<i>Aspergillus oryzae </i>JAAS-32 and use thereof in preparation of larval <i>Hermetia illucens </i>paste protein peptide

Abstract

The present invention discloses an Aspergillus oryzae JAAS-32 and use thereof in preparation of a larval Hermetia illucens paste protein peptide. The Aspergillus oryzae JAAS-32 was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on Aug. 10, 2023 with an accession number of GDMCC No: 63725, classified and named Aspergillus oryzae. A larval Hermetia illucens paste is subjected to enzymatic fermentation by the Aspergillus oryzae JAAS-32 provided by the present invention for 20-40 hours. The content of the protein peptide (<10 kDa) is 1.53 times that of an untreated group; the content of free amino acids is 1.41 times that of the untreated group; the total antioxidant activity is 1.35 times that of the untreated group. Diameters of inhibition zones against Staphylococcus aureus, Escherichia coli, and Vibrio alginolyticus are 1.62, 1.17, and 1.45 times those of the untreated group, respectively. The strain is cultured readily, fast in growth, and well-adapted. A low-cost, easy-to-operate, and efficient method for enhancing antibacterial performance of the larval Hermetia illucens paste can be established on the basis of the strain.

Claims

1. A method for preparing a larval Hermetia illucens paste protein peptide using an Aspergillus oryzae JAAS-32, which was deposited in Guangdong Microbial Culture Collection Center on Aug. 10, 2023 with an accession number of GDMCC No: 63725, the method comprising the following steps: (1) preparing a larval Hermetia illucens paste, and fermenting Aspergillus oryzae JAAS-32 to obtain a fermented Aspergillus oryzae sample; and (2) mixing the larval Hermetia illucens paste with the fermented Aspergillus oryzae sample, and fermenting the mixture to obtain a fermentation liquor of the larval Hermetia illucens paste.

2. The method according to claim 1, wherein in the step (1), Hermetia illucens larvae and water are mixed in a mass ratio of 5:4-15:4 and homogenized to prepare the larval Hermetia illucens paste.

3. The method according to claim 1, wherein in the step (1), an Aspergillus oryzae JAAS-32 single colony is picked and inoculated into a potato dextrose agar (PDA) liquid medium and cultured at a temperature of 30-40 C. and a stirring speed of 100-200 rpm for 48-96 hours, to obtain an Aspergillus oryzae seed solution; the Aspergillus oryzae seed solution is inoculated into a fermentation tank containing a PDA liquid medium in an inoculum size to volume ratio of 5%-20% and cultured at a temperature of 30-40 C., a stirring speed of 100-400 rpm, and an air aeration volume of 0.2-2 vvm for 48-96 hours, to obtain the fermented Aspergillus oryzae sample.

4. The preparation method according to claim 1, wherein in the step (2), 3-10 mL of the fermented Aspergillus oryzae sample is added per 100 g of the larval Hermetia illucens paste; and/or the fermentation is performed at a temperature of 25-35 C. for 20-40 hours.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a phylogenetic tree constructed on the basis of an ITS sequence;

(2) FIG. 2 shows a protein hydrolysis circle of an Aspergillus oryzae JAAS-32; and

(3) FIG. 3 shows diameter determination of inhibition zones of an antibacterial Hermetia illucens peptides to pathogenic bacteria: a, antibacterial Hermetia illucens peptide in an untreated group; b, antibacterial Hermetia illucens peptide in an Aspergillus oryzae fermentation group; c, sterile water in negative control; and d, chloramphenicol aqueous solution in positive control.

DESCRIPTION OF THE EMBODIMENTS

(4) To specify the present invention more clearly, the present invention will be further described specifically in combination with the examples and with reference to the accompanying drawings. It should be understood by those skilled in the art that the content described specifically below is illustrative, but not restrictive and thus, should be not construed as limiting the protection scope of the present invention.

