Methods and assays for detection and subtyping of microbial pathogens
12404558 ยท 2025-09-02
Assignee
- The Translational Genomics Research Institute (Phoenix, AZ)
- Arizona Board Of Regents On Behalf Of Northern Arizona University (Flagstaff, AZ)
Inventors
- James Schupp (Flagstaff, AZ, US)
- Jason Sahl (Phoenix, AZ, US)
- Paul Keim (Flagstaff, AZ)
- David Engelthaler (Flagstaff, AZ)
- David Wagner (Phoenix, AZ, US)
- Viacheslav Fofanov (Phoenix, AZ, US)
Cpc classification
C12Q1/04
CHEMISTRY; METALLURGY
International classification
C12Q1/04
CHEMISTRY; METALLURGY
Abstract
The present invention provides methods of detecting a biothreat agent in a sample, comprising detecting at least one biothreat-specific amplicon in the sample. The methods also encompass confirming the absence of the biothreat agent by detecting Near Neighbor specific amplicons to avoid false positive results.
Claims
1. A method of detecting Bacillus anthracis in a sample, comprising: generating one or more amplicons from the sample using at least one primer pair comprising a forward and reverse primer in at least one amplification reaction; sequencing the one or more amplicons using next-generation sequencing; and detecting at least one B. anthracis-specific amplicon in the sequenced amplicons, wherein each forward and reverse primer comprise a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; SEQ ID NO: 9 and SEQ ID NO: 10; SEQ ID NO: 11 and SEQ ID NO: 12; SEQ ID NO: 13 and SEQ ID NO: 14; SEQ ID NO: 15 and SEQ ID NO: 16; and SEQ ID NO: 17 and SEQ ID NO: 18; wherein the presence of the at least one B. anthracis-specific amplicon indicates the presence of B. anthracis in the sample, and the absence of the at least one B. anthracis-specific amplicon indicates the absence of B. anthracis from the sample.
2. The method of claim 1, further comprising confirming the absence of B. anthracis by detecting at least one B. anthracis Near Neighbor-specific amplicon using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 19 and SEQ ID NO: 20; SEQ ID NO: 21 and SEQ ID NO: 22; and SEQ ID NO: 23 and SEQ ID NO: 24; wherein detecting at least one B. anthracis Near Neighbor-specific amplicon in the sample confirms the absence of B. anthracis.
3. The method of claim 1, further comprising confirming the absence of B. anthracis by detecting at least one B. anthracis Near Neighbor-specific sequence variant (SV) or single nucleotide polymorphism (SNP) using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 25 and SEQ ID NO: 26; SEQ ID NO: 27 and SEQ ID NO: 28; SEQ ID NO: 49 and SEQ ID NO: 50; SEQ ID NO: 51 and SEQ ID NO: 52; SEQ ID NO: 53 and SEQ ID NO: 54; SEQ ID NO: 55 and SEQ ID NO: 56; SEQ ID NO: 57 and SEQ ID NO: 58; and SEQ ID NO: 59 and SEQ ID NO: 60; wherein detecting at least one B. anthracis Near Neighbor-specific SV in the sample confirms the absence of B. anthracis.
4. The method of claim 1, further comprising detecting a virulence locus or virulence plasmid in the sample by detecting a virulence-specific amplicon using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 29 and SEQ ID NO: 30; SEQ ID NO: 31 and SEQ ID NO: 32; SEQ ID NO: 33 and SEQ ID NO: 34; and SEQ ID NO: 35 and SEQ ID NO: 36; wherein the presence of the virulence-specific amplicon indicates the presence of the virulence locus or virulence plasmid in the sample.
5. The method of claim 1, further comprising detecting at least one drug resistance single nucleotide polymorphism (SNP) from B. anthracis in the sample using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 37 and SEQ ID NO: 38; SEQ ID NO: 39 and SEQ ID NO: 40; SEQ ID NO: 41 and SEQ ID NO: 42; SEQ ID NO: 43 and SEQ ID NO: 44; SEQ ID NO: 45 and SEQ ID NO: 46; and SEQ ID NO: 47 and SEQ ID NO: 48.
6. The method of claim 1, further comprising detecting Burkholderia pseudomallei and/or Burkholderia mallei in the sample by detecting at least one B. pseudomallei or B. mallei-specific amplicon using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 61 and SEQ ID NO: 62; SEQ ID NO: 63 and SEQ ID NO: 64; SEQ ID NO: 65 and SEQ ID NO: 66; SEQ ID NO: 67 and SEQ ID NO: 68; SEQ ID NO: 69 and SEQ ID NO: 70; SEQ ID NO: 71 and SEQ ID NO: 72; SEQ ID NO: 73 and SEQ ID NO: 74; SEQ ID NO: 75 and SEQ ID NO: 76; SEQ ID NO: 77 and SEQ ID NO: 78; SEQ ID NO: 79 and SEQ ID NO: 80; SEQ ID NO: 81 and SEQ ID NO: 82; SEQ ID NO: 83 and SEQ ID NO: 84; SEQ ID NO: 85 and SEQ ID NO: 86; SEQ ID NO: 87 and SEQ ID NO: 88; SEQ ID NO: 89 and SEQ ID NO: 90; SEQ ID NO: 91 and SEQ ID NO: 92; SEQ ID NO: 93 and SEQ ID NO: 94; SEQ ID NO: 95 and SEQ ID NO: 96; SEQ ID NO: 97 and SEQ ID NO: 98; SEQ ID NO: 99 and SEQ ID NO: 100; SEQ ID NO: 101 and SEQ ID NO: 102; SEQ ID NO: 103 and SEQ ID NO: 104; SEQ ID NO: 103 and SEQ ID NO: 104; SEQ ID NO: 105 and SEQ ID NO: 106; SEQ ID NO: 107 and SEQ ID NO: 108; SEQ ID NO: 117 and SEQ ID NO: 118; SEQ ID NO: 119 and SEQ ID NO: 120; SEQ ID NO: 121 and SEQ ID NO: 122; SEQ ID NO: 123 and SEQ ID NO: 124; and SEQ ID NO: 125 and SEQ ID NO: 126; wherein the presence of the at least one B. pseudomallei or B. mallei-specific amplicon indicates the presence of B. pseudomallei and/or B. mallei in the sample, and an absence of the at least one B. pseudomallei or B. mallei-specific amplicon indicates an absence of B. pseudomallei and B. mallei in the sample.
7. The method of claim 6, further comprising confirming the absence of B. pseudomallei and B. mallei by detecting at least one B. pseudomallei or B. mallei Near Neighbor-specific amplicon using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 177 and SEQ ID NO: 178; SEQ ID NO: 179 and SEQ ID NO: 180; SEQ ID NO: 181 and SEQ ID NO: 182; SEQ ID NO: 183 and SEQ ID NO: 184; SEQ ID NO: 185 and SEQ ID NO: 186; SEQ ID NO: 187 and SEQ ID NO: 188; SEQ ID NO: 189 and SEQ ID NO: 190; SEQ ID NO: 191 and SEQ ID NO: 192; SEQ ID NO: 193 and SEQ ID NO: 194; SEQ ID NO: 195 and SEQ ID NO: 196; SEQ ID NO: 197 and SEQ ID NO: 198; SEQ ID NO: 199 and SEQ ID NO: 200; SEQ ID NO: 201 and SEQ ID NO: 202; SEQ ID NO: 203 and SEQ ID NO: 204; SEQ ID NO: 205 and SEQ ID NO: 206; SEQ ID NO: 207 and SEQ ID NO: 208; SEQ ID NO: 207 and SEQ ID NO: 208; SEQ ID NO: 209 and SEQ ID NO: 210; SEQ ID NO: 211 and SEQ ID NO: 212; SEQ ID NO: 213 and SEQ ID NO: 214; SEQ ID NO: 215 and SEQ ID NO: 216; SEQ ID NO: 217 and SEQ ID NO: 218; SEQ ID NO: 219 and SEQ ID NO: 220; SEQ ID NO: 221 and SEQ ID NO: 222; SEQ ID NO: 223 and SEQ ID NO: 224; SEQ ID NO: 225 and SEQ ID NO: 226; SEQ ID NO: 227 and SEQ ID NO: 228; and SEQ ID NO: 229 and SEQ ID NO: 230; wherein detecting at least one B. pseudomallei or B. mallei Near Neighbor-specific amplicon in the sample confirms the absence of B. pseudomallei and B. mallei.
8. The method of claim 6, further comprising confirming the absence of B. pseudomallei and B. mallei by detecting at least one B. pseudomallei or B. mallei Near Neighbor-specific SNP or SV using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 109 and SEQ ID NO: 110; SEQ ID NO: 111 and SEQ ID NO: 112; SEQ ID NO: 113 and SEQ ID NO: 114; and SEQ ID NO: 115 and SEQ ID NO: 116; wherein detecting at least one B. pseudomallei or B. mallei Near Neighbor-specific SNP or SV in the sample confirms the absence of B. pseudomallei and B. mallei.
9. The method of claim 6, further comprising detecting at least one drug resistance SNP or SV from Burkholderia spp. in the sample using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 127 and SEQ ID NO: 128; SEQ ID NO: 129 and SEQ ID NO: 130; SEQ ID NO: 131 and SEQ ID NO: 132; SEQ ID NO: 133 and SEQ ID NO: 134; SEQ ID NO: 135 and SEQ ID NO: 136; SEQ ID NO: 137 and SEQ ID NO: 138; SEQ ID NO: 145 and SEQ ID NO: 146; SEQ ID NO: 147 and SEQ ID NO: 148; SEQ ID NO: 149 and SEQ ID NO: 150; SEQ ID NO: 151 and SEQ ID NO: 152; and SEQ ID NO: 153 and SEQ ID NO: 154.
10. The method of claim 1, further comprising detecting Francisella tularensis in the sample by detecting at least one F. tularensis-specific amplicon using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 265 and SEQ ID NO: 266; SEQ ID NO: 267 and SEQ ID NO: 268; and SEQ ID NO: 269 and SEQ ID NO: 270; wherein the presence of the at least one F. tularensis-specific amplicon indicates that F. tularensis is present in the sample, and an absence of the at least one F. tularensis-specific amplicon indicates that F. tularensis is absent in the sample.
11. The method of claim 10, further comprising confirming the absence of F. tularensis by detecting at least one F. tularensis Near Neighbor-specific amplicon using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 285 and SEQ ID NO: 286; SEQ ID NO: 287 and SEQ ID NO: 288; SEQ ID NO: 289 and SEQ ID NO: 290; SEQ ID NO: 291 and SEQ ID NO: 292; and SEQ ID NO: 293 and SEQ ID NO: 294; wherein detecting at least one F. tularensis Near Neighbor-specific amplicon in the sample confirms the absence of F. tularensis.
12. The method of claim 10, further comprising confirming the absence of F. tularensis by detecting at least one F. tularensis Near Neighbor-specific SNP or SV using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 271 and SEQ ID NO: 272; SEQ ID NO: 273 and SEQ ID NO: 274; SEQ ID NO: 275 and SEQ ID NO: 276; SEQ ID NO: 277 and SEQ ID NO: 278; SEQ ID NO: 279 and SEQ ID NO: 280; SEQ ID NO: 281 and SEQ ID NO: 282; and SEQ ID NO: 283 and SEQ ID NO: 284; wherein detecting at least one F. tularensis Near Neighbor-specific SNP or SV in the sample confirms the absence of F. tularensis.
13. The method of claim 1, further comprising detecting Yersinia pestis in the sample by detecting at least one Y. pestis-specific amplicon using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 231 and SEQ ID NO: 232; SEQ ID NO: 233 and SEQ ID NO: 234; SEQ ID NO: 235 and SEQ ID NO: 236; and SEQ ID NO: 237 and SEQ ID NO: 238; wherein the presence of at least one Y. pestis-specific amplicon indicates the presence of Y. pestis in the sample, and an absence of at least one Y. pestis-specific amplicon indicates an absence of Y. pestis in the sample.
14. The method of claim 13, further comprising confirming the absence of Y. pestis by detecting at least one Y. pestis Near Neighbor-specific SNP or SV using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 249 and SEQ ID NO: 250; SEQ ID NO: 251 and SEQ ID NO: 252; SEQ ID NO: 253 and SEQ ID NO: 254; SEQ ID NO: 255 and SEQ ID NO: 256; SEQ ID NO: 257 and SEQ ID NO: 258; SEQ ID NO: 259 and SEQ ID NO: 260; and SEQ ID NO: 261 and SEQ ID NO: 262; wherein detecting at least one Y. pestis Near Neighbor-specific SNP or SV confirms the absence of Y. pestis.
15. The method of claim 13, further comprising confirming the absence of Y. pestis by detecting at least one Y. pestis Near Neighbor-specific amplicon using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 263 and SEQ ID NO: 264; wherein detecting at least one Y. pestis Near Neighbor-specific amplicon confirms the absence of Y. pestis.
16. The method of claim 13, further comprising characterizing and/or subtyping Y. pestis in the sample by detecting at least one amplicon using at least one primer pair comprising a forward and reverse primer comprising a forward and reverse sequence selected from the group consisting of: SEQ ID NO: 239 and SEQ ID NO: 240; SEQ ID NO: 241 and SEQ ID NO: 242; SEQ ID NO: 243 and SEQ ID NO: 244; SEQ ID NO: 245 and SEQ ID NO: 246; and SEQ ID NO: 247 and SEQ ID NO: 248.
17. The method of claim 1, wherein the one or more amplicons are generated with at least one multiplex amplification reaction; and each primer in the at least one primer pair comprises a universal tail sequence.
18. The method of claim 17, wherein the at least one amplicon is present when a locus read count of the at least one amplicon is at least 10 sequence reads covering at least 75% of a corresponding amplicon reference sequence, and the universal tail sequence for each forward and reverse primer comprises SEQ ID NO: 301 and SEQ ID NO: 303.
19. The method of claim 1, wherein the sample is a biological sample obtained from a subject and further comprising administering an effective amount of at least one antibiotic to the subject, wherein the at least one antibiotic is selected from the group consisting of a fluoroquinolone, an aminoglycoside, a glycopeptide, a lincosamide, a macrolide/ketolide, a cephalosporin, a monobactam, a nitroimidazole, a penicillin, a streptogramin, a tetracycline, and a physiologically acceptable salt, prodrug, or combination thereof.
20. The method of 19, wherein the at least one antibiotic is not a fluoroquinolone if a gyrA drug resistance SNP is detected; and/or the at least one antibiotic is not a fluoroquinolone if a parC drug resistance SNP is detected; and/or the at least one antibiotic is not a fluoroquinolone or an aminocoumarin if a gyrB drug resistance SNP is detected; and/or the at least one antibiotic is not a rifamycin if a rpoB drug resistance SNP is detected; and/or the at least one antibiotic is not a -lactam if a penA drug resistance SNP is detected; and/or the at least one antibiotic is not a trimethoprim and sulfamethoxazole combination, co-trimoxazole, if a folM drug resistance SV is detected; and/or the at least one antibiotic is not a trimethoprim and sulfamethoxazole combination, co-trimoxazole, if a bpeT drug resistance SV is detected; and/or the at least one antibiotic is not a trimethoprim and sulfamethoxazole combination, co-trimoxazole, if a bpeS drug resistance SV is detected.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION
Definitions
(12) As used herein, the verb comprise as is used in this description and in the claims and its conjugations are used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded.
(13) As used herein, reference to an element by the indefinite article a or an does not exclude the possibility that more than one of the elements are present, unless the context clearly requires that there is one and only one of the elements. The indefinite article a or an thus usually means at least one.
(14) The sample in this method is preferably a biological sample from a subject. The term sample or biological sample or environmental sample is used in its broadest sense. Depending upon the embodiment of the invention, for example, a sample may comprise a bodily fluid including whole blood, serum, plasma, urine, saliva, cerebral spinal fluid, semen, vaginal fluid, pulmonary fluid, tears, perspiration, mucus and the like; an extract from a cell, chromosome, organelle, or membrane isolated from a cell; a cell; genomic DNA, RNA, or cDNA, in solution or bound to a substrate; a tissue; a tissue print, or any other material isolated in whole or in part from a living subject or organism. Biological samples may also include sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histologic purposes such as blood, plasma, serum, sputum, stool, tears, mucus, hair, skin, and the like. Biological samples also include explants and primary and/or transformed cell cultures derived from patient tissues. In some embodiments, sample may comprise a portion of a non-animal organism, such as a plant (e.g., castor beans or derivatives thereof). In other embodiments, the sample comprises soil, water, air or other environmental material.
(15) In some embodiments, sample or biological sample may include a bodily tissue, fluid, or any other specimen that may be obtained from a living organism that may comprise additional living organisms. By way of example only, in some embodiments, sample or biological sample may include a specimen from a first organism (e.g., a human) that may further comprise an additional organism (e.g., bacteria, including pathogenic or non-pathogenic/commensal bacteria, viruses, parasites, fungi, including pathogenic or non-pathogenic fungi, etc.). In some embodiments, the additional organism may be separately cultured after isolation of the sample to provide additional starting materials for downstream analyses, in some embodiments, the sample or biological sample may comprise a direct portion of the additional, non-human organism and the host organism (e.g., a biopsy or sputum sample that contains human cells and bacteria).
(16) Some embodiments of the invention may comprise a multiplex assay. As used herein, the term multiplex refers to the production of more than one amplicon, PCR product, PCR fragment, amplification product, etc. in a single reaction vessel. In other words, multiplex is to be construed as the amplification of more than one target-specific sequences within a PCR reaction or assay within the same PCR assay mixture (e.g., more than one amplicon is produced within a single vessel that contains all of the reagents necessary to perform a PCR reaction). In some embodiments, a step prior to performing the PCR (or RT-PCR, quantitative RT-PCR, etc.) reaction can occur such that sets of primers and/or primers and probes are designed, produced, and optimized within a given set of reaction conditions to ensure proper amplicon production during the performance of the PCR.
(17) BioThreatSeq
(18) Currently, there are two approaches being used to identifying specimens in the environment. The first approach, metagenomics, tries to sequence all of the DNA in a sample and then to unravel its content computationally. Sequencing all of the DNA is difficult, slow, and very expensive. The computational approaches are improving but still contain many flaws that lead to false conclusions. A recent sensationalized report of DNA from anthrax and plague bacteria in the NYC subways illustrates the pitfalls of such endeavors (Mason et al., Cell Systems). Significant amounts of data are produced with metagenomics but frequently not enough for informative signatures to differentiate pathogens from near neighbors. Deep sequencing of single specimens may cost nearly $1,000 and take several weeks to generate. It is clearly not ready at this time for implementation for biosurveillance.
(19) The second approach, amplicon sequencing, involves the deep (>5,000) sequencing of the 16S gene PCR amplicon to identify individual components of mixed bacterial communities. While the PCR primers are not specific, the intervening sequences can be highly informative and can be used to discriminate among bacterial taxa. Unfortunately for biothreat detection, the 16S gene has insufficient discrimination power to differentiate biothreat pathogens from their near neighbors. Discrimination power is a function of gene diversity and the 16S has low or no diversity among closely related bacteria. It cannot effectively identify a biothreat agent or distinguish from near-neighbor species.
(20) Increasing the amplicon discrimination power can be accomplished through comparative genomic analysis to identify diverse genomics regions. This is most effective when large genome databases are available and can be highly predictive of success once implemented. In clinical diagnostics, this approach is being used to identify multiple pathogens and to predict their virulence and resistance to antibiotics. PCR primers specific to a pathogen genera or species is sufficient, if there is additional DNA sequence information that can be leveraged for precise agent identification. Multiplex systems of several hundred amplicons are becoming common and provide coverage for dozens of pathogens. Sample preparation that works for real-time-PCR also works for this technology, so currently sampling schemes would adapt well to this type of assay. A multiple amplicon sequencing system would be easily adapted to changing targets with addition of new amplicons. Because of the multiplex nature of the assay, redundant amplicons can easily be included to verify the identification of a biothreat agent and even provide a differential identification of a near-neighbor species. Variation within the amplicons can be analyzed to identify drug resistance, virulence factors and subtype to the strain level.
(21) The ideal multiple amplicon sequencing system for identifying major biothreat agents should distinguish between the biothreat agent and its near-neighbor species using both amplification positive/negative criteria and qualitative analysis of sequence within the amplicons. This latter analysis provides strain identification and drug susceptibility identification. The analytical system should be supported by an automated interpretive software that generates actionable reports. Such a system includes quality assurance data to identify sample and/or process issues rapidly, to limit the effect of QC issues on final results.
(22) BioThreatSeq detects a presence, an absence, and/or a clinically important characteristic of nucleic acids from one or more microbial pathogens. BioThreatSeq is based upon very discriminating genetic regions bioinformatically identified using public and private genome sequences from microbial pathogens including but not limited to Bacillus anthracis, Burkholderia pseudomallei, Burkholderia mallei, Francisella tularensis, Yersinia pestis and Near Neighbor (NN) species. BioThreatSeq can be used to screen environmental samples for presence of target agent DNA, as well as war fighter and civilian patients for target agent carriage in the event of suspected exposure.
(23) In an embodiment, BioThreatSeq comprises a highly multiplexed amplicon sequencing assay. The assay is a highly informative screening tool capable of simultaneously detecting a presence of a microbial pathogen and a clinically important characteristic of the microbial pathogen without a live culturing step. Non-limiting examples of the clinically important characteristics include: virulence, or antibiotic resistance genetic signatures, etc.
