GENE DRIVE TARGETING FEMALE DOUBLESEX SPLICING IN ARTHROPODS
20250255283 ยท 2025-08-14
Assignee
Inventors
Cpc classification
A01K2217/07
HUMAN NECESSITIES
C12N15/8509
CHEMISTRY; METALLURGY
International classification
Abstract
The invention relates to gene drives, and in particular to genetic sequences and constructs for use in a gene drive. The invention is especially concerned with ultra-conserved and ultra-constrained sequences for use as a gene drive target with the aim of overcoming the development of resistance to the drive. The invention is also concerned with methods of suppressing wild type arthropod populations by use of the gene drive construct described herein.
Claims
1. A gene drive genetic construct capable of disrupting an intron-exon boundary of the female-specific splice form of the doublesex gene in an arthropod.
2. The gene drive genetic construct according to claim 1, wherein the arthropod is an insect.
3.-47. (canceled)
48. The gene drive genetic construct according to claim 2, wherein the insect is selected from the group consisting of an Anopheline species, an Aedes species, Ceratitis capitata and a Drosophila species.
49. The gene drive genetic construct according to claim 48, wherein the insect is an Anopheline species, selected from a group consisting of Anopheles gambiae, Anopheles coluzzi, Anopheles merus, Anopheles arabiensis, Anopheles quadriannulatus, Anopheles stephensi, Anopheles funestus, and Anopheles melas.
50. The gene drive genetic construct according to claim 49, wherein the arthropod is Anopheles gambiae.
51. The gene drive genetic construct according to claim 1, wherein the doublesex gene comprises a nucleic acid sequence as set out in SEQ ID NO: 1, or a fragment or variant thereof.
52. The gene drive genetic construct according to claim 1, wherein the intron-exon boundary is the boundary between intron 4 and exon 5 of the doublesex gene.
53. The gene drive genetic construct according to claim 1, wherein the intron-exon boundary comprises the nucleotide sequence as set out in SEQ ID NO: 2, 3 or 4, or a fragment or variant thereof.
54. The gene drive genetic construct according to claim 52, wherein the intron-exon boundary is targeted by a genetic construct having a-target sequence including up to 1, 2, 3, 4, 5, 10 or 15 nucleotides 5 and/or 3 of SEQ ID No:2, 3 or 4 and said gene drive genetic construct is a nuclease-based genetic construct.
55. The gene drive genetic construct according claim 54, wherein the nuclease-based genetic construct is selected from a group consisting of a transcription activator-like effector nuclease (TALEN) genetic construct, Zinc finger nuclease (ZFN) genetic construct, and a CRISPR-based gene drive genetic construct.
56. The gene drive genetic construct according to claim 55, wherein the gene drive genetic construct is a CRISPR-based gene drive construct selected from the group consisting of a CRISPR-Cpf1-based or a CRISPR-Cas9-based gene drive genetic construct.
57. The gene drive genetic construct according to claim 55, wherein the genetic construct comprises a first nucleotide sequence encoding a nucleotide sequence that is capable of hybridising to the intron-exon boundary of the doublesex gene.
58. The gene drive genetic construct according to claim 57 wherein the genetic construct comprises a first nucleotide sequence encoding a nucleotide sequence that is capable of hybridising to the intron-exon boundary of the doublesex gene is a guide RNA.
59. The gene drive genetic construct according to claim 57, wherein the first nucleotide sequence encoding a nucleotide sequence that is capable of hybridising to the intron-exon boundary of the doublesex (dsx) gene comprises a nucleic acid sequence as set out in SEQ ID NO: 5 or 6, or a fragment or variant thereof.
60. The gene drive genetic construct according to claim 57, wherein the nucleotide sequence which is encoded by the first nucleotide sequence and which is capable of hybridising to the intron-exon boundary of the doublesex (dsx) gene comprises a nucleic acid sequence as set out in SEQ ID NO: 58 or 48, or a fragment or variant thereof.
61. The gene drive genetic construct according to claim 55, wherein the gene drive genetic construct further comprises a second nucleotide sequence encoding a CRISPR nuclease.
62. The gene drive genetic construct according to claim 55, wherein the gene drive genetic construct further comprises a second nucleotide sequence encoding a CRISPR nuclease, wherein the second nucleotide sequence encodes a Cpf1 or Cas9 nuclease.
63. The gene drive genetic construct according to claim 55, wherein the gene drive genetic construct further comprises at least one promoter sequence, which drives expression of the first and second nucleotide sequence.
64. The gene drive genetic construct according to claim 63, wherein the gene drive genetic construct comprises a first promoter sequence operably linked to the first nucleotide sequence and a second promoter sequence operably linked to the second nucleotide sequence.
65. The gene drive genetic construct according to claim 64, wherein the first promoter is a polymerase III promoter, or wherein the first promoter sequence comprises a nucleic acid sequence substantially as set out in SEQ ID No: 49, or a variant or fragment thereof.
66. The gene drive genetic construct according to claim 64, wherein the second promoter sequence is a promoter sequence that restricts expression of the second nucleotide sequence to germline cells of the arthropod.
