Method for constructing gE protein-deleted pseudorabies virus strain using adenine base editor and use thereof
12385015 ยท 2025-08-12
Assignee
Inventors
- Yu Ye (Nanchang, CN)
- Peixia Wang (Nanchang, CN)
- Yuxin Tang (Nanchang, CN)
- Chuan Zeng (Nanchang, CN)
- Jun Gu (Nanchang, CN)
- Jinyan Shen (Nanchang, CN)
- Yiwen Duan (Nanchang, CN)
- Yuwei Bai (Nanchang, CN)
- Dongyan Huang (Nanchang, CN)
- Deping Song (Nanchang, CN)
Cpc classification
C12N15/1031
CHEMISTRY; METALLURGY
C12N2710/16721
CHEMISTRY; METALLURGY
International classification
Abstract
Provided is a method for constructing a gE protein-deleted pseudorabies virus (PRV) strain using an adenine base editor (ABE) and use thereof. The method includes: designing an sgRNA sequence using the ABE with a start codon of the gE gene in a PRV as a target site, ligating an enzyme-digested fragment to a double-stranded DNA fragment with sticky ends to obtain a ligation product; and transforming the ligation product into a competent cell to allow plate screening and culture, selecting a resulting positive bacterial strain to allow expanded culture, and extracting a plasmid from a resulting positive bacterial solution; and transferring the plasmid into a target cell to allow the transfection for 24 h, collecting a resulting virus liquid, and centrifuging the virus liquid to collect a resulting supernatant.
Claims
1. A gE protein-deleted pseudorabies virus (PRV) strain, the gE protein-deleted PRV strain being deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: V202323; and the gE protein-deleted PRV strain being constructed using an adenine base editor (ABE); (ABE) and wherein the gE protein-deleted PRV strain is constructed using a process comprising: (1), constructing an sgRNA backbone plasmid, comprising: designing an sgRNA sequence having the sequence set forth in SEQ ID NO: 2, using the ABE with a start codon of the gE gene in a PRV as a target site, synthesizing two single-stranded oligonucleotides according to the sgRNA sequence, annealing the single-stranded oligonucleotides to obtain a double-stranded DNA fragment with sticky ends, digesting a vector with a restriction endonuclease and recovering a resulting enzyme-digested fragment, and then ligating the enzyme-digested fragment to the double-stranded DNA fragment with sticky ends to obtain a ligation product, namely an sgRNA expression vector; wherein the single-stranded oligonucleotide has the sequences set forth in SEQ ID NO: 3 or SEQ ID NO: 4: NG-ABE8e-gE-F: CACCGGCCGCATGGTCTCAACCCC (SEQ ID NO: 3); NG-ABE8e-gE-R: AAACGGGGTTGAGACCATGCGGCC (SEQ ID NO: 4); the vector has the sequence set forth in SEQ ID NO: 11; the restriction endonuclease is a BbsI enzyme; and transforming the ligation product into a competent cell to allow plate screening and culture, selecting a resulting positive bacterial strain to allow expanded culture, and extracting a resulting plasmid from a resulting positive bacterial solution; and (2), transfection of the plasmid, comprising: introducing the plasmid into a Vero81 cell, culturing the Vero81 cell to logarithmic growth phase at 37 C. and 5% (v/v) CO.sub.2, collecting a resulting virus liquid, and centrifuging the virus liquid to collect a resulting supernatant; wherein the adenine base editor is NG-ABE8e; and wherein a base at position 2 of a start codon in the gE gene of wild-type PRV is mutated from T to C to obtain a resulting mutated gE gene; wherein the resulting mutated gE gene is set forth in SEQ ID NO: 1.