(24) The utility of this assay has been demonstrated on several complex environmental and clinical specimen types including urine, wound swabs, sputum, air, soil, water samples. The superiority of BioThreatSeq over traditional typing techniques include high sensitivity (e.g., a low limit of detection) and high specificity (e.g., discriminating among strains, detecting antimicrobial resistance, and profiling virulence signatures, etc.) in target agent detection. BioThreatSeq is also highly adaptable to new content, which allows for the flexibility to detect new biothreats agents and signatures. Thus, the assay methodology allows for the expansion of this tool to be used for several other BioThreat agents or applications.
(25) Target Specific Amplicon
(26) The Inventors used comparative genomics to identify a first genomic region that differentiates a target agent from its near neighbor relatives. In the first scenario, the first genomic region is present in all known target strains, and a lack of the first genomic region indicates an absence of the target agent in the sample. In the second scenario, the first genomic region not only is present in all known target strains, but is also absent in near-neighbor species. Thus, a presence of the first genomic region indicates a presence of the target agent in the sample.
(27) In certain non-limiting embodiments, the presence or absence of the first genomic region in the nucleic acids of the sample is determined by PCR using a first forward primer and a first reverse primer. The first forward primer and the first reverse primer amplify a Target Specific Amplicon, i.e., all strains of the threat agent, but not the near neighbors.
(28) Differential Target Amplicons
(29) The Inventors also used comparative genomics to identify a second genomic region that differentiates a target agent from its near neighbor relatives. The second genomic region is present in all strains of the near-neighbor relatives, but will not be in the target. Thus, a presence of the second genomic region indicates an absence of the target agent in the sample.
(30) In certain non-limiting embodiments, the presence or absence of the second genomic region in the nucleic acids of the sample is determined by PCR using a second forward primer and a second reverse primer. The second forward primer and second reverse primer amplify Differential Target Amplicons, i.e., all strains of the near neighbors, but not the threat agent. Differential identification assays can be included in the multiplex assay to help nullify any false positive results. This optional step offers interpretive value in complex species.
(31) The Inventors determined the exclusivity and inclusivity of the first forward and the first reverse primers in silico across all available threat agents (Bacillus anthracis, Burkholderia pseudomallei, Burkholderia mallei, Francisella tularensis, and Yersinia pestis) and near neighbor genomes. The in-silico validation included genomes from common contaminants such as humans. Because a large number of genomics sequences exist for both target and non-target organisms, the in-silico validation step eliminates any primers that are non-exclusive to the biothreat target. The assay primers were tested against the target and near-neighbor DNA templates to validate them under actual assay conditions.
(32) Primer Design
(33) The design of the first forward primer, the first reverse primer, the second forward primer, and the second reverse primer is consistent with a standard PCR method but is amendable to analysis using next-generation sequencing methods. This requirement includes the addition of barcodes to allow for indexing of samples for combining into single DNA sequencing batches. The technical details are provided in the PCT Patent Application entitled Systems And Methods for Universal Tail-Based Indexing Strategies for Amplicon Sequencing (International Application Number: PCT/US2014/064890; International Publication Number: WO 2015/070187 A2), the contents of which are hereby incorporated in their entirety.
(34) The Inventors determined the exclusivity and inclusivity of the second forward and the second reverse primers in silico across all available threat agents (Bacillus anthracis, Burkholderia pseudomallei, Burkholderia mallei, Francisella tularensis, and Yersinia pestis) and near neighbor genomes. The in-silico validation included genomes from common contaminants such as humans and soil DNA. Because a large number of genomics sequences exist for both target and non-target organisms, the in-silico validation step eliminates any primers that are non-exclusive to the near-neighbor species. The assay primers were tested against the target and near-neighbor DNA templates to validate them under actual assay conditions.
(35) In the third scenario, the first genomic region is present in all known target strains and at least one near-neighbor species. In this case, producing an exclusive amplicon is not feasible and the combination of amplification and internal sequence is needed to distinguish target from near-neighbors. In the absence of exclusive-target amplification, the amplicon sequence could provide definitive identification of the target and non-target agents.
(36) The Inventors has defined the phylogenetic structure of the first genomic region that includes both the target agent and its near neighbors and identified a variable internal sequence region which allows for: (1) differentiation of near neighbor from target species, (2) strain identification, (3) drug susceptibility identification, and/or (4) virulence prediction.
(37) Performance of the Multiplex Assays
(38) The Inventors have developed combined multi-agent amplicon sequencing assays for 2, 3, 4, 5, 6, or 7 biothreat agents and validated them under laboratory conditions. For the combined biothreat agent assays, important test parameters such as linearity, LOD, sensitivity, specificity, quantitative performance (absolute and relative), contaminant interference, performance with environmental samples (spikes), etc. have been determined.
(39) Software
(40) The Inventors have developed software that analyzes B. anthracis amplicon sequence data and provides actionable information (i.e., agent presence with confidence metrics, presence of virulence and antibiotic resistance factors, phylogenetic classification, etc.). The Inventors have also developed software that analyzes B. anthracis and other target agent (F. tularensis, Y. pestis, B. mallei, B. pseudomallei, Brucella melitensis, and B. abortus) and allow for on-site and remote reporting.
(41) BTSeq comprises target agent and near neighbor (NN) species identification assays, antimicrobial resistance (AMR) assays, virulence gene assays, and uses TGen North's amplicon sequencing analysis pipeline (ASAP) to report results.
(42) Use of the disclosed amplicon sequencing tool can be used to screen environmental samples for presence of target agent DNA, as well as war fighter and civilian patients for target agent carriage in the event of suspected exposure.
(43) In some embodiments, the present invention relates to a method of detecting Bacillus anthracis in a sample, comprising detecting at least one B. anthracis-specific amplicon selected from the group consisting of: CP008853.1_5309, CP008853.1_5316, CP012725.1_3629, CP012725.1_5103, CP012725.1_5107, JSZQ01000034.1_220, JSZS01000036.1_5, LGCC01000010.1_232, and LGCC01000048.1_280 in the sample, wherein the presence of the B. anthracis-specific amplicon indicates the presence of B. anthracis in the sample, and an absence of the B. anthracis-specific amplicon indicates an absence of B. anthracis in the sample.
(44) In other embodiments, the disclosed methods further comprise confirming the absence of B. anthracis by detecting at least one B. anthracis Near Neighbor-specific amplicon selected from the group consisting of: NN_LOMU01000090.1_49, NN_LOQC01000013.1_3, and ChimpKiller_9-159 in the sample, wherein detecting the B. anthracis Near Neighbor-specific amplicon confirms the absence of B. anthracis.
(45) In yet other embodiments, the disclosed methods further comprise characterizing and/or subtyping B. anthracis by detecting at least one amplicon, single nucleotide polymorphism (SNP) or sequence variant (SV) selected from the group consisting of: ChimpKiller_91-320, ChimpKiller_481-698, plcR, pagA, pX01, pX01, gyrA, parC, gyrB, rpoB, AA_2502, AA_2503, Ba_AmesAnc_4669915, Ba_AmesAnc_4001578, Ba_AmesAnc_1069024, Ba_AmesAnc_3668548, Ba_AmesAnc_371913, and Ba_AmesAnc_999035 in the sample.
(46) In certain aspects, the disclosed methods further comprise characterizing and/or subtyping B. anthracis by detecting at least one amplicon, single nucleotide polymorphism (SNP) or sequence variant (SV) selected from the group consisting of: ChimpKiller_91-320, ChimpKiller_481-698, plcR, pagA, pX01, pX01, gyrA, parC, gyrB, rpoB, AA_2502, AA_2503, Ba_AmesAnc_4669915, Ba_AmesAnc_4001578, Ba_AmesAnc_1069024, Ba_AmesAnc_3668548, Ba_AmesAnc_371913, and Ba_AmesAnc_999035 in the sample.
(47) In other aspects, the present invention relates to a method of detecting Burkholderia pseudomallei and/or Burkholderia mallei in a sample by detecting at least one B. pseudomallei or B. mallei-specific amplicon selected from the group consisting of: LWWC01000187.1_18, LWWB01000125.1_17183_17602, LXAY01000367.1_0_640, LWVY01000190.1_17226_17689, and LXAD01000059.1_24760_25075, wherein the presence of the B. pseudomallei or B. mallei-specific amplicon indicates the presence of B. pseudomallei and/or B. mallei in the sample, and an absence of the B. pseudomallei or B. mallei-specific amplicon indicates an absence of B. pseudomallei and B. mallei in the sample.
(48) In some embodiments, the present invention provides a method of detecting Burkholderia pseudomallei and/or Burkholderia mallei in the sample by detecting at least one B. pseudomallei or B. mallei-specific amplicon selected from the group consisting of: LWWC01000187.1_18, LWWB01000125.1_17183_17602, LXAY01000367.1_0_640, LWVY01000190.1_17226_17689, and LXAD01000059.1_24760_25075, wherein the presence of the B. pseudomallei or B. mallei-specific amplicon indicates the presence of B. pseudomallei and/or B. mallei in the sample, and an absence of the B. pseudomallei or B. mallei-specific amplicon indicates an absence of B. pseudomallei and B. mallei in the sample.
(49) In other embodiments, the present invention provides a method of detecting B. pseudomallei in a sample by detecting at least one B. pseudomallei-specific amplicon selected from the group consisting of: TTS1 BPSS1407, LXCC01000141.1 39296 39817, LXBY01000087.1_75760_76751, LXCD01000002.1_99652_100245, and LXCE01000123.1_34220_34747 (, wherein the presence of the B. pseudomallei-specific amplicon indicates the presence of B. pseudomallei in the sample, and an absence of the B. pseudomallei-specific amplicon indicates an absence of B. pseudomallei in the sample.
(50) In yet other embodiments, the present invention provides a method of detecting B. mallei in the sample by detecting at least one B. mallei-specific amplicon selected from the group consisting of: Bm 11589 and Bm 11767, wherein the presence of the B. mallei-specific amplicon indicates the presence of B. mallei in the sample, and an absence of the B. mallei-specific amplicon indicates an absence of B. mallei in the sample.
(51) In certain aspects, the disclosed methods further comprise characterizing and/or subtyping B. pseudomallei and/or B. mallei by detecting at least one one amplicon, single nucleotide polymorphism (SNP) or sequence variant (SV) selected from the group consisting of: K9penA378-529, K9penA575-761, K9penA949-1172, pbp3-1, and pbp3-2 in the sample.
(52) In other aspects, the disclosed methods further comprise confirming the absence of B. pseudomallei and B. mallei by detecting at least one B. pseudomallei or B. mallei Near Neighbor-specific single nucleotide polymorphism (SNP) or sequence variant (SV) selected from the group consisting of: NC 006350 2289827, NC 006350 133027, NC 006350 2248145-2248193, and NC 006350 988041-988089 in the sample, wherein detecting the B. pseudomallei or B. mallei Near Neighbor-specific single nucleotide polymorphism (SNP) or sequence variant (SV) confirms the absence of B. pseudomallei and B. mallei.
(53) In yet other aspects, the present invention provides a method of detecting Francisella tularensis in a sample by detecting at least one F. tularensis-specific amplicon selected from the group consisting of: F. tularensis_CP000915.1_1782, F. tularensis_CP000915.1-731, and Ft_dup_CP000915.1_197, wherein the presence of the F. tularensis-specific amplicon indicates that F. tularensis is present in the sample, and an absence of the F. tularensis-specific amplicon indicates that F. tularensis is absent in the sample.
(54) In some aspects, the disclosed methods further comprise confirming the absence of F. tularensis by detecting at least one F. tularensis Near Neighbor-specific amplicon selected from the group consisting of: F. tnovicida_CP009607.1, F. philom_CP009444.1_569, and F. philom_CP009444.1_285 in the sample, wherein detecting the F. tularensis Near Neighbor-specific amplicon confirms the absence of F. tularensis.
(55) In other aspects, the disclosed methods further comprise confirming the absence of F. tularensis by detecting at least one F. tularensis Near Neighbor-specific SNP or SV selected from the group consisting of: FtA1, FtA2, FtB, FtA, FtLVS_AM233362_1646546, FtLVS_AM233362_1643765, and FtLVS_AM233362_1562618 in the sample, wherein detecting the F. tularensis Near Neighbor-specific polymorphism confirms the absence of F. tularensis.
(56) In yet other aspects, the present invention provides a method of detecting Yersinia pestis in the sample by detecting at least one Y. pestis-specific amplicon selected from the group consisting of: Y. pestis_LPQY01000176.1_7, AGJT01000065.1_0_338, and FAUR01000053.1_96407_96884, wherein the presence of the Y. pestis-specific amplicon indicates the presence of Y. pestis in the sample, and an absence of the Y. pestis-specific amplicon indicates an absence of Y. pestis in the sample.
(57) In one embodiment, the disclosed methods further comprise confirming the absence of Y. pestis by detecting at least one Y. pestis Near Neighbor-specific SNP or SV selected from the group consisting of: YpCO92_NC_003143_113190, YpCO92_NC_003143_161621, YpCO92_NC_003143_152213, YpCO92_NC_003143_129539, YpCO92_NC_003143_91203, YpCO92_NC_003143_121812, and Yp_AL590842.1_RX_SNP in the sample, wherein detecting the Y. pestis Near Neighbor-specific SNP or SV confirms the absence of Y. pestis.
(58) In another embodiment, the disclosed methods further comprise characterizing and/or subtyping Y. pestis by detecting at least one amplicon selected from the group consisting of: YpPGM_AL031866.1_81, YpPGM_31-205, Yp-p1202_42780-43194, Yp-p1202_126386-126750, and Yp-p1202_156402-156711 in the sample.
(59) In some embodiments, the presence or absence of B. anthracis in a sample is detected by identifying a specific mutation in the PlcR gene, a single base change at position 640, a nonsense mutation, which creates a dysfunctional protein. In other embodiments, the presence or absence of B. anthracis in a sample is detected by identifying the pXO1 and/or pXO2 plasmids.
(60) PlcR is a global transcriptional regulator which controls most of the secreted virulence factors in B. cereus and B. thuringiensis. It is chromosomally encoded and is ubiquitous throughout the cell (Agaisse, H. et al. (June 1999). PlcR is a pleiotropic regulator of extracellular virulence factor gene expression in Bacillus thuringiensis. Molecular Microbiology. 32 (5): 1043-53). In B. anthracis, however, the plcR gene contains a single base change at position 640, a nonsense mutation, which creates a dysfunctional protein. While 1% of the B. cereus group carries an inactivated plcR gene, none of them carries the specific mutation found only in B. anthracis (Slamti, L. et al. (June 2004). Distinct mutations in PlcR explain why some strains of the Bacillus cereus group are nonhemolytic. Journal of Bacteriology. 186 (11): 3531-8).
(61) The lack of PlcR in B. anthracis is a principle characteristic differentiating it from other members of the B. cereus group. While B. cereus and B. thuringiensis depend on the plcR gene for expression of their virulence factors, B. anthracis relies on the pXO1 and pXO2 plasmids for its virulence (Kolsto, A. et al. (October 2009). What Sets Bacillus anthracis Apart from Other Bacillus Species? Annual Review of Microbiology. 63 (1): 451-476). Bacillus cereus biovar anthracis, i.e. B. cereus with the two plasmids, is also capable of causing anthrax.
(62) In various embodiments, the disclosed methods identify an antibiotic resistance gene selected from a beta-lactamase gene, such as bIaOXA, encoding extended spectrum OM class D beta-lactamases, blaCTX-M 82, blaCFX A4, encoding extended spectrum class A serine beta-lactamases, and AmpC, encoding the extended spectrum cephalosporin-resistant class C beta-lactamases; a multidrug efflux transporter system gene such as acrE, encoding a component of the AcrEF-ToIC multidrug efflux transporter system (Lau and Zgurskaya, 2005, J. Bacteriol. 187:7815); baeR; encoding a response regulator of the MdtABC multidrug efflux transporter system (Nagakubo et al., 2002, J. Bacteriol. 184:4161); emrY, encoding a component of the EmrKY-ToIC multidrug efflux transporter system (Tanabe et al., 1997, J. Gen. Appl. Microbiol. 43:257); mdtD, encoding a component of the MdtABC multidrug efflux transporter system (Nagakubo et al., 2002, J. Bacteriol. 184:4161); and mdtN, encoding a multidrug resistance efflux pump from the major facilitator superfamily (Sulavik et al., 2001, Antimicrob. Agents Chemother. 45:1126); pbp2, encoding penicillin binding protein 2 (Bharat et al., 2015, Antimicrob. Agents Chemother. 59:5003); pbp4, encoding penicillin binding protein 4 (Sun et al., 2014, PLoS One 9:e97202); andaminoglycoside_strA (Scholz et al., 1989, Gene 75:271) encodes an aminoglycoside phosphotransferase, and Tetracycline_tet39 (Agerso and Guardabassi, 2005, J. Antimicrob. Chemother. 55:566) encodes a component of a tetracycline efflux pump.
(63) Other antibiotic resistance genes are provided in the Antibiotic Resistance Genes Database (ARDB), see Nucl. Acids Res. (2009) 37 (suppl 1): D443-D447, the World Wide Web (www) at ardb.cbcb.umd.edu, Antimicrob. Agents Chemother. July 2013 vol. 57 no. 7 3348-3357, and the NCBI database (the World Wide Web (www) at ncbi.nlm.nih.gov), the entire contents of which are hereby incorporated by reference.
(64) In various embodiments, the antibiotic resistance gene is one or more of the genes shown below:
(65) Aminocoumarins:
(66) Aminocournarin-resistant DNA topoisomerases Aminocournarin-resistant GyrB, ParE, ParY
Aminoglycosides: Aminoglycoside acetyltransferases AAC(1), AAC(2), AAC(3), AAC(6) Aminoglycosi de nucleotidyltransferases ANT(2), ANT(3), ANT(4), ANT(6), ANT(9) Aminoglycoside phosphotransferases APH(2), APH(3), APH(3), APH(4), APH(6), APH(7), APH(9) 16S rRNA methyltransferases ArmA, RaitA, RrntB, RrniC, Sgrn
-Lactams: Class A -lactamases AER, BLA1, CTX-M, KPC, SHV, TEM, etc. Class B (metallo-)-lactamases BlaB, CcrA, IMP, NDM, VIM, etc. Class C -lactamases ACT, AmpC, CMY, LAT, PDC, etc. Class D -lactamases OXA -lactamase mecA (methicillin-resistant PBP2) Mutant porin proteins conferring antibiotic resistance Antibiotic-resistant Omp36, OmpF, PIB (por)
Genes Modulating -Lactam Resistance: bla (blaI, blaR1) and mec (mecI, mecR1) operons
Chloramphenicol: Chloramphenicol acetyitransferase (CAT) Chloramphenicol phosphotransferase
Ethambutol: Ethambutol-resistant arabinosyltransferase (FrnbB)
Mupirocin: Mupirocin-resistant isoleucyl-tRNA synthetases
MupA, MupB Peptide Antibiotics: Integral membrane protein MpriF
Phenicol: Cfr 23S rRNA methyltransferase
Rifampin: Rifampin ADP-ribosyitransferase (Arr) Rifampin glycosyltransferase Rifampin monooxygenase Rifampin phosphotransferase Rifampin resistance RNA polymerase-binding proteins
DnaA, RbpA Rifampin-resistant beta-subunit of RNA polymerase
(RpoB)
Streptogramins: Cfr 23S rRNA methyltransferase Erm 23S rRNA methyltransferases ErmA, ErmB, Erm(31), etc. Streptogramin resistance ATP-binding cassette (ABC) efflux pumps Lsa, MsrA, Vga, VgaB Streptogramin Vgb lyase Vat acetyltransferase
Fitioroquirmiones: Fluoroquinolone acetyltransferase Fluoroquinolone-resistant DNA topoisomerases Fluoroquinolone-resistant GyrA, GyrB, ParC Quinolone resistance protein (Qnr)
Fosfomycin: Fosfomycin phosphotransferases FomA, FomB, FosC Fosfomycin thiol transferases FosA, FosB, FosX
Glycopeptides: VanA, VanB, VanD, VanR, VanS, etc.
Lincosamides: Cfr 23S rRNA methyltransferase Erm 23SrRNA methyltransferases ErmA, ErmB, Em(31), etc. Lincosamide nucleotidyltransferase (Lin)
Linezolid: Cfr 23S rRNA methyltransferase
Macrolides: Cfr 23S rRNA methyltransferase Erm 23S rRNA methyltransferases ErmA, ErmB, Erm(31), Macrolide esterases EreA, EreB Macrolide glycosyltransferases GimA, Mgt, Ole Macrolide phosphotransferases (MPH) MPH(2)-I, MPH(2)-II Macrolide resistance efflux pumps MefA, MefE, Mel
Streptothricin: Streptothricin acetyltransferase (sat)
Sulfonamides: Sulfonamide-resistant dihydropteroate synthases Sul1, Sul2, Sul3, sulfonamide-resistant FolP
Tetracyclines: Mutant porin PIB (por) with reduced permeability Tetracycline inactivation enzyme TetX Tetracycline resistance major facilitator supeifamily (MFS) efflux pumps TetA, TetB, TetC, Tet30, Tet31, etc. Tetracycline resistance ribosomal protection proteins TetM, TetO, TetQ, Tet32, Tet36, etc.