67. The gene drive genetic construct according to claim 66 wherein the second promoter sequence is: (i) zpg, wherein the second promoter sequence comprises a nucleic acid sequence as set out in SEQ ID No: 7, or a variant or fragment thereof; (ii) nos, wherein the second promoter sequence comprises a nucleic acid sequence as set out in SEQ ID No: 8, or a variant or fragment thereof; (iii) exu, wherein the second promoter sequence comprises a nucleic acid sequence as set out in SEQ ID No: 9, or a variant or fragment thereof; or (iv) vasa2, wherein the second promoter sequence comprises a nucleic acid sequence as set out in SEQ ID No: 10, or a variant or fragment thereof.
68. The gene drive genetic construct according to claim 55, wherein the construct further comprises attB integrase attachment sites which flank the first nucleotide sequence encoding the nucleotide sequence that is capable of hybridising to the intron-exon boundary of the doublesex gene, the second nucleotide sequence encoding the nuclease, the first promoter sequence and the second promoter sequence.
69. The gene drive genetic construct according to claim 55, wherein the construct further comprises third and fourth nucleotide sequences which flank the first nucleotide sequence encoding the nucleotide sequence that is capable of hybridising to the intron-exon boundary of the doublesex gene, the second nucleotide sequence encoding the nuclease, the first promoter sequence and the second promoter sequence, wherein the third and fourth nucleotides are homologous to the genomic sequences flanking the intron-exon boundary, such that the gene drive construct is integrated into the disrupted intron-exon boundary via homology-directed repair.
70. The gene drive genetic construct according to claim 69, wherein the third nucleotide sequence comprises a nucleic acid sequence as set out in SEQ ID No: 11, or a variant or fragment thereof and/or wherein the fourth nucleotide sequence comprises a nucleic acid sequence as set out in SEQ ID No: 12, or a variant or fragment thereof.
71. The gene drive genetic construct according to claim 1, wherein the gene drive construct comprises a nucleic acid sequence as set out in SEQ ID NO: 13, or a fragment or variant thereof.
72. The gene drive genetic construct according to claim 1, wherein the construct is capable of targeting (i) a first target site which comprises the intron-exon boundary of the female specific splice form of the doublesex (dsx) gene, and (ii) a second target site disposed in exon 5 of the female specific splice form of the doublesex (dsx) gene.
73. The gene drive genetic construct according to claim 72, wherein the second target site comprises a nucleic acid sequence, which is disposed in the sequence as set out in SEQ ID No: 35, 36 (T2), 37 (T3) or 38 (T4) or a variant or fragment thereof, or wherein the second target site includes up to 1, 2, 3, 4, 5, 10 or 15 nucleotides 5 and/or 3 of SEQ ID No:35, 36, 37 or 38.
74. The gene drive genetic construct according to claim 72, wherein the gene drive construct targets: (i) SEQ ID NO: 4, or up to 1, 2, 3, 4, 5, 10 or 15 nucleotides 5 and/or 3 of SEQ ID No:4; and (ii) SEQ ID No:3, or up to 1, 2, 3, 4, 5, 10 or 15 nucleotides 5 and/or 3 of SEQ ID No:3.
75. The gene drive genetic construct according to claim 72, wherein the construct comprises: (i) a first nucleotide sequence encoding a first guide RNA which is capable of hybridising to a first target site which is an intron-exon boundary of the female specific splice form of the doublesex (dsx) gene, and (ii) a fifth nucleotide sequence encoding a second guide RNA which is capable of hybridising to a second target site disposed in exon 5 of the female specific splice form of the doublesex (dsx) gene.
76. The gene drive genetic construct according to claim 75, wherein the first and/or fifth nucleotide sequence encodes a guide RNA.
77. The gene drive genetic construct according to claim 75, wherein the fifth nucleotide sequence encoding a nucleotide sequence that is capable of hybridising to the second target site comprises a nucleic acid sequence as set out in any one of SEQ ID NO: 39-44, or a fragment or variant thereof.
78. The gene drive genetic construct according to claim 73, wherein the nucleotide sequence which is encoded by the fifth nucleotide sequence and which is capable of hybridising to the second target site comprises a nucleic acid sequence as set out in any one of SEQ ID NO: 45, 46, 47, 59, 60 or 61 or a fragment or variant thereof.
79. The gene drive genetic construct according to claim 75, wherein the construct comprises a first promoter sequence operably linked to the first nucleotide sequence, a second promoter sequence operably linked to the second nucleotide sequence, and a third promoter sequence operably linked to the fifth nucleotide sequence.
80. The gene drive genetic construct according to claim 75, wherein the construct further comprises att integrase attachment sites which flank the first nucleotide sequence encoding the nucleotide sequence that is capable of hybridising to the first target site which is an intron-exon boundary of the female specific splice form of the doublesex (dsx) gene, and the fifth nucleotide sequence capable of hybridising to a second target site disposed in exon 5 of the female specific splice form of the doublesex (dsx) gene, the second nucleotide sequence encoding the nuclease, the first promoter sequence, the second promoter sequence and the third promoter sequence.
81. The gene drive genetic construct according to claim 75, wherein the construct further comprises sixth and seventh nucleotide sequences which flank the first nucleotide sequence encoding the nucleotide sequence that is capable of hybridising to the first target site which is an intron-exon boundary of the female specific splice form of the doublesex (dsx) gene, and the fifth nucleotide sequence capable of hybridising to a second target site disposed in exon 5 of the female specific splice form of the doublesex (dsx) gene, the second nucleotide sequence encoding the nuclease, the first promoter sequence, the second promoter sequence and the third promoter sequence, wherein the sixth and seventh nucleotides are homologous to the genomic sequences flanking the two cut-sites which are disposed in exon 5 of the arthropod, such that when the docking construct is introduced into the arthropod, it is integrated into the arthropod's genome by homology directed repair.
