NOVEL PHOSPHOENOLPYRUVATE CARBOXYLASE VARIANT AND METHOD FOR PRODUCING 5'-INOSINIC ACID USING SAME
20250257379 ยท 2025-08-14
Assignee
Inventors
- Sun Hee Lee (Seoul, KR)
- Tae Yeol CHOI (Seoul, KR)
- Hyun Ho Kim (Seoul, KR)
- Dong Hyun Kim (Seoul, KR)
- Hyun Sook KIM (Seoul, KR)
- Jong Hwan SHIN (Seoul, KR)
Cpc classification
C12P19/32
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a novel phosphoenolpyruvate carboxylase variant and a method of producing 5-inosinic acid using the same. The phosphoenolpyruvate carboxylase variant is obtained by substituting one or more amino acids in the amino acid sequence constituting phosphoenolpyruvate carboxylase to change the activity of the protein, and a recombinant microorganism comprising the phosphoenolpyruvate carboxylase variant is capable of efficiently producing 5-inosinic acid.
Claims
1. A phosphoenolpyruvate carboxylase variant in which one or more of the amino acids at positions 472 and 673 in the amino acid sequence of SEQ ID NO: 4 is/are substituted with other amino acid(s).
2. The phosphoenolpyruvate carboxylase variant of claim 1, which consists of the amino acid sequence of SEQ ID NO: 2 in which proline at position 472 in the amino acid sequence of SEQ ID NO: 4 is substituted with serine and glycine at position 673 is substituted with aspartic acid.
3. A polynucleotide encoding the variant of claim 1.
4. A transformant comprising the variant of claim 1.
5. The transformant of claim 4, which is a Corynebacterium sp. microorganism.
6. The transformant of claim 4, which has ability to produce 5-inosinic acid.
7. A method for producing 5-inosinic acid, comprising steps of: culturing the transformant of claim 4 in a medium; and recovering 5-inosinic acid from the transformant or the medium in which the transformant has been cultured.
8. A transformant comprising the polynucleotide of claim 3.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0058]
MODE FOR INVENTION
[0059] Hereinafter, the present invention will be described in more detail. However, this description is merely presented by way of example to facilitate the understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.
Example 1. Construction of Strain Expressing Phosphoenolpyruvate Carboxylase Variant
[0060] To evaluate the effect of a variant (SEQ ID NO: 2) having a substitution of serine(S) for proline (P) at position 472 and a substitution of aspartic acid (D) for glycine (G) at position 673 in the amino acid sequence of phosphoenolpyruvate carboxylase (SEQ 4) on the production of 5-inosinic acid, the present inventors constructed a vector for expressing the phosphoenolpyruvate carboxylase variant and a strain into which the vector has been introduced.
1-1. Construction of Vector for Expression of Phosphoenolpyruvate Carboxylase Variant
[0061] Using the genomic DNA of wild-type Corynebacterium stationis ATCC6872 as a template, PCR was performed using a primer pair of primers 1 and 2. The PCR fragment and a pK19msb plasmid (SEQ ID NO: 5) were treated with the restriction enzyme smaI (NEB) and ligated together using T4 ligase. The resulting plasmid was named pK_PC.
[0062] The PCR amplification was performed using Pfu PreMix (Bioneer) under the following conditions: denaturation at 95 C. for 5 min, and then 30 cycles, each consisting of 95 C. for 30 sec, 58 C. for 30 sec, and 72 C. for 1 min and 30 sec, followed by reaction at 72 C. for 5 min.
[0063] The primer sequences used for plasmid construction are shown in Table 1 below,
TABLE-US-00001 TABLE1 Primername SEQIDNO. Primersequence(5-3) Primer1 6 CTCTGCTCGCTCACTGGTCT Primer2 7 TACTCGCTGTGTCGTAGCGGG
1-2. Construction of Mutant Strain into Which Phosphoenolpyruvate Carboxylase Variant Has Been Introduced
[0064] An electrocompetent cell preparation method, a modification of the method of van der Rest et al., was used as a method for transformation of Corynebacterium stationis KCCM13339P.