Efflux Pumps Conferring Antibiotic Resistance: ABC antibiotic efflux pump MacAR-TolC, MsbA, MsrA, VgaB, etc. MFS antibiotic efflux pump EmrD, EmrAB-TolC, NorB, GepA, etc. Multidrug and toxic compound extrusion (MATE) transporter MepA Resistance-nodulation-cell division (RND) efflux pump AdeABC, AcrD, MexAB-OprM, mtrCDE, etc. Small multidrug resistance (SMR) antibiotic efflux pump EmrE
Genes Modulating Antibiotic Efflux: adeR, acrR, baeSR, mexR, phoPQ, mtrR
Multidrug Resistance: plasmid plP1202
(67) In certain aspects, the disclosed methods the sample is obtained from a subject and the method further comprises administering at least one antibiotic to the subject.
(68) In one aspect, the at least one antibiotic is a fluoroquinolone. Non-limiting fluoroquinolones for use as described herein include levofloxacin, ofloxacin, ciprofloxacin, enoxacin, gatifloxacin, gemifloxacin, grepafloxacin, besifloxacin, lomefloxacin, moxifloxacin, norfloxacin, ofloxacin, pefloxacin, sparfloxacin, garenoxacin, trovafloxacin, sitafloxacin, and DX-619.
(69) In another aspect, the at least one antibiotic is an aminoglycoside such as amikacin, gentamycin, kanamycin, neomycin, netilmicin, paromomycin, streptomycin, or tobramycin.
(70) In another aspect, the at least one antibiotic is a carbapenem such as ertapenem, imipenem, meropenem, or chloramphenicol.
(71) In another aspect, the at least one antibiotic is a glycopeptide such as vancomycin.
(72) In another aspect, the at least one antibiotic is a lincosamide such as clindamycin.
(73) In another aspect, the at least one antibiotic is a macrolide/ketolide such as azithromycin, clarithromycin, dirithromycin, erythromycin, or telithromycin.
(74) In another aspect, the at least one antibiotic is a cephalosporin such as (1st generation) cefadroxil, cefazolin, cephalexin, cephalothin, cephapirin, and cephradine; or (2nd generation) cefaclor, cefamandole, cefonicid, cefotetan, cefoxitin, cefprozil, cefuroxime, and loracarbef, or (3rd generation) cefdinir, cefditoren, cefixime, cefoperazone, cefotaxime, cefpodoxime, ceftazidime, ceftibuten, ceftizoxime, and ceftriaxone, or (4th generation) cefepime.
(75) In another aspect, the at least one antibiotic is a monobactam such as aztreonam.
(76) In another aspect, the at least one antibiotic is a nitroimidazole such as metronidazole.
(77) In another aspect, the at least one antibiotic is an oxazolidinone such as linezolid.
(78) In another aspect, the at least one antibiotic is a penicillin such as amoxicillin, amoxicillin/clavulanate, ampicillin, ampicillin/sulbactam, bacampicillin, carbenicillin, cloxacillin, dicloxacillin, methicillin, mezlocillin, nafcillin, oxacillin, penicillin G, penicillin V, piperacillin, piperacillin/tazobactam, ticarcillin, or ticarcillin/clavulanate.
(79) In another aspect, the at least one antibiotic is a streptogramin such as quinupristin/dalfopristin.
(80) In another aspect, the at least one antibiotic is a tetracycline such as demeclocycline, doxycycline, minocycline, or tetracycline.
(81) In another aspect, the at least one antibiotic is a -lactam such as a penicillin, cephalosporin, carbapenem, or monobactam.
(82) The at least one antibiotic may be a physiologically acceptable salt, prodrug, or combination of any one of the aforementioned antibiotics.
(83) The following examples are given for purely illustrative and non-limiting purposes of the present invention.
EXAMPLES
Example 1. Detecting the Presence of Nucleic Acids from Burkholderia
(84) This protocol describes procedures for: (1) PCR amplification of multiplexed Burkholderia targets; (2) Index extension PCR to prepare amplicons for MiSeq (ILLUMINA sequencer); (3) SequelPrep Normalization Plate Kit (ThermoFisher); and (4) Agencourt AMPure XP bead cleanup for PCR purification (Beckman Coulter).
(85) Universal-tailed gene-specific primers are pooled together in a primer mix in amounts relative to each other to help reduce PCR bias. Make the primer mixture by combining the primers and 1TE (e.g., according to Table 8). Vortex and spin down each primer stock. The primer mixture can be stored at 20 C. Plan and arrange the layout of where the samples will go on a 96-well plate. If clinical samples are being processed, make sure to space the samples on the plate accordingly.
(86) To prepare Burkholderia Multiplex, on experimental day, thaw out an aliquot of Internal Plasmid Sequencing Control (IPSC) at 10{circumflex over ()}6 copies per uL, dilute down to 10{circumflex over ()}3 copies per uL by three serial dilutions of 1 to 10. Make dilutions in tubes for better vortexing & spinning. For single reaction no-template control (NTC) reaction, add 12.5 L Q5 2 HotStart, 5 L 5M Betaine, and 4.5 L Diluted Primer Mix. For single reaction, add 12.5 L Q5 2 HotStart, 5 L 5M Betaine, 1 L IPSC 1000 copies per L, and 4.5 L Diluted Primer Mix. To prepare for Master Mix reaction, add 2475 L Q5 2 HotStart, 990 L 5M Betaine, 198 L IPSC 1000 copies per L, and 891 L Diluted Primer.
(87) Gently mix template DNA and spin down (Do not vortex genomic DNA). Add 2L of template DNA to its appropriate well, along with 2L H.sub.2O for IPSC, and 3L H.sub.2O for NTC. Seal plate with a thermocycler seal. Spin down the plate. Using a heated lid, put plate on thermocycler and run the following parameters:
(88) TABLE-US-00001 Step Repeats Temperature ( C.) Time initial denaturation 1 98 5 min denaturation 35 98 30 sec annealing 68 15 sec extension 72 20 sec final extension 1 72 2 min cooling 1 10 forever
(89) Spin plates (Burkholderia target plate and Bacillus, Yersinia, Francisella target plate) down once the thermocycler finishes.
(90) Prepare AMPure Beads. Prepare 10 mM Tris-HCl 0.05% Tween-20 in H.sub.2O by adding 400 L 10 mM Tris-HCl, 20 L 0.05% Tween-20, and 39.580 mL Molecular Grade H.sub.2O, and heat to 50 C. Equilibrate the bead to Room Temperature for 30 minutes. Add beads in a 1:1 ratio with reaction volume to each well (30 L) and mix well by pipetting. Incubate the bead/reaction mixture for 5 minutes. Place the 96-well plate onto a magnetic stand, incubate for another 5 minutes. Aspirate supernatant out of wells without disturbing the beads. If beads were disturbed, let them incubate for another 2 minutes. Be sure to remove as much liquid as you can. Twice wash the beads by adding 80% EtOH (32 ml 100% Ethanol, and 8 ml Molecular Grade H.sub.2O) to completely cover beads (200 L) and incubate for 30 seconds. Aspirate. Fully remove liquids after the wash. Move plate off magnetic stand and allow beads to dry. Be sure to keep a close watch on the beads. If the beads start to crack, the DNA will be difficult to elute out. Move plate off the magnetic stand and add 32.54 heated 10 mM Tris-HCl 0.05% Tween-20 in H.sub.2O to the wells, mix well. Incubate for 2 minutes. Move plate to magnetic stand and incubate for 2 minutes. Remove 304 of supernatant and transfer it to a new well, do not disturb or transfer any beads.
(91) Burkholderia, Bacillus, Francisella, and Yersinia AmpSeq amplicons require two bead cleanups before Extension PCR. Repeat steps 12-21.
(92) Detecting the Presence of Nucleic Acids from Bacillus anthracis, Yersinia, and Francisella UT-AmpSeq PCR and Bead Cleanup.
(93) 1. PCR amplification of multiplexed Bacillus, Yersinia, and Francisella targets. Universal-tailed gene-specific primers are pooled together in a primer mix in amounts relative to each other to help reduce PCR bias. These amounts have been previously optimized. Please follow the Primer Mix parameters to create the needed mix for the multiplex currently in use. 2. Index extension PCR to prepare amplicons for MiSeq (ILLUMINA sequencer). Enter the total number of samples in the box below. Primer Mix Parameters, # of Samples 3. SequelPrep Normalization Plate Kit (ThermoFisher). 4. Agencourt AMPure XP bead cleanup for PCR purification (Beckman Coulter).
Protocol
SOP for Burkholderia UT-AmpSeq PCR and Bead Cleanup
(94) This SOP describes procedures for the following: 1. PCR amplification of multiplexed Burkholderia targets 2. Index extension PCR to prepare amplicons for MiSeq (ILLUMINA sequencer) 3. SequelPrep Normalization Plate Kit (ThermoFisher) 4. Agencourt AMPure XP bead cleanup for PCR purification (Beckman Coulter)
Steps and Procedures 1. Universal-tailed gene-specific primers are pooled together in a primer mix in amounts relative to each other to help reduce PCR bias. These amounts have been previously optimized. Please follow the Primer Mix parameters to create the needed mix for the multiplex currently in use 2. Enter the total number of samples in the box below. Primer Mix Parameters # of Samples 180 ensure that all values in column K How much starting primer conc. to add in mix stock are above 2.0u1 and not highlighted in red 3a. Make the primer mixture by combining the following primers. 3b. Vortex and spin down each primer stock. 3c. Using the Start (uM) concentration primer stock of each primer, add the volume from Amount to add (uL) into a 1.7 mL microcentrifuge tube, unless Total (uL) at bottom of table is above 1200, then split volume evenly across necessary tubes. Vortex to mix and spin. (Refer to Table 8) 4a. This mixture can be stored at 20 C. for future use. To use mixture, let thaw, vortex and spin down. 4b. If using mixture previously made, write down the initials of the person who made it and when: Initials ______ Date ______ 5. Plan and arrange the layout of where your samples will go on a 96-well plate. If you are processing clinical samples make sure to space your samples on the plate accordingly. 6. Use the Plate Maps sheet for convenience and record keeping. (Refer to
(95) TABLE-US-00002 Burkholderia Multiplex uL for single uL addition Reagent reaction in Master Mix Q5 2x HotStart 12.5 2475 Betaine 5M 5 990 IPSC 1000 copies/uL 1 198 Diluted Primer Mix 4.5 891 4554 6c. Add 22 uL of Burkholderia Multiplex Master Mix without IPSC to any NTC reactions you are processing 7a. Thaw out an aliquot of Internal Plasmid Sequencing Control (IPSC) at 10{circumflex over ()}6 copies per uL. Dilute this down to 10{circumflex over ()}3 copies/uL by three serial dilutions of 1 to 10. Make dilutions in tubes for better vortexing & spinning Make this fresh the day of. 7b. Add volume with the # of NTCs subtracted of 10{circumflex over ()}3 copies/uL IPSC to master mix. For example, if you had 3 NTCs that you had aliquoted master mix for, and the above table indicated 9 uL of IPSC be added, you would add 6 instead. 7d. Mix well and spin down 7e. Add 23 uL of Master Mix to each appropriate well on your plate 8a. Gently mix template DNA and spin down (Do not vortex genomic DNA) 8b. Add 2 uL of template DNA to its appropriate well, along with 2 uL H.sub.2O for IPSC, and 3 uL H.sub.2O for NTC 8c. Seal plate with a thermocycler seal 8d. Spin down plate 9. Using a heated lid, put plate on thermocycler and run the following parameters
(96) TABLE-US-00003 Step: Reps: Temp: Time: initial denaturation 1 98 5 min denaturation 35 98 30 sec annealing 68 15 sec extension 72 20 sec final extension 1 72 2 min cooling 1 10 forever 10. During this time, take out AMPure Beads to equilibrate them to Room Temperature for 30 minutes and heat some 10 mM Tris-HCl 0.05% Tween-20 in H.sub.2O to 50 C.
(97) TABLE-US-00004 10 mM Tris-HCl 0.05% Tween-20 in H2O Example Formula 10 mM Tris-HCl 400 uL 0.05% Tween-20 20 uL Molecular Grade H2O 39.580 mL 80% Ethanol in H2O 100% Ethanol 32 mL MBG H2O 8 mL 11. Spin plates (Burkholderia target plate and Bacillus, Yersinia, Francisella target plate) down once the thermocycler finishes 12. Combine 15 uL of Burkholderia target reaction with 15 uL of Bacillus, Yersinia, Francisella target reaction 13. Add beads in a 1:1 ratio with reaction volume to each well (30 uL) and mix well by pipette 14. Incubate the bead/reaction mixture for 5 minutes 15. Place 96-well plate onto a magnetic stand, incubate for another 5 minutes 16. Aspirate supernatant out of wells without disturbing the beads. If beads ARE disturbed, let them incubate for another 2 minutes. Be sure to remove as much liquid as you can 17a. Add 80% EtOH to completely cover beads (200 uL) and incubate for 30 seconds. Aspirate. 17b. Repeat 16a and remove as much liquid as you can (two washes total), following with a 20 uL pipette to ensure full removal 18. Move plate off magnetic stand and allow beads to dry. Be sure to keep a close watch on the beads. If the beads start to crack, the DNA will be harder to elute out. 19. Move plate off the magnetic stand and add 32.5 uL heated 10 mM Tris-HCl 0.05% Tween-20 in H.sub.2O to the wells, mix well 20. Incubate for 2 minutes 21. Move plate to magnetic stand and incubate for 2 minutes 22. Remove 30 uL of supernatant and transfer it to a new well, do not disturb or transfer any beads 22. Burkholderia, Bacillus, Francisella, and Yersinia AmpSeq amplicons require two bead cleanups before Extension PCR. Repeat steps 12-21 23. Store amplicons at 20 C Index Extension PCR 24. Thaw, gently mix, and spin down the following reagents in the following amounts for the Index Extension of the Target Amplicons * Amounts are in respect to number of samples entered in Step 2
(98) TABLE-US-00005 Index Extension Master Mix Reagent uL Lot# 2x Kapa Hifi 2475 Betaine 5M 990 Molecular Grade H2O 693 25. Combine the above volumes together, mix gently, and spin down. 26a. Each reaction will require a unique pair of index primers (UT1 and UT2), prepare a chart of what indexes will be used and where 26b. Thaw, vortex, and spin down the stock 10 uM aliquots of each index that will be used for this run 26c. If some tubes appear empty, create a new 10 uM aliquot of that index. Dilute in TE. 27. Once all indexes are accounted for, add 21 uL of Index Extension Master Mix to each appropriate well in a 96-well plate 28. Add 1 uL of each 10 uM index to its appropriate well 29a. After all UT1 and UT2 indexes have been added to their wells add 2 uL of CLEANED AMPLICONS 29b. The following should now be in each reaction well
(99) TABLE-US-00006 12.5 uL 2x Kapa Hifi 3.5 uL H2O 5 uL 5M Betaine 2 uL DNA 1 uL 10 uM UT1 1 uL 10 uM UT2 25 uL 30. Seal the plate with a thermocycler seal 31. Spin down plate 32a. Using a heated lid, put plate on thermocycler and run the following parameters
(100) TABLE-US-00007 Step: Reps: Temp: Time: initial denaturation 1 98 2 min denaturation 8 98 30 sec annealing 60 20 sec extension 72 30 sec final extension 1 72 2 min cooling 1 10 forever 32b. After the PCR has completed, spin down plate 33a. Samples will be cleaned and normalized using the Invitrogen SequalPrep system 33b. In a new plate, add equal amounts of illext DNA template and SequalPrep Normalization Binding Buffer 33c. Mix completely by pipette mixing several times, take care not to etch the sides of the well with the pipette tip 33d. Incubate the plate for 1 hour at room temperature to allow binding of DNA to the plate surface (longer than 1 hr is acceptable but will not increase binding or final elution concentration, can be overnight) 33e. Aspirate the liquid from the wells 33f. Add 50 uL Sequal Prep Normalization Wash Buffer, mix by pipetting up and down twice 33g. Completely aspirate the buffer, a small amount of residual Wash Buffer (1-3 uL) is typical 33h. Add 20 uL SequalPrep Normalization Elution Buffer to each well of the plate, mix by pipette 33i. Incubate at room temperature for 5 minutes 33j. Transfer samples to a new plate 34a. Samples should all be normalized now so pool them together in equal volumes 34b. The final DNA concentration will be fairly low, so perform an AMPure XP bead cleanup on the pool at a 1:1 ratio of pool to beads (be sure to note total volume of pooled samples) 34c. However, when eluting the DNA off the beads with heated Tris-Tween use 1/10 the initial pool volume used 35. Store DNA at 20 C
SOP for Bacillus, Yersinia, and Francisella UT-AmpSeq PCR and Bead Cleanup
(101) This SOP describes procedures for the following: 1. PCR amplification of multiplexed Bacillus, Yersinia, and Francisella targets 2. Index extension PCR to prepare amplicons for MiSeq (ILLUMINA sequencer) 3. SequelPrep Normalization Plate Kit (ThermoFisher) 4. Agencourt AMPure XP bead cleanup for PCR purification (Beckman Coulter)
Steps and Procedures 1. Universal-tailed gene-specific primers are pooled together in a primer mix in amounts relative to each other to help reduce PCR bias. These amounts have been previously optimized. Please Follow the Primer Mix Parameters to Create the Needed Mix for the Multiplex Currently in use 2. Enter the total number of samples in the box below. Primer Mix Parameters # of Samples 180 ensure that all values in column K How much starting primer conc. to add in mix stock are above 2.0u1 and not highlighted in red 3a. Make the primer mixture by combining the following primers. 3b. Vortex and spin down each primer stock. 3c. Using the Start (uM) concentration primer stock of each primer, add the volume from Amount to add (uL) into a 1.7 mL microcentrifuge tube, unless Total (uL) at bottom of table is above 1200, then split volume evenly across necessary tubes. Vortex to mix and spin. (Refer to Table 10) 4a. This mixture can be stored at 20 C. for future use. To use mixture, let thaw, vortex and spin down. 4b. If using mixture previously made, write down the initials of the person who made it and when: Initials______ Date______ 5. Plan and arrange the layout of where your samples will go on a 96-well plate. If you are processing clinical samples make sure to space your samples on the plate accordingly. 6. Use the Plate Maps sheet for convenience and record keeping. (Refer to
(102) TABLE-US-00008 uL Bacillus, Francisella, addition in Yersinia Multiplex uL for Master Reagent single reaction Mix Q5 2x HotStart 12.5 2475 H2O 5 990 IPSC 1000 copies/uL 1 198 Diluted Primer Mix 4.5 891 4554 6c. Add 22 uL of Burkholderia Multiplex Master Mix without IPSC to any NTC reactions you are processing 7a. Thaw out an aliquot of Internal Plasmid Sequencing Control (IPSC) at 10{circumflex over ()}6 copies per uL. Dilute this down to 10{circumflex over ()}2 copies/uL by three serial dilutions of 1 to 10. Make dilutions in tubes for better vortexing & spinning Make this fresh the day of. 7b. Add volume with the # of NTCs subtracted of 10{circumflex over ()}2 copies/uL IPSC to master mix. For example, if you had 3 NTCs that you had aliquoted master mix for, and the above table indicated 9 uL of IPSC be added, you would add 6 instead. 7d. Mix well and spin down 7e. Add 23 uL of Master Mix to each appropriate well on your plate 8a. Gently mix template DNA and spin down (Do not vortex genomic DNA) 8b. Add 2 uL of template DNA to its appropriate well, along with 2 uL H.sub.2O for IPSC, and 3 uL H.sub.2O for NTC 8c. Seal plate with a thermocycler seal 8d. Spin down plate 9. Using a heated lid, put plate on thermocycler and run the following parameters
(103) TABLE-US-00009 Step: Reps: Temp: Time: initial denaturation 1 98 5 min denaturation 35 98 30 sec annealing 55 15 sec extension 72 20 sec final extension 1 72 2 min cooling 1 10 forever 10. During this time, take out AMPure Beads to equilibrate them to Room Temperature for 30 minutes and heat some 10 mM Tris-HCl 0.05% Tween-20 in H.sub.2O to 50 C
(104) TABLE-US-00010 10 mM Tris-HCl 0.05% Tween-20 in H2O Example Formula 10 mM Tris-HCl 400 uL 0.05% Tween-20 20 uL Molecular Grade H2O 39.580 mL 80% Ethanol in H2O 100% Ethanol 32 mL MBG H2O 8 mL 11. Spin plates (Burkholderia target plate and Bacillus, Yersinia, Francisella target plate) down once the thermocycler finishes 12. Combine 15 uL of Burkholderia target reaction with 15 uL of Bacillus, Yersinia, Francisella target reaction 13. Add beads in a 1:1 ratio with reaction volume to each well (30 uL) and mix well by pipette 14. Incubate the bead/reaction mixture for 5 minutes 15. Place 96-well plate onto a magnetic stand, incubate for another 5 minutes 16. Aspirate supernatant out of wells without disturbing the beads. If beads ARE disturbed, let them incubate for another 2 minutes. Be sure to remove as much liquid as you can 17a. Add 80% EtOH to completely cover beads (200 uL) and incubate for 30 seconds. Aspirate. 17b. Repeat 16a and remove as much liquid as you can (two washes total), following with a 20 uL pipette to ensure full removal 18. Move plate off magnetic stand and allow beads to dry. Be sure to keep a close watch on the beads. If the beads start to crack, the DNA will be harder to elute out. 19. Move plate off the magnetic stand and add 32.5 uL heated 10 mM Tris-HCl 0.05% Tween-20 in H.sub.2O to the wells, mix well 20. Incubate for 2 minutes 21. Move plate to magnetic stand and incubate for 2 minutes 22. Remove 30 uL of supernatant and transfer it to a new well, do not disturb or transfer any beads 22. Burkholderia, Bacillus, Francisella, and Yersinia AmpSeq amplicons require two bead cleanups before Extension PCR. Repeat steps 12-21 23. Store amplicons at 20 C Index Extension PCR 24. Thaw, gently mix, and spin down the following reagents in the following amounts for the Index Extension of the Target Amplicons *Amounts are in respect to number of samples entered in Step 2
(105) TABLE-US-00011 Index Extension Master Mix Reagent uL 2x Kapa Hifi 2475 Betaine 5M 990 Molecular Grade H2O 693 4158 Lot# 25. Combine the above volumes together, mix gently, and spin down. 26a. Each reaction will require a unique pair of index primers (UT1 and UT2), prepare a chart of what indexes will be used and where 26b. Thaw, vortex, and spin down the stock 10 uM aliquots of each index that will be used for this run 26c. If some tubes appear empty, create a new 10 uM aliquot of that index. Dilute in TE. 27. Once all indexes are accounted for, add 21 uL of Index Extension Master Mix to each appropriate well in a 96-well plate 28. Add 1 uL of each 10 uM index to its appropriate well 29a. After all UT1 and UT2 indexes have been added to their wells add 2 uL of CLEANED AMPLICONS 29b. The following should now be in each reaction well
(106) TABLE-US-00012 12.5 uL 2x Kapa Hifi 3.5 uL H2O 5 uL 5M Betaine 2 uL DNA 1 uL 10 uM UT1 1 uL 10 uM UT2 25 uL 30. Seal the plate with a thermocycler seal 31. Spin down plate 32. Using a heated lid, put plate on thermocycler and run the following parameters
(107) TABLE-US-00013 Step: Reps: Temp: Time: initial denaturation 1 98 2 min denaturation 8 98 30 sec annealing 60 20 sec extension 72 30 sec final extension 1 72 2 min cooling 1 10 forever 32b. After the PCR has completed, spin down plate 33a. Samples will be cleaned and normalized using the Invitrogen SequalPrep system 33b. In a new plate, add equal amounts of illext DNA template and SequalPrep Normalization Binding Buffer 33c. Mix completely by pipette mixing several times, take care not to etch the sides of the well with the pipette tip 33d. Incubate the plate for 1 hour at room temperature to allow binding of DNA to the plate surface (longer than 1 hr is acceptable but will not increase binding or final elution concentration, can be overnight) 33e. Aspirate the liquid from the wells 33f. Add 50 uL Sequal Prep Normalization Wash Buffer, mix by pipetting up and down twice 33g. Completely aspirate the buffer, a small amount of residual Wash Buffer (1-3 uL) is typical 33h. Add 20 uL SequalPrep Normalization Elution Buffer to each well of the plate, mix by pipette 33i. Incubate at room temperature for 5 minutes 33j. Transfer samples to a new plate 34a. Samples should all be normalized now so pool them together in equal volumes 34b. The final DNA concentration will be fairly low, so perform an AMPure XP bead cleanup on the pool at a 1:1 ratio of pool to beads (be sure to note total volume of pooled samples) 34c. However, when eluting the DNA off the beads with heated Tris-Tween use 1/10 the initial pool volume used 35. Store DNA at 20 C Burkholderia pseudomallei, Burkholderia mallei, Bacillus anthracis, Yersinia pestis and Francisella tularensis are all Tier 1 select agents, posing a potentially severe threat to public health..sup.1 Current surveillance methods rely upon single locus PCR techniques that allow for only presence/absence of SA results. Has been known to lead to false positives, especially due to the complexity of environmental samples including huge numbers of microorganisms, many of which can be highly similar target pathogens. Constantly working to develop technologies that significantly improve the identification of biological contaminants in varying sample types Both sequencing costs and sequencing time are decreasing..sup.2 Targeted amplicon sequencing can provide the necessary information at a fraction of the cost of WGS. Targeted amplicon sequencing can also provide a more manageable data set for researchers with less background in bioinformatics with an appropriate processing tool.