82. The gene drive genetic construct according to claim 81, wherein the sixth nucleotide sequence comprises a nucleic acid sequence as set out in SEQ ID No: 11, or a variant or fragment thereof and/or wherein the seventh nucleotide sequence comprises a nucleic acid sequence as set out in SEQ ID No: 50, or a variant or fragment thereof.
83. The gene drive genetic construct according to claim 72, wherein the gene drive construct comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 51, or a fragment or variant thereof.
84. A method for preventing or reducing the inclusion of at least one exon into the female specific splice form of arthropod doublesex mRNA, when said mRNA is produced by splicing from a precursor mRNA transcript, the method comprising contacting one or more cells of an arthropod, one or more cells of an arthropod embryo, in vitro or ex vivo, under conditions conducive to uptake of the gene drive genetic construct according to claim by such cell, and allowing splicing to take place.
85. A method of producing a genetically modified arthropod, the method comprising introducing into an arthropod a gene drive genetic construct capable of disrupting an intron/exon boundary of the female specific splice form of doublesex gene in an arthropod.
86. An arthropod obtained or obtainable by the method according to claim 84.
87. A genetically modified arthropod comprising a disrupted intron-exon boundary of the female specific splice form doublesex gene, wherein the genetically modified arthropod is targeted using the gene drive genetic construct as defined in claim 1.
88. A method of suppressing a wild type arthropod population comprising breeding a genetically modified arthropod comprising an intron-exon boundary of the female exon of doublesex gene that has been disrupted by a gene drive genetic construct, with a wild type population of the arthropod, such that when the gene drive construct is expressed in offspring of the genetically modified arthropod and wild type arthropod, it disrupts the doublesex gene contributed by the wild type population.
89. The method according to claim 88, wherein the genetic construct is as defined in claim 1.
90. A nucleic acid comprising a nucleotide sequence substantially as set out as any one of SEQ ID No: 6-34, 42-48, 50-57 or a fragment or variant thereof.
91. A guide RNA comprising any one of SEQ ID No:58 to 61 and a nuclease binding region.
92. A guide RNA according to claim 91, wherein the nuclease binding region binds to, or complexes with, a CRISPR nuclease, which is a Cas endonuclease, Cas9 or Cpf1.
93. A guide RNA according to claim 92, wherein the guide RNA comprises trans-activating CRISPR RNA (tracrRNA) and a CRISPR RNA (crRNA), or a single guide RNA (sgRNA).
Description
[0167] For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which:
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
[0181]
EXAMPLES
[0182] The invention described herein relies on inserting site-specific nuclease genes into a locus of choice, in formations that both confer some trait of interest on an individual and lead to a biased inheritance of the trait. The approach relies on homing leading to suppression. The invention is focused on population suppression, whereby the gene drive construct is designed to insert within a target gene in such a way that the gene product, or a specific isoform thereof, is disrupted. To build the nuclease-based gene drive of the invention, the nuclease gene is inserted within its own recognition sequence in the genome such that a chromosome containing the nuclease gene cannot be cut, but chromosomes lacking it are cut. When an individual contains both a nuclease-carrying chromosome and an unmodified chromosome (i.e. heterozygous for the gene drive), the unmodified chromosome is cut by the nuclease. The broken chromosome is usually repaired using the nuclease-containing chromosome as a template and, by the process of homologous recombination, the nuclease is copied into the targeted chromosome. If this process, called homing, is allowed to proceed in the germline, then it results in a biased inheritance of the nuclease gene, and its associated disruption, because sperm or eggs produced in the germline can inherit the gene from either the original nuclease-carrying chromosome, or the newly modified chromosome.
[0183] Due to the negative reproductive load the gene drive imposes, selection can be expected to occur for resistant alleles. The most likely source of such resistance is sequence variation at the target site that prevents the nuclease cutting yet at the same time permits a functional product from the target gene. Such variation can pre-exist in a population or can be created by activity of the nuclease itselfa small proportion of cut chromosomes, rather than using the homologous chromosome as a template, can instead be repaired by end-joining (EJ), which can introduce small insertions or deletions (indels) or base substitutions during the repair of the target site. In-frame indels or conservative substitutions might be expected to show selection in the presence of a gene drive. The inventors have previously observed target site resistance in cage experiments (data not shown) and found that end-joining in chromosomes of the early embryo, due to parentally-deposited nuclease, was likely to be the predominant source of the resistant alleles at the target site.
[0184] In mitigating and preventing the emergence of resistant alleles, the strategy being investigated by the inventors involves carefully selecting target sites in regions of the target gene that are so functionally constrained and conserved that most variation is unlikely to restore function to the gene, meaning that the majority of variants will simply not confer any selective advantage. The inventors therefore investigated whether Anopheles gambiae doublesex gene (dsx) is a suitable target for a gene drive approach aimed at suppressing population reproductive capacity to eradicate malaria. To do this, they disrupted the intron 4-exon 5 boundary of dsx (referred to as target site T1) with the primary objective to prevent the formation of functional AgdsxF while leaving the AgdsxM transcript unaffected. They also disrupted target sites (referred to as T2, T3 and T4) in addition to the original target site, T1.