2. A method for constructing the gE protein-deleted PRV strain according to claim 1 using an ABE, comprising the following steps: (1), constructing an sgRNA backbone plasmid, comprising: designing an sgRNA sequence having the sequence set forth in SEO ID NO: 2, using the ABE with a start codon of the gE gene in a PRV as a target site, synthesizing two single-stranded oligonucleotides according to the sgRNA sequence, annealing the single-stranded oligonucleotide to obtain a double-stranded DNA fragment with sticky ends, digesting a vector with a restriction endonuclease and recovering a resulting enzyme-digested fragment, and then ligating the enzyme-digested fragment to the double-stranded DNA fragment with sticky ends to obtain a ligation product, namely an sgRNA expression vector; wherein the single-stranded oligonucleotide has the sequences set forth in SEQ ID NO: 3 or SEO ID NO: 4: NG-ABE8e-gE-F: CACCGGCCGCATGGTCTCAACCCC (SEO ID NO: 3); NG-ABE8e-gE-R: AAACGGGGTTGAGACCATGCGGCC (SEO ID NO: 4); the vector has the sequence set forth in SEO ID NO: 11; the restriction endonuclease is a BbsI enzyme; and transforming the ligation product into a competent cell to allow plate screening and culture, selecting a resulting positive bacterial strain to allow expanded culture, and extracting a resulting plasmid from a resulting positive bacterial solution; and (2), transfection of the plasmid, comprising: introducing the plasmid into a Vero81 cell, culturing the Vero81 cell to logarithmic growth phase at 37 C. and 5% (v/v) CO.sub.2, collecting a resulting virus liquid, and centrifuging the virus liquid to collect a resulting supernatant.
3. The method according to claim 2, wherein the restriction endonuclease is a BbsI enzyme.
4. The method according to claim 2, wherein the Vero81 cell is cultured in a fetal bovine serum (FBS)-containing medium to a logarithmic growth phase before the transfection is conducted.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(6) The technical solutions of the present disclosure will be further described in detail below in conjunction with specific examples.
(7) All experimental materials used in the following examples are purchased from conventional biochemical reagent companies, unless otherwise specified. NG-ABE8e vector: Addgene, product number: 138491; in the NG-ABE8e vector, a CMV promoter drives the expression of related proteins; an ABE NG-ABE8e expresses adenine deaminase for point mutations; and an sgRNA backbone plasmid includes a binding region that binds the target sequence and a binding region that binds the Cas9 protein.
(8) I. Construction of an sgRNA backbone plasmid In this example, a start codon of the gE gene was selected as a target site; An sgRNA with a recognition sequence was designed as follows:
(9) TABLE-US-00002 NG-ABE8e-gE: (SEQIDNO:2) GGCCGCATGGTCTCAACCCC;
(10) A single-stranded oligonucleotide was synthesized according to the designed sequence. A sequence of the single-stranded oligonucleotide was as follows:
(11) TABLE-US-00003 NG-ABE8e-gE-F: (SEQIDNO:3) CACCGGCCGCATGGTCTCAACCCC; NG-ABE8e-gE-R: (SEQIDNO:4) AAACGGGGTTGAGACCATGCGGCC; the NG-ABE8e-gE-F and NG-ABE8e-gE-R were annealed to obtain a double-stranded DNA fragment with sticky ends; a pU6-sgRNA-Puro-2A-EGFP vector was digested with a BbsI enzyme, and a resulting fragment was recovered and then ligated to the double-stranded DNA fragment with sticky ends to obtain an sgRNA expression vector; and an ABE NG-ABE8e included Cas9 (N), which in this example could specifically be a plasmid expressing the nCas9 protein.
(12) The pU6-sgRNA-Puro-2A-EGFP vector consists of pU6, sgRNA, Puro, 2A, and EGFP and has the sequence set forth in SEQ ID NO: 11. The pU6-sgRNA-Puro-2A-EGFP vector is commercially available. In the name of pU6-sgRNA-Puro-2A-EGFP vector, p represents plasmid, U6 represents U6 promoter (SEQ ID NO: 12), sgRNA represents sgRNA scaffold (SEQ ID NO: 13), EGFP represents enhanced green fluorescent protein (SEQ ID NO: 14), 2A represents linker 2A peptide (SEQ ID NO: 15), and Puro represents puromycin (SEQ ID NO: 16).