Summary With the cost of sequencing decreasing and the ability to combine higher and higher numbers of samples on a single run, amplicon sequencing provides a cost effective alternative to individual PCR methods. A screening panel of target organism strains as well as near neighbor strains allowed for differentiation with 100% sensitivity for all target agents and 91-100% specificity.
Future Directions Limit of detection testing across a subset of target organisms in a pristine sample. Limit of detection testing across a subset of target organisms in samples with environmental and human backgrounds. Testing on other sequencing platforms.
REFERENCES
(108) .sup.1 Select Agents and Toxins Regulations. 42 C.F.R. Part 73.3 HHS Select Agents and Toxins .sup.2 Goodwin S, McPherson J D, McCombie W R. Coming of age: ten years of next-generation sequencing technologies. Nat Rev Genet. 2016
(109) TABLE-US-00014 TABLE 1 BTseq Loci Summary B. pseudo- B. mallei/ F. Y anthracis mallei tularensis pestis Target Species Loci PA 9 12* 3 3 NN Species Loci PA 4 0 3 0 NN Species Loci SNP/SV 7 9 7 7 AMR Loci 6 4 0 3 Virulence/Plasmid Loci 4 0 0 2 Total 30 25 13 15 *Five loci amplify both Bp and Bm
(110) TABLE-US-00015 TABLE 2 SNPs for detecting the presence of nucleic acids from Bacillus anthracis. Ba_AmesAnc LocusID 1069024::91 1712462::85 3668548::88 371913::77 388555::108 3981642::97 4001578::113 Reference T C C T A A C Ba_A0098_S45_L001 T C C T A A C Ba_A0330_S46_L001 T C C T A A C Ba_A0490_S47_L001 T C C T A A C Ba_A0605_S48_L001 T C C T A A C Ba_A0615_S49_L001 T C C T A A C Ba_A0706_S50_L001 T C C T A A C Ba_A071_S52_L001 T C C T A A C Ba_A072_S58_L001 T C C T A A C Ba_A073_S59_L001 T C C T A A C Ba_A074_S60_L001 T C C T A A C Ba_A0767_S51_L001 T C C T A A C Ba_A0847_S53_L001 T C C T A A C Ba_A1085_S54_L001 T C C T A A C Ba_A2010_S55_L001 T C C T A A C Ba_A2105_S56_L001 T C C T A A C Ba_A2175_S57_L001 T C C T A A C Ba_NN295171- A X X X X X T grainy_S63_L001 Ba_NN295171- X X X X X X X smooth_S70_L001 Ba_NN295618_S71_L001 X X X X X X X Ba_NNAI-hakem- X X X X X X X grainy_S77_L001 Ba_NNAI-hakem- A X X C G G T smooth_S64_L001 Ba_NNATCC10792_S62_L001 A X X C G G T Ba_NNATCC13402_S76_L001 X X X X X X X Ba_NNATCC31293_S74_L001 X X X X X X T Ba_NNBacillus- X X X X X X X cereus_S69_L001 Ba_NNBacillus- A X X X X X T megaterium_S75_L001 Ba_NNFRI33_S72_L001 X X X X X X X Ba_NNFRI35_S73_L001 A X X X G G T Ba_NNHD- A X T C G G T 1011_S93_L001 Ba_NNHD- A X X C X X T 1012_S94_L001 Ba_NNHD- A X X X X G T 1015_S61_L001 Ba_NNHD- A X X C G G T 288_S81_L001 Ba_NNHD- X X X X X X T 34_S78_L001 Ba_NNHD-44- X X X C X G T grainy_S79_L001 Ba_NNHD-44- X X X X X X X smooth_S66_L001 Ba_NNHD- A X X C G X T 47_S80_L001 Ba_NNHD-526- A X X T X G T grainy_S82_L001 Ba_NNHD-526- A T X C G G T smooth_S67_L001 Ba_NNHD- X X X X X X T 557_S83_L001 Ba_NNHD-571- A X T C G G T grainy_S84_L001 Ba_NNHD-571- A X T C G G T smooth_S65_L001 Ba_NNHD- X X X X X X T 621_S85_L001 Ba_NNHD- A X X X G X T 681_S86_L001 Ba_NNHD- X X X X X X X 682_S87_L001 Ba_NNHD- X X X X X X X 711_S88_L001 Ba_NNHD- A X X X X X T 754_S89_L001 Ba_NNHD- X X X X X X X 789_S90_L001 Ba_NNHD- A X X X G X T 930_S91_L001 Ba_NNHD-974- A X X X G G T grainy_S92_L001 Ba_NNHD-974- A X X X G G T smooth_S68_L001 Ba_NNNTC_Ba_1_S95_L001 X X X X X X X Ba_NNNTC_Ba_2_S96_L001 X X X X X X X F1057_S97_L001 X X X X X X X F1062_S98_L001 X X X X X X X NTC_Ft1_S99_L001 X X X X X X X NTC_Ft2_S100_L001 X X X X X X X NTC_Yp1_55_S104_L001 X X X X X X X NTC_Yp2_55_S105_L001 X X X X X X C NTC_Yp3_60_S109_L001 X X X X X X C NTC_Yp4_60_S110_L001 X X X X X X C NTC_Yp5_65_S114_L001 X X X X X X C NTC_Yp6_65_S115_L001 X X X X X X C Yp1763_55_S101_L001 X X X X X X X Yp1763_60_S106_L00 X X X X X X X Yp1763_65_S111_L001 X X X X X X X Yp2051_55_S102_L001 X X X X X X X Yp2051_60_S107_L001 X X X X X X X Yp2051_65_S112_L001 X X X X X X X Yp2126_55_S103_L001 X X X X X X X Yp2126_60_S108_L001 X X X X X X X Yp2126_65_S113_L001 X X X X X X X Ba_AmesAnc LocusID 4087624::116 4669915::40 734209::105 999035::79 plcR::147 Reference G T T G A Ba_A0098_S45_L001 G T T G A Ba_A0330_S46_L001 G T T G A Ba_A0490_S47_L001 G T T G A Ba_A0605_S48_L001 G T T G A Ba_A0615_S49_L001 G T T G A Ba_A0706_S50_L001 G T T G A Ba_A071_S52_L001 G T T G A Ba_A072_S58_L001 G T T G A Ba_A073_S59_L001 G T T G A Ba_A074_S60_L001 G T T G A Ba_A0767_S51_L001 G T T G A Ba_A0847_S53_L001 G T T G A Ba_A1085_S54_L001 G T T G A Ba_A2010_S55_L001 G T T G A Ba_A2105_S56_L001 G T T G A Ba_A2175_S57_L001 G T T G A Ba_NN295171- X X X A X grainy_S63_L001 Ba_NN295171- X X X X X smooth_S70_L001 Ba_NN295618_S71_L001 X X X X X Ba_NNAI-hakem- X X X X X grainy_S77_L001 Ba_NNAI-hakem- T C C A X smooth_S64_L001 Ba_NNATCC10792_S62_L001 T C C A C Ba_NNATCC13402_S76_L001 X X X X X Ba_NNATCC31293_S74_L001 X X X X X Ba_NNBacillus- X X X X X cereus_S69_L001 Ba_NNBacillus- X X X X X megaterium_S75_L001 Ba_NNFRI33_S72_L001 X X X X X Ba_NNFRI35_S73_L001 T C X A C Ba_NNHD- T C C A C 1011_S93_L001 Ba_NNHD- T C X A C 1012_S94_L001 Ba_NNHD- X C X A X 1015_S61_L001 Ba_NNHD- X C C A X 288_S81_L001 Ba_NNHD- X X X X X 34_S78_L001 Ba_NNHD-44- X C X X C grainy_S79_L001 Ba_NNHD-44- X X X X X smooth_S66_L001 Ba_NNHD- X C X A X 47_S80_L001 Ba_NNHD-526- X C X X A grainy_S82_L001 Ba_NNHD-526- T C X A X smooth_S67_L001 Ba_NNHD- X X X X X 557_S83_L001 Ba_NNHD-571- T C C A C grainy_S84_L001 Ba_NNHD-571- T C C A C smooth_S65_L001 Ba_NNHD- X X X X X 621_S85_L001 Ba_NNHD- X C X A X 681_S86_L001 Ba_NNHD- X X X X X 682_S87_L001 Ba_NNHD- X X X X X 711_S88_L001 Ba_NNHD- X C X A X 754_S89_L001 Ba_NNHD- X X X X X 789_S90_L001 Ba_NNHD- X C X A X 930_S91_L001 Ba_NNHD-974- X C X X X grainy_S92_L001 Ba_NNHD-974- X C X X X smooth_S68_L001 Ba_NNNTC_Ba_1_S95_L001 X X X X X Ba_NNNTC_Ba_2_S96_L001 X X X X X F1057_S97_L001 X X X X X F1062_S98_L001 X X X X X NTC_Ft1_S99_L001 X X X X X NTC_Ft2_S100_L001 X X X X X NTC_Yp1_55_S104_L001 X X X X X NTC_Yp2_55_S105_L001 X X X X A NTC_Yp3_60_S109_L001 X X X X X NTC_Yp4_60_S110_L001 X X X X A NTC_Yp5_65_S114_L001 X X X X X NTC_Yp6_65_S115_L001 X X X X A Yp1763_55_S101_L001 X X X X X Yp1763_60_S106_L00 X X X X X Yp1763_65_S111_L001 X X X X X Yp2051_55_S102_L001 X X X X X Yp2051_60_S107_L001 X X X X X Yp2051_65_S112_L001 X X X X X Yp2126_55_S103_L001 X X X X X Yp2126_60_S108_L001 X X X X X Yp2126_65_S113_L001 X X X X X
(111) TABLE-US-00016 TABLE3 PrimersfordetectingthepresenceofnucleicacidsfromBacillusanthracis. Assay SEQ Assayname Type Targetspecies/gene primername sequence(5->3) IDNO CP008853.1_5309 PA B.anthracis F Ba-specific-3F_UT1 ACGTCAGGTGATTATTGGAC 1 R Ba-specific-3R_UT2 CAACAATTATATCCGCCATT 2 CP008853.1_5316 PA B.anthracis F Ba-specific-5F_UT1 GAAGATGTACGCTCGATAGG 3 R Ba-specific-5R_UT2 GAAATTCTTTTTGCCATCAC 4 CP012725.1_3629 PA B.anthracis F Ba-specific-6F_UT1 CACAATTGAATGAAAATGCT 5 R Ba-specific-6R_UT2 CACGAAACCTGTTTACCTTT 6 CP012725.1_5103 PA B.anthracis F Ba-specific-8F_UT1 GATATTCGACGAGCTTTCTG 7 R Ba-specific-8R_UT2 TATTCATCGTCATCCTCCTC 8 CP012725.1_5107 PA B.anthracis F Ba-specific-9F_UT1 TATTGAACGCATTGAATCAG 9 R Ba-specific-9R_UT2 TATTGGTAAGCAAACCGTCT 10 JSZQ01000034.1_220 PA B.anthracis F Ba-specific-11F_UT1 GGTTCAGGACAAAATGTAGC 11 R Ba-specific-11R_UT2 TAACTTCTGAAGCGAAAACC 12 JSZS01000036.1_5 PA B.anthracis F Ba-specific-12F_UT1 GCGAATTTTAGACGACAATC 13 R Ba-specific-12R_UT2 TAACCGTGCTTAATTCGTTT 14 LGCC01000010.1_232 PA B.anthracis F Ba-specific-14F_UT1 ATTAATAAGGCGACTGGTGA 15 R Ba-specific-14R_UT2 TTACCCATCCAGAATGAGAC 16 LGCC01000048.1_280 PA B.anthracis F Ba-specific-16F_UT1 ACAATTCTTAAAAGGCGACA 17 R Ba-specific-16R_UT2 TGTAGCGTCTCCGATATTTT 18 NN_LOMU01000090.1_49 PA nearneighbor F Ba-specific-20F_UT1 CATGGGGCTTTCTATTATGT 19 species R Ba-specific-20R_UT2 TTCGTTCTTTCATAAGTTTCCT 20 NN_LOQC01000013.1_3 PA nearneighbor F Ba-specific-22F_UT1 TTGGAGTTTGTTTTGCTTTT 21 species R Ba-specific-22Rv2_ GTAACAATTAATCCACGTCCT 22 UT2 ChimpKiller_9-159 PA B.cereusspp. F ChimpKiller_9F TTATCGTCCATTCTTTCGTC 23 anthracis R ChimpKiller_159R AAACCTAATGAAACGGGATT 24 ChimpKiller_91-320 SV B.cereusspp. F ChimpKiller_91F TATGAAAGGAGCCGTAAAAC 25 anthracis R ChimpKiller_320R TGAATATGAAGCGGAAAACT 26 ChimpKiller_481-698 SV B.cereusspp. F ChimpKiller_481F TCGAACATACCTCCATTTCT 27 anthracis R ChimpKiller_698R AAAGATAGCTTTGCACTTGG 28 plcR PA VirulencelocusplcR F Ba-specific-1F_UT1 TTTTTCGTAAGCATCTTCAA 29 R Ba-specific-1R_UT2 TTTGATGTGAAGGTGAGACA 30 pagA PA VirulencelocuspagA F 801F_pagAv3_UT1 GGTTACAGGACGGATTGATA 31 R 1042R_pagAv3_UT2 TCCCACCAATATCAAAGAAC 32 pX01 PA Virulenceplasmid F pX01_113F_UT1 TGAGCCTACCTAGTGATTGG 33 pX01 R pX01-315Rv2_UT2 TTGGATAAATTCCACAAATTCC 34 TC pX02 PA Virulenceplasmid F pX02_101F_UT1 CGCCAGCGTATTATATAGGT 35 pX02 R pX02_269R_UT2 GCTAATTCTGGGTTGTGTTT 36 gyrA SNP DrugresistanceSNP F gyrA_28Fv2_UT1 TCGGTAAGTATCACCCTCA 37 gyrA R gyrA_182Ry2_UT2 TGCTTCTGTATAACGCATT 38 parC SNP DrugresistanceSNP F parC_1F_UT1 CAGTCGGTAACGTTATTGGT 39 parC R parC_197R_UT2 TAACTCAGATGCAATTGGTG 40 gyrB SNP DrugresistanceSNP F gyrB_8F_UT1 ATTGTAGAGGGTGACTCTGC 41 gyrB R gyrB_194R_UT2 TATCAAAATCTCCGCCAAT 42 rpoB SNP DrugresistanceSNP F rpoB_29F_UT1 TTCTTCGGAAGTTCTCAGTT 43 rpoB R rpoB_196R_UT2 CGGACACATACGACCATAG 44 AA_2502 SNP DrugresistanceSNP F AA_2502_UT1 AAGTTTGAGGTGTGGAAATG 45 R AA_2502_UT2 TCGAAATGAGTTCCAATTTT 46 AA_2503 SNP DrugresistanceSNP F AA_2503v2_UT1 CAAAACTAATAGGGGAGGGTG 47 R AA_2503_UT2 CCGAGAACCTACCTCGTTA 48 Ba_AmesAnc_4669915 SV nearneighborspecies F Ba&NN32_F AGGAGATGAGAGTTTTGCAC 49 R Ba&NN32_R ACCCCCATAATTACCATGA 50 Ba_AmesAnc_4001578 SV nearneighborspecies F Ba&NN33_F CGTTGCGTAAGTATGTGCTA 51 R Ba&NN33_R AGGTGGCGTAATTAACGTAG 52 Ba_AmesAnc_1069024 SV nearneighborspecies F Ba&NN37_F CGAAAAGTTGTCGACCTAAT 53 R Ba&NN37_R ACTGCGTTCACGAAGAATAG 54 Ba_AmesAnc_3668548 SV nearneighborspecies F Ba&NN38_F TCTCTTGATTCAACGTTTCC 55 R Ba&NN38_R GATGCAAAACCAATTCACTT 56 Ba_AmesAnc_371913 SV nearneighborspecies F Ba&NN40_F GTGAAACATCGCTTTTTAGG 57 R Ba&NN40_R TCCGCAATGATATACTTCAA 58 Ba_AmesAnc_999035 SV nearneighborspecies F Ba&NN41_F ATACGGTGAAAATGAAGCAG 59 R Ba&NN41_R CGTCTTTGGTAATCGTTCA 60
(112) TABLE-US-00017 TABLE4 PrimersfordetectingthepresenceofnucleicacidsfromBurkholderia. Assay Targetspecies/ sequence SEQID Assayname Type gene primername (5->3) NO: TTS1_BPSS1407 PA TTS1 F BpAmpSeq_1_F TCGTCGTCACCGGGAT 61 GGTC R BpAmpSeq_1_R GGCCTTTGCCCGCATA 62 CTCG LXCC01000141.1_392 PA B.pseudomallei F BpAmpSeq_3_F TCGCAWGAAGTGCGT 63 96_39817 TGCCG R BpAmpSeq_3_R GCCGCTTGCGAAGCGA 64 TGAT LXBY01000087.1_757 PA B.pseudomallei F BpAmpSeq_4_F CGCGCTTGCCCAACTA 65 60_76751 CCAG R BpAmpSeq_4_R GCGCAACGGTGCGAG 66 ACAAT LXCD01000002.1_996 PA B.pseudomallei F BpAmpSeq_5_F AATCCATGCATGTCGY 67 52_100245 GCCC R BpAmpSeq_5_R GCGATCGCTCAACGGG 68 CTTC LXCE01000123.1_342 PA B.pseudomallei F BpAmpSeq_6_F TCGCATTTGCAYACGC 69 20_34747 TCCC R BpAmpSeq_6_R AGTGCGCAAACTTGGC 70 GAGG BpCEN586498 PA pseudomallei F BpCEN586498_F102 CACCGAAAGATTTCAG 71 TTCCGCCTCATTCA R BpCEN586498_R388 GGCCGTCGATGGTTTC 72 GTCGGTTTTC BpCEN617822 PA pseudomallei F BpCEN617822_F43 TGCATTGAGCACGGCA 73 CGCAGATTC R BpCEN617822_R260 GAAAAATTTATCGGAT 74 CGAGCACCATGGTTTG BpCEN972235 PA pseudomallei F BpCEN972235_F107 ATACGCGGCGCGGCTC 75 ATTTCG R BpCEN972235_R305 GCGTCGCGCTCGTCGA 76 TACGGTCA BpCEN70178 PA pseudomallei F BpCEN70178-2F TGCGCAGCGAGTGGTT 77 CAGGTTGTC R BpCEN70178-182R CGACGATACGGATAC 78 GGCACGGAAGC BpCEN508364 PA pseudomallei F UT1-BpCEN508364_F37 CCGCGCCGGCCGCAG 79 ACC R UT2-BpCEN508364_R184 CGGGCGTGCCGGACTC 80 CTCGTC LWWC01000187.1_18 PA B.pseudomallei F BpAmpSeq_8_F CCTTTGCGGCAAGCGT 81 mallei CGAA R BpAmpSeq_8_R GAGCCAACGCACATG 82 GACGG LWWB01000125.1_17 PA B.pseudomallei F BpAmpSeq_10_F CCAGTCGGGCCGGGA 83 183_17602 mallei AAAAC R BpAmpSeq_10_R GGCGGCAAAAGCGTC 84 GATGA LXAY01000367.1_0_6 PA B.pseudomallei F BpAmpSeq_11_F GCCGGAACCGTCGAG 85 40 mallei R BpAmpSeq_11_R CATTG TGGATTCGACTGCCTC 86 CGCT LWVY01000190.1_17 PA B.pseudomallei F BpAmpSeq_12_F TCGATATCCGCCGTCT 87 226_17689 mallei CGCC R BpAmpSeq_1_R ATGTGTCGGTGGGCTT 88 CGGT LXAD01000059.1_247 PA B.pseudomallei F BpAmpSeq_13_F GAAAGGCGATGTGCC 89 60_25075 mallei GAGCG R BpAmpSeq_13_R TTCGGAGAAGCGCCA 90 AACGC BpmCEN322640 PA pseudomallei/mallei F BpCEN322640_F2 CGCGGACAGCATCGAT 91 TACGTGAATC R BpCEN32264_R2 CCGCCGAATCCGATGC 92 TCAATTTC BpmCEN1761486 PA pseudomallei/mallei F BpmCEN1761486_F1 GACCTGCAGCAGGTAT 93 TCGACATTATCGTTC R BpCEN1761486_R1 AGCTTCGCATACAGCA 94 CTTCCGCCAG BpmCEN1235988 PA pseudomallei/mallei F BpmCEN1235988_F1 GCGCTGCCCGTTTCAC 95 CACTGG R BpmCEN1235988_R1 CGTGACGCCGTCGGGA 96 AAGATCATC BpmCEN1565214 PA pseudomallei/mallei F BpmCEN1565214_F1 CTGACCGAACGATGGC 97 TGGAGATACATGC R BpmCEN1565214_R1 CAAATGGGAAGCGAG 98 CTCCCTTCCGA BpmCEN276339-1 PA pseudomallei/mallei F BpmCEN276339-1_F1 CGGACGCCTGTCGCCC 99 GAAACCTAT R BpmCEN276339-1_R1 