(5) The strain Aspergillus oryzae JAAS-32 provided by the present invention was deposited in Guangdong Microbial Culture Collection Center (GDMCC for short, address: 5th Floor, No. 59 Building, No. 100 Courtyard, Xianlie Mid. Rd., Institute of Microbiology, Guangdong Academy of Sciences, postcode: 510070) on Aug. 10, 2023 with the accession number of GDMCC No. 63725, classified and named Aspergillus oryzae. Aspergillus oryzae JAAS-32 GDMCC No. 63725 is abbreviated Aspergillus oryzae JAAS-32.

(6) In the following examples, the PDA liquid medium contains the following components of 6.0 g/L powdered potato extract, 20.0 g/L glucose, and 0.1 g/L chloramphenicol, with a pH value of 5.4-5.8.

(7) The PDA solid plate is namely obtained by adding 15 g/L agar to a PDA liquid medium.

(8) Article number (Art. No.) of Staphylococcus aureus: CICC 10306; Art. No. of Escherichia coli: CICC 10372; Art. No. of Vibrio alginolyticus: CICC 10484.

Example 1 Screening, Identification, and Enzyme Activity Assay of Aspergillus oryzae

(9) 1. Isolation and Purification of Culture

(10) (1) 200.0 g fresh Hermetia illucens larvae fed with kitchen wastes were weighed and homogenized. 200.0 g of the homogenized Hermetia illucens larvae were weighed, added with 80.0 mL deionized water, and oscillated for 1 hour at 30.0 C. and 200 rpm, then taken out and subjected to standing for 30 minutes.

(11) (2) Supernatant was taken and diluted with sterile water in gradients to 105 CFU/mL, and then the diluted bacterial suspension was coated on a PDA solid plate. The PDA solid plate was invertedly cultured for 24 hours at a constant temperature of 30 C.; single colonies were picked from the plate and repeatedly coated on the PDA solid plate, to obtain a pure culture.

(12) 2. Identification of the Strain

(13) The screened fungi were subjected to ITS sequencing. A column-type DNA method (a column-type DNA extraction kit was purchased from Sangon Biotech (Shanghai) Co., Ltd.) was used to extract genomic DNA of fungi; the extracted DNA was PCR amplified using ITS amplification primers ITS1 and ITS4.

(14) The ITS1 sequence is: 5-TCCGTAGGTGAACCTGCGG-3 (SEQ ID No.1), and the ITS4 sequence is: 5-TCCTCCGCTTATTGATATGC-3 (SEQ ID No.2). The PCR amplification system is shown in Table 1; and PCR procedure is shown in Table 2.

(15) TABLE-US-00001 TABLE 1 PCR amplification system Reagent Dose (L) Primer ITS1 1.5 Primer ITS4 1.5 ddH.sub.2O 20.5 Mastermix 15 DNA template 1.5

(16) TABLE-US-00002 TABLE 2 PCR amplification procedure Step Condition Predenaturation 95 C., 5 min Denaturation 95 C., 30 s Annealing 57 C., 30 s Extension 72 C., 1 min 30 s Final extension 72 C., 7 min Preservation 4 C.

(17) Note: there are three procedures of cyclic denaturation-annealing-extension, 30 cycles in total.

(18) The PCR amplified product was sent to General Biol (Anhui) Co., Ltd for sequencing, and the gene sequence of the sequenced ITS fragment is shown in SEQ ID No. 3 and subjected to homology alignment with NCBI database; MGEA 11 was used to construct a phylogenetic tree; see details in FIG. 1. As can be seen from FIG. 1, the strain was identified as Aspergillus oryzae.

(19) The gene sequence of the ITS fragment is shown in the following SEQ ID No. 3:

(20) TABLE-US-00003 GATTTCTCGTAAGGTGCCGAGCGGGTCATCATAGAAACACCGCCCGATC CCTAGTCGGCATAGTTTATGGTTAAGACTACGACGGTATCTGATCGTCT TCGATCCCCTAACTTTCGTTCCCTGATTAATGAAAACATCCTTGGCGAA TGCTTTCGCAGTAGTTAGTCTTCAGCAAATCCAAGAATTTCACCTCTGA CAGCTGAATACTGACGCCCCCGACTATCCCTATTAATCATTACGGCGGT CCTAGAAACCAACAAAATAGAACCGCACGTCCTATTCTATTATTCCATG CTAATGTATTCGAGCAAAGGCCTGCTTTGAACACTCTAATTTTTTCACA GTAAAAGTCCTGGTTCCCCCCACAGCCAGTGAAGGCCATGAGGTTCCCC AGAAGGAAAGGTCCAGCCGGACCAGTACTCGCGGTGAGGCGGACCGGCC AGCCAGACCCAAGGTTCAACTACGAGCTTTTTAACTGCAACAACTTTAA TATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGC CCTCCAATTGTTCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTA CGAGACCCAAAAGAGCCCCGTATCAGTATTTATTGTCACTACCTCCCCG TGTCGGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGGT AGCCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCCCCGTT ACCCGTTGCCACCATGGTAGGCCACTATCCTACCATCGAAAGTTGATAG GGCAGAAATTTGAATGAACCATCGCCGGCGCAAGGCCATGCGATTCGTT AAGTTATTATGAATCACCAAGGAGCCCCGAAGGGCATTGGTTTTTTATC TAATAAATACACCCCTTCCGAAGTCGAGGTTTTTAGCATGTATTAGCTC TAGAATTACCACAGGTATCCATGTAGTAAGGTACTATCAAATAAACGAT AACTGATTTAATGAGCCATTCGC
3. Determination of Aspergillus oryzae Protein Hydrolysis Circle
(1) Preparation of an Aspergillus oryzae JAAS-32 Solution

(21) A frozen Aspergillus oryzae JAAS-32 strain was taken out of a 80 C. refrigerator. The strain was coated on a PDA solid plate and cultured for 24 hours at 30 C. 1-2 circles of the Aspergillus oryzae single colonies were taken out of the PDA solid plate and inoculated into 100 mL of a PDA liquid medium, and then cultured in a thermostatic incubator (30 C., 200 rpm) for 24 hours, to obtain the Aspergillus oryzae JAAS-32 solution.

(22) (2) Aspergillus oryzae Protein Hydrolysis Circle

(23) A proper amount of the Aspergillus oryzae JAAS-32 solution was absorbed, and slightly dotted on a protease screening plate (the protease screening plate contains the components of 20 g/L skimmed milk, and 20 g/L agar), invertedly cultured for 24 hours at 30 C. to observe and determine the diameter of the Aspergillus oryzae protein hydrolysis circle. As shown in FIG. 2, the result shows that the diameter of the Aspergillus oryzae protein hydrolysis circle is 250.2 mm.

(24) 4. Enzymatic Activity Assay of Total Aspergillus oryzae Proteases

(25) The Aspergillus oryzae JAAS-32 solution was subjected to enzymatic activity assay of proteases with a kit for enzymatic activity assay of total proteases from Nanjing Jiancheng Bioengineering Institute, and the enzymatic activity was 1.104 azocasein/h/mg.

Example 2 Aspergillus oryzae Enzymolysis Process of the Larval Hermetia Illucens Paste

(26) 1. Preparation of the Larval Hermetia Illucens Paste

(27) 200.0 g of fresh Hermetia illucens larvae which were fed with kitchen wastes and aged in five days were weighed, added with 80.0 mL of sterile water and homogenized in a homogenizer, to obtain the larval Hermetia illucens paste.

(28) 2. Fermentation of Aspergillus oryzae JAAS-32 to obtain a fermented Aspergillus oryzae sample

(29) Aspergillus oryzae JAAS-32 was streak inoculated onto a PDA solid plate and cultured for 24 hours at 30 C. to obtain activated Aspergillus oryzae JAAS-32 single colonies. The Aspergillus oryzae JAAS-32 single colonies were picked and inoculated into a PDA liquid medium for culture at a temperature of 30 C. and a stirring speed of 150 rpm for 60 hours, to obtain an Aspergillus oryzae seed solution; the seed solution was inoculated into a fermentation tank containing a PDA liquid medium in an inoculum size of 10% of a volume ratio for culture at a temperature of 30 C., a stirring speed of 300 rpm, and an air aeration volume of 0.4 vvm for 60 hours, to obtain the fermented Aspergillus oryzae JAAS-32 sample.