(13) (1) Construction of a Double-Stranded sgRNA
(14) The following table showed a phosphorylation annealing system;
(15) TABLE-US-00004 TABLE 1 Phosphorylation annealing system Reagent System (L) Forward single strand (100 M) 1 Reverse single strand (100 M) 1 10 T4 DNA ligation buffer (NEB) 1 T4 PNK (NEB) 1 Double distilled water Supplementing to 10 L
(16) A gradient annealing program was shown in Table 2:
(17) TABLE-US-00005 TABLE 2 Gradient annealing program Temperature Time Gradient 37 C. 30 min 95 C. 5 min 95-85 C. 1 min 5 C. 85-75 C. 1 min 5 C. 75-65 C. 1 min 5 C. 65-55 C. 1 min 5 C. 55-45 C. 1 min 5 C. 45-35 C. 1 min 5 C. 35-25 C. 1 min 5 C. 4 C. Hold
(2) Construction and Expression of a Linearized Backbone Vector Plasmid
(18) The table below (Table 3) showed an enzyme digestion system of PX459 vector.
(19) TABLE-US-00006 TABLE 3 Enzyme digestion system of PX459 vector Reagent Volume (L) 10 NEB 5 Restriction endonuclease BbsI 1 PX459 vector (2 g) 3.5 Double distilled water 40.5 Total 50 Reaction procedure: the enzyme digestion system was placed in a 37 C. water bath for 2 h to obtain an enzyme digestion product.
(20) The enzyme digestion product was detected by agarose gel electrophoresis, and a target band was recovered from a gel the after electrophoresis.
(21) (3) Construction of a Backbone Plasmid Expressing sgRNA
(22) The following table (Table 4) showed a ligation reaction system.
(23) TABLE-US-00007 TABLE 4 Ligation reaction system Reagent Volume (L) 10 T4 DNA ligation buffer 1 T4 DNA ligase (NEB) 1 Linearized PX459 vector (50 ng) 2 200-fold-diluted gE-sgRNA annealing product 1 Double distilled water 5 Total 10
(24) The ligation product was transformed into Top 10 competent cells by conventional methods. An appropriate amount of resulting bacterial solution was applied onto an LB plate containing ampicillin. After liquid on the surface of the plate evaporated, the plate was put upside down in a 37 C. incubator to allow overnigEt culture for 16 h to 18 h, and the transformation was observed. 5 single-clonal colonies were selected, cultured with shaking and sequenced. The positive colonies with correct sequencing were further selected to allow expanded culture, and endotoxic-free plasmids for cell transfection were extracted and then stored at 20 C.
(25) II. Plasmid Transfection
(26) (1) One day before transfection, the well-growing Vero81 cells were digested with trypsin, 110.sup.6 digested cells were transferred to a six-well plate, and added with 2 mL of DMEM medium containing 10% (v/v) FBS (purchased from Gibco), and cultured to logarithmic growth phase at 37 C. and 5% (v/v) CO.sub.2.
(27) (2) Cell transfection was conducted according to the official instructions of Lipofectamine3000, where a total amount of transfected DNA was 3 g, including 1 g each of viral genomic DNA, NG-ABE8e plasmid, and sgRNA expression vector plasmid.
(28) (3) 24 h after transfection, the presence or absence of PRV characteristic lesions was observed under a microscope. After lesions were observed, the six-well plate was frozen and thawed three times at 80 C. to room temperature, the collected virus liquid was centrifuged at 8,000 rpm for 5 min, and a portion of the collected supernatant was used to extract genes for sequencing. The detection primers were synthesized according to Table 5, and the target genes were amplified using the corresponding primers. The procedures were shown in Table 6. During amplification, a temperature with the lowest Tm value in the primer pair was used as an annealing temperature of the PCR reaction, and the extension time was set to 7 s according to the characteristics of the polymerase used. The results of PCR products were analyzed by agarose gel electrophoresis, and the successfully identified target fragments were cut out and sent to ShangEai Sangon Biotech Co., Ltd. for sequencing.
(29) TABLE-US-00008 TABLE5 SyntheticsequencesofPCRdetectionprimers Target fragment Name Sequence(5-3) size gE-T-F TGATCTTCCTGGGCGGGAT 584bp (SEQIDNO:5) gE-T-R TCGGACACGTTCACCAGAT (SEQIDNO:6)
(30) TABLE-US-00009 TABLE 6 PCR program Temperature ( C.) Time Initial denaturation 98 30 s Denaturation 98 10 s 35 cycles Annealing 57 5 s 35 cycles Extension 72 7 s 35 cycles Total extension 72 1 min Short-term storage 4 30 min
(31) Results: PCR detection was conducted using gE-T-F and gE-T-R as upstream and downstream primers, and a target band of the expected size was obtained. The results of gel electrophoresis of PCR products are shown in
(32) (4) After successful sequencing, the sequencing results were compared with the wild-type PRV gene to obtain detailed mutation information.
(33) The sequencing results are shown in
(34) The obtained gE protein-deleted PRV strain was deposited in the CCTCC on Jun. 30, 2023, with a deposit number of CCTCC NO: V202323; and the gE protein-deleted PRV strain was named: porcine pseudorabies virus PRV-AgE-ABE.
(35) III. Plaque Purification of Mutant Strain
(36) (1) The virus supernatant was serially diluted 10 to 10.sup.6 times in a ten-fold ratio. The different dilutions of virus liquids were inoculated separately into a 12-well plate filled with Vero81 monolayer cells, with 200 L in each well, the cells were incubated for 2 h with the cell plate shaken every half hour. The virus liquid was discarded, and cell surface was washed 3 times with a serum-free DMEM medium for later use.
(37) (2) The autoclaved 2% (w/v) low melting point agarose was dissolved by microwave heating, cooled to about 37 C., mixed thorougEly with an equal volume of 2DMEM medium containing 4% FBS, quickly added into the 12-well plate, with 1 mL to each well, and placed at room temperature for about 0.5 h. After the medium solidified naturally, the plate was put upside down in a carbon dioxide cell incubator for culture.
(38) (3) After 48 h of incubation, cell lesions and plaque formation were observed. Multiple single plaques were randomly selected with a 10 L pipette tip in the low dilution wells, blown into 200 L of DMEM medium, mixed well and inoculated with Vero81 cells in a 24-well plate to allow expanded culture.
(39) (4) After a large number of lesions appeared on the cells, the virus liquid was collected, the viral DNA was extracted, the target fragment was amplified using primers, followed by proceeding to the next round of purification based on the corresponding sequencing results.
(40) (5) After purification, the virus was passed througE 10 consecutive passages, sequencing was conducted to verify the stability of the mutant gene, and the virus liquid was collected.
(41) Results: the PRV-AgE-ABE gene sequencing results after 10 passages were shown in
(42) IV. Analysis of Expression of Viral Proteins Caused by Gene Silencing
(43) (1) Whether the expression of target gene was silenced detected by Western blot
(44) The purified virus was internalized into Vero81 cells, and the viral protein was collected 24 h after inoculation, and Western blot was conducted to detect the expression of the gE gene.
(45) (2) The experimental results are shown in
(46) (3) The above results showed that using the NG-ABE base editor to mutate the start codon of the gene could inhibit the expression of gE in the virus, thereby achieving better gene silencing effects.
(47) The above embodiments are merely illustrative of some implementations of the present disclosure, and the description thereof is specific and detailed, but should not be construed as limiting the patent scope of the present disclosure. Corresponding changes and variations may be made by those skilled in the art according to the technical solutions and concepts described above, and all these changes and variations should fall within the protection scope of the claims of the present disclosure.