CGCGAGCACGCCGAG 100 CGACAT BpmCEN276339-2 PA pseudomallei/mallei F BpmCEN276339-2_F1 CGTCGACGCCCCGGGC 101 TTTCTG R BpmCEN276339-2_R1 CGCCGCGCACCGGTTT 102 CAATC BpmCEN894337 PA pseudomallei/mallei F BpmCEN894337_F_1 CGAAAATAATTTTCGG 103 CCGGCGCAC R BpmCEN894337_R1 CGACAGGCATCGGGC 104 GACTACTACCAG BpmCEN1722622 PA pseudomallei/mallei F UT2-Bpm_CEN1722622-f1 CAACGGGCGAGTTTGC 105 AACGGAATC R UT1-Bpm_CEN1722622-1-1 GCCGGCTTGGCTTCGT 106 CCTTGTC BpmCEN357268 PA pseudomallei/mallei F UT1-Bpm_CEN357268-fl CGGCATGCGCGGCCG 107 AATC R UT2-Bpm_CEN357268-r1 ATCGCGCCCTGCAGCG 108 AGCAC NC_006350_2289827 SV B.pseudomallei F BpAmpSeq_16_F GCCAGCGCATCCACCA 109 complexSNP ACAT R BpAmpSeq_16_R AGAGGAAGAAGGGCG 110 AGGCG NC_006350_133027 SV B.cepaciacomplex F BpAmpSeq_18_F CGCGCARYTCGTCGTC 111 SNPs CTCG R BpAmpSeq_18_R CGAACCTSGTGCMGGT 112 RCAG NC_006350_2248145- SV B.pseudomallei F BpAmpSeq_19_F CACGTTGCCSGGRAAR 113 2248193 complexSNP TACG R BpAmpSeq_19_R CCGTCGACAAGATCGC 114 GCTS NC_006350_988041- SV B.pseudomallei F BpAmpSeq_20_F CAGAACGCGCTRTYCC 115 988089 complexSNP ACG R BpAmpSeq_20_R TGCCGCGTGATCCATT 116 GCAT Bm_11589 PA B.mallei F BpAmpSeq_21_F AGGGGGTGGTTTCCTG 117 AGTGGCGTGAC R BpAmpSeq_21_R AGCGGTGTCGACGGGT 118 GGAAAGGATG Bm_11767 PA B.mallei F BpAmpSeq_22_F ACGGGCGCTTCACGAT 119 CTCGGTGTTC R BpAmpSeq_22_R GCGCGGCAGTTCGATC 120 AGGCATTTG Bm_11589 PA B.mallei F Bm-11589-f1_UT1 GACGGCGGGCTTTGGG 121 GAGTCC R Bm-11589-r1_UT2 GCTCGCGGGCAGCGGT 122 GTCG Bm_11767 PA B.mallei F Bm-11767-f1_UT1 GACGGCCCCGGGCGG 123 CTTTAC R Bin-11767-r1_UT2 CGCGGCAGTTCGATCA 124 GGCATTTGAG Bm_11767 PA B.mallei F Bm-11767-f1_UT1 GACGGCCCCGGGCGG 125 CTTTAC R Bm-11767-r2_UT2 CGAGGGGCGAAATTC 126 CCCTTATAGATCAGTT G K9penA378-529 SNP penA F BpAmpSeq_26_F CGGTCGCCACAAATTC 127 GCACGCACTC R BpAmpSeq_26_R AGCGAGCGGCGCAAC 128 GGAGAATGATT K9penA575-761 SNP penA F BpAmpSeq_27_F GCTGCGCGGCCAAGC 129 GAAAAACG R BpAmpSeq_27_R CGCGAGGACCGCAGC 130 GCAAAGC K9penA949-1172 SNP penA F BpAmpSeq_28_F GGCCGCAGACCGTCAC 131 CGCGTATG R BpAmpSeq_28_R GTCGCCCGTCTTGTTG 132 CCGAGCATC penA_-78promoter SNP penA F K9penA281fUT1 GCCCGTCAATCCGATG 133 CMGTATCTGG R K9penA565rUT2 GCGCCGATCARTGGGG 134 TGGAAATG penA_C69Y_S72F SNP penA F K9penA696fUT1 CATCGCGGCGACGAG 135 CGTTTCC R K9penA848rUT2 CTCGGTGATCGGCGAA 136 TAGCGGATGAGA penA_P167S SNP penA F K9penA881fUT1 GCTGTGCGCGGCGACG 137 CTTCAGTA R K9penA1258rUT2 CCGATGTCGTTCGCCG 138 TTCCGTAGTC PBP3-170f-505r PA penA F PBP3-170f3UT1 ATCCGCCGTCCCGCCC 139 AGCAATAG R PBP3-505r3UT2 GGGTTCGCCCAGATTT 140 CGTAGGTGGTGAG pbp3-1 PA pbp3 F K9pbp336fUT1 TCGCCGTTTCACGCCC 141 CGCAAC R K9PBP3331rUT2 GCGCCGAACGCGAGG 142 AACACGA pbp3-2 PA pbp3 F K9pbp31292fUT1 GCTCGCGAAGCTCGCG 143 CTGAACC R K9PBP31527rUT2 GGATCGTGCCGTCGCC 144 CGCATAC V15G_R20 SV folMpteredine F 1026pter371fU ACAAGCCCGGYGTCGTCG 145 reductase AGATGGTGAC R 1026pter636rUT2 CGCGTCGGCCGAAYG 146 GTCGTAGT bpeTHTH SV bpeTHTHregion F bpeT_-76fUT1 AATCGTCGGCTGCGTC 147 GCCTTCA R bpeT_596rUT2 CGGGTAGCGTGAGTG 148 GAATTCGCAGAG bpeTsubstrate SV bpeTsubstrate F bpeT_695fUT1 CCTCGAAGGCTTCGGG 149 binding bindingregion CTGATCCAG R bpeT_1014rUT2 GACTAACCGCTTACGC 150 CACCCACTCGTTC bpeSHTH SV bpeSHTHregion F bpeS_-83fUT1 AAAGCGAATAGTCGC 151 GAAGCGGCTTGA R bpeS_230rUT2 GCGATCTCGGTGATGA 152 TCTTGATGCAGTG bpeSsubstrate SV bpeSsubstrate F bpeS_648fUT1 AACGGCGGCGTGACC 153 binding bindingregion GTCAACG R bpeS_977rUT2 CGCTACGCGGCCACCT 154 GCCC bimA PA bimA F Bpvir_bimA_407F CGGAGCTTCAGAACA 155 ACCCGCGTGTAAC R Bpvir_bimA_654R CCTTCGGACCTTTTCC 156 CGCAACTGGC cheD PA cheD F Bpvir_cheD_29F AATTCGGCCGGCAGGC 157 GGTACG R Bpvir_cheD_297R CGCGCGCAGCCGGCAT 158 TTG fhaB1long PA fhaB1long F Bpvir_fhaB1long_8410F CCCTTCGGTCCCCACC 159 AGAAAAATTCG R Bpvir_fhaB1long_8599R AGCCGTACAGGCCAAT 160 GCAGCCATCTATG fhaB1short PA fhaB1short F Bpvir_fhaB1short_63F GCGCCGCGTGTTCGTG 161 ACCTTGTC R Bpvir_fhaBlshort_316R CGCTGATCGGCGCATC 162 GGACAC fhaB2 PA fhaB2 F Bpvir_fhaB2_1812F ATCGTGATATCGCCGG 163 TTCCTGGTTGTG R Bpvir_fhaB2_2100R CACGTTTGGCGGCAGT 164 GCAAGGTGTAG fhaB3 PA fhaB3 F Bpvir_fhaB3_3966F TCTGCTGATCGGCCTT 165 CGCCAGATAYAC R Bpvir_fhaB3_4324R GCGGATGAACAATTTC 166 CTGTCGAGCGACTATT AC LPSA PA LPSA F Bpvir_LPSA_1087F GCAGGGCGCCTTGATA 167 TCCGCTATGAG R Bpvir_LPSA_1407R CGGCGCAAGGTTCTCC 168 TGCCACATC LPSb1 PA LPSb1 F Bpvir_LP_Sb1_65F GTGTGATCGACKGCGT 169 CCTCCCTGAG R Bpvir_LPSb1_256R CAAGCCGCTGATACCC 170 GTGTCGCTG LPSb2 PA LPSb2 F Bpvir_LPSb2_88F GCGCTTCTCGGTGGGT 171 ACGAAAAACAGC R Bpvir_LPSb2_400R CGAGTCGGCCAAGATC 172 ATTCAGGACCAG wcbj PA wcbj F Bpvir_wcbj_252F CACCTTGACACTGATC 173 CGCGGCGTAG R Bpvir_wcbj_508R CTTCCTTCGCACAACC 174 GAGCAAATACTGAGT AAATC ylf PA ylf F Bpvir_ylf_865F GATCTTGCGACCGATG 175 CTCAGCGTGTG R Bpvir_ylf_1153R TGGCGCGGGCCAAGG 176 ATATCAGTTC thai_small_15666 PA thailandensis(small F thai_small_15666_3F_UT1 GCCTTACGCCTTCGGG 177 clade) ATCG R thai_small_15666_342R_UT2 GAATGCGCTCACCCGA 178 TGCT thai_small_28301 PA thailandensis(small F thai_small_28301_11F_UT1 AGCAAGCCATCCGCGT 179 clade) CATC R thai_small_28301_297R_UT2 CAGGATGCCACCGTTG 180 GTGA thai_large_48054 PA thailandensis(large F thai_large_48054_286F GCCACAGGCATGGTG 181 clade) AGCAA R thai_large_48054_534R CGGCATTCCCTCAATC 182 ACGAA thai_all_110625 PA thailandensis F thai_all_110625_212F CTGCGTCCCAAACCGA 183 CGA R thai_all_110625_512R CCGTCGATGCCACGAA 184 TGAA humpty_7099 PA humptydooensis F humpty_7099_510F CCCCAAAAATCCCGCT 185 CTGG R humpty_7099_762R CGGCACAAAGCCGGT 186 GAAAG humpty_45647 PA humptydooensis F HUMPTY_45647_173F_UT1 TGCCGTTCAGTTGGGC 187 CTTT R HUMPTY_45647_390R_UT2 TGCCGCTTCCAACTGC 188 TTCA humpty_7093 PA humptydooensis F HUMPTY_7093_48F_UT1 GGGCGGGCCAATCTTT 189 TCTG R HUMPTY_7093_381R_UT2 TCCGCGATGTGACCAA 190 ACGA humpty_38764 PA humptydooensis F humpty_38764_44F TCGGAGATTCCGACGG 191 ACCA R humpty_38764_390R CCGCATATCGCCCTGA 192 CACA okla_24632 PA oklahomensis F OK_24632_724F_UT1 GGCACCGACGTGCAA 193 AAAGC R OK_24632_996R_UT2 GGCCGATCTCGGCACT 194 ACGA okla_5812 PA oklahomensis F okla_5812_382F GCGGGGTACGGGCTA 195 ACCAA R okla_5812_700R TCCGTACGCTCGCCAC 196 AACA okla_3784 PA oklahomensis F okla_3784_454F GCAAAGGCGCCAGGA 197 AACAA R okla_3784_742R ACCGCCCCGATTGACC 198 AAGT okla_like_18345 PA oklahomensis-like F OK_like_18345_56F_UT1 TCCAGGCGGTTCTCCG 199 ATTG R OK_like_18345_372R_UT2 GTTGCCGATGTCGAGG 200 CACA okla_like_18342 PA oklahomensis-like F OK_like_18342_361F_UT1 TCTTCGGCGAGCGTCT 201 ACGG R OK_like_18342_685R_UT2 CGCGTCGGACGAGTGT 202 CGTA MSMB175_14005 PA MSMB175group F MSMB175_14005_422F GGCTCACACGGCTGGG 203 TCAT R MSMB175_14005_746R ACGGCGTTTTGGACCA 204 CGAG MSMB175_1868 PA MSMB175group F MSMB175_1868_197F_UT1 CCGCCTACTGGTGGCA 205 GGTG R MSMB175_1868_480R_UT2 GCCAGTCCCGGGAAG 206 GAGTG MSMB175_8900 PA MSMB175group F MSMB175_8900_29F_UT1 GCTCATCCTGCCAGGC 207 CAGT R MSMB175_8900_345R_UT2 GATACCCACCGCCGGA 208 ACCT MSMB175_9798 PA MSMB175group F MSMB175_9798_517F_UT1 AGCGGCGGATTATGG 209 GCACT R MSMB175_9798_782R_UT2 ACGCTGGGGCTGTTTT 210 GCAG MSMB264_34074 PA MSMB264group F MSMB264_34074_554F CGCCCTTCGAGCTTGC 211 TTCC R MSMB264_34074_778R CCGCAACAGGTGGCTT 212 CTGAC MSMB264_4163 PA MSMB264group F MSMB264_4163_252F CGTTGCCCCCGCCCAC 213 GTAG R MSMB264_4163_596R CCGTGTGGCGCGTCCT 214 CCAT vietnam_61292 PA vietnamiensis F vietnam_61292_183F TGGGCTCATCCTCGCA 215 AAGC R vietnam_61292_527R ACGCGCTCGGTGGAA 216 AACAG vietnam_98057 PA vietnamiensis F vietnam_98057_111F TCACACCATGGGCTCC 217 GAGA R vietnam_98057_460R CGGGCGGGTAGACGA 218 GTTCC vietnam_226017 PA vietnamiensis F vietnam_226017_33F_UT1 ACCACGAGTGTGTGCG 219 GCATT R vietnam_226017_285R_UT2 GCGCTCGATGGTTCCC 220 GAAG ubon_small_102920 PA ubonensis(small F ubon_small_102920_511F CTTGCCTTCCAGGCGC 221 clade) ACAT R ubon_small_102920_802R TGCCAAGCGGAAGCTC 222 CTTG ubon_small_111449 PA ubonensis(small F ubon_small_111449_167F_UT GCCGTGTCCGCATGAT 223 clade) 1 CCTC R ubon_small_111449_431R_U CGCTCCAGTGCGTTGT 224 T2 CGAG ubon_large_1438777 PA ubonensis(large F ubon_large_41F_1438777_BH CACTGTTCGCATCGGT 225 clade) _RP ATTC R ubon_large_240R_1438777_B CTYGCCGTGTCCGTCA 226 H_RP CGACAAG ubon_all_1328624 PA ubonensis F ubon_all_1328624_220F GGCGCCTTCTGGTGGT 227 CCTT R ubon_all_1328624_563R TGGCTTTGCGACCAGT 228 CGTG cepacia_1208120 PA cepacia-complex F cepacia_1208120_1F ATGGCAARGATTCTKG 229 TRG R cepacia_1208120_311R TTCACGATCCAGCCCT 230 T
(113) TABLE-US-00018 TABLE5 PrimersfordetectingthepresenceofnucleicacidsfromYersinia. SEQ Assay Targetspecies/ ID Assayname Type gene primername sequence(5->3) NO: Ypestis_ PA Y.pestis F Yp&NN1_F AACAAGCTAAAACCGAACAA 231 LPQY01000176.1_7 R Yp&NN1_R ATAGCCTCAACTGCTTTTTG 232 AGJT01000065.1_0_338 PA Y.pestis F Yp&NN11_F CAGTACCGACAAAACTTC 233 R Yp&NN11_R TTTACTACTCTGAAAACGAG 234 FAUR01000053.1_96407_ PA Y.pestis F Yp&NN12_F GCACTACAAATTTAAATCCC 235 96884 R Yp&NN12_R GTCGATTATCAACCTCTATG 236 Wagner_Yp_pla_Forward PA Y.pestis F Yp&NN2_F GAAAGGAGTGCGGGTAATAGG 237 TT R Yp&NN2_R GGCCTGCAAGTCCAATATATGG 238 YpPGM_8-158 PA Virulencelocus F YpPGM_8F TTAATATCCCGGCACTCATA 239 PGM R YpPGM_158R TCCTTAACTGAATAAGTGCTCA 240 YpPGM_31-205 PA Virulencelocus F YpPGM_31Fv2 TTTAATGAACGGTGCCTAG 241 PGM R YpPGM_205Rv2 GTCTGCGTTTCTCCAGTAT 242 Yp-p1202_42780-43194 PA DrugResistance F Yp-p1202_ TCTGGCCTGCTAAATAAAAACG 243 plasmidp1P1202 42780F-UT1 AACC R Yp-p1202_ CAGGCCTCAGCATTTTATTATG 244 43194R-UT2 GTGAT Yp-p1202_126386-126750 PA DrugResistance F Yp-p1202_ GGGGCGGATACCTTCACCTATG 245 plasmidp1P1202 126386F-UT1 R Yp-p1202_ CTGGGGTTCAGTCTGGACGAGA 246 126750R-UT2 T Yp-p1202_156402-156711 PA DrugResistance F Yp-p1202_ ACCATCCGGCGCTAAATCGTC 247 plasmidp1P1202 156402F2-UT1 R Yp-p1202_ GAAATGCGCCTGGTAAGCAGA 248 156711R-UT2 GT YpCO92_NC_003143_113190 SV nearneighbor F Yp&NN4_F ACTCGGGATACTCCATACTG 249 species R Yp&NN4_R CGAAAGCAGTGGTCAATC 250 YpCO92_NC_003143_161621 SV nearneighbor F Yp&NN5_F CATGCGCTTTACGTTATATG 251 species R Yp&NN5_R GCGTTCTGCACTCTGTCT 252 YpCO92_NC_003143_152213 SV nearneighbor F Yp&NN6_F AGCGACTTCCGTGATAAAG 253 species R Yp&NN6_R ACTCAGGATACCGTGTGGT 254 YpCO92_NC_003143_129539 SV nearneighbor F Yp&NN7_F TTCACGATAATCCCCTAATG 255 species R Yp&NN7_R TTCTGTGCTCTGGCTGATA 256 YpCO92_NC_003143_91203 SV nearneighbor F Yp&NN8_F ATTATCTGTGCCCCTTCTTT 257 species R Yp&NN8_R GGAGTGGATGCCACTAAAC 258 YpCO92_NC_003143_121812 SV nearneighbor F Yp&NN9_F CCTCACACAACAATTCACTG 259 species R Yp&NN9_R TTTTTCCGACAAATTTAAGG 260 Yp_AL590842.1_RX_SNP SV nearneighbor F Yp&NN10_F AGCATGAAGGTTGCTAAAAG 261 species R Yp&NN10_R GGTGACTTCAAAACCGTTAG 262 Yentero_FR729477.2_1623 PA Y. F Yp&NN3_F GATGCTTCTGCTATCAGSTT 263 enterocoliticus R Yp&NN3_R GTGTGRCTTTGAASTCTTGT 264
(114) TABLE-US-00019 TABLE6 Primersfordetectingthepresenceofnucleic acidsfromFrancisella. Target SEQ Assay species/ primer sequence ID Assayname Type gene name (5->3) NO: Ftularensis_ PA F. F Ft& GAAGTGGCTC 265 CP000915.1_ tularensis NN2_F ATGTTAGAGG 1782 R Ft& AGCGAGCCTA 266 NN2_R TATGTAACCA Ftularensis_ PA F. F Ft& TTTAATGTCC 267 CP000915.1_ tularensis NN3_F GTCAACCTCT 731 R Ft& ACGAGTTTGT 268 NN3_R GAGTCGCTAT Ft_dup_ PA F. F Ft& TGTTACGTAC 269 CP000915.1_ tularensis NN8_F AGGCTGTCAA 197 R Ft& ATCATATCCC 270 NN8_R GTAGCACAAG FtA1 SNP FtA1Clade F 9F_ CATAACCCAT 271 FtA1_ CGCAATATCT UT1 R 246R_ AAATTATCTG 272 FtA1_ TAGCGGCAAA UT2 FtA2 SNP FtA2Clade F 34F_ GTGTCCAACG 273 FtA2_ AAACCATAAT UT1 R 169R_ TTTGGTTGAT 274 FtA2_ TCTGTCAGTG UT2 FtB SNP FtBClade F 28F_ AAGCTTAACT 275 FtB_ GGTGATTGGA UT1 R 173R_ CGCCTAACAT 276 FtB_ CTTATCTGCT UT2 FtA SNP FtAClade F 14F_ GGGTGATGCA 277 FtA_ GTAGAGAAAA UT1 R 207R_ TACCAGATGA 278 FtA_ ACGAATAGCC UT2 FtLVS_ SV near F Ft& ATCAAGCTCA 279 AM233362_ neighbor NN9_F TCTTCAAAGC 1646546 species R Ft& AACCATGTTC 280 NN9_R AGATCCAAAA FtLVS_ SV near F Ft& TACCTCTGCC 281 AM233362_ neighbor NN10_F AAAAATTCAT 1643765 species R Ft& GGCATACTCA 282 NN10_R AGGTAGTGGT FtLVS_ SV near F Ft& TCTTTGGTAG 283 AM233362_ neighbor NN11_F CTTGCTGACT 1562618 species R Ft& CAGACGACAC 284 NN11_R TTGGCTTATT Ftnovicida_ PA F. F Ft& GGTAGGATAA 285 CP009607.1 tularensis NN1_F CTACCAAG spp. R Ft& GTCATGAGTT 286 Novicida NN1_R TTACCAATAC TC Fphilom_ PA F. F Ft& CTTATGCAGC 287 CP009444.1_ philomiragia NN6_F AAGAGGAACT 569 R Ft& ATACACCGGG 288 NN6_R ATAGGTTTCT Fphilom_ PA F. F Ft& CTGATGGAAG 289 CP009444.1_ philomiragia NN7_F AGAGTTCGAG 285 R Ft& GTAGATATAA 290 NN7_ TCAGCGCCAC Rv2 Fnoatunensis_ PA F. F Ft& CGGTAAGAAT 291 CP003402.1_ noatunensis NN4_F ACGACCAGAG 1749 R Ft& AGAGGATTTC 292 NN4_R TTCCTCCTTG Fnoatunensis_ PA F. F Ft& AATTCTACAA 293 CP003402.1_ noatunensis NN5_F GCACCTGGAA 424 R Ft& TCCTATTAAA 294 NN5_R AGCGCCATAG