[0065] First, Corynebacterium stationis KCCM13339P was primarily cultured in 10 mL of 2YT medium (containing 16 g/l of tryptone, 10 g/l of yeast extract, and 5 g/l of sodium chloride) supplemented with 2% glucose, thus preparing a seed culture. Isonicotinic acid hydrazine at a concentration of 1 mg/ml and 2.5% glycine were added to 100 ml of 2YT medium free of glucose. Next, the seed culture was inoculated into the 2YT medium to reach an OD.sub.610 value of 0.3, and then cultured at 30 C. and 180 rpm for 5 to 8 hours so that the OD.sub.610 value reached 0.6 to 0.7. The culture was kept on ice for 30 minutes, and then centrifuged at 3,500 rpm at 4 C. for 10 minutes. Thereafter, the supernatant was discarded and the precipitated Corynebacterium stationis KCCM13339P was washed 4 times with a 10% glycerol solution and finally re-suspended in 0.5 ml of a 10% glycerol solution, thereby preparing competent cells. Electroporation was performed using a Bio-Rad electroporator. The prepared competent cells and the constructed pK_PC vector were placed in an electroporation cuvette (0.2 mm), and then subjected to electroporation under conditions of 2.5 kV, 200 and 12.5 F. Immediately after completion of the electroporation, 1 ml of regeneration (RG) medium (containing 18.5 g/l brain heart infusion and 0.5 M sorbitol) was added to the cells which were then heat-treated at 46 C. for 6 minutes. Next, the cells were cooled at room temperature, transferred into a 15-ml cap tube, incubated at 30 C. for 2 hours, and plated on a selection medium (containing 5 g/l tryptone, 5 g/l NaCl, 2.5 g/l yeast extract, 18.5 g/l brain heart infusion powder, 15 g/l agar, 91 g/l sorbitol, and 20 g/1 kanamycin). The cells were cultured at 30 C. for 72 hours, and the generated colonies were cultured in medium until the stationary phase to induce secondary recombination. Then, the cells were diluted to 10-5 to 10-7, and plated on an antibiotic-free plate medium (containing 10% sucrose), and a strain having no kanamycin resistance and grown on the medium containing 10% sucrose was selected and named IPC-1.
Experimental Example 1. Evaluation of 5-Inosinic Acid Productivity of Strain Expressing Phosphoenolpyruvate Carboxylase Variant
[0066] 5-Inosinic acid productivity was compared between the parent strain KCCM13339P and the mutant strain IPC-1 into which the phosphoenolpyruvate carboxylase variant has been introduced.
[0067] Each strain (parent strain or mutant strain) was inoculated at 1% by volume into a 100-mL flask containing 10 mL of the medium for 5-inosinic acid production shown in Table 2 below, and cultured with shaking at 200 rpm at 34 C. for 45 hours. After completion of the culturing, the concentration of 5-inosinic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.
TABLE-US-00002 TABLE 2 Component Content Glucose 70 g/L (NH.sub.4).sub.2SO.sub.4 2 g/L MgSO.sub.4 1 g/L Urea 2 g/L Yeast extract 20 g/L KH.sub.2PO.sub.4 2 g/L FeSO.sub.4 10 mg/L MnSO.sub.4 10 mg/L Thiamine_HCl 5 mg/L biotin 20 ug/L Cystein 20 mg/L Bata-alanine 20 mg/L Adenine 30 mg/L
TABLE-US-00003 TABLE 3 Strain 5-inosinic acid production (g/L) KCCM13339P 20.0 IPC-1 23.2
[0068] As shown in Table 3 above, it was confirmed that the amount of 5-inosinic acid produced by the mutant strain into which the phosphoenolpyruvate carboxylase variant has been introduced was increased by about 16% compared to that produced by the parent strain, due to substitution of the amino acids at positions 472 and 673 with other amino acids. These results suggest that introduction of point mutations into phosphoenolpyruvate carboxylase provides a significant effect on 5-inosinic acid productivity.
[0069] So far, the present invention has been described with reference to the preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will appreciate that the present invention may be embodied modified in forms without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view, not from a restrictive point of view. The scope of the present invention is defined by the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention
[Accession Number]
[0070] Depository Authority: Korean Culture Center of Microorganisms (KCCM) [0071] Accession Number: KCCM13339P [0072] Deposit Date: Mar. 29, 2023