Materials and Methods
Population Genetics Model
[0185] To model the results of the cage experiments, the inventors used discrete-generation recursion equations for the genotype frequencies, treating males and females separately. F_ij (t) and M_ij (t) denote the frequency of females (or males) of genotype i/j in the total female (or male) population. The inventors considered three alleles, W (wildtype), D (driver) and R (non-functional resistant), and therefore six genotypes.
Homing Adults of genotype W/D produce gametes at meiosis in the ratio W:D:R as follows: [0186] (1d.sub.f)(1u.sub.f):d.sub.f:(1d.sub.f)u.sub.f in females [0187] (1d.sub.m)(1u.sub.m):d.sub.m:(1d.sub.m)u.sub.m in females
[0188] Here, d_f and d_m are the rates of transmission of the driver allele in the two sexes and u_f and u_m are the fractions of non-drive gametes that are non-functional resistant (R alleles) from meiotic end-joining. In all other genotypes, inheritance is Mendelian.
[0189] Fitness. Let w_ij1 represent the fitness of genotype i/j relative to w_WW=1 for the wild type homozygote. The inventors assume no fitness effects in males. Fitness effects in females are manifested as differences in the relative ability of genotypes to participate in mating and reproduction. The inventors assume the target gene is needed for female fertility, thus D/D, D/R and R/R females are sterile; there is no reduction in fitness in females with only one copy of the target gene (W/D, W/R).
Parental Effects
[0190] The inventors consider that further cleavage of the W allele and repair can occur in the embryo if nuclease is present, due to one or both contributing gametes derived from a parent with one or two driver alleles. The presence of parental nuclease is assumed to affect somatic cells and therefore female fitness but has no effect in germline cells that would alter gene transmission. Previously, embryonic EJ effects (maternal only) were modelled as acting immediately in the zygote [1,2]. Here, the inventors consider that experimental measurements of female individuals of different genotypes and origins show a range of fitnesses, suggesting that individuals may be mosaics with intermediate phenotypes. The inventors therefore model genotypes W/X (X=W, D, R) with parental nuclease as individuals with an intermediate reduced fitness w.sub.WX.sup.10, w.sub.WX.sup.01, or w.sub.WX.sup.11 depending on whether nuclease was derived from a transgenic mother, father, or both. The inventors assume that parental effects are the same whether the parent(s) had one or two drive alleles. For simplicity, a baseline reduced fitness of w.sub.10, w.sub.01, w.sub.11 is assigned to all genotypes W/X (X=W, D, R) with maternal, paternal and maternal/paternal effects, with fitness estimated as the product of mean egg production values and hatching rates relative to wild type in Table 1 in the deterministic model. In the stochastic version of the model, egg production from female individuals with different parentage is sampled with replacement from experimental values.
TABLE-US-00034 TABLE 1 Parameters for stochastic cage model Method of Parameter Estimate estimation Mating 0.85 for heterozygotes; 0 for Estimated probability D/D, D/R and R/R homozygotes from Hammond et al. 2017 Egg production Mean 137.4. Sampling with From assays from wildtype replacement of observed values of mated female (no (10, 61, 96, 98, 111, 111, 113, females parental 127, 128, 129, 132, 132, 134, nuclease) 135, 137, 138, 138, 139, 142, 142, 146, 146, 149, 152, 152, 152, 158, 160, 162, 164, 170, 179, 186, 189, 191) Egg production Mean 118.96. Sampling with From assays from W/D replacement of observed values of mated heterozygote (12, 31, 76, 90, 96, 100, 106, females female (nuclease 106, 107, 113, 117, 118, 119, from ) 130, 133, 136, 136, 136, 137, 138, 139, 142, 143, 145, 146, 148, 157, 174) Egg production Mean 59.67. Sampling with From assays from W/D replacement of observed values of mated heterozygote (0, 0, 0, 0, 0, 34, 47, 50, 65, females female (nuclease 105, 113, 115, 115, 125, 126) from ) Hatching 0.941 From assays probability, of mated wildtype female females (no parental nuclease) Hatching 0.707 From assays probability, of mated W/D heterozygote females female (nuclease from ) Hatching 0.47 From assays probability, of mated W/D heterozygote females female (nuclease from ) Probability 0.8708 Average of of emergence observations from pupa over all (survival generations from larva) and both cage experiments Drive in 0.9985 Observed W/D females fraction transgenic from assays Drive in 0.9635 Observed W/D males fraction transgenic from assays Meiotic EJ 0.4685 Estimated parameter from Hammond (fraction et al. 2016 non-drive alleles that are resistant)
Recursion Equations
[0191] The inventors firstly considered the gamete contributions from each genotype, including parental effects on fitness. In addition to W and R gametes that are derived from parents that have no drive allele and therefore have no deposited nuclease, gametes from W/D females and W/D, D/R and D/D males carry nuclease that is transmitted to the zygote, and these are denoted as W{circumflex over ()}*, D{circumflex over ()}*, R{circumflex over ()}*. The proportion of type i alleles in eggs produced by females participating in reproduction are given in terms of male and female genotype frequencies below. Frequencies of mosaic individuals with parental effects (i.e., reduced fitness) due to nuclease from mothers, fathers or both are denoted by superscripts 10, 01 or 11.