(115) TABLE-US-00020 TABLE7 PrimersforSequenceControl. For- Re- Target ward Forward SEQ verse Reverse SEQ Assay species/ primer sequence ID primer sequence ID name gene name (5->3) NO name 5->3) NO IPSC- se- UT1- GGGCGGAC 295 UT2- GCCGGGAT 298 1 quencing IPSC- GAAAACCC IPSC- GCCTTACC control f1 TTGAGCAC r1 TAGACGCA AG ATGA IPSC- se- UT1- GCTCGGGC 296 UT2- GCCGGGAT 299 1 quencing IPSC- GGACGAAA IPSC- GCCTTACC control f1v2 ACCCTTGA r1 TAGACGCA ATGA IPSC- se- UT1- GCGGCAGC 297 UT2- CGAGTTCC 300 2 quencing IPSC- CGTTGAGG IPSC- GTCCGGTT control f2 CAAAAGTG r2 AAGCGTGA ATAC CAGTC Forward sequence w/UT: ACCCAACTGAATGGAGC (SEQ ID NO: 301) at 5of the forward sequence, e.g., UT1-IPSC-f1: ACCCAACTGAATGGAGCGGGCGGACGAAAACCCTTGAGCACAG (SEQ ID NO: 302) Reverse sequence w/UT: ACGCACTTGACTTGTCTTC (SEQ ID NO: 303) at 5of the reverse sequence, e.g., UT2-IPSC-r1: ACGCACTTGACTTGTCTTCGCCGGGATGCCTTACCTAGACGCAATGA (SEQ ID NO: 304)
(116) TABLE-US-00021 TABLE 8 Preparation of Primer Mixture for detecting the presence of nucleic acids from Burkholderia. uM in mix Volume starting Desired stock needed primer Recalculated final (final in Mix conc. to final conc. of Start uM uM stock add in mix primer in Assay name Primer Target (uM) in rxn. 5.56) (uL) stock a single rxn. TTS1_BPSS1407 BpAmpSeq_1_F TTS1 100 0.10 0.56 0.03 5.0 0.10 TTS1_BPSS1407 BpAmpSeq_1_R TTS1 100 0.10 0.56 0.03 5.0 0.10 LXCC01000141.1_39296_39817 BpAmpSeq_3_F pseudomallei 100 0.20 1.11 0.05 9.9 0.20 LXCC01000141.1_39296_39817 BpAmpSeq_3_R pseudomallei 100 0.20 1.11 0.05 9.9 0.20 LXBY01000087.1_75760_76751 BpAmpSeq_4_F pseudomallei 100 0.20 1.11 0.05 9.9 0.20 LXBY01000087.1_75760_76751 BpAmpSeq_4_R pseudomallei 100 0.20 1.11 0.05 9.9 0.20 LXCD01000002.1_99652_100245 BpAmpSeq_5_F pseudomallei 100 0.40 2.22 0.10 19.8 0.40 LXCD01000002.1_99652_100245 BpAmpSeq_5_R pseudomallei 100 0.40 2.22 0.10 19.8 0.40 LXCE01000123.1_34220_34747 BpAmpSeq_6_F pseudomallei 100 0.40 2.22 0.10 19.8 0.40 LXCE01000123.1_34220_34747 BpAmpSeq_6_R pseudomallei 100 0.40 2.22 0.10 19.8 0.40 LWWC01000187.1_18 BpAmpSeq_8_F pseudomallei mallei 100 0.30 1.67 0.08 14.9 0.30 LWWC01000187.1_18 BpAmpSeq_8_R pseudomallei mallei 100 0.30 1.67 0.08 14.9 0.30 LWWB01000125.1_17183_17602 BpAmpSeq_10_F pseudomallei mallei 100 0.20 1.11 0.05 9.9 0.20 LWWB01000125.1_17183_17602 BpAmpSeq_10_R pseudomallei mallei 100 0.20 1.11 0.05 9.9 0.20 LXAY1000367.1_0_640 BpAmpSeq_11_F pseudomallei mallei 100 0.10 0.56 0.03 5.0 0.10 LXAY01000367.1_0_640 BpAmpSeq_11_R pseudomallei mallei 100 0.10 0.56 0.03 5.0 0.10 LWVY01000190.1_17226_17689 BpAmpSeq_12_F pseudomallei mallei 100 0.40 2.22 0.10 19.8 0.40 LWVY01000190.1_17226_17689 BpAmpSeq_12_R pseudomallei mallei 100 0.40 2.22 0.10 19.8 0.40 LXAD01000059.1_24760_25075 BpAmpSeq_13_F pseudomallei mallei 100 0.30 1.67 0.08 14.9 0.30 LXAD01000059.1_24760_25075 BpAmpSeq_13_R pseudomallei mallei 100 0.30 1.67 0.08 14.9 0.30 NC_006350_2289827 BpAmpSeq_16_F pseudomallei complex 100 0.40 2.22 0.10 19.8 0.40 SNP NC_006350_2289827 BpAmpSeq_16_R pseudomallei complex 100 0.40 2.22 0.10 19.8 0.40 SNP NC_006350_133027 BpAmpSeq_18_F cepacia complex 100 0.20 1.11 0.05 9.9 0.20 SNPs NC_006350_133027 BpAmpSeq_18_R cepacia complex 100 0.20 1.11 0.05 9.9 0.20 SNPs NC_006350_2248145-2248193 BpAmpSeq_19_F Bpc MSS 100 0.40 2.22 0.10 19.8 0.40 NC_006350_2248145-2248193 BpAmpSeq_19_R Bpc MSS 100 0.40 2.22 0.10 19.8 0.40 NC_006350_988041-988089 BpAmpSeq_20_F Bpc MSS 100 0.20 1.11 0.05 9.9 0.20 NC_006350_988041-988089 BpAmpSeq_20_R Bpc MSS 100 0.20 1.11 0.05 9.9 0.20 Bm_11589 BpAmpSeq_21_F mallei 100 0.40 2.22 0.10 19.8 0.40 Bm_11589 BpAmpSeq_21_R mallei 100 0.40 2.22 0.10 19.8 0.40 Bm_11767 BpAmpSeq_22_F mallei 100 0.40 2.22 0.10 19.8 0.40 Bm_11767 BpAmpSeq_22_R mallei 100 0.40 2.22 0.10 19.8 0.40 PBP3-170-505 BpAmpSeq_24_F pbp3 100 0.20 1.11 0.05 9.9 0.20 PBP3-170-505 BpAmpSeq_24_R pbp3 100 0.20 1.11 0.05 9.9 0.20 K9penA378-529 BpAmpSeq_26_F penA 100 0.10 0.56 0.03 5.0 0.10 K9penA378-529 BpAmpSeq_26_R penA 100 0.10 0.56 0.03 5.0 0.10 K9penA575-761 BpAmpSeq_27_F penA 100 0.10 0.56 0.03 5.0 0.10 K9penA575-761 BpAmpSeq_27_R penA 100 0.10 0.56 0.03 5.0 0.10 K9penA949-1172 BpAmpSeq_28_F penA 100 0.10 0.56 0.03 5.0 0.10 K9penA949-1172 BpAmpSeq_28_R penA 100 0.10 0.56 0.03 5.0 0.10 IPSC IPSC-f1v2 IPSC 20 0.05 0.28 0.06 12.4 0.05 IPSC IPSC-r1 IPSC 20 0.05 0.28 0.06 12.4 0.05 Volume of primer mix in a single rxn: 4.5 uL. Desired volume of primer mix stock: 891 uL.
(117) TABLE-US-00022 TABLE 10 Preparation of Primer Mixture for detecting the presence of nucleic acids from SOP for Bacillus, Yersinia, and Francisella UT-AmpSeq PCR and Bead Cleanup Volume uM in Desired Re- of primer mix Volume volume of How much calculated mix in Desired stock needed Primer starting final conc. a single final (final in Mix mix primer conc. Of primer Start rxn uM in uM stock stock to add in mix in a single Primer name Assay name (uM) (uL) rxn. 5.56) (uL) (uL) stock rxn. Ba-specific-1F_UT1 plcR 100 4.5 0.1 0.56 0.03 891 5 0 Ba-specific-1R_UT2 plcR 100 0.1 0.56 0.03 5 0 Ba-specific-3F_UT1 CP008853.1_5309 500 0.2 1.11 0.01 2 0 Ba-specific-3R_UT2 CP008853.1_5309 500 0.2 1.11 0.01 2 0 Ba-specific-5F_UT1 CP008853.1_5316 500 0.2 1.11 0.01 2 0 Ba-specific-5R_UT2 CP008853.1_5316 500 0.2 1.11 0.01 2 0 Ba-specific-6F_UT1 CP012725.1_3629 500 1.6 8.9 0.08 15.9 0 Ba-specific-6R_UT2 CP012725.1_3629 500 1.6 8.9 0.08 15.9 0 Ba-specific-8F_UT1 CP012725.1_5103 100 0.1 0.56 0.03 5 0 Ba-specific-8R_UT2 CP012725.1_5103 100 0.1 0.56 0.03 5 0 Ba-specific-9F_UT1 CP012725.1_5107 100 0.1 0.56 0.03 5 0 Ba-specific-9R_UT2 CP012725.1_5107 100 0.1 0.56 0.03 5 0 Ba-specific-11F_UT1 JSZQ01000034.1_220 100 0.1 0.56 0.03 5 0 Ba-specific-11R_UT2 JSZQ01000034.1_220 100 0.1 0.56 0.03 5 0 Ba-specific-12F_UT1 JSZS01000036.15 100 0.1 0.56 0.03 5 0 Ba-specific-12R_UT2 JSZS01000036.15 100 0.1 0.56 0.03 5 0 Ba-specific-14F_UT1 LGCC01000010.1_232 500 0.4 2.22 0.02 4 0 Ba-specific-14R_UT2 LGCC01000010.1_232 500 0.4 2.22 0.02 4 0 Ba-specific-16F_UT1 LGCC01000048.1_280 100 0.1 0.56 0.03 5 0 Ba-specific-16R_UT2 LGCC01000048.1_280 100 0.1 0.56 0.03 5 0 Ba-specific-20F_UT1 NN_LOMU01000090.1_49 500 1 5.56 0.05 9.9 0 Ba-specific-20R_UT2 NN_LOMU01000090.1_49 500 1 5.56 0.05 9.9 0 Ba-specific-22F_UT1 NN_LOQC01000013.1_3 500 0.2 1.11 0.01 2 0 Ba-specific-22Rv2_UT2 NN_LOQC01000013.1_3 500 0.2 1.11 0.01 2 0 pX01_113F_UT1 pX01 500 0.8 4.45 0.04 7.9 0 pX01-315Rv2_UT2 pX01 500 0.8 4.45 0.04 7.9 0 pX02_101F_UT1 pX02 100 0.1 0.56 0.03 5 0 pX02_269R_UT2 pX02 100 0.1 0.56 0.03 5 0 gyrA_28Fv2_UT1 gyrA 50 0.05 0.28 0.03 5 0 gyrA_182Rv2_UT2 gyrA 50 0.05 0.28 0.03 5 0 parC_1F_UT1 parC 100 0.05 0.28 0.01 2.5 0 parC_197R_UT2 parC 100 0.05 0.28 0.01 2.5 0 gyrB_8F_UT1 gyrB 100 0.1 0.56 0.03 5 0 gyrB_194R_UT2 gyrB 100 0.1 0.56 0.03 5 0 801F_pagAv3_UT1 pagAv3 100 0.1 0.56 0.03 5 0 1042R_pagAv3_UT2 pagAv3 100 0.1 0.56 0.03 5 0 rpoB_29F_UT1 rpoB 50 0.05 0.28 0.03 5 0 rpoB_196R_UT2 rpoB 50 0.05 0.28 0.03 5 0 AA_2502_UT1 AA_2502 500 0.8 4.45 0.04 7.9 0 AA_2502_UT2 AA_2502 500 0.8 4.45 0.04 7.9 0 AA_2503v2_UT1 AA_2503 500 0.8 4.45 0.04 7.9 0 AA_2503_UT2 AA_2503 500 0.8 4.45 0.04 7.9 0 Ba&NN32_F Ba_AmesAnc_4669915 100 0.1 0.56 0.03 5 0 Ba&NN32_R Ba_AmesAnc_4669915 100 0.1 0.56 0.03 5 0 Ba&NN33_F Ba_AmesAnc_4001578 100 0.05 0.28 0.01 2.5 0 Ba&NN33_R Ba_AmesAnc_4001578 100 0.05 0.28 0.01 2.5 0 Ba&NN37_F Ba_AmesAnc_1069024 500 0.2 1.11 0.01 2 0 Ba&NN37_R Ba_AmesAnc_1069024 500 0.2 1.11 0.01 2 0 Ba&NN38_F Ba_AmesAnc_3668548 500 0.2 1.11 0.01 2 0 Ba&NN38_R Ba_AmesAnc_3668548 500 0.2 1.11 0.01 2 0 Ba&NN40_F Ba_AmesAnc_371913 500 0.2 1.11 0.01 2 0 Ba&NN40_R Ba_AmesAnc_371913 500 0.2 1.11 0.01 2 0 Ba&NN41_F Ba_AmesAnc_999035 100 0.05 0.28 0.01 2.5 0 Ba&NN41_R Ba_AmesAnc_999035 100 0.05 0.28 0.01 2.5 0 ChimpKiller_9F ChimpKiller_9-159 100 0.1 0.56 0.03 5 0 ChimpKiller_159R ChimpKiller_9-159 100 0.1 0.56 0.03 5 0 ChimpKiller_91F ChimpKiller_91-320 500 0.8 4.45 0.04 7.9 0 ChimpKiller_320R ChimpKiller_91-320 500 0.8 4.45 0.04 7.9 0 ChimpKiller_481F ChimpKiller_481-698 500 0.8 4.45 0.04 7.9 0 ChimpKiller_698R ChimpKiller_481-698 500 0.8 4.45 0.04 7.9 0 Yp&NN1_F Ypestis_LPQY01000176.1_7 500 0.2 1.11 0.01 2 0 Yp&NN1_R Ypestis_LPQY01000176.1_7 500 0.2 1.11 0.01 2 0 Yp&NN2_F Wagner_Yp_pla_Forward 100 0.1 0.56 0.03 5 0 Yp&NN2_R Wagner_Yp_pla_Forward 100 0.1 0.56 0.03 5 0 Yp&NN3_F Yentero_FR729477.2_1623 500 0.2 1.11 0.01 2 0 Yp&NN3_R Yentero_FR729477.2_1623 500 0.2 1.11 0.01 2 0 Yp&NN4_F YpCO92_NC_003143_113190 500 0.4 2.22 0.02 4 0 Yp&NN4_R YpCO92_NC_003143_113190 500 0.4 2.22 0.02 4 0 Yp&NN5_F YpCO92_NC_003143_161621 100 0.05 0.28 0.01 2.5 0 Yp&NN5_R YpCO92_NC_003143_161621 100 0.05 0.28 0.01 2.5 0 Yp&NN6_F YpCO92_NC_003143_152213 100 0.05 0.28 0.01 2.5 0 Yp&NN6_R YpCO92_NC_003143_152213 100 0.05 0.28 0.01 2.5 0 Yp&NN7_F YpCO92_NC_003143_129539 100 0.1 0.56 0.03 5 0 Yp&NN7_R YpCO92_NC_003143_129539 100 0.1 0.56 0.03 5 0 Yp&NN8_F YpCO92_NC_003143_91203 100 0.05 0.28 0.01 2.5 0 Yp&NN8_R YpCO92_NC_003143_91203 100 0.05 0.28 0.01 2.5 0 Yp&NN9_F YpCO92_NC_003143_121812 100 0.1 0.56 0.03 5 0 Yp&NN9_R YpCO92_NC_003143_121812 100 0.1 0.56 0.03 5 0 Yp&NN10_F Yp_AL590842.1_RX_SNP 50 0.05 0.28 0.03 5 0 Yp&NN10_R Yp_AL590842.1_RX_SNP 50 0.05 0.28 0.03 5 0 Yp&NN11_F AGJT01000065.1_0_338 100 0.1 0.56 0.03 5 0 Yp&NN11_R AGJT01000065.1_0_338 100 0.1 0.56 0.03 5 0 Yp&NN12_F FAUR01000053.1_96407_96884 100 0.1 0.56 0.03 5 0 Yp&NN12_R FAUR01000053.1_96407_96884 100 0.1 0.56 0.03 5 0 YpPGM_8F YpPGM_8-158 500 0.8 4.45 0.04 7.9 0 YpPGM_158R YpPGM_8-158 500 0.8 4.45 0.04 7.9 0 YpPGM_31Fv2 YpPGM_31-205 50 0.05 0.28 0.03 5 0 YpPGM_205Rv2 YpPGM_31-205 50 0.05 0.28 0.03 5 0 Yp-p1202_42780F-UT1 Yp-p1202_42780-43194 500 0.2 1.11 0.01 2 0 Yp-p1202_43194R-UT2 Yp-p1202_42780-43194 500 0.2 1.11 0.01 2 0 Yp-p1202_126386F-UT1 Yp-p1202_126386-126750 500 0.2 1.11 0.01 2 0 Yp-p1202_126750R-UT2 Yp-p1202_126386-126750 500 0.2 1.11 0.01 2 0 Yp-p1202_156402F2-UT1 Yp-p1202_156402-156711 500 0.2 1.11 0.01 2 0 Yp-p1202_156711R-UT2 Yp-p1202_156402-156711 500 0.2 1.11 0.01 2 0 Ft&NN1_F Ftnovicida_CP009607.1 500 0.2 1.11 0.01 2 0 Ft&NN1_R Ftnovicida_CP009607.1 500 0.2 1.11 0.01 2 0 Ft&NN2_F Ftularensis_CP000915.1_1782 100 0.1 0.56 0.03 5 0 Ft&NN2_R Ftularensis_CP000915.1_1782 100 0.1 0.56 0.03 5 0 Ft&NN3_F Ftularensis_CP000915.1_731 500 1.6 8.9 0.08 15.9 0 Ft&NN3_R Ftularensis_CP000915.1_731 500 1.6 8.9 0.08 15.9 0 Ft&NN4_F Fnoatunensis_CP003402.1_1749 500 0.2 1.11 0.01 2 0 Ft&NN4_R Fnoatunensis_CP003402.1_1749 500 0.2 1.11 0.01 2 0 Ft&NN5_F Fnoatunensis_CP003402.1_424 500 0.2 1.11 0.01 2 0 Ft&NN5_R Fnoatunensis_CP003402.1_424 500 0.2 1.11 0.01 2 0 Ft&NN6_F Fphilom_CP009444.1_569 500 0.2 1.11 0.01 2 0 Ft&NN6_R Fphilom_CP009444.1_569 500 0.2 1.11 0.01 2 0 Ft&NN7_F Fphilom_CP009444.1_285 500 0.2 1.11 0.01 2 0 Ft&NN7_Rv2 Fphilom_CP009444.1_285 500 0.2 1.11 0.01 2 0 Ft&NN8_F Ft_dup_CP000915.1_197 100 0.05 0.28 0.01 2.5 0 Ft&NN8_R Ft_dup_CP000915.1_197 100 0.05 0.28 0.01 2.5 0 Ft&NN9_F FtLVS_AM233362_1646546 100 0.05 0.28 0.01 2.5 0 Ft&NN9_R FtLVS_AM233362_1646546 100 0.05 0.28 0.01 2.5 0 Ft&NN10_F FtLVS_AM233362_1643765 100 0.1 0.56 0.03 5 0 Ft&NN10_R FtLVS_AM233362_1643765 100 0.1 0.56 0.03 5 0 Ft&NN11_F FtLVS_AM233362_1562618 100 0.1 0.56 0.03 5 0 Ft&NN11_R FtLVS_AM233362_1562618 100 0.1 0.56 0.03 5 0 9F_FtA1_UT1 FtA1 100 0.1 0.56 0.03 5 0 246R_FtA1_UT2 FtA1 100 0.1 0.56 0.03 5 0 34F_FtA2_UT1 FtA2 100 0.1 0.56 0.03 5 0 169R_FtA2_UT2 FtA2 100 0.1 0.56 0.03 5 0 28F_FtB_UT1 FtB 100 0.1 0.56 0.03 5 0 173R_FtB_UT2 FtB 100 0.1 0.56 0.03 5 0 14F_FtA_UT1 FtA 100 0.1 0.56 0.03 5 0 207R_FtA_UT2 FtA 100 0.1 0.56 0.03 5 0 IPSC-f2 IPSC 20 0.03 0.14 0.03 6.2 0 IPSC-r2 IPSC 20 0.03 0.14 0.03 6.2 0 580.6 uL total volume of primers 310.4 uL of 1x TE to add to bring up to desired volume of primer mix stock 891.0 Total (uL)