(30) 3. Fermentation of the Larval Hermetia Illucens Paste by Aspergillus oryzae

(31) 100.0 g of the larval Hermetia illucens paste was weighed, added with 5 mL of the fermented Aspergillus oryzae sample and mixed well, then put in a thermostatic incubator (30.0 C., 200 rpm) and fermented for 24 hours, to obtain a fermentation liquor of larval Hermetia illucens paste in the Aspergillus oryzae fermentation group.

(32) Moreover, 100.0 g of the larval Hermetia illucens paste was weighed, put to a thermostatic incubator (30.0 C., 200 rpm) and fermented for 24 hours, to obtain a fermentation liquor of larval Hermetia illucens paste in the untreated group.

(33) 4. Dialysis of the Hermetia Illucens Protein Polypeptide (<10 kDa) by a Dialysis Bag

(34) (1) Pretreatment of a Dialysis Bag:

(35) A dialysis bag having a molecular weight cut-off of 10 kDa was cut into small segments having a length of 11 cm, and boiled with EDTA (pH=8.0) before use to wash off surface impurity, and then taken out, washed thoroughly with distilled water, to ensure no cleaning agent or impurity residual on the surface of the dialysis bag.

(36) (2) Dialysis and Content Determination of the Protein Polypeptide (<10 kDa):

(37) The fermentation liquor of larval Hermetia illucens paste obtained in step 3 was taken out and put in the dialysis bag, and both ends of the dialysis bag were clamped with a dialysis clamp or ribbon. The dialysis bag containing the larval Hermetia illucens paste was put to a beaker and added with 50 mL of distilled water to ensure that the dialysis bag was completely soaked into the distilled water for dialysis for 36 hours, and distilled water was replaced once every 12 hours. At the end of the dialysis, three times of the dialysate were mixed to determine the content of the protein peptide therein by a BCA process, and to determine the content of the free amino acids by a kit for free amino acid content (purchased from Grace Biotechnology Co., Ltd, Suzhou, China).

(38) Test result:

(39) The Aspergillus oryzae fermentation group in this example has an increased content of protein polypeptide (<10 kDa) and an increased content of free amino acids, as compared to the fermentation liquor of larval Hermetia illucens paste in the untreated group. As can be seen from Table 3, the content of protein polypeptide (<10 kDa) in the Aspergillus oryzae fermentation group is 1.53 times that of the untreated group, and the content of free amino acids is 1.41 times that of the untreated group. It indicates that macromolecular proteins may be subjected to enzymolysis with the protease secreted by Aspergillus oryzae into polypeptides and amino acids.

(40) TABLE-US-00004 TABLE 3 Content of the protein peptides and free amino acids in the larval Hermetia illucens pastes of the untreated group and the Aspergillus oryzae fermentation group Protein polypeptide Free amino Name <10 kDa (mg/g) acid (mg/g) Untreated group 118.400 30.571 Aspergillus oryzae 181.020 43.215 fermentation group

(41) Test Example 1 Detection for the total antioxidant activity of the larval Hermetia illucens paste protein peptide

(42) The lyophilized powder of the larval Hermetia illucens paste protein polypeptide (<10 kDa) prepared in the Aspergillus oryzae fermentation group of Example 2 was taken out and prepared to series of solutions having a concentration of 10 mg/mL by ultrapure water; the total antioxidant capacity assay was performed according to the method of the instructions of the total antioxidant capacity assay kit (purchased from Nanjing Jiancheng Bioengineering Institute).

(43) Test result: the larval Hermetia illucens paste protein peptides prepared both in the untreated group and the Aspergillus oryzae fermentation group all show antioxidant activity; when the concentration of the Hermetia illucens protein polypeptide (<10 kDa) is 10 mg/g, as shown in Table 4, the total antioxidant capacity in the untreated group is 26.81 U/mg, and the total antioxidant capacity in the Aspergillus oryzae fermentation group is 36.18 U/mg, which is 1.35 times that of the untreated group.

(44) TABLE-US-00005 TABLE 4 Total antioxidant activity of the larval Hermetia illucens paste protein peptide Treatment Total antioxidant condition activity U/mg Untreated group 26.81 Aspergillus oryzae 36.18 enzymatic fermentation group

(45) Test Example 2 Detection for the antibacteral activity of the larval Hermetia illucens paste protein peptide

(46) 1. Extraction of the Antibacterial Peptide of the Larval Hermetia Illucens Paste

(47) (1) Preparation of an antibacterial peptide extraction solution (10% acetic acid and 0.01 mol/L Na.sub.2EDTA).

(48) (2) The fermentation liquor of larval Hermetia illucens paste in the untreated group and the Aspergillus oryzae fermentation group of Example 2 was mixed with the antibacterial peptide extraction solution well (v: v=1:10), respectively, and liquid-solid extracted for half an hour at 200 rpm and 37 C., then transferred to a centrifugal machine (3500 rpm, 25 min); supernatant was collected as a crude extraction solution of the antibacterial peptide. The crude extraction solution was further frozen-dried to obtain the antibacterial Hermetia illucens peptide.

(49) 2. Determination of Antibacteral Activity of the Antibacterial Hermetia Illucens Peptide

(50) The negative control was sterile water, the antibiotic chloramphenicol served as a positive control and was prepared to a chloramphenicol aqueous solution having a concentration of 0.5 mg/mL. The concentration of the Staphylococcus aureus solution and Escherichia coli solution as well as Vibrio alginolyticus solution was determined 1.010.sup.9 CFU/mL, 1.010.sup.9 CFU/mL, and 1.010.sup.7 CFU/mL, respectively; proper amount of the Staphylococcus aureus solution and Escherichia coli solution were absorbed and evenly coated on LB media, and the Vibrio alginolyticus solution was coated on a TCBS plate. An Oxford cup having a diameter of 7.5 mm was slightly placed on the LB plate, added with an equivalent amount of the antibacterial Hermetia illucens peptide, and cultured in a 37 C. thermostatic incubator for 10 hours, then the diameter of inhibition zones was observed and measured.

(51) Test result: the antibacterial Hermetia illucens peptide was subjected to in vitro antibacterial test. The antibacterial effect is as follows: as can be seen from Table 5, inhibition zones appear both in the untreated group and the Aspergillus oryzae fermentation group; the inhibition zones against Staphylococcus aureus, Escherichia coli, and Vibrio alginolyticus are 160.1 mm, 240.1 mm, and 200.2 mm in the untreated group, respectively; the inhibition zones against Staphylococcus aureus, Escherichia coli, and Vibrio alginolyticus are 260.2 mm, 280.1 mm, and 290.2 mm in the Aspergillus oryzae fermentation group, respectively; the diameter of the inhibition zones is 1.62 times, 1.17 times, and 1.45 times that of the untreated group, respectively. The test result indicates that the larval Hermetia illucens paste has significantly improved antibacterial performance after enzymatic fermentation by Aspergillus oryzae.

(52) TABLE-US-00006 TABLE 5 Antibacteral activity of the antibacterial Hermetia illucens peptide Diameter of inhibition zone (mm) Aspergillus Un- oryzae Positive control treated fermentation Negative (1 mg/ml of group group control chloramphenicol) Bacterium (a) (b) (c) (d) Staphylococcus 16 26 16 aureus Escherichia coli 24 28 0 17 Vibrio 20 29 26 alginolyticus

(53) Obviously, the aforesaid examples of the present invention are merely illustrative of the examples given in the present invention more clearly but are not construed as limiting the embodiments of the present invention. Based on the aforesaid description, those skilled in the art could further make other different forms of changes or alterations. All the implementation methods may be not exhaustively enumerated here. Any obvious change or alteration elicited from the technical solutions of the present invention shall still fall within the protection scope of the present invention.