[0192] The proportions s.sub.i of type i alleles in sperm are:
[0193] Above,
[0194] To model cage experiments, the inventors started with an equal number of males and females, with an initial frequency of wildtype females in the female population of F_WW=1, wildtype males in the male population of M.sub.WW=1/2, and M.sub.WD.sup.01=1/2 heterozygote drive males that inherited the drive from their fathers. Assuming a 50:50 ratio of males and females in progeny, after the starting generation, genotype frequencies of type i/j in the next generation (t+1) are the same in males and females, F.sub.ij (t+1)=M.sub.ij (t+1). Both are given by G.sub.ij (t+1) in the following set of equations in terms of the gamete proportions in the previous generation, assuming random mating:
[0195] The frequency of transgenic individuals can be compared with experiment (fraction of RFP+ individuals):
[0196] All calculations were carried out using Wolfram Mathematica.sup.23.
PCR
[0197] The PCR reactions were performed using Phusion High Fidelity Master Mix. Initial denaturation was performed in 98 C. for 30 seconds. Primer annealing was performed at a temperature range of 60-72 C. form 30 seconds and elongation was performed at a temperature of 72 C. for 30 seconds per kb.
TABLE-US-00035 TABLE2 PrimersusedinthisstudyforExample1 dsxgRNA-F TGCTGTTTAACACAGGTCAAGCGG-SEQIDNo:14 dsxgRNA-R AAACCCGCTTGACCTGTGTTAAAC-SEQIDNo:15 dsx31L-F GCTCGAATTAACCATTGTGGACCGGTCTTGTGTTTAGCAG GCAGGGGA-SEQIDNo:16 dsx31L-R TCCACCTCACCCATGGGACCCACGCGTGGTGCGGGTCACC GAGATGTTC-SEQIDNo:17 dsx31R-F CACCAAGACAGTTAACGTATCCGTTACCTTGACCTGTGTTA AACATAAAT-SEQIDNo:18 dsx31R-R GGTGGTAGTGCCACACAGAGAGCTTCGCGGTGGTCAACG AATACTCACG-SEQIDNo:19 zpgprCRISPR-F GCTCGAATTAACCATTGTGGACCGGTCAGCGCTGGCGGTG GGGA-SEQIDNo:20 zpgprCRISPR-R TCGTGGTCCTTATAGTCCATCTCGAGCTCGATGCTGTATTT GTTGT-SEQIDNo:21 zpgteCRISPR-F AGGCAAAAAAGAAAAAGTAATTAATTAAGAGGACGGCGA GAAGTAATCAT-SEQIDNo:22 zpgteCRISPR-R TTCAAGCGCACGCATACAAAGGCGCGCCTCGCATAATGAA CGAACCAAAGG-SEQIDNo:23 dsxin3-F GGCCCTTCAACCCGAAGAAT-SEQIDNo:24 dsxex6-R CTTTTTGTACAGCGGTACAC-SEQIDNo:25 GFP-F GCCCTGAGCAAAGACCCCAA-SEQIDNo:26 dsxex4-F GCACACCAGCGGATCGACGAAG-SEQIDNo:27 dsxex5-R CCCACATACAAAGATACGGACAG-SEQIDNo:28 dsxex6-R GAATTTGGTGTCAAGGTTCAGG-SEQIDNo:29 3xP3 TATACTCCGGCGGTCGAGGGTT-SEQIDNo:30 hCas9-F CCAAGAGAGTGATCCTGGCCGA-SEQIDNo:31 dsxex5-R1 CTTATCGGCATCAGTTGCGCAC-SEQIDNo:32 dsxin4-F GGTGTTATGCCACGTTCACTGA-SEQIDNo:33 RFP-R CAAGTGGGAGCGCGTGATGAAC-SEQIDNo:34
TABLE-US-00036 TABLE6 PrimersusedinthisstudyforExample2 multidsx31L-F gctcgaattaaccattgtggaccggtCTTGTGTTTAGCAGGCAGGGGA-SEQ IDNo:52 multidsx31L-R tgaacgattggggtaccggtCTTGACCTGTGTTAAACATAAATG-SEQID No:53 multidsx31R-F agatataatcctgaacgcgtGAGTGGATGATAAACTTTCCGCAC-SEQID No:54 multidsx31R-R tccacctcacccatgggacccacgcgtGGTGCGGGTCACCGAGATGTTC-SEQ IDNo:55 4050-2U6-T1-F gagggtctcaTGCTGTTTAACACAGGTCAAGCGGgttttagagctagaaatagca agt-SEQIDNo:56 4050-2U6-T3-R gagggtctcaAAACCTCTGACGGGTGGTATTGCagcagagagcaactccatttca t-SEQIDNo:57
Example 1
[0198] To investigate whether dsx represented a suitable target for a gene drive approach aimed at suppressing population reproductive capacity, the inventors disrupted the intron 4-exon 5 boundary of dsx with the objective to prevent the formation of functional AgdsxF while leaving the AgdsxM transcript unaffected. The inventors injected A. gambiae embryos with a source of Cas9 and gRNA designed to selectively cleave the intron 4-exon 5 boundary in combination with a template for homology directed repair (HDR) to insert an eGFP transcription unit (
Results
[0199] HDR-mediated integration was confirmed by diagnostic PCR using primers that spanned the insertion site, producing a larger amplicon of the expected size for the HDR event and a smaller amplicon for the wild type allele, and thus allowing easy confirmation of genotypes (
[0200] The knock-in of the eGFP construct resulted in the complete disruption of the exon 5 (dsxF.sup.) coding sequence and was confirmed by PCR and genomic sequencing of the chromosomal integration (
TABLE-US-00037 TABLE 3 Ratio of larvae recovered by intercrossing heterozygous dsx C31-knock-in mosquitoes GFP strong (dsxF.sup./) GFP weak (dsxF.sup./+) no GFP (+/+) Total 262 (24.9%) 523 (49.7%) 268 (25.5%) 1053
[0201] Larvae heterozygous for the exon 5 disruption developed into adult male and female mosquitoes with a sex ratio close to 1:1. On the contrary half of dsxF/ individuals developed into normal males whereas the other half showed the presence of both male and female morphological features as well as a number of developmental anomalies in the internal and external reproductive organs (intersex).
[0202] To establish the sex genotype of these dsxF.sup./ intersex, the inventors introgressed the mutation into a line containing a Y-linked visible marker (RFP) and used the presence of this marker to unambiguously assign sex genotype among individuals heterozygous and homozygous for the null mutation. This approach revealed that the intersex phenotype was observed only in genotypic females that were homozygous for the null mutation. The inventors saw no effect in heterozygous mutants, suggesting that the female-specific isoform of dsx is haplosufficient.
[0203] Examination of external sexually dimorphic structures in dsxF.sup./ genotypic females showed several phenotypic abnormalities including: the development of dorsally rotated male claspers (and absent female cerci), longer flagellomeres associated with male-like plumose antennae (
[0204] Males carrying the dsxF null mutation in heterozygosity or homozygosity showed wild type levels of fertility as measured by clutch size and larval hatching per mated female, as did heterozygous dsxF female mosquitoes. On the contrary, intersex XX dsxF.sup./ female mosquitoes, though attracted to anaesthetised mice were unable to take a bloodmeal and failed to produce any eggs (
[0205] The surprisingly drastic phenotype of dsxF.sup./ in females is proof of key functional role of exon 5 of dsx in the poorly understood sex differentiation pathway of A. gambiae mosquitoes and suggested that its sequence could represent a suitable target for gene drive approaches aimed at population suppression.
[0206] The inventors employed recombinase-mediated cassette exchange (RMCE) to replace the 3P3::GFP transcription unit with a dsxF.sup.CRISPRh gene drive construct that consists of an RFP marker gene, a transcription unit to express the gRNA targeting dsxF, and the Cas9 gene under the control of the germline promoter of zero population growth (zpg) and its terminator sequence (
[0207] The ability of the dsxFCRISPRh construct to home and bypass Mendelian inheritance was analysed by scoring the rates of RFP inheritance in the progeny of heterozygous parents (referred to as dsxF.sup.CRISPRh/+ hereafter) crossed to wild type mosquitoes. Surprisingly, high dsxF.sup.CRISPRh transmission rates of up to 100% were observed in the progeny of both heterozygous dsxF.sup.CRISPRh/+ male and female mosquitoes (
[0208] Surprisingly, the inventors noticed a more severe reduction in the fertility of heterozygous females when the drive allele was inherited from their father (mean fecundity 21.7%+/8.6%) rather than their mother (64.9%+/6.9%) (
[0209] To test this hypothesis, caged wild type mosquito populations were mixed with individuals carrying the dsxF.sup.CRISPRh allele and subsequently monitored at each generation to assess the spread of the drive and quantify its effect on reproductive output. To mimic a hypothetical release scenario, the inventors started the experiment in two replicate cages putting together 300 wild type female mosquitoes with 150 wt male mosquitoes and 150 dsxF.sup.CRISPRh/+ male individuals and allowed them to mate. Eggs produced from the whole cage were counted and 650 eggs were randomly selected to seed the next generations. The larvae that hatched from the eggs were screened for the presence of the RFP marker to score the number of the progeny containing the dsxF.sup.CRISPRh allele in each generation. During the first three generations, the inventors observed in both caged populations an increase of the drive allele from 25% up to 69% and thereafter they diverged. In cage 2 the drive reached 100% frequency by generation 7; in the following generation no eggs were produced and the population collapsed. In cage 1 the drive allele reached 100% frequency at generation 11 after drifting around 65% for two generations. This cage population also failed to produce eggs in the next generation. Though the two cages showed some apparent differences in the dynamics of spreading both curves fall within the prediction of the model (
[0210] The inventors also monitored at different generations the occurrence of mutations at the target site to identify the occurrence of nuclease resistant functional variants. Amplicon sequencing of the target sequence from pooled population samples collected at generation 2, 3, 4 and 5 revealed the presence of several low frequency indels generated at the cleavage site, none of which appeared to encode for a functional AgdsxF transcript (
[0211] Heterozygous and homozygous individuals for the dsxF.sup. allele were separated based on the intensity of fluorescence afforded by the GFP transcription unit within the knockout allele. Homozygous mutants were distinguishable as recovered in the expected Mendelian ratio of 1:2:1 suggesting that the disruption of the female-specific isoform of Agdsx is not lethal at the L1 larval stage.
TABLE-US-00038 TABLE 4 Genetic females homozygous for the insertion carry male-specific characteristics Genetic Males Genetic Females Characteristic dsxF.sup.+/+ dsxF.sup.+/ dsxF.sup./ dsxF.sup.+/+ dsxF.sup.+/ dsxF.sup./ Pupal genital male male male female female male lobe Claspers X X Cercus X X X X Spermatheca X X X X MAGs X X Feed on blood X X X X Can lay eggs X X X X Plumose X X antennae Pilose X X X X antennae
[0212] The inventors assume that parental effects on fitness (egg production and hatching rates) for non-drive (W/W, W/R) females with nuclease from one or both parents are the same as observed values for drive heterozygote (W/D) females with parental effects. For combined maternal and paternal effects (nuclease from both parents), the minimum of the observed values for maternal and paternal effect is assumed.
TABLE-US-00039 TABLE 5 Summary of values obtained from the cage trials Cage Trial 1 Cage Trial 2 Transgenic Hatching Egg Repr. Transgenic Hatching Egg Repr. Rate Rate Output Load Rate Rate Output Load Generation (%) (%) (N) (%) (%) (%) (N) (%) G0 25 27462 25 26895 (150/600) (150/600) G1 49.65 88.62 17405 36.62 50 86.15 16578 38.36 (268/576) (576/650) (280/560) (560/650) G2 62.01 74.92 14957 45.54 61.79 80.92 15565 42.13 (302/487) (487/650) (325/526) (526/650) G3 68.94 76.77 11249 59.04 68.05 74.15 9376 65.14 (344/499) (499/650) (328/482) (482/650) G4 67.67 71.85 9170 66.61 85.41 71.69 6514 75.78 (316/467) (467/650) (398/466) (466/650) G5 58.67 69.23 11364 58.62 86.5 61.54 4805 81.13 (264/450) (450/650) (346/400) (400/650) G6 63.3 70 7727 71.86 90.09 52.77 4210 84.35 (288/455) (455/650) (309/343) (343/650) G7 69.47 78.62 7785 71.65 100 55.85 1668 93.8 (355/511) (511/650) (363/363) (363/650) G8 70.07 70.92 6293 77.08 100 42.77 0 100 (323/461) (461/650) (278/278) (278/650) G9 75.58 66.15 4107 85.04 (325/430) (430/650) G10 95.71 57.38 4146 84.90 (357/373) (373/650) G11 100 57.54 2645 90.37 (374/374) (374/650) G12 100 38.92 0 100 (253/253) (253/650)
[0213] Transgenic rate, hatching rate, egg output and reproductive load at each generation during the cage experiment. The reproductive load indicates the suppression of egg production at each generation compared to the first generation.
Conclusions
[0214] In the human malaria vector, Anopheles gambiae, the gene doublesex (Agdsx) encodes two alternatively spliced transcripts dsx-female (AgdsxF) and dsx-male (AgdsxM) that, in turn, regulate the activation of distinct subordinate genes responsible for the differentiation of the two sexes. The female transcript, unlike AgdsxM, contains an exon (exon 5) whose coding sequence is highly conserved in all Anopheles mosquitoes so far analysed. CRISPR-Cas9 targeted disruption of the intron 4-exon 5 sequence boundary aimed at blocking the formation of functional AgdsxF did not affect male development or fertility, whereas females homozygous for the disrupted allele showed an intersex phenotype characterised by the presence of male internal and external reproductive organs and complete sterility, as summarised in table 4. A CRISPR-Cas9 gene drive construct targeting this same sequence was able to spread rapidly in caged mosquito populations reaching 100% prevalence within a span of 8-12 generations while progressively reducing the egg production to the point of total population collapse. Notably, this drive solution did not induce resistance. A variety of non-functional Cas9 resistant variants were generated in each generation at the target site, they all failed to block the spread of the drive.
[0215] Hence, these data all together provide important functional insights on the role of dsx in A. gambiae sex determination while demonstrating substantial progress towards the development of effective gene drive vector control measures aimed at population suppression. Without wishing to be bound to any particular theory, the intersex phenotype of dsxF/ genetic females demonstrates that exon 5 is critical for the production of a functional female transcript. Furthermore, the observation that heterozygous dsxFCRISPRh/+ females are fertile and produce nearly 100% transformed progeny would indicate that the majority of the germ cells in these females are homozygous and, unlike somatic cells, do not undergo autonomous dsx-mediated sex commitment.sup.18. The development of a gene drive solutions capable of collapsing a human malaria vector population is a long sought scientific and technical achievement.sup.19. The gene drive dsxFCRISPRh targeting exon 5 of dsx showed a number of desired efficacy features for field applications, in term of inheritance bias, fertility of heterozygous individuals, phenotype of homozygous females and apparent lack of nuclease-resistant functional variants at the target site.
Example 2
[0216] A promising approach to mitigate resistance to gene drive is to target multiple sites at the same time in a strategy analogous to combinational drug therapy. For resistance to get selected against the gene drive, resistant mutations would have to be simultaneously present at all target sites, and co-operatively restore the targeted gene's original function. Note that homing will also serve to remove resistant mutations generated if at least one of the targeted sites is still cleavable.
[0217] Exon 5 of doublesex that was targeted with a gene drive as described in Example 1 contains a total of four invariant target sites that are amenable to multiplexing (
[0218] The inheritance bias of the gene drive, and fertility of gene drive carriers was assessed through phenotype assays. Gene drive heterozygotes of both sexes that had inherited the drive from either males or females were crossed to wild-type individuals and females of each cross were allowed to lay eggs individually. The same was done with a wild-type cage, as a control. Egg and larval output of each female was counted, as soon as they laid and hatched respectively. Larvae were then screened for RFP fluorescence indicative of gene drive presence. The mating status of females that did not give offspring was determined by dissecting their spermathecae and examining it under an EVOS cell imaging microscope for the presence of spermatozoa. Females that showed no evidence of mating were all included in the analysis as having given 0 progeny, since mating competence can be affected by carrying the doublesex gene drive. The results from Kyrou et al. (2018) were adapted to also include unmated individuals in the analysis.
[0219] The results revealed that the novel multiplexed gene drive can successfully bias its inheritance to the next generation with transmission rates comparable to the single-guide gene drive we previously developed (p>0.05) or higher (p=0.04), when the gene drive was transmitted by a male carrier who inherited it maternally (F->M class) (
REFERENCES
[0220] 1. Gantz, V. M. et al. Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi. Proc Natl Acad Sci USA 112, E6736-6743 (2015). [0221] 2. Hammond, A. et al. A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae. Nat Biotechnol 34, 78-83 (2016). [0222] 3. Burt, A. Site-specific selfish genes as tools for the control and genetic engineering of natural populations. Proc Biol Sci 270, 921-928 (2003). [0223] 4. Deredec, A., Godfray, H. C. & Burt, A. Requirements for effective malaria control with homing endonuclease genes. Proc Natl Acad Sci USA 108, E874-880 (2011). [0224] 5. Hamilton, W. D. Extraordinary sex ratios. A sex-ratio theory for sex linkage and inbreeding has new implications in cytogenetics and entomology. Science 156, 477-488 (1967). [0225] 6. Galizi, R. et al. A synthetic sex ratio distortion system for the control of the human malaria mosquito. Nat Commun 5, 3977 (2014). [0226] 7. Magnusson, K. et al. Demasculinization of the Anopheles gambiae X chromosome. BMC Evol Biol 12, 69 (2012). [0227] 8. Champer, J. et al. Novel CRISPR/Cas9 gene drive constructs reveal insights into mechanisms of resistance allele formation and drive efficiency in genetically diverse populations. PLoS Genet 13, e1006796 (2017). [0228] 9. Hammond, A. M. et al. The creation and selection of mutations resistant to a gene drive over multiple generations in the malaria mosquito. PLoS Genet 13, e1007039 (2017). [0229] 10. Marshall, J. M., Buchman, A., Sanchez, C. H. & Akbari, O. S. Overcoming evolved resistance to population-suppressing homing-based gene drives. Sci Rep 7, 3776 (2017). [0230] 11. Unckless, R. L., Clark, A. G. & Messer, P. W. Evolution of Resistance Against CRTSPR/Cas9 Gene Drive. Genetics 205, 827-841 (2017). [0231] 12. Burtis, K. C. & Baker, B. S. Drosophila doublesex gene controls somatic sexual differentiation by producing alternatively spliced mRNAs encoding related sex-specific polypeptides. Cell 56, 997-1010 (1989). [0232] 13. Graham, P., Penn, J. K. & Schedl, P. Masters change, slaves remain. Bioessays 25, 1-4 (2003). [0233] 14. Krzywinska, E., Dennison, N. J., Lycett, G. J. & Krzywinski, J. A maleness gene in the malaria mosquito Anopheles gambiae. Science 353, 67-69 (2016). [0234] 15. Scali, C., Catteruccia, F., Li, Q. & Crisanti, A. Identification of sex-specific transcripts of the Anopheles gambiae doublesex gene. J Exp Biol 208, 3701-3709 (2005). [0235] 16. Neafsey, D. E. et al. Mosquito genomics. Highly evolvable malaria vectors: the genomes of 16 Anopheles mosquitoes. Science 347, 1258522 (2015). [0236] 17. Anopheles gambiae Genomes, C. et al. Genetic diversity of the African malaria vector Anopheles gambiae. Nature 552, 96-100 (2017). [0237] 18. Murray, S. M., Yang, S. Y. & Van Doren, M. Germ cell sex determination: a collaboration between soma and germline. Curr Opin Cell Biol 22, 722-729 (2010). [0238] 19. Curtis, C. F. Possible use of translocations to fix desirable genes in insect pest populations. Nature 218, 368-369 (1968). [0239] 20. National Academies of Sciences, E. & Medicine Gene Drives on the Horizon: Advancing Science, Navigating Uncertainty, and Aligning Research with Public Values. (The National Academies Press, Washington, DC; 2016). [0240] 21. Papathanos, P. A., Windbichler, N., Menichelli, M., Burt, A. and Crisanti, A. The vasa regulatory region mediates germline expression and maternal transmission of proteins in the malaria mosquito Anopheles gambiae: a versatile tool for genetic control strategies. BMC Mol Biol 10, 65, (2009). [0241] 22 Hammond, A. M. et al. The creation and selection of mutations resistant to a gene drive over multiple generations in the malaria mosquito. PLoS Genet 13, e1007039 (2017). [0242] 23. Wolfram Research, Inc., 2017 Mathematica 11.2, Champaign, IL.