(118) TABLE-US-00023 TABLE11 BurkholderiaprimersandprimerswithUniversalTail(UT). TheUTsequenceisunderlined. Target SEQ SEQ Assay species/ ID ID name gene NO: NO: Forward Forwardsequence primername (5->3) Forwardsequencew/UT TTS1_ TTS1 BpAmpSeq_1 TCGTCGTCACCGGGATGGTC 61 ACCCAACTGAATGGAGCTCGTCG 307 BPSS1 _F TCACCGGGATGGTC 407 Reverse Reversesequence primername (5->3) Reversesequencew/UT BpAmpSeq_1 GGCCTTTGCCCGCATACTCG 62 ACGCACTTGACTTGTCTTCGGCC 308 _R TTTGCCCGCATACTCG Forward Forwardsequence primername (5->3) Forwardsequencew/UT LXCCO pseudomallei BpAmpSeq_3 TCGCAWGAAGTGCGTTGCC 63 ACCCAACTGAATGGAGCTCGCA 309 100014 _F G WGAAGTGCGTTGCCG 1.1_392 Reverse Reversesequence 96_398 primername (5->3) Reversesequencew/UT 17 BpAmpSeq_3 GCCGCTTGCGAAGCGATGAT 64 ACGCACTTGACTTGTCTTCGCCG 310 _R CTTGCGAAGCGATGAT Forward Forwardsequence primername (5->3) Forwardsequencew/UT LXBY0 pseudomallei BpAmpSeq_4 CGCGCTTGCCCAACTACCAG 65 ACCCAACTGAATGGAGCCGCGCT 311 100008 _F TGCCCAACTACCAG 7.1_757 Reverse Reversesequence 60_767 primername (5->3) Reversesequencew/UT 51 BpAmpSeq_4 GCGCAACGGTGCGAGACAA 66 ACGCACTTGACTTGTCTTCGCGC 312 _R T AACGGTGCGAGACAAT Forward Forwardsequence primername (5->3) Forwardsequencew/UT LXCD0 pseudomallei BpAmpSeq_5 AATCCATGCATGTCGYGCCC 67 ACCCAACTGAATGGAGCAATCCA 313 100000 _F TGCATGTCGYGCCC 2.1_996 Reverse Reversesequence 52_100 primername (5->3) Reversesequencew/UT 245 BpAmpSeq_5 GCGATCGCTCAACGGGCTTC 68 ACGCACTTGACTTGTCTTCGCGA 314 _R TCGCTCAACGGGCTTC Forward Forwardsequence primername (5->3) Forwardsequencew/UT LXCE0 pseudomallei BpAmpSeq_6 TCGCATTTGCAYACGCTCCC 69 ACCCAACTGAATGGAGCTCGCAT 315 100012 _F TTGCAYACGCTCCC 3.1_342 Reverse Reversesequence 20_347 primername (5->3) Reversesequencew/UT 47 BpAmpSeq_6 AGTGCGCAAACTTGGCGAG 70 ACGCACTTGACTTGTCTTCAGTG 316 _R G CGCAAACTTGGCGAGG Forward Forwardsequence primername (5->3) Forwardsequencew/UT LWWC pseudomallei BpAmpSeq_8 CCTTTGCGGCAAGCGTCGAA 81 ACCCAACTGAATGGAGCCCTTTG 317 010001 mallei _F CGGCAAGCGTCGAA 87.118 Reverse Reversesequence primername (5->3) Reversesequencew/UT BpAmpSeq_8 GAGCCAACGCACATGGACG 82 ACGCACTTGACTTGTCTTCGAGC 318 _R G CAACGCACATGGACGG Forward Forwardsequence primername (5->3) Forwardsequencew/UT LWWB pseudomallei BpAmpSeq_1 CCAGTCGGGCCGGGAAAAA 83 ACCCAACTGAATGGAGCCCAGTC 319 010001 mallei 0_F C GGGCCGGGAAAAAC 25.1_17 Reverse Reversesequence 183_17 primername (5->3) Reversesequencew/UT 602 BpAmpSeq_1 GGCGGCAAAAGCGTCGATG 84 ACGCACTTGACTTGTCTTCGGCG 320 0_R A GCAAAAGCGTCGATGA Forward Forwardsequence primername (5->3) Forwardsequencew/UT LXAY0 pseudomallei BpAmpSeq_1 GCCGGAACCGTCGAGCATT 85 ACCCAACTGAATGGAGCGCCGG 321 100036 mallei 1_F G AACCGTCGAGCATTG 7.1_0_6 Reverse Reversesequence 40 primername (5->3) Reversesequencew/UT BpAmpSeq_1 TGGATTCGACTGCCTCCGCT 86 ACGCACTTGACTTGTCTTCTGGA 322 1_R TTCGACTGCCTCCGCT Forward Forwardsequence primername (5->3) Forwardsequencew/UT LWVY pseudomallei BpAmpSeq_1 TCGATATCCGCCGTCTCGCC 87 ACCCAACTGAATGGAGCTCGATA 323 010001 mallei 2_F TCCGCCGTCTCGCC 90.1_17 Reverse Reversesequence 226_17 primername (5->3) Reversesequencew/UT 689 BpAmpSeq_1 ATGTGTCGGTGGGCTTCGGT 88 ACGCACTTGACTTGTCTTCATGT 324 2_R GTCGGTGGGCTTCGGT Forward Forwardsequence primername (5->3) Forwardsequencew/UT LXAD0 pseudomallei BpAmpSeq_1 GAAAGGCGATGTGCCGAGC 89 ACCCAACTGAATGGAGCGAAAG 325 100005 mallei 3_F G GCGATGTGCCGAGCG 9.1_247 Reverse Reversesequence 60_250 primername (5->3) Reversesequencew/UT 75 BpAmpSeq_1 TTCGGAGAAGCGCCAAACG 90 ACGCACTTGACTTGTCTTCTTCGG 326 3_R C AGAAGCGCCAAACGC Forward Forwardsequence primername (5->3) Forwardsequencew/UT NC_00 pseudomallei BpAmpSeq_1 GCCAGCGCATCCACCAACAT 109 ACCCAACTGAATGGAGCGCCAGC 327 6350_2 complexSNP 6_F GCATCCACCAACAT 289827 Reverse Reversesequence primername (5->3) Reversesequencew/UT BpAmpSeq_1 AGAGGAAGAAGGGCGAGGC 110 ACGCACTTGACTTGTCTTCAGAG 328 6_R G GAAGAAGGGCGAGGCG Forward Forwardsequence primername (5->3) Forwardsequencew/UT NC_00 cepacia BpAmpSeq_1 CGCGCARYTCGTCGTCCTCG 111 ACCCAACTGAATGGAGCCGCGCA 329 6350_1 complex 8_F RYTCGTCGTCCTCG 33027 SNPs Reverse Reversesequence primername (5->3) Reversesequencew/UT BpAmpSeq_1 CGAACCTSGTGCMGGTRCA 112 ACGCACTTGACTTGTCTTCCGAA 330 8_R G CCTSGTGCMGGTRCAG Forward Forwardsequence primername (5->3) Forwardsequencew/UT NC_00 BpcMSS BpAmpSeq_1 CACGTTGCCSGGRAARTACG 113 ACCCAACTGAATGGAGCCACGTT 331 6350_2 9_F GCCSGGRAARTACG 248145- Reverse Reversesequence 224819 primername (5->3) Reversesequencew/UT 3 BpAmpSeq_1 CCGTCGACAAGATCGCGCTS 114 ACGCACTTGACTTGTCTTCCCGTC 332 9_R GACAAGATCGCGCTS Forward Forwardsequence primername (5->3) Forwardsequencew/UT NC_00 BpcMSS BpAmpSeq_2 CAGAACGCGCTRTYCCACG 115 ACCCAACTGAATGGAGCCAGAA 333 6350_9 0_F CGCGCTRTYCCACG 88041- Reverse Reversesequence 988089 primername (5->3) Reversesequencew/UT BpAmpSeq_2 TGCCGCGTGATCCATTGCAT 116 ACGCACTTGACTTGTCTTCTGCC 334 0_R GCGTGATCCATTGCAT Forward Forwardsequence primername (5->3) Forwardsequencew/UT Bm_11 mallei BpAmpSeq_2 AGGGGGTGGTTTCCTGAGTG 117 ACCCAACTGAATGGAGCAGGGG 335 589 1_F GCGTGAC GTGGTTTCCTGAGTGGCGTGAC Reverse Reversesequence primername (5->3) Reversesequencew/UT BpAmpSeq_2 AGCGGTGTCGACGGGTGGA 118 ACGCACTTGACTTGTCTTCAGCG 336 1_R AAGGATG GTGTCGACGGGTGGAAAGGATG Forward Forwardsequence primername (5->3) Forwardsequencew/UT Bm_11 mallei BpAmpSeq_2 ACGGGCGCTTCACGATCTCG 119 ACCCAACTGAATGGAGCACGGG 337 767 2_F GTGTTC CGCTTCACGATCTCGGTGTTC Reverse Reversesequence primername (5->3) Reversesequencew/UT BpAmpSeq_2 GCGCGGCAGTTCGATCAGG 120 ACGCACTTGACTTGTCTTCGCGC 338 2_R CATTTG GGCAGTTCGATCAGGCATTTG Forward Forwardsequence primername (5->3) Forwardsequencew/UT PBP3- pbp3 BpAmpSeq_2 ATCCGCCGTCCCGCCCAGCA 305 ACCCAACTGAATGGAGCATCCGC 339 170- 4_F ATAG CGTCCCGCCCAGCAATAG 505 Reverse Reversesequence primername (5->3) Reversesequencew/UT BpAmpSeq_2 GGGTTCGCCCAGATTTCGTA 306 ACGCACTTGACTTGTCTTCGGGT 340 4_R GGTGGTGAG TCGCCCAGATTTCGTAGGTGGTG AG Forward Forwardsequence primername (5->3) Forwardsequencew/UT K9pen penA BpAmpSeq_2 CGGTCGCCACAAATTCGCAC 127 ACCCAACTGAATGGAGCCGGTCG 341 A378- 6_F GCACTC CCACAAATTCGCACGCACTC 529 Reverse Reversesequence primername (5->3) Reversesequencew/UT BpAmpSeq_2 AGCGAGCGGCGCAACGGAG 128 ACGCACTTGACTTGTCTTCAGCG 342 6_R AATGATT AGCGGCGCAACGGAGAATGATT Forward Forwardsequence primername (5->3) Forwardsequencew/UT K9pen penA BpAmpSeq_2 GCTGCGCGGCCAAGCGAAA 129 ACGCACTTGACTTGTCTTCGCTG 343 A575- 7_F AACG CGCGGCCAAGCGAAAAACG 761 Reverse Reversesequence primername (5->3) Reversesequencew/UT BpAmpSeq_2 CGCGAGGACCGCAGCGCAA 130 ACCCAACTGAATGGAGCCGCGA 344 7_R AGC GGACCGCAGCGCAAAGC Forward Forwardsequence primername (5->3) Forwardsequencew/UT K9pen penA BpAmpSeq_2 GGCCGCAGACCGTCACCGC 131 ACCCAACTGAATGGAGCGGCCGC 345 A949- 8_F GTATG AGACCGTCACCGCGTATG 1172 Reverse Reversesequence primername (5->3) Reversesequencew/UT BpAmpSeq_2 GTCGCCCGTCTTGTTGCCGA 132 ACGCACTTGACTTGTCTTCGTCG 346 8_R GCATC CCCGTCTTGTTGCCGAGCATC
(119) TABLE-US-00024 TABLE12 BacillusprimersandprimerswithUniversalTail(UT).TheUTsequenceisunderlined. SEQ SEQ ID ID NO: NO: Target Forward Forward Forward Assay species/ primer sequence sequence name gene name (5->3) w/UT plcR pIcR Ba- TTTTTCGTAAGCATCTTCAA 29 ACCCAACTGAATGGAGCTTTTTC 347 specific- GTAAGCATCTTCAA 1F_UT1 Reverse Reverse Reverse primer sequence sequence name (5->3) w/UT Ba- TTTGATGTGAAGGTGAGACA 30 ACGCACTTGACTTGTCTTCTTTGA 348 specific- TGTGAAGGTGAGACA IRUT2 Target Forward Forward Forward Assay species/ primer sequence sequence name gene name (5->3) w/UT CP0088 Ba- ACGTCAGGTGATTATTGGAC 1 ACCCAACTGAATGGAGCACGTCA 349 53.1_ specific- GGTGATTATTGGAC 5309 3F_UT1 Reverse Reverse Reverse primer sequence sequence name (5->3) w/UT Ba- CAACAATTATATCCGCCATT 2 ACGCACTTGACTTGTCTTCCAAC 350 specific- AATTATATCCGCCATT 3RUT2 Target Forward Forward Forward Assay species/ primer sequence sequence name gene name (5->3) w/UT CP(K)88 Ba- GAAGATGTACGCTCGATAG 3 ACCCAACTGAATGGAGCGAAGA 351 53.1_ specific- G TGTACGCTCGATAGG 5316 5FUT1 Reverse Reverse Reverse primer sequence sequence name (5->3) w/UT Ba- GAAATTCTTTTTGCCATCAC 4 ACGCACTTGACTTGTCTTCGAAA 352 specific- TTCTTTTTGCCATCAC 5RUT2 Target Forward Forward Forward Assay species/ primer sequence sequence name gene name (5->3) w/UT CP0127 Ba- CACAATTGAATGAAAATGCT 5 ACCCAACTGAATGGAGCCACAAT 353 25.1_ specific- TGAATGAAAATGCT 3629 6F_UT1 Reverse Reverse Reverse primer sequence sequence name (5->3) w/UT Ba- CACGAAACCTGTTTACCTTT 6 ACGCACTTGACTTGTCTTCCACG 354 specific- AAACCTGTTTACCTTT 6RUT2 Target Forward Forward Forward Assay species/ primer sequence sequence name gene name (5->3) w/UT CP0127 Ba- GATATTCGACGAGCTTTCTG 7 ACCCAACTGAATGGAGCGATATT 355 25.1_ specific- CGACGAGCTTTCTG 5103 8F_UT1 Reverse Reverse Reverse primer sequence sequence name (5->3) w/UT Ba- TATTCATCGTCATCCTCCTC 8 ACGCACTTGACTTGTCTTCTATT 356 specific- CATCGTCATCCTCCTC 8R_UT2 Target Forward Forward Forward Assay species/ primer sequence sequence name gene name (5->3) w/UT CP0127 Ba- TATTGAACGCATTGAATCAG 9 ACCCAACTGAATGGAGCTATTGA 357 25.1_ specific- ACGCATTGAATCAG 5107 9F_UT1 Reverse Reverse Reverse primer sequence sequence name (5->3) w/UT Ba- TATTGGTAAGCAAACCGTCT 10 ACGCACTTGACTTGTCTTCTATTG 358 specific- GTAAGCAAACCGTCT 9RUT2 Target Forward Forward Forward Assay species/ primer sequence sequence name gene name (5->3) w/UT JSZQ01 Ba- GGTTCAGGACAAAATGTAG 11 ACCCAACTGAATGGAGCGGTTCA 359 000034. specific- C GGACAAAATGTAGC 1_220 11F_UT1 Reverse Reverse Reverse primer sequence sequence name (5->3) w/UT Ba- TAACTTCTGAAGCGAAAACC 12 ACGCACTTGACTTGTCTTCTAACT 360 specific- TCTGAAGCGAAAACC 11R_UT2 Target Forward Forward Forward Assay species/ primer sequence sequence name gene name (5->3) w/UT JSZS010 Ba- GCGAATTTTAGACGACAATC 13 ACCCAACTGAATGGAGCGCGAAT 361 00036.1_5 specific- TTTAGACGACAATC 12F_UT1 Reverse Reverse Reverse primer sequence Sequence name (5->3) w/UT Ba- TAACCGTGCTTAATTCGTTT 14 ACGCACTTGACTTGTCTTCT 362 specific- AACCGTGCTTAATTCGTTT 12RUT2 Target Forward Forward Forward Assay species/ primer sequence Sequence name gene name (5->3) w/UT LGCC0 Ba- ATTAATAAGGCGACTGGTGA 15 ACCCAACTGAATGGAGCATT 363 1000010.1_ specific- AATAAGGCGACTGGTGA 232 14F_UT1 Reverse Reverse Reverse primer sequence Sequence name (5->3) w/UT Ba- TTACCCATCCAGAATGAGAC 16 ACGCACTTGACTTGTCTTCT 364 specific- TACCCATCCAGAATGAGAC 14RUT2 Target Forward Forward Forward Assay species/ primer sequence Sequence name gene name (5->3) w/UT LGCC0 Ba- ACAATTCTTAAAAGGCGACA 17 ACCCAACTGAATGGAGCACA 365 1000048.1_ specific- ATTCTrAAAAGGCGACA 280 16F_UT1 Reverse Reverse Reverse primer sequence Sequence name (5->3) w/UT Ba- TGTAGCGTCTCCGATATTTT 18 ACGCACTTGACTTGTCTTCT 366 specific- GTAGCGTCTCCGATATTTT 16R_UT2 Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT NNLO Ba- CATGGGGCTTTCTATTATGT 19 ACCCAACTGAATGGAGCCATGGG 367 MU010000 specific- GCTTTCTATTATGT 90.1_49 20FUT1 Reverse Reversesequence Reversesequence primername (5->3) w/UT Ba- TTCGTTCTTTCATAAGTTTCC 20 ACGCACTTGACTTGTCTTCTTCGT 368 specific- T TCTTTCATAAGIF1CCT 20R_UT2 Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT NN_LO Ba- TTGGAGTITGTTITGCTTTT 21 ACCCAACTGAATGGAGCTTGGAG 369 QC0100 specific- TTTGTTTTGCTTTT 0013.1_3 22F_UT1 Reverse Reversesequence Reversesequencew/UT primername (5->3) Ba-specific- GTAACAATTAATCCACGTCC 22 ACGCACTTGACTTGTCTTCGTAA 370 22Rv2_UT2 T CAATTAATCCACGTCCT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT pX01 pX01 pX01_ TGAGCCTACCTAGTGATTGG 33 ACCCAACTGAATGGAGCTGAGCC 371 113F_UT1 TACCTAGTGATTGG Reverse Reversesequence Reversesequence primername (5->3) w/UT pX01- TTGGATAAATTCCACAAATT 34 ACGCACTTGACTTGTCTTCTTGG 372 315Rv2_UT2 CCTC ATAAATTCCACAAATTCCTC Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT pX02 pX02 pX02_101F_ CGCCAGCGTATTATATAGGT 35 ACCCAACTGAATGGAGCCGCCAG 373 UT1 CGTATTATATAGGT Reverse primer Reversesequence Reversesequencew/UT name (5->3) pX02269R GCTAATTCTGGGTTGTGTTT 36 ACGCACTTGACTTGTCTTCGCTA 374 UT2 ATTCTGGGTTGTGTTT Assay Target Forward Forwardsequence name species/gene primername (5->3) Forwardsequencew/UT gyrA gyrA gyrA_28Fv2_ TCGGTAAGTATCACCCTCA 37 ACCCAACTGAATGGAGCTCGGTA 375 UT1 AGTATCACCCTCA Reverse primer Reversesequence name (5->3) Reversesequencew/UT gyrA_182Rv2 TGCTTCTGTATAACGCATT 38 ACGCACTTGACTTGTCTTCTGCTT 376 _UT2 CTGTATAACGCATT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT parC parC parC_1F_UTl CAGTCGGTAACGTTATTGGT 39 ACCCAACTGAATGGAGCCAGTCG 377 GTAACGTTATTGGT Reverse Reversesequence Reversesequence primername (5->3) w/UT parC_197R_U TAACTCAGATGCAATTGGTG 40 ACGCACTTGACTTGTCTTCTAACT 378 T2 CAGATGCAATTGGTG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT gyrB gyrB gyrB_8F_UT ATTGTAGAGGGTGACTCTGC 41 ACCCAACTGAATGGAGCATTGTA 379 1 GAGGGTGACTCTGC Reverse Reversesequence Reversesequence primername (5->3) w/UT gyrB_194R_ TATCAAAATCTCCGCCAAT 42 ACGCACTTGACTTGTCTTCTATCA 380 UT2 AAATCTCCGCCAAT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT pagA pagA 801F_pagAv3_ GGTTACAGGACGGATTGAT 31 ACCCAACTGAATGGAGCGGTTAC 381 UT1 A AGGACGGATTGATA Reverse Reversesequence Reversesequence primername (5->3) w/UT 1042R_pagAv TCCCACCAATATCAAAGAAC 32 ACGCACTTGACTTGTCTTCTCCCA 382 3UT2 CCAATATCAAAGAAC Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT rpoB rpoB rpoB_29F_U TTCTTCGGAAGTTCTCAGTT 43 ACCCAACTGAATGGAGCTTCTTC 383 T1 GGAAGTTCTCAGTT Reverse Reversesequence Reversesequence primername (5->3) w/UT rpoB_196R_ CGGACACATACGACCATAG 44 ACGCACTTGACTTGTCTTCCGGA 384 UT2 CACATACGACCATAG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT AA_2502 AA_2502_UT AAGTTTGAGGTGTGGAAAT 45 ACCCAACTGAATGGAGCAAGTTT 385 1 G GAGGTGTGGAAATG Reverse Reversesequence Reversesequence primername (5->3) w/UT AA_2502_UT TCGAAATGAGTTCCAATTTT 46 ACGCACTTGACTTGTCTTCTCGA 386 2 AATGAGTTCCAATTTT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT AA_2503 AA_2503v2_ CAAAACTAATAGGGGAGGG 47 ACCCAACTGAATGGAGCCAAAA 387 UT1 TG CTAATAGGGGAGGGTG Reverse Reversesequence Reversesequence primername (5->3) w/UT AA_2503_UT CCGAGAACCTACCTCGTTA 48 ACGCACTTGACTTGTCTTCCCGA 388 2 GAACCTACCTCGTTA Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Ba_AmesAnc_ Ba&NN32_F AGGAGATGAGAGTTTTGCA 49 ACCCAACTGAATGGAGCAGGAG 389 4669915 C ATGAGAGTTTTGCAC Reverse Reversesequence Reversesequence primername (5->3) w/UT Ba&NN32_R ACCCCCATAATTACCATGA 50 ACGCACTTGACTTGTCTTCACCC 390 CCATAATTACCATGA Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Ba_AmesAnc_ Ba&NN33_F CGTTGCGTAAGTATGTGCTA 51 ACCCAACTGAATGGAGCCGTTGC 391 4001578 GTAAGTATGTGCTA Reverse Reversesequence Reversesequence primername (5->3) w/UT Ba&NN33_R AGGTGGCGTAATTAACGTA 52 ACGCACTTGACTTGTCTTCAGGT 392 G GGCGTAATTAACGTAG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Ba_AmesAnc_ Ba&NN37_F CGAAAAGTTGTCGACCTAAT 53 ACCCAACTGAATGGAGCCGAAA 393 1069024 AGTTGTCGACCTAAT Reverse Reversesequence Reversesequence primername (5->3) w/UT Ba&NN37_R ACTGCGTTCACGAAGAATA 54 ACGCACTTGACTTGTCTTCACTG 394 G CGTTCACGAAGAATAG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Ba_AmesAnc_ Ba&NN38_F TCTCTTGATTCAACGTTTCC 55 ACCCAACTGAATGGAGCTCTCTT 395 3668548 GATTCAACGTTTCC Reverse Reversesequence Reversesequence primername (5->3) w/UT Ba&NN38_R GATGCAAAACCAATTCACTT 56 ACGCACTTGACTTGTCTTCGATG 396 CAAAACCAATTCACTT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Ba_AmesAnc_ Ba&NN40_F GTGAAACATCGCTTTTTAGG 57 ACCCAACTGAATGGAGCGTGAA 397 371913 ACATCGCTTTTTAGG Reverse Reversesequence Reversesequence primername (5->3) w/UT Ba&NN40_R TCCGCAATGATATACTTCAA 58 ACGCACTTGACTTGTCTTCTCCGC 398 AATGATATACTTCAA Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT BaA_mesAnc_ Ba&NN41_F ATACGGTGAAAATGAAGCA 59 ACCCAACTGAATGGAGCATACGG 399 999035 G TGAAAATGAAGCAG Reverse Reversesequence Reversesequence primername (5->3) w/UT Ba&NN41R CGTCTTTGGTAATCGTTCA 60 ACGCACTTGACTTGTCTTCCGTCT 400 TTGGTAATCGTTCA Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT ChimpKiller_ ChimpKiller_ TTATCGTCCATTCTTTCGTC 23 ACCCAACTGAATGGAGCTTATCG 401 9-159 9F TCCATTCTTTCGTC Reverse Reversesequence Reversesequence primername (5->3) w/UT ChimpKiller_ AAACCTAATGAAACGGGAT 24 ACGCACTTGACTTGTCTTCAAAC 402 159R T CTAATGAAACGGGATT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT ChimpKiller_ ChimpKiller_ TATGAAAGGAGCCGTAAAA 25 ACCCAACTGAATGGAGCTATGAA 403 91-320 91F C AGGAGCCGTAAAAC Reverse Reversesequence Reversesequence primername (5->3) w/UT ChimpKiller_ TGAATATGAAGCGGAAAAC 26 ACGCACTTGACTTGTCTTCTGAA 404 320R T TATGAAGCGGAAAACT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT ChimpKiller_ ChimpKiller_ TCGAACATACCTCCATTTCT 27 ACCCAACTGAATGGAGCTCGAAC 405 481-698 481F ATACCTCCATTTCT Reverse Reversesequence Reversesequence primername (5->3) w/UT ChimpKiller_ AAAGATAGCTTTGCACTTGG 28 ACGCACTTGACTTGTCTTCAAAG 406 698R ATAGCTTTGCACTTGG
(120) TABLE-US-00025 TABLE13 YersiniaprimersandprimerswithUniversalTail(UT).TheUTsequenceisunderlined. SEQ SEQ ID ID NO: NO: Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Ypestis_LPQY Yp&NNl_F AACAAGCTAAAACCGAACA 231 ACCCAACTGAATGGAGCAACAA 407 01000176.1_7 A GCTAAAACCGAACAA Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN1_R ATAGCCTCAACTGCTTTTTG 232 ACGCACTTGACTTGTCTTCATAG 408 CCTCAACTGCTTTTTG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Wagner_Yp_ Yp&NN2_F GAAAGGAGTGCGGGTAATA 237 ACCCAACTGAATGGAGCGAAAG 409 pla_Forward GGTT GAGTGCGGGTAATAGGTT Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN2_R GGCCTGCAAGTCCAATATA 238 ACGCACTTGACTTGTCTTCGGCC 410 TGG TGCAAGTCCAATATATGG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT YenteroFR72 Yp&NN3_F GATGCTTCTGCTATCAGSTT 263 ACCCAACTGAATGGAGCGATGCT 411 9477.2_623 TCTGCTATCAGSTT Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN3_R GTGTGRCTTTGAASTCTTGT 264 ACGCACTTGACTTGTCTTCGTGT 412 GRCTTTGAASTCTTGT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT YPCO92_NC_00 Yp&NN4_F ACTCGGGATACTCCATACT 249 ACCCAACTGAATGGAGCACTCGG 413 3143_113190 G GATACTCCATACTG Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN4_R CGAAAGCAGTGGTCAATC 250 ACGCACTTGACTTGTCTTCCGAA 414 AGCAGTGGTCAATC Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT YPCO92_NC_00 Yp&NN5_F CATGCGCTTTACGTTATATG 251 ACCCAACTGAATGGAGCCATGCG 415 3143_161621 CTTTACGTTATATG Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN5_R GCGTTCTGCACTCTGTCT 252 ACGCACTTGACTTGTCTTCGCGTT 416 CTGCACTCTGTCT Assay Target Forward Forwardsequence Forwardsequence (5->3) w/UT name species/gene primername YPCO92_NC_00 Yp&NN6_F AGCGACTTCCGTGATAAAG 253 ACCCAACTGAATGGAGCAGCGA 417 3143_152213 CTTCCGTGATAAAG Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN6_R ACTCAGGATACCGTGTGGT 254 ACGCACTTGACTTGTCTTCACTC 418 AGGATACCGTGTGGT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT YPCO92_NC_00 Yp&NN7_F TTCACGATAATCCCCTAAT 255 ACCCAACTGAATGGAGCTTCACG 419 3143_129539 G ATAATCCCCTAATG Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN7_R TTCTGTGCTCTGGCTGATA 256 ACGCACTTGACTTGTCTTCTTCTG 420 TGCTCTGGCTGATA Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT YPCO92_NC_00 Yp&NN8_F ATTATCTGTGCCCCTTCTTT 257 ACCCAACTGAATGGAGCATTATC 421 3143_91203 TGTGCCCCTTCTTT Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN8_R GGAGTGGATGCCACTAAAC 258 ACGCACTTGACTTGTCTTCGGAG 422 TGGATGCCACTAAAC Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT YpC092_NC_00 Yp&NN9_F CCTCACACAACAATTCACT 259 ACCCAACTGAATGGAGCCCTCAC 423 3143121812 G ACAACAATTCACTG Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN9_R TTTTTCCGACAAATTTAAG 260 ACGCACTTGACTTGTCTTCTTTTT 424 G CCGACAAATTTAAGG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Yp_AL590842.1_ Yp&NN10_F AGCATGAAGGTTGCTAAAA 261 ACCCAACTGAATGGAGCAGCATG 425 RX_SNP G AAGGTTGCTAAAAG Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN10_R GGTGACTTCAAAACCGTTA 262 ACGCACTTGACTTGTCTTCGGTG 426 G ACTTCAAAACCGTTAG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT AGJT01000065. Yp&NN11_F CAGTACCGACAAAACTTC 233 ACCCAACTGAATGGAGCCAGTAC 427 1_0_338 CGACAAAACTTC Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN11_R TTTACTACTCTGAAAACGA 234 ACGCACTTGACTTGTCTTCTTTAC 428 G TACTCTGAAAACGAG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT FAURO1000053.1_ Yp&NN12_F GCACTACAAATTTAAATCC 235 ACCCAACTGAATGGAGCGCACTA 429 9640_796884 C CAAATTTAAATCCC Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp&NN12_R GTCGATTATCAACCTCTAT 236 ACGCACTTGACTTGTCTTCGTCG 430 G ATTATCAACCTCTATG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT YpPGM_ PGM YpPGM_8F TTAATATCCCGGCACTCAT 239 ACCCAACTGAATGGAGCTTAATA 431 8-158 A TCCCGGCACTCATA Reverse Reversesequence Reversesequence primername (5->3) w/UT YpPGM_158 TCCTTAACTGAATAAGTGC 240 ACGCACTTGACTTGTCTTCTCCTT 432 R TCA AACTGAATAAGTGCTCA Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT YpPGM_ PGM YpPGM_31F TTTAATGAACGGTGCCTAG 241 ACCCAACTGAATGGAGCTTTAAT 433 31-205 v2 GAACGGTGCCTAG Reverse Reversesequence Reversesequence primername (5->3) w/UT YpPGM_205 GTCTGCGTTTCTCCAGTAT 242 ACGCACTTGACTTGTCTTCGTCTG 434 Rv2 CGTTTCTCCAGTAT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Yp-p1202_ plP1202 Yp- TCTGGCCTGCTAAATAAAA 243 ACCCAACTGAAIGGAGCTCTGGC 435 42780- P1202_42780 ACGAACC CTGCTAAATAAAAACGAACC 43194 F-UT1 Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp- CAGGCCTCAGCATTTTATT 244 ACGCACTTGACTTGTCTTCCAGG 436 p1202_ ATGGTGAT CCTCAGCATTTTATTATGGTGAT 43194 R-UT2 Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Yp- plP1202 Yp- GGGGCGGATACCTTCACCT 245 ACCCAACTGAATGGAGCGGGGC 437 p1202_1 P1202_ ATG GGATACCTTCACCTATG 26386- 12638 126750 6F-UT1 Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp- CTGGGGTTCAGTCTGGACG 246 ACGCACTTGACTTGTCTTCCTGG 438 p1202_ AGAT GGTTCAGTCTGGACGAGAT 126750R- UT2 Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Yp-p1202_ plP1202 Yp- ACCATCCGGCGCTAAATCG 247 ACCCAACTGAATGGAGCACCATC 439 156402- p1202_ TC CGGCGCTAAATCGTC 156711 15640 2F2-UT1 Reverse Reversesequence Reversesequence primername (5->3) w/UT Yp- GAAATGCGCCTGGTAAGCA 248 ACGCACTTGACTTGTCTTCGAAA 440 pl202_15671 GAGT TGCGCCTGGTAAGCAGAGT 1R-UT2
(121) TABLE-US-00026 TABLE14 FrancisellaprimersandprimerswithUniversalTail(UT).TheUTsequenceisunderlined. SEQ SEQ ID ID NO: NO: Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Ftnovicida_ Ft&NN1_F GGTAGGATAACTACCAAG 285 ACCCAACTGAATGGAGCGGTAG 441 CP009607.1 GATAACTACCAAG Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN1_R GTCATGAGTTTTACCAATA 286 ACGCACTTGACTTGTCTTCGTCAT 442 CTC GAGTTTTACCAATACTC Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Ftularensis_CP0 Ft&NN2_F GAAGTGGCTCATGTTAGAG 265 ACCCAACTGAATGGAGCGAAGT 443 00915.1_1782 G GGCTCATGTTAGAGG Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN2_R AGCGAGCCTATATGTAACC 266 ACGCACTTGACTTGTCTTCAGCG 444 A AGCCTATATGTAACCA Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Ftularensis_ Ft&NN3_F TTTAATGTCCGTCAACCTCT 267 ACCCAACTGAATGGAGCTTTAAT 445 CP000915.1_731 GTCCGTCAACCTCT Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN3_R ACGAGTTTGTGAGTCGCTA 268 ACGCACTTGACTTGTCTTCACGA 446 T GTTTGTGAGTCGCTAT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Fnoatunensis_CP Ft&NN4_F CGGTAAGAATACGACCAGA 291 ACCCAACTGAATGGAGCCGGTAA 447 003402.1_1749 G GAATACGACCAGAG Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN4_R AGAGGATTTCTTCCTCCTTG 292 ACGCACTTGACTTGTCTTCAGAG 448 GATTTCTTCCTCCTTG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Fnoatunensis_ Ft&NN5_F AATTCTACAAGCACCTGGA 293 ACCCAACTGAATGGAGCAATTCT 449 CP003402.1_424 A ACAAGCACCTGGAA Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN5R TCCTATTAAAAGCGCCATA 294 ACGCACTTGACTTGTCTTCTCCTA 450 G TTAAAAGCGCCATAG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Fphilom_CP009 Ft&NN6F CTTATGCAGCAAGAGGAAC 287 ACCCAACTGAATGGAGCCTTATG 451 444.1_569 T CAGCAAGAGGAACT Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN6_R ATACACCGGGATAGGTTTC 288 ACGCACTTGACTTGTCTTCATAC 452 T ACCGGGATAGGTTTCT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Fphilom_CP009 Ft&NN7_F CTGATGGAAGAGAGTTCGA 289 ACCCAACTGAATGGAGCCTGATG 453 444.1_285 G GAAGAGAGTTCGAG Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN7_Rv2 GTAGATATAATCAGCGCCA 290 ACGCACTTGACTTGTCTTCGTAG 454 C ATATAATCAGCGCCAC Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT Ft_dup_CP0009 Ft&NN8_F TGTTACGTACAGGCTGTCA 269 ACCCAACTGAATGGAGCTGTTAC 455 15.1_197 A GTACAGGCTGTCAA Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN8_R ATCATATCCCGTAGCACAA 270 ACGCACTTGACTTGTCTTCATCAT 456 G ATCCCGTAGCACAAG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT FtLVS_AM2333 Ft&NN9_F ATCAAGCTCATCTTCAAAG 279 ACCCAACTGAATGGAGCATCAAG 457 62_1646546 C CTCATCTTCAAAGC Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN9_R AACCATGTTCAGATCCAAA 280 ACGCACTTGACTTGTCTTCAACC 458 A ATGTTCAGATCCAAAA Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT FtLVS_AM2333 Ft&NN10_F TACCTCTGCCAAAAATTCA 281 ACCCAACTGAATGGAGCTACCTC 459 62_1643765 T TGCCAAAAATTCAT Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN10_R GGCATACTCAAGGTAGTGG 282 ACGCACTTGACTTGTCTTCGGCA 460 T TACTCAAGGTAGTGGT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT FtLVS_AM2333 Ft&NN11_F TCTTTGGTAGCTTGCTGACT 283 ACCCAACTGAATGGAGCTCTTTG 461 62_1562618 GTAGCTTGCTGACT Reverse Reversesequence Reversesequence primername (5->3) w/UT Ft&NN11_R CAGACGACACTTGGCTTAT 284 ACGCACTTGACTTGTCTTCCAGA 462 T CGACACTTGGCTTATT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (S->3) w/UT FtA1 FtA1 9F_FtA1_UT CATAACCCATCGCAATATC 271 ACCCAACTGAATGGAGCCATAAC 463 1 T CCATCGCAATATCT Reverse Reversesequence Reversesequence primername (5->3) w/UT 246R_FtA1_ AAATTATCTGTAGCGGCAA 272 ACGCACTTGACTTGTCTTCAAAT 464 UT2 A TATCTGTAGCGGCAAA Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT FtA2 FtA2 34F_FtA2_U GTGTCCAACGAAACCATAA 273 ACCCAACTGAATGGAGCGTGTCC 465 T1 T AACGAAACCATAAT Reverse Reversesequence Reversesequence primername (5->3) w/UT 169R_FtA2_ TTTGGTTGATTCTGTCAGTG 274 ACGCACTTGACTTGTCTTCTTTGG 466 UT2 TTGATTCTGTCAGTG Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT FtB FtB 28F_FtB_UT AAGCTTAACTGGTGATTGG 275 ACCCAACTGAATGGAGCAAGCTT 467 1 A AACTGGTGATTGGA Reverse Reversesequence Reversesequence primername (5->3) w/UT 173R_FtB_U CGCCTAACATCTTATCTGCT 276 ACGCACTTGACTTGTCTTCCGCCT 468 T2 AACATCTTATCTGCT Assay Target Forward Forwardsequence Forwardsequence name species/gene primername (5->3) w/UT FtA FtA 14F_FtA_UT GGGTGATGCAGTAGAGAAA 277 ACCCAACTGAATGGAGCGGGTG 469 1 A ATGCAGTAGAGAAAA Reverse Reversesequence Reversesequence primername (5->3) w/UT 207R_FtA_U TACCAGATGAACGAATAGC 278 ACGCACTTGACTTGTCTTCTACC 470 T2 C AGATGAACGAATAGCC
(122) All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
(123) Unless defined otherwise, all technical and scientific terms herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials, similar or equivalent to those described herein, can be used in the practice or testing of the present invention, the preferred methods and materials are described herein. All publications, patents, and patent publications cited are incorporated by reference herein in their entirety for all purposes.
(124) The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.
(125) While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims.