 40 C. for 48 hours to 60 hours.

7. The method according to claim 6, wherein the fermentation system comprises: 30 g/L to 40 g/L glucose, 3 g/L to 7 g/L (NH.sub.4).sub.2SO.sub.4, 1 g/L to 5 g/L KH.sub.2PO.sub.4, 1 g/L to 5 g/L MgSO.sub.4.Math.7H.sub.2O, 1 g/L to 2 g/L sodium citrate, 0.5 g/L to 1.5 g/L NaCl, 0.05 g/L to 0.1 g/L vitamin B.sub.1, 0.1 g/L to 0.12 g/L FeSO.sub.4.Math.7H.sub.2O, 1 g/L to 3 g/L yeast powder, 2 g/L to 6 g/L peptone, and 1 ml/L to 2 ml/L trace element nutrient solution.

8. The recombinant E. coli according to claim 1, wherein the E. coli is E. coli strain WSH-Z06.

9. The recombinant E. coli according to claim 1, wherein the E. coli is produced by a process of: mutating sequentially the genome by transforming the recombinant E. coli with recombinant vectors pCas9, pTarget-pheA, pTarget-TrpE, pAP-aroG.sup.fbr-tyrA.sup.fbr-ppsA-tktA, pTarget-tyrR, pTarget-dadx-cvra, pTarget-ykgh-betA, pAP-aroG.sup.fbr-tyrA.sup.fbr-fpk, pTarget-poxB, pTarget-aroP, and pTarget-tyrP, and wherein the E. coli is E. coli strain WSH-Z06.

10. The recombinant E. coli according to claim 9, wherein said recombinant vectors are constructed by hybridization of primers having nucleotide sequences identical to those of SEQ ID NOS:13-100.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1 is a diagram showing synthesis of L-tyrosine in E. coli.

(2) FIG. 2 is a diagram showing yield of L-tyrosine obtained by feed-batch fermentation of E. coli in a 5 L fermentation tank.

DETAILED DESCRIPTION

(3) (I) Culture Media

(4) A seed culture medium (LB) includes: 10 g/L peptone, 5 g/L a yeast extract and 5 g/L sodium chloride; and 2% (mass fraction) agar powder was added into a solid culture medium.

(5) A fermentation culture medium (1 L) includes: 35 g of glucose, 5 g of (NH.sub.4).sub.2SO.sub.4, 3 g of K.sub.2HPO.sub.4.Math.3H.sub.2O, 3 g of MgSO.sub.4.Math.7H.sub.2O, 1.5 g of sodium citrate, 1 g of NaCl, 0.075 g of vitamin B.sub.1, 0.1125 g of FeSO.sub.4.Math.7H.sub.2O, 2 g of yeast powder, 4 g of peptone and 1.5 mL of a trace element nutrient solution (TES), and appropriate amounts of antibiotics were added as required. 12 g of calcium carbonate was added into a conical flask to control the pH value; and the TES includes: 2.0 g/L Al.sub.2(SO.sub.4).sub.3.Math.18H.sub.2O, 0.75 g/L CoSO.sub.4.Math.7H.sub.2O, 2.5 g/L CuSO.sub.4.Math.5H.sub.2O, 0.5 g/L H.sub.3BO.sub.3, 24 g/L MnSO.sub.4.Math.H.sub.2O, 2.5 g/L NiSO.sub.4.Math.6H.sub.2O and 15 g/L ZnSO.sub.4.Math.7H.sub.2O.

(6) (II) PCR Reaction System and Amplification Conditions

(7) 1 L (10 M) of a forward primer, 1 L (10 M) of a reverse primer, 10-50 ng of template DNA and 25 L of 2Phanta Max Master Mix, and double distilled water added to 50 L. Amplification conditions include: pre-denaturation at 95 C. for 3 min, followed by 30 cycles (at 95 C. for 15 s, at 55 C. for 15 s) and at 72 C. for 15 s) and continuous extension at 72 C. for 5 min.

(8) (III) Preparation of E. coli Competent Cells

(9) E. coli K12 in a glycerol tube was streaked on a corresponding LB plate and cultured overnight at 37 C. (for about 12 h). 12 h later, monoclone is picked, inoculated into a 50 mL shake flask containing 5 mL of an LB culture medium and cultured at 220 rpm at 37 C. until an OD.sub.600 value was 0.6-0.8. A bacterial solution was transferred to a 50 mL centrifuge tube, placed on ice for about 15 min and centrifuged at 4,000 rpm at 4 C. for 5 min to remove a supernatant. 5 mL of a solution A was added for resuspension, and centrifugation was performed at 4,000 rpm at 4 C. for 5 min to remove a supernatant. Then, 5 mL of a solution B was added to resuspend the bacteria, and a resulting product was packaged in 100 L/part and store at 80 C.

(10) (IV) Transformation of E. coli

(11) E. coli competent cells were thawed on ice. 10 L of a recombinant product (50 ng of plasmid) was added into 100 L of the competent cells, evenly mixed by flicking, and subjected to standing on ice for 30 min. A resulting mixture was subjected to heat shock in a water bath pot at 42 C. for 45 s, followed by standing on ice for 2 min. 1 mL of an LB culture medium was added, and the bacteria were shaken at 220 rpm at 37 C. for 60 min. Then, centrifugation was performed at 4,500 rpm for 2 min to remove a supernatant. The bacteria were resuspended with the remaining culture medium and then coated on a resistant plate.

(12) (V) Determination of L-Tyrosine by High Performance Liquid Chromatography (HPLC)

(13) After completion of fermentation, 1 mL of a fermentation liquid was taken, diluted to an appropriate multiple with 3 M hydrochloric acid, violently shaken and uniformly mixed, followed by centrifugation at 14,000 rpm for 10 min. A supernatant was taken and filtered with a 0.22 m inorganic filter membrane, and a product was detected by a high performance liquid chromatograph LC-20A of Shimadzu. A Thermo Fisher C18 chromatographic column (4.6 mm250 mm, 5 m) was used for chromatographic separation; the temperature of a column oven was set to 30 C.; the injection volume was 10 L; mobile phases were as follows: phase A: 0.1 M sodium acetate (the pH was adjusted to 4.5 with glacial acetic acid), and phase B: pure methanol; the total flow rate was 1 mL/min; the volume percentage was 90% and 10%, respectively; and the wavelength of a detector was 280 nm.

(14) (VI) Plasmids

(15) A plasmid pAP-B03 involved in the following examples is recorded in the document Zhou, H., Liao, X., Wang, T., Du, G., Chen, J., 2010. Enhanced L-phenylalanine biosynthesis by co-expression of pheA.sup.fbr and aroF.sup.wt. Bioresource Technology. 101(11): 4151-4156.. Plasmids pCas and p-Target involved in the following examples are recorded in the document Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., Yang, S., 2015. Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and Environmental Microbiology. 81(7): 2506-2514.. A recombinant plasmid pCDF-aroG.sup.fbr-tyrA.sup.fbr involved in the following examples is recorded in the document Wu, J., Zhou, T., Du, G., Zhou, J., Chen, J., 2014. Modular optimization of heterologous pathways for de novo synthesis of (2S)-naringenin in Escherichia coli. PloS One. 9(7): 1-9.. A strain E. coli HG involved in the following examples is a strain WSH-Z06 (pAP-B03) recorded in the document Zhou, H., Liao, X., Wang, T., Du, G., Chen, J., 2010. Enhanced L-phenylalanine biosynthesis by co-expression of pheA.sup.fbr and aroF.sup.wt. Bioresource Technology. 101(11): 4151-4156., which is named as E. coli HG in the present disclosure.

(16) (VII) Information of Strains as Shown in Table 1

(17) TABLE-US-00001 TABLE 1 Strains and genes involved in the present disclosure Strain name Genotype E. coli HG0 E. coli HG eliminate pAP-pheA.sup.fbr-aroF.sup.fbr E. coli HGA E. coli HG0 pheA containing pAP-aroG.sup.fbr-tyrA.sup.fbr-ppsA-tktA E. coli HGB E. coli HG0 pheAtrpE containing pAP-aroG.sup.fbr-tyrA.sup.fbr-ppsA-tktA E. coli HGC E. coli HG0 pheAtrpEtyrR containing pAP-aroG.sup.fbr-tyrA.sup.fbr-ppsA-tktA E. coli HGD0 E. coli HG0 pheAtrpEtyrR dadx-cvra::tktA E. coli HGE E. coli HGD0 ykgh-betA::ppsA containing pAP-aroG.sup.fbr-tyrA.sup.fbr-fpk E. coli HGF E. coli HGE poxB containing pAP-aroG.sup.fbr-tyrA.sup.fbr-fpk E. coli HGG E. coli HGF0 aroP containing pAP-aroG.sup.fbr-tyrA.sup.fbr-fpk E. coli HGH0 E. coli HGF0 aroPtyrP E. coli HGH E. coli HGF0 aroPtyrP containing pAP-aroG.sup.fbr-yddG-tyrA.sup.fbr-fpk

Example 1: Construction of Recombinant E. coli for Synthesis of L-Tyrosine

(18) (1) Preparation of an Engineered Strain HGA0

(19) E. coli HG stored in a laboratory was continuously subjected to passage culture at 42 C. for removing a plasmid to obtain a plasmid-free strain HG0. A plasmid pCas was transformed into chemically transformed competent cells of the E. coli HG0; monoclone obtained by transformation is picked into a 4 mL of an LB culture medium containing 50 g/mL kanamycin and cultured at 30 C. for 12 h; then a bacterial solution with a volume ratio of 2% was inoculated into 50 mL of an LB culture medium; and kanamycin with a final concentration of 50 g/mL and a 10 mM arabinose solution were added. A mixed solution was cultured at 220 rpm at 30 C. for 4-6 h, and when the optical density (OD) value was 0.6, the bacterial solution was transferred to a 50 mL centrifuge tube and subjected to standing on ice for 15 min. Centrifugation was performed at 4,000 rpm at 4 C. for 10 min to remove a supernatant, and 10 mL of 10% glycerol was added for resuspension; the operation was repeated twice, and a resulting product was packaged at 100 L/part and stored at 80 C. to obtain electrically transformed competent cells of E. coli HG0 containing a plasmid pCas, named as E. coli HG0-pCas.

(20) The E. Coli HG0 was selected as an original strain for production of L-tyrosine by fermentation. First, according to a synthetic route of L-tyrosine shown in FIG. 1, in order to increase the carbon flux of a synthetic route for synthesis of tyrosine, a gene pheA encoding chorismate mutase-prephenate dehydratase (CM-PDT) in E. coli was knocked out by a CRISPR/Cas9 gene editing method. With an E. coli K12 genome as a template, an upstream homologous arm U1 and a downstream homologous arm D1 of the gene pheA were amplified with primer pairs F11/R11 and F12/R12, respectively, and fragments were purified. With purified fragments U1 and D1 as templates, a knockout box UD1 was obtained by amplification with a primer pair F11/R12, and fragments were purified. In order to obtain pTarget-pheA for knocking out the pheA, amplification was performed with a primer pair F13/R13 with p-Target stored in a laboratory as a template, and fragments were purified. A purified fragment pTarget-pheA was transformed into E. coli JM109, and a plasmid was extracted and sequenced for verification to obtain a correct recombinant vector pTarget-pheA.

(21) 400 ng of the recombinant vector pTarget-pheA and 1,200 ng of the knockout box UD1 were added into the electrically transformed competent cells of E. coli HG0-pCas, and a mixture was subjected to standing on ice for 10 min, transferred into a 1 mm electroporation cuvette precooled for 10 min and then subjected to electric shock at a voltage of 1.8 kv. After completion of the electric shock, 1 mL of an LB liquid culture medium was added and cultured at 30 C. for 1.5 h. Bacterial colonies were subjected to PCR verification with a primer pair F14/R14, and the verified monoclone loses the pTarget-pheA and the pCas9 to obtain an engineered strain of E. coli HGA0.

(22) (2) Preparation of Overexpression Plasmids pAP-aroG.sup.fbr-tyrA.sup.fbr and pAP-aroG.sup.fbr-tyrA.sup.fbr-ppsA-tktA and an Engineered Strain HGA

(23) A heat induced plasmid framework was obtained from a plasmid pAP-B03 with a primer pair F113/R113, including a kanamycin gene, a promoter P.sub.RP.sub.L (obtained with a primer pair F116/R116) and a replicator p15A. Genes aroG.sup.fbr and tyrA.sup.fbr were obtained from a plasmid pCDF-aroG.sup.fbr-tyrA.sup.fbr with primer pairs F114/R114 and F117/R117, respectively. A gene tktA and a gene ppsA were obtained from an E. coli genome by amplification with primer pairs F115/R115 and F118/R118, respectively. The obtained heat induced plasmid framework was assembled with the target genes aroG.sup.fbr, tyr A.sup.fbr, tktA and ppsA by a GIBSON ASSEMBLY method (a cloning method that joins DNA fragments together without the need for restriction enzymes) to obtain plasmids pAP-aroG.sup.fbr-tyrA.sup.fbr and pAP-aroG.sup.fbr-tyrA.sup.fbr-ppsA-tktA.

(24) The recombinant vector pAP-aroG.sup.fbr-tyrA.sup.fbr-ppsA-tktA was transformed into the E. coli HGA0 to obtain an engineered strain HGA.

(25) (3) Preparation of Engineered Strains HGB0 and HGB

(26) With the engineered strain HGA0 as an original strain, electrically transformed competent cells HGA0-pCas of HGA0 containing a plasmid pCas were constructed by the same method. A gene trpE was knocked out by the same method to block the synthesis of tryptophan. With an E. coli K12 genome as a template, upstream and downstream homologous arms of the trpE were amplified with primer pairs F15/R15 and F16/R16, respectively, and a knockout box UD2 was obtained by amplification with a primer pair F15/R16. p-Target was amplified with a primer pair F17/R17 to prepare a recombinant vector pTarget-trpE. The knockout box UD2 and the recombinant vector pTarget-trpE were electrically transformed into the HGA0-pCas. Bacterial colonies were subjected to PCR verification with a primer pair F18/R18, and the verified monoclone loses the pTarget-trpE and the pCas9 to obtain an engineered strain HGB0.

(27) The recombinant vector pAP-aroG.sup.fbr-tyrA.sup.fbr-ppsA-tktA was transformed into the E. coli HGB0 to obtain an engineered strain HGB.

(28) (4) Preparation of Engineered Strains HGC0 and HGC

(29) With the engineered strain HGB0 as an original strain, electrically transformed competent cells HGB0-pCas of HGB0 containing a plasmid pCas were constructed by the same method. With an E. coli K12 genome as a template, a gene tyrR was knocked out by the same method to relieve a repression effect of accumulation of amino acids on key enzymes of a shikimic acid pathway, upstream and downstream homologous arms of the tyrR were amplified with primer pairs F19/R19 and F110/R110, respectively, and a knockout box UD3 was obtained by amplification with a primer pair F19/R110. p-Target was amplified with a primer pair F111/R111 to prepare a recombinant vector pTarget-tyrR. The knockout box UD3 and the recombinant vector pTarget-tyrR were electrically transformed into the HGB0-pCas. Bacterial colonies were subjected to PCR verification with a primer pair F112/R112, and the verified monoclone loses the pTarget-tyrR and the pCas9 to obtain an engineered strain HGC0.

(30) The recombinant vector pAP-aroG.sup.fbr-tyrA.sup.fbr-ppsA-tktA was transformed into the E. coli HGC0 to obtain an engineered strain HGC.

(31) The engineered strain HGC was inoculated into 50 mL of a seed culture medium and cultured at 220 rpm at 37 C. for 12 h to obtain a seed liquid. Then, the seed liquid was inoculated into a fermentation culture medium containing kanamycin with a final concentration of 50 g/mL at an inoculation amount of 2% (v/v) and cultured at 220 rpm at 33 C. for 3 h, and the temperature was changed to 38 C. Synthesis of L-tyrosine was induced at 220 rpm at 38 C., fermentation was performed for 48 h, and 5.6 g/L tyrosine was accumulated in a shake flask.

(32) All primer sequences are listed in Table 2.

(33) TABLE-US-00002 TABLE2 Primersequences Primer name Primersequence F11 cgtctcgccaaactggaaaaatgg SEQIDNO:13 R11 cttttcaccccgatttgggaggccttattg SEQIDNO:14 F12 ctcccaaatcggggtgaaaaggtgccggatgatgtgaatcatcc SEQIDNO:15 R12 caatggtttctggagcaaattcaggtctg SEQIDNO:16 F13 atataccgaaagtacgtctggttttagagctagaaatagcaagttaaaataag SEQIDNO:17 gctag R13 cagacgtactttcggtatatactagtattatacctaggactgagctagctg SEQIDNO:18 F14 ccagcaaacaaatggaaattactccgg SEQIDNO:19 R14 gtctggtgtgatggacgtaaaccg SEQIDNO:20 F15 ccaggcgttcaattaaggtttgcg SEQIDNO:21 R15 gtttttatctcgccgaactgcgtcacgatcttgac SEQIDNO:22 F16 gacgcagttcggcgagataaaaacagaaatcagggcag SEQIDNO:23 R16 cgactctcgaactgctaacctgc SEQIDNO:24 F17 attgccggaacacgcccacggttttagagctagaaatagcaagttaaaataag SEQIDNO:25 g R17 cgtgggcgtgttccggcaatactagtattatacctaggactgagctagctg SEQIDNO:26 F18 ccaggagaaagcatcagcacc SEQIDNO:27 R18 gcaatcagatacccagcccg SEQIDNO:28 F19 cggaatcaacgttgatgattgcgg SEQIDNO:29 R19 aggcatattcgcacttcggcgtaaagatatccg SEQIDNO:30 F110 gccgaagtgcgaatatgcctgatggtgcaacacc SEQIDNO:31 R110 gatctgtctgacgtcaccctcg SEQIDNO:32 F111 ccacgggacagtacgcacatgttttagagctagaaatagcaagttaaaataag SEQIDNO:33 R111 atgtgcgtactgtcccgtggactagtattatacctaggactgagctagctg SEQIDNO:34 F112 gtccagccagttttagatgcccag SEQIDNO:35 R112 gttacagtcgccaattccatccc SEQIDNO:36 F113 gaagaaataaccggcgttcagcctgtgc SEQIDNO:37 R113 cgttctgataattcatgatctttagctgtcttggtttgccc SEQIDNO:38 F114 atgaattatcagaacgacgatttacgcatc SEQIDNO:39 R114 gtgaggacatggtatatctccttttacccgcgacgcgcttttac SEQIDNO:40 F115 gggtaaaaggagatataccatgtcctcacgtaaagagcttgcc SEQIDNO:41 R115 gtaggtgagttacagcagttcttttgctttcgcaac SEQIDNO:42 F116 gcaaaagaactgctgtaactcacctaccaaacaatgcccc SEQIDNO:43 R116 gcaaccattggatcccaatgcttcgtttcg SEQIDNO:44 F117 ggatccaatggttgctgaattgaccgcattac SEQIDNO:45 R117 gttggacatggtatatctccttttactggcgattgtcattcgcc SEQIDNO:46 F118 gccagtaaaaggagatataccatgtccaacaatggctcgtcac SEQIDNO:47 R118 ggctgaacgccggttatttcttcagttcagccaggcttaacc SEQIDNO:48

Example 2: Exogenous Introduction of Fpk to Improve Synthesis of L-Tyrosine

(34) In order to improve the utilization of glucose, fpk from Bifidobacterium adolescentis was heterologously expressed to directionally guide glucose to a shikimic acid pathway so as to increase precursor supply of the shikimic acid pathway. In order to prevent too long plasmids from affecting gene expression efficiency, genes ppsA and tktA and a strong promoter PJ.sub.231119 were linked for integration on an E. coli genome.

(35) (1) Preparation of an Engineered Strain HGD0

(36) With the engineered strain HGC0 constructed in Example 1 as an original strain, electrically transformed competent cells HGC0-pCas of HGC0 containing a plasmid pCas were constructed by the same method. A gene tktA was integrated by the same gene knockout method. With an E. coli K12 genome as a template, the gene tktA was amplified with a primer pair F23/R23, and upstream and downstream homologous arms of dadx-cvra were amplified with primer pairs F24/R24 and F25/R25, respectively. With the gene tktA and the upstream and downstream homologous arms of dadx-cvra as templates, a knock-in box UTD was obtained by amplification of the tktA and the upstream and downstream homologous arms with a primer pair F24/R25. p-Target was amplified with a primer pair F26/R26 to prepare a recombinant vector pTarget-dadx-cvra. The knock-in box UTD and the recombinant vector pTarget-dadx-cvra were electrically transformed into the HGC0-pCas. Bacterial colonies were subjected to PCR verification with a primer pair F27/R27, and the verified monoclone loses the pTarget-dadx-cvra and the pCas9 to obtain an engineered strain HGD0.

(37) (2) Preparation of an Overexpression Plasmid pAP-aroG.sup.fbr-tyrA.sup.fbr-Fpk and Engineered Strains HGE0 and HGE

(38) Electrically transformed competent cells HGD0-pCas of HGD0 containing a plasmid pCas were constructed by the same method. A gene ppsA was integrated by the same method. With an E. coli K12 genome as a template, the gene ppsA was amplified with a primer pair F28/R28, upstream and downstream homologous arms of ykgh-betA were amplified with primer pairs F29/R29 and F210/R210, respectively, and a knock-in box UPD was obtained by amplification of the ppsA and the upstream and downstream homologous arms with a primer pair F29/R210. p-Target was amplified with a primer pair F211/R211 to prepare a recombinant vector pTarget-ykgh-betA. The knock-in box UPD and the recombinant vector pTarget-ykgh-betA were electrically transformed into the HGD0-pCas. Bacterial colonies were subjected to PCR verification with a primer pair F212/R212, and the verified monoclone loses the pTarget-ykgh-betA and the pCas9 to obtain an engineered strain HGE0.

(39) With synthetic fpk as a template, amplification was performed with a primer pair F21/R21, followed by purification and recovery. With the recombinant vector pAP-aroG.sup.fbr-tyrA.sup.fbr constructed in Example 1 as a template, amplification was performed with a primer pair F22/R22, and fragments were recovered. A fragment fpk and the vector pAP-aroG.sup.fbr-tyrA.sup.fbr skeleton were reconstructed by a GIBSON ASSEMBLY method (a cloning method that joins DNA fragments together without the need for restriction enzymes) to obtain a recombinant vector, the recombinant vector was transformed into E. coli JM109, and a plasmid was extracted and sequenced for verification to obtain a correct recombinant vector pAP-aroG.sup.fbr-tyrA.sup.fbr-fpk.

(40) The engineered strain HGE was inoculated into 50 mL of a seed culture medium and cultured at 220 rpm at 37 C. for 12 h to obtain a seed liquid. Then, the seed liquid was inoculated into a fermentation culture medium containing kanamycin with a final concentration of 50 g/mL at an inoculation amount of 2% (v/v), and cultured at 220 rpm at 33 C. for 3 h, and the temperature was changed to 38 C. Synthesis of L-tyrosine was induced at 220 rpm at 38 C., fermentation was performed for 48 h, and 6.0 g/L L-tyrosine was accumulated in a shake flask.

(41) All primer sequences are listed in Table 3.

(42) TABLE-US-00003 TABLE3 Primersequences Primer name Primersequence F21 ggtaaaaggagatataccatgactaaccctgtaatcggtactcc SEQIDNO:49 R21 gtttggtaggtgagttattcattgtcaccagcagtagcagc SEQIDNO:50 F22 ggtgacaatgaataactcacctaccaaacaatgcccc SEQIDNO:51 R22 cagggttagtcatggtatatctccttttacccgcgacgcgcttttactgcattc SEQIDNO:52 F23 ttgacagctagctcagtcctaggtataatactagtaaagaggagaaaaagct SEQIDNO:53 tatgtcctcacgtaaagagcttgc R23 ttacagcagttcttttgctttcgcaac SEQIDNO:54 F24 gtgatatcgccaataccggattacg SEQIDNO:55 R24 ggactgagctagctgtcaatgcggtgagttcaggttccgg SEQIDNO:56 F25 gcaaaagaactgctgtaacaggcgttctacataaaacgcttacgc SEQIDNO:57 R25 ggcgatgtgttgtgtgtaattgg SEQIDNO:58 F26 ggcgaagaatatcatccatggttttagagctagaaatagcaagttaaaataa SEQIDNO:59 gg R26 catggatgatattcttcgccactagtattatacctaggactgagctagctg SEQIDNO:60 F27 cgcattttgactgggttcggc SEQIDNO:61 R27 gcggcactgtttcgtgataacc SEQIDNO:62 F28 ttgacagctagctcagtcctaggtataatactagtaaagaggagaaaaagct SEQIDNO:63 tatgtccaacaatggctcgtcac R28 gattgagagttttatttcttcagttcagccaggcttaac SEQIDNO:64 F29 gtatctcatcgagaacttgcctgcc SEQIDNO:65 R29 gactgagctagctgtcaaaccgttccagagagggggacc SEQIDNO:66 F210 gaagaaataaaactctcaatctgatcggttcctgc SEQIDNO:67 R210 gtgcggattaaatcccgcgac SEQIDNO:68 F211 ggtgaaaacgactatcacgggttttagagctagaaatagcaagttaaaataa SEQIDNO:69 gg R211 ccgtgatagtcgttttcaccactagtattatacctaggactgagctagctg SEQIDNO:70 F212 cggatacaatgaccagttcctgg SEQIDNO:71 R212 Cggtttccagtgccacgtc SEQIDNO:72

Example 3: Modification of Acetic Acid Pathway to Improve Utilization of Glucose

(43) When the HGE strain constructed in Example 2 was fermented in a shake flask, it was found that the content of acetic acid accumulated in the shake flask was 1.2 g/L within 48 h, resulting in serious waste of carbon resources. Therefore, an acetic acid pathway of E. coli was modified. A gene poxB encoding pyruvate oxidase (PoxB) in E. coli was knocked out.

(44) With an E. coli K12 genome as a template, an upstream homologous arm U1 and a downstream homologous arm D1 of the gene poxB were amplified with primer pairs F31/R31 and F32/R32, respectively, and fragments were purified. With purified fragments U1 and D1 as templates, a knockout box UD1 was obtained by amplification with a primer pair F31/R32, and fragments were purified. In order to obtain pTarget-poxB for knocking out the poxB, amplification was performed with a primer pair F33/R33 with p-Target stored in a laboratory as a template, and fragments were purified. A purified fragment was transformed into E. coli JM109, and a plasmid was extracted and sequenced for verification to obtain a correct recombinant vector pTarget-poxB.

(45) With the engineered strain HGE as an original strain, electrically transformed competent cells HGE-pCas of HGE containing a plasmid pCas were constructed by the same method. A gene poxB of E. coli HGE was knocked out by the same experimental method in Example 1. Bacterial colonies were subjected to PCR verification with a primer pair F34/R34, and the verified monoclone loses the pTarget-poxB and the pCas9 to obtain an engineered strain HGF0.

(46) The recombinant vector pAP-aroG.sup.fbr-tyrA.sup.fbr-fpk in Example 2 was transformed into the E. coli HGF0 to obtain an engineered strain HGF.

(47) The engineered strain HGF was inoculated into 50 mL of a seed culture medium and cultured at 220 rpm at 37 C. for 12 h to obtain a seed liquid. Then, the seed liquid was inoculated into a fermentation culture medium containing kanamycin with a final concentration of 50 g/mL at an inoculation amount of 2% (v/v), and cultured at 220 rpm at 33 C. for 3 h, and the temperature was changed to 38 C. Synthesis of L-tyrosine was induced at 220 rpm at 38 C., fermentation was performed for 48 h, and 6.2 g/L L-tyrosine was accumulated in a shake flask, where the accumulation content of acetic acid was only 0.45 g/L, which was effectively reduced by 62.5%.

(48) All primer sequences are listed in Table 4.

(49) TABLE-US-00004 TABLE4 Primersequences Primername Primersequence F31 ggcaacactttgccgttgtgg SEQIDNO:73 R31 cataatcgccgaactggcgaaaacaaactggc SEQIDNO:74 F32 tcgccagttcggcgattatgcgagaaccaaatcc SEQIDNO:75 R32 cgatgagtggcgtaactatccgg SEQIDNO:76 F33 ggtgaaaatagcgtcatcgggttttagagctagaaatagcaagttaaaat SEQIDNO:77 aagg R33 ccgatgacgctattttcaccactagtattatacctaggactgagctagctg SEQIDNO:78 F34 gtcaacatgcagcgccagatt SEQIDNO:79 R34 gatctacaacgtgcgtacgcc SEQIDNO:80

Example 4: Modification of Aromatic Amino Acid Transport System

(50) (1) Preparation of Engineered Strains HGG0 and HGG

(51) Through determination of the intracellular content of tyrosine in the strain HGF in Example 3, it was found that the intracellular concentration of tyrosine in the HGF was 972.7% higher than that of wild-type E. coli K12 as a control group. Therefore, an aromatic amino acid transport system of the HGF was modified. A gene aroP encoding permease of an aromatic amino acid transporter AroP in E. coli was knocked out. With an E. coli K12 genome as a template, an upstream homologous arm U1 and a downstream homologous arm D1 of the gene aroP were amplified with primer pairs F41/R41 and F42/R42, respectively, and fragments were purified. With purified fragments U1 and D1 as templates, a knockout box UD1 was obtained by amplification with a primer pair F41/R42, and fragments were purified. In order to obtain pTarget-aroP for knocking out the aroP, amplification was performed with a primer pair F43/R43 with p-Target stored in a laboratory as a template, and fragments were purified. A purified fragment was transformed into E. coli JM109, and a plasmid was extracted and sequenced for verification to obtain a correct recombinant vector pTarget-aroP.

(52) With the engineered strain HGF0 as an original strain, electrically transformed competent cells HGF0-pCas of HGF0 containing a plasmid pCas were constructed by the same method. A gene aroP of E. coli HGF0 was knocked out by the same experimental method in Example 1. Bacterial colonies were subjected to PCR verification with a primer pair F44/R44, and the verified monoclone loses the pTarget-aroP and the pCas9 to obtain an engineered strain of E. coli HGG0.

(53) The recombinant vector pAP-aroG.sup.fbr-tyrA.sup.fbr-fpk in Example 2 was transformed into the E. coli HGG0 to obtain an engineered strain HGG.

(54) (2) Preparation of Overexpression Plasmid pAP-aroG.sup.fbr-yddG-tyrA.sup.fbr-Fpk and Engineered Strains HGH0 and HGH

(55) A gene tyrP was knocked out by the same method to block the synthesis of a tyrosine specific transport protein. With the engineered strain HGG0 as an original strain, electrically transformed competent cells HGG0-pCas of HGG0 containing a plasmid pCas were constructed by the same method. A gene tyrP was knocked out by the same method to block the synthesis of tryptophan. With an E. coli K12 genome as a template, upstream and downstream homologous arms of the tyrP were amplified with primer pairs F45/R45 and F46/R46, respectively, and a knockout box UD1 was obtained by amplification with a primer pair F45/R46. p-Target was amplified with a primer pair F47/R47 to prepare a recombinant vector pTarget-tyrP. The knockout box UD1 and the recombinant vector pTarget-tyrP were electrically transformed into the HGG0-pCas. Bacterial colonies were subjected to PCR verification with a primer pair F48/R48, and the verified monoclone loses the pTarget-tyrP and the pCas9 to obtain an engineered strain HGH0.

(56) With an E. coli K12 genome as a template, a fragment yddG was amplified with a primer pair F49/R49. With the vector pAP-aroG.sup.fbr-tyrA.sup.fbr-fpk as a template, amplification was performed with a primer pair FP410/RP410, and a product was purified. A fragment yddG and the vector pAP-aroG.sup.fbr-tyrA.sup.fbr-fpk skeleton were reconstructed by a GIBSON ASSEMBLY method (a cloning method that joins DNA fragments together without the need for restriction enzymes) to obtain a recombinant vector, the recombinant vector was transformed into E. coli JM109, and a plasmid was extracted and sequenced for verification to obtain a correct recombinant vector pAP-aroG.sup.fbr-yddG-tyrA.sup.fbr-fpk. The recombinant vector pAP-aroG.sup.fbr-yddG-tyrA.sup.fbr-fpk was transformed into the E. coli HGH0 to obtain an engineered strain HGH.

(57) The engineered strain HGH was inoculated into 50 mL of a seed culture medium and cultured at 220 rpm at 37 C. for 12 h to obtain a seed liquid. Then, the seed liquid was inoculated into a fermentation culture medium containing kanamycin with a final concentration of 50 g/mL at an inoculation amount of 2% (v/v), and cultured at 220 rpm at 33 C. for 3 h, and the temperature was changed to 38 C. Synthesis of L-tyrosine was induced at 220 rpm at 38 C., fermentation was performed for 48 h, and 6.9 g/L tyrosine was accumulated in a shake flask.

(58) All primer sequences are listed in Table 5.

(59) TABLE-US-00005 TABLE5 Primersequences Primer name Primersequence F41 cgtgagtatttgcgtgagctgc SEQIDNO:81 R41 acgaggtttctctctctacgccctcacccg SEQIDNO:82 F42 cgtagagagagaaacctcgtgcggtggttg SEQIDNO:83 R42 ggtcttaccaatttcatgtctgtgacg SEQIDNO:84 F43 aatcaccacaaagaatacgggttttagagctagaaatagcaagttaaaat SEQIDNO:85 aagg R43 cagctagctcagtcctaggtataatactagtaatcaccacaaagaatacgg SEQIDNO:86 F44 ttggcgcaggtaaagttcgt SEQIDNO:87 R44 tgttttgccagttcgcgttc SEQIDNO:88 F45 gcggcgaaggtctgtattttatcga SEQIDNO:89 R45 ctatctgagctttcttctgtcctgacgatctttatgag SEQIDNO:90 F46 cgtcaggacagaagaaagctcagatagcctcaaattccttattgggtgc SEQIDNO:91 R46 ctggcttttcaacatatggccgatac SEQIDNO:92 F47 agaaaatatatgccaccagggttttagagctagaaatagcaagttaaaat SEQIDNO:93 aagg R47 cagctagctcagtcctaggtataatactagtagaaaatatatgccaccagg SEQIDNO:94 F48 gagcagcatgaagaagagaaactgttc SEQIDNO:95 R48 ggcgtcagagaaagagatgacgc SEQIDNO:96 F49 ggtaaaaggagatataccatgacacgacaaaaagcaacgc SEQIDNO:97 R49 gtttggtaggtgagttaaccacgacgtgtcgccag SEQIDNO:98 F410 cgtcgtggttaactcacctaccaaacaatgcccc SEQIDNO:99 R410 ctttttgtcgtgtcatggtatatctccttttacccgcgacgcgcttttac SEQIDNO:100

Example 5: Optimization of Fermentation in 5-L Fermentation Tank

(60) The engineered strain HGH constructed in Example 4 was inoculated into 50 mL of a seed culture medium and cultured at 220 rpm at 37 C. for 12 h to obtain a primary seed liquid, the primary seed liquid was inoculated into 50 mL of a secondary seed liquid at an inoculation amount of 2% (v/v), and then, the secondary seed liquid was inoculated into 2.5 L of a fermentation culture medium containing kanamycin with a final concentration of 50 g/mL at an inoculation amount of 2% (v/v). With the initial rotation speed controlled at 300 rpm, the seed liquid was cultured at 33 C. for 12 h until the OD.sub.600 value was 20-23, heated to 38 C. and continuously cultured for 48-55 h to obtain a fermentation liquid. In a whole fermentation process, the pH value was controlled at 6.4-6.6 by fed-batch 50% ammonia water; when the dissolved oxygen (DO) value was decreased to 20%, the rotation speed or the ventilation capacity was gradually increased to maintain the DO value at 20% or above; and when the glucose in a culture medium was depleted, a feeding procedure was started, and 750 g/L glucose was added to perform fed-batch fermentation, where the concentration of glucose was maintained at about 5-8 g/L. After completion of fermentation, the content of tyrosine was determined. Finally, as shown in FIG. 2, when the engineered strain HGH was subjected to fed-batch fermentation in a 5 L fermentation tank for 55 h, the accumulation content of tyrosine was 80.5 g/L, and the production intensity was 1.46 g/L/h.

(61) Although the present disclosure has been disclosed as above through the preferred examples, the examples are not intended to limit the present disclosure. For any person familiar with the art, various changes and modifications can be made without departing from the spirit and scope of the present disclosure. Therefore, the protection scope of the present disclosure should be as defined in the claims.