GENETIC POLYMORPHISMS ASSOCIATED WITH STROKE, METHODS OF DETECTION AND USES THEREOF
20230115835 · 2023-04-13
Inventors
Cpc classification
A61K31/435
HUMAN NECESSITIES
A61K31/35
HUMAN NECESSITIES
A61K31/40
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
A61K31/35
HUMAN NECESSITIES
A61K31/40
HUMAN NECESSITIES
Abstract
The present invention provides compositions and methods based on genetic polymorphisms that are associated with vascular diseases such as stroke. In particular, the present invention relates to genetic polymorphisms that have utility for such uses as predicting disease risk or predicting an individual's response to a treatment such as statins, including groups of polymorphisms that may be used as a signature marker set for such uses, as well as nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection.
Claims
1. A method of determining whether a human has an altered risk for stroke, comprising testing nucleic acid from said human for the presence or absence of a polymorphism selected from the group consisting of the polymorphisms represented by position 101 of any one of the nucleotide sequences of SEQ ID NOS:436-1566 or its complement, wherein the polymorphism indicates an altered risk for stroke.
2-3. (canceled)
4. The method of claim 1, wherein the altered risk is an increased risk.
5. The method of claim 1, wherein the altered risk is a decreased risk.
6. The method of claim 1, wherein said nucleic acid is a nucleic acid extract from a biological sample from said human.
7. The method of claim 6, wherein said biological sample is blood, saliva, or buccal cells.
8. The method of claim 6, further comprising preparing said nucleic acid extract from said biological sample prior to said testing step.
9. The method of claim 8, further comprising obtaining said biological sample from said human prior to said preparing step.
10. The method of claim 1, wherein said testing step comprises nucleic acid amplification.
11. The method of claim 10, wherein said nucleic acid amplification is carried out by polymerase chain reaction.
12. The method of claim 1, further comprising correlating the presence or absence of the polymorphism with an altered risk for stroke.
13. The method of claim 12, wherein said correlating step is performed by computer software.
14. The method of claim 1, wherein said testing is performed using sequencing, 5′ nuclease digestion, molecular beacon assay, oligonucleotide ligation assay, size analysis, single-stranded conformation polymorphism analysis, or denaturing gradient gel electrophoresis (DGGE).
15. The method of any one of claim 1, wherein said testing is performed using an allele-specific method.
16. The method of claim 15, wherein said allele-specific method is allele-specific probe hybridization, allele-specific primer extension, or allele-specific amplification.
17. The method of claim 16, wherein the method is performed using an allele-specific primer provided in Table 3.
18. (canceled)
19. The method of claim 1, further comprising correlating the presence of the polymorphism with a reduction of risk for stroke by an HMG-CoA reductase inhibitor.
20. The method of claim 19, wherein said correlating step is performed by computer software.
21-25. (canceled)
26. A method for reducing risk of stroke in a human, comprising administering to said human an effective amount of a therapeutic agent, said human having been identified as having an increased risk for stroke due to the presence or absence of a polymorphisms selected from the group consisting of the polymorphisms represented by position 101 of any one of the nucleotide sequences of SEQ ID NOS:436-1566 or its complement.
27. The method of claim 26, wherein the method comprises testing nucleic acid from said human for the presence or absence of said polymorphism.
28. The method of claim 26, wherein said therapeutic agent comprises an HMG-CoA reductase inhibitor.
29-41. (canceled)
Description
BRIEF DESCRIPTION OF THE FIGURES
[0131]
DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS OF THE INVENTION
[0132] The present invention provides SNPs associated with stroke risk, and SNPs that are associated with an individual's responsiveness to therapeutic agents, particularly statins, which may be used for the treatment (including preventive treatment) of stroke. The present invention further provides nucleic acid molecules containing SNPs, methods and reagents for the detection of the SNPs disclosed herein, uses of these SNPs for the development of detection reagents, and assays or kits that utilize such reagents. The SNPs disclosed herein are useful for diagnosing, prognosing, screening for, and evaluating predisposition to stroke and related pathologies in humans. The drug response-associated SNPs disclosed herein are particularly useful for predicting, screening for, and evaluating response to statin treatment, particularly treatment or prevention of stroke using statins, in humans. Furthermore, such SNPs and their encoded products are useful targets for the development of therapeutic and preventive agents.
[0133] A large number of SNPs have been identified from re-sequencing DNA from 39 individuals, and they are indicated as “Applera” SNP source in Tables 1-2. Their allele frequencies observed in each of the Caucasian and African-American ethnic groups are provided. Additional SNPs included herein were previously identified during shotgun sequencing and assembly of the human genome, and they are indicated as “Celera” SNP source in Tables 1-2. Furthermore, the information provided in Table 1-2, particularly the allele frequency information obtained from 39 individuals and the identification of the precise position of each SNP within each gene/transcript, allows haplotypes (i.e., groups of SNPs that are co-inherited) to be readily inferred. The present invention encompasses SNP haplotypes, as well as individual SNPs.
[0134] Thus, the present invention provides individual SNPs associated with stroke, and/or drug response (particularly statin response), as well as combinations of SNPs and haplotypes in genetic regions associated with stroke, polymorphic/variant transcript sequences (SEQ ID NOS:1-80) and genomic sequences (SEQ ID NOS:260-435) containing SNPs, encoded amino acid sequences (SEQ ID NOS: 81-160), and both transcript-based SNP context sequences (SEQ ID NOS:161-259) and genomic-based SNP context sequences (SEQ ID NOS:436-1566) (transcript sequences, protein sequences, and transcript-based SNP context sequences are provided in Table 1 and the Sequence Listing; genomic sequences and genomic-based SNP context sequences are provided in Table 2 and the Sequence Listing), methods of detecting these polymorphisms in a test sample, methods of determining the risk of an individual of having a stroke, methods of determining if an individual is likely to respond to a particular treatment such as statins (particularly for treating or preventing stroke), methods of screening for compounds useful for treating disorders associated with a variant gene/protein such as stroke, compounds identified by these screening methods, methods of using the disclosed SNPs to select a treatment/preventive strategy or therapeutic agent (e.g., a statin), methods of treating or preventing a disorder associated with a variant gene/protein, and methods of using the SNPs of the present invention for human identification.
[0135] For example, certain embodiments provide methods of using any of rs3900940/hCV7425232 (MYH15), rs3814843/hCV11476411 (CALM1), rs2200733/hCV16158671 (chromosome 4q25), and/or rs10757274/hCV26505812 (chromosome 9p21) for determining stroke risk in an individual, and methods of using rs10757274/hCV26505812 (chromosome 9p21) for determining whether an individual will benefit from statin treatment.
[0136] Since vascular disorders/diseases share certain similar features that may be due to common genetic factors that are involved in their underlying mechanisms, the SNPs identified herein as being particularly associated with stroke may be used as diagnostic/prognostic markers or therapeutic targets for other vascular diseases such as coronary heart disease (CHD), atherosclerosis, cardiovascular disease, congestive heart failure, congenital heart disease, and pathologies and symptoms associated with various heart diseases (e.g., angina, hypertension), as well as for predicting responses to drugs such as statins that are used to treat cardiovascular diseases.
[0137] The present invention further provides methods for selecting or formulating a treatment regimen (e.g., methods for determining whether or not to administer statin treatment to an individual who has previously had a stroke, or who is at risk for having a stroke in the future, methods for selecting a particular statin-based treatment regimen such as dosage and frequency of administration of statin, or a particular form/type of statin such as a particular pharmaceutical formulation or statin compound, methods for administering an alternative, non-statin-based treatment to individuals who are predicted to be unlikely to respond positively to statin treatment, etc.), and methods for determining the likelihood of experiencing toxicity or other undesirable side effects from statin treatment, etc. The present invention also provides methods for selecting individuals to whom a statin or other therapeutic will be administered based on the individual's genotype, and methods for selecting individuals for a clinical trial of a statin or other therapeutic agent based on the genotypes of the individuals (e.g., selecting individuals to participate in the trial who are most likely to respond positively from the statin treatment and/or excluding individuals from the trial who are unlikely to respond positively from the statin treatment).
[0138] The present invention provides novel SNPs associated with stroke and related pathologies, as well as SNPs that were previously known in the art, but were not previously known to be associated with stroke or response to statin treatment. Accordingly, the present invention provides novel compositions and methods based on the novel SNPs disclosed herein, and also provides novel methods of using the known, but previously unassociated, SNPs in methods relating to evaluating an individual's likelihood of having a first or recurrent stroke, prognosing the severity of stroke in an individual, or prognosing an individual's recovery from stroke, and methods relating to evaluating an individual's likelihood of responding to statin treatment (particularly statin treatment, including preventive treatment, of stroke). In Tables 1-2, known SNPs are identified based on the public database in which they have been observed, which is indicated as one or more of the following SNP types: “dbSNP”=SNP observed in dbSNP, “HGBASE”=SNP observed in HGBASE, and “HGMD”=SNP observed in the Human Gene Mutation Database (HGMD).
[0139] Particular SNP alleles of the present invention can be associated with either an increased risk of having a stroke (or related pathologies), or a decreased risk of having a stroke. SNP alleles that are associated with a decreased risk of having a stroke may be referred to as “protective” alleles, and SNP alleles that are associated with an increased risk of having a stroke may be referred to as “susceptibility” alleles, “risk” alleles, or “risk factors”. Thus, whereas certain SNPs (or their encoded products) can be assayed to determine whether an individual possesses a SNP allele that is indicative of an increased risk of having a stroke (i.e., a susceptibility allele), other SNPs (or their encoded products) can be assayed to determine whether an individual possesses a SNP allele that is indicative of a decreased risk of having a stroke (i.e., a protective allele). Similarly, particular SNP alleles of the present invention can be associated with either an increased or decreased likelihood of responding to a particular treatment or therapeutic compound (e.g., statins), or an increased or decreased likelihood of experiencing toxic effects from a particular treatment or therapeutic compound. The term “altered” may be used herein to encompass either of these two possibilities (e.g., an increased or a decreased risk/likelihood).
[0140] Those skilled in the art will readily recognize that nucleic acid molecules may be double-stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand. In defining a SNP position, SNP allele, or nucleotide sequence, reference to an adenine, a thymine (uridine), a cytosine, or a guanine at a particular site on one strand of a nucleic acid molecule also defines the thymine (uridine), adenine, guanine, or cytosine (respectively) at the corresponding site on a complementary strand of the nucleic acid molecule. Thus, reference may be made to either strand in order to refer to a particular SNP position, SNP allele, or nucleotide sequence. Probes and primers, may be designed to hybridize to either strand and SNP genotyping methods disclosed herein may generally target either strand. Throughout the specification, in identifying a SNP position, reference is generally made to the protein-encoding strand, only for the purpose of convenience.
[0141] References to variant peptides, polypeptides, or proteins of the present invention include peptides, polypeptides, proteins, or fragments thereof, that contain at least one amino acid residue that differs from the corresponding amino acid sequence of the art-known peptide/polypeptide/protein (the art-known protein may be interchangeably referred to as the “wild-type”, “reference”, or “normal” protein). Such variant peptides/polypeptides/proteins can result from a codon change caused by a nonsynonymous nucleotide substitution at a protein-coding SNP position (i.e., a missense mutation) disclosed by the present invention. Variant peptides/polypeptides/proteins of the present invention can also result from a nonsense mutation, i.e., a SNP that creates a premature stop codon, a SNP that generates a read-through mutation by abolishing a stop codon, or due to any SNP disclosed by the present invention that otherwise alters the structure, function/activity, or expression of a protein, such as a SNP in a regulatory region (e.g. a promoter or enhancer) or a SNP that leads to alternative or defective splicing, such as a SNP in an intron or a SNP at an exon/intron boundary. As used herein, the terms “polypeptide”, “peptide”, and “protein” are used interchangeably.
[0142] As used herein, an “allele” may refer to a nucleotide at a SNP position (wherein at least two alternative nucleotides are present in the population at the SNP position, in accordance with the inherent definition of a SNP) or may refer to an amino acid residue that is encoded by the codon which contains the SNP position (where the alternative nucleotides that are present in the population at the SNP position form alternative codons that encode different amino acid residues). An “allele” may also be referred to herein as a “variant”. Also, an amino acid residue that is encoded by a codon containing a particular SNP may simply be referred to as being encoded by the SNP.
[0143] A phrase such as “as represented by”, “as shown by”, “as symbolized by”, or “as designated by” may be used herein to refer to a SNP within a sequence (e.g., a polynucleotide context sequence surrounding a SNP), such as in the context of “a polymorphism as represented by position 101 of SEQ ID NO:X or its complement”. Typically, the sequence surrounding a SNP may be recited when referring to a SNP, however the sequence is not intended as a structural limitation beyond the specific SNP position itself. Rather, the sequence is recited merely as a way of referring to the SNP (in this example, “SEQ ID NO:X or its complement” is recited in order to refer to the SNP located at position 101 of SEQ ID NO:X, but SEQ ID NO:X or its complement is not intended as a structural limitation beyond the specific SNP position itself). A SNP is a variation at a single nucleotide position and therefore it is customary to refer to context sequence (e.g., SEQ ID NO:X in this example) surrounding a particular SNP position in order to uniquely identify and refer to the SNP. Alternatively, a SNP can be referred to by a unique identification number such as a public “rs” identification number or an internal “hCV” identification number, such as provided herein for each SNP (e.g., in Tables 1-2).
[0144] With respect to an individual's risk for a disease or predicted drug responsiveness (e.g., based on the presence or absence of one or more SNPs disclosed herein in the individual's nucleic acid), terms such as “assigning” or “designating” may be used herein to characterize the individual's risk for the disease.
[0145] As used herein, the term “benefit” (with respect to a preventive or therapeutic drug treatment) is defined as achieving a reduced risk for a disease that the drug is intended to treat or prevent (e.g., stroke) by administrating the drug treatment (e.g., a statin), compared with the risk for the disease in the absence of receiving the drug treatment (or receiving a placebo in lieu of the drug treatment) for the same genotype. The term “benefit” may be used herein interchangeably with terms such as “respond positively” or “positively respond”.
[0146] As used herein, the terms “drug” and “therapeutic agent” are used interchangeably, and may include, but are not limited to, small molecule compounds, biologics (e.g., antibodies, proteins, protein fragments, fusion proteins, glycoproteins, etc.), nucleic acid agents (e.g., antisense, RNAi/siRNA, and microRNA molecules, etc.), vaccines, etc., which may be used for therapeutic and/or preventive treatment of a disease (e.g., stroke).
[0147] The statin response-associated SNPs disclosed herein are useful with respect to any statin (HMG-CoA reductase inhibitor), including but not limited to pravastatin (Pravachol®), atorvastatin (Lipitor®), storvastatin, rosuvastatin (Crestor®), fluvastatin (Lescol®), lovastatin (Mevacor®), and simvastatin (Zocor®), as well as combination therapies that include a statin such as simvastatin+ezetimibe (Vytorin®), lovastatin+niacin extended-release (Advicor®), and atorvastatin+amlodipine besylate (Caduet®).
[0148] Furthermore, the drug response-associated SNPs disclosed herein may also be used for predicting an individual's responsiveness to drugs other than statins that are used to treat or prevent stroke, and these SNPs may also be used for predicting an individual's responsiveness to statins for the treatment or prevention of disorders other than stroke, particularly cancer. For example, the use of statins in the treatment of cancer is reviewed in: Hindler et al., “The role of statins in cancer therapy”, Oncologist. 2006 March; 11(3):306-15; Demierre et al., “Statins and cancer prevention”, Nat Rev Cancer. 2005 December; 5(12):930-42; Stamm et al., “The role of statins in cancer prevention and treatment”, Oncology. 2005 May; 19(6):739-50; and Sleijfer et al., “The potential of statins as part of anti-cancer treatment”, Eur J Cancer. 2005 March; 41(4):516-22, each of which is incorporated herein by reference in their entirety.
[0149] Drug response with respect to statins may be referred to herein as “stroke statin response” or “SSR”.
[0150] The various methods described herein, such as correlating the presence or absence of a polymorphism with an altered (e.g., increased or decreased) risk (or no altered risk) for stroke (and/or correlating the presence or absence of a polymorphism with the predicted response of an individual to a drug such as a statin), can be carried out by automated methods such as by using a computer (or other apparatus/devices such as biomedical devices, laboratory instrumentation, or other apparatus/devices having a computer processor) programmed to carry out any of the methods described herein. For example, computer software (which may be interchangeably referred to herein as a computer program) can perform the step of correlating the presence or absence of a polymorphism in an individual with an altered (e.g., increased or decreased) risk (or no altered risk) for stroke for the individual. Computer software can also perform the step of correlating the presence or absence of a polymorphism in an individual with the predicted response of the individual to a therapeutic agent (such as a statin) or other treatment. Accordingly, certain embodiments of the invention provide a computer (or other apparatus/device) programmed to carry out any of the methods described herein.
[0151] Reports, Programmed Computers, Business Methods, and Systems
[0152] The results of a test (e.g., an individual's risk for stroke or an individual's predicted drug responsiveness such as statin response, based on assaying one or more SNPs disclosed herein, and/or an individual's allele(s)/genotype at one or more SNPs disclosed herein, etc.), and/or any other information pertaining to a test, may be referred to herein as a “report”. A tangible report can optionally be generated as part of a testing process (which may be interchangeably referred to herein as “reporting”, or as “providing” a report, “producing” a report, or “generating” a report).
[0153] Examples of tangible reports may include, but are not limited to, reports in paper (such as computer-generated printouts of test results) or equivalent formats and reports stored on computer readable medium (such as a CD, USB flash drive or other removable storage device, computer hard drive, or computer network server, etc.). Reports, particularly those stored on computer readable medium, can be part of a database, which may optionally be accessible via the internet (such as a database of patient records or genetic information stored on a computer network server, which may be a “secure database” that has security features that limit access to the report, such as to allow only the patient and the patient's medical practioners to view the report while preventing other unauthorized individuals from viewing the report, for example). In addition to, or as an alternative to, generating a tangible report, reports can also be displayed on a computer screen (or the display of another electronic device or instrument).
[0154] A report can include, for example, an individual's risk for stroke, or may just include the allele(s)/genotype that an individual carries at one or more SNPs disclosed herein, which may optionally be linked to information regarding the significance of having the allele(s)/genotype at the SNP (for example, a report on computer readable medium such as a network server may include hyperlink(s) to one or more journal publications or websites that describe the medical/biological implications, such as increased or decreased disease risk, for individuals having a certain allele/genotype at the SNP). Thus, for example, the report can include disease risk or other medical/biological significance (e.g., drug responsiveness, etc.) as well as optionally also including the allele/genotype information, or the report may just include allele/genotype information without including disease risk or other medical/biological significance (such that an individual viewing the report can use the allele/genotype information to determine the associated disease risk or other medical/biological significance from a source outside of the report itself, such as from a medical practioner, publication, website, etc., which may optionally be linked to the report such as by a hyperlink).
[0155] A report can further be “transmitted” or “communicated” (these terms may be used herein interchangeably), such as to the individual who was tested, a medical practitioner (e.g., a doctor, nurse, clinical laboratory practitioner, genetic counselor, etc.), a healthcare organization, a clinical laboratory, and/or any other party or requester intended to view or possess the report. The act of “transmitting” or “communicating” a report can be by any means known in the art, based on the format of the report. Furthermore, “transmitting” or “communicating” a report can include delivering a report (“pushing”) and/or retrieving (“pulling”) a report. For example, reports can be transmitted/communicated by various means, including being physically transferred between parties (such as for reports in paper format) such as by being physically delivered from one party to another, or by being transmitted electronically or in signal form (e.g., via e-mail or over the internet, by facsimile, and/or by any wired or wireless communication methods known in the art) such as by being retrieved from a database stored on a computer network server, etc.
[0156] In certain exemplary embodiments, the invention provides computers (or other apparatus/devices such as biomedical devices or laboratory instrumentation) programmed to carry out the methods described herein. For example, in certain embodiments, the invention provides a computer programmed to receive (i.e., as input) the identity (e.g., the allele(s) or genotype at a SNP) of one or more SNPs disclosed herein and provide (i.e., as output) the disease risk (e.g., an individual's risk for stroke) or other result (e.g., disease diagnosis or prognosis, drug responsiveness, etc.) based on the identity of the SNP(s). Such output (e.g., communication of disease risk, disease diagnosis or prognosis, drug responsiveness, etc.) may be, for example, in the form of a report on computer readable medium, printed in paper form, and/or displayed on a computer screen or other display.
[0157] In various exemplary embodiments, the invention further provides methods of doing business (with respect to methods of doing business, the terms “individual” and “customer” are used herein interchangeably). For example, exemplary methods of doing business can comprise assaying one or more SNPs disclosed herein and providing a report that includes, for example, a customer's risk for stroke (based on which allele(s)/genotype is present at the assayed SNP(s)) and/or that includes the allele(s)/genotype at the assayed SNP(s) which may optionally be linked to information (e.g., journal publications, websites, etc.) pertaining to disease risk or other biological/medical significance such as by means of a hyperlink (the report may be provided, for example, on a computer network server or other computer readable medium that is internet-accessible, and the report may be included in a secure database that allows the customer to access their report while preventing other unauthorized individuals from viewing the report), and optionally transmitting the report. Customers (or another party who is associated with the customer, such as the customer's doctor, for example) can request/order (e.g., purchase) the test online via the internet (or by phone, mail order, at an outlet/store, etc.), for example, and a kit can be sent/delivered (or otherwise provided) to the customer (or another party on behalf of the customer, such as the customer's doctor, for example) for collection of a biological sample from the customer (e.g., a buccal swab for collecting buccal cells), and the customer (or a party who collects the customer's biological sample) can submit their biological samples for assaying (e.g., to a laboratory or party associated with the laboratory such as a party that accepts the customer samples on behalf of the laboratory, a party for whom the laboratory is under the control of (e.g., the laboratory carries out the assays by request of the party or under a contract with the party, for example), and/or a party that receives at least a portion of the customer's payment for the test). The report (e.g., results of the assay including, for example, the customer's disease risk and/or allele(s)/genotype at the assayed SNP(s)) may be provided to the customer by, for example, the laboratory that assays the SNP(s) or a party associated with the laboratory (e.g., a party that receives at least a portion of the customer's payment for the assay, or a party that requests the laboratory to carry out the assays or that contracts with the laboratory for the assays to be carried out) or a doctor or other medical practitioner who is associated with (e.g., employed by or having a consulting or contracting arrangement with) the laboratory or with a party associated with the laboratory, or the report may be provided to a third party (e.g., a doctor, genetic counselor, hospital, etc.) which optionally provides the report to the customer. In further embodiments, the customer may be a doctor or other medical practitioner, or a hospital, laboratory, medical insurance organization, or other medical organization that requests/orders (e.g., purchases) tests for the purposes of having other individuals (e.g., their patients or customers) assayed for one or more SNPs disclosed herein and optionally obtaining a report of the assay results.
[0158] In certain exemplary methods of doing business, kits for collecting a biological sample from a customer (e.g., a buccal swab for collecting buccal cells) are provided (e.g., for sale), such as at an outlet (e.g., a drug store, pharmacy, general merchandise store, or any other desirable outlet), online via the internet, by mail order, etc., whereby customers can obtain (e.g., purchase) the kits, collect their own biological samples, and submit (e.g., send/deliver via mail) their samples to a laboratory which assays the samples for one or more SNPs disclosed herein (such as to determine the customer's risk for stroke) and optionally provides a report to the customer (of the customer's disease risk based on their SNP genotype(s), for example) or provides the results of the assay to another party (e.g., a doctor, genetic counselor, hospital, etc.) which optionally provides a report to the customer (of the customer's disease risk based on their SNP genotype(s), for example).
[0159] Certain further embodiments of the invention provide a system for determining an individual's stroke risk, or whether an individual will benefit from statin treatment (or other therapy) in reducing stroke risk. Certain exemplary systems comprise an integrated “loop” in which an individual (or their medical practitioner) requests a determination of such individual's stroke risk (or drug response, etc.), this determination is carried out by testing a sample from the individual, and then the results of this determination are provided back to the requestor. For example, in certain systems, a sample (e.g., blood or buccal cells) is obtained from an individual for testing (the sample may be obtained by the individual or, for example, by a medical practitioner), the sample is submitted to a laboratory (or other facility) for testing (e.g., determining the genotype of one or more SNPs disclosed herein), and then the results of the testing are sent to the patient (which optionally can be done by first sending the results to an intermediary, such as a medical practioner, who then provides or otherwise conveys the results to the individual), thereby forming an integrated loop system for determining an individual's stroke risk (or drug response, etc.). The portions of the system in which the results are transmitted (e.g., between any of a testing facility, a medical practitioner, and/or the individual) can be carried out by way of electronic or signal transmission (e.g., by computer such as via e-mail or the internet, by providing the results on a website or computer network server which may optionally be a secure database, by phone or fax, or by any other wired or wireless transmission methods known in the art).
Isolated Nucleic Acid Molecules and SNP Detection Reagents & Kits
[0160] Tables 1 and 2 provide a variety of information about each SNP of the present invention that is associated with stroke, including the transcript sequences (SEQ ID NOS:1-80), genomic sequences (SEQ ID NOS:260-435), and protein sequences (SEQ ID NOS:81-160) of the encoded gene products (with the SNPs indicated by IUB codes in the nucleic acid sequences). In addition, Tables 1 and 2 include SNP context sequences, which generally include 100 nucleotide upstream (5′) plus 100 nucleotides downstream (3′) of each SNP position (SEQ ID NOS:161-259 correspond to transcript-based SNP context sequences disclosed in Table 1, and SEQ ID NOS:436-1566 correspond to genomic-based context sequences disclosed in Table 2), the alternative nucleotides (alleles) at each SNP position, and additional information about the variant where relevant, such as SNP type (coding, missense, splice site, UTR, etc.), human populations in which the SNP was observed, observed allele frequencies, information about the encoded protein, etc.
[0161] Isolated Nucleic Acid Molecules
[0162] The present invention provides isolated nucleic acid molecules that contain one or more SNPs disclosed Table 1 and/or Table 2. Preferred isolated nucleic acid molecules contain one or more SNPs identified as Applera or Celera proprietary. Isolated nucleic acid molecules containing one or more SNPs disclosed in at least one of Tables 1-2 may be interchangeably referred to throughout the present text as “SNP-containing nucleic acid molecules”. Isolated nucleic acid molecules may optionally encode a full-length variant protein or fragment thereof. The isolated nucleic acid molecules of the present invention also include probes and primers (which are described in greater detail below in the section entitled “SNP Detection Reagents”), which may be used for assaying the disclosed SNPs, and isolated full-length genes, transcripts, cDNA molecules, and fragments thereof, which may be used for such purposes as expressing an encoded protein.
[0163] As used herein, an “isolated nucleic acid molecule” generally is one that contains a SNP of the present invention or one that hybridizes to such molecule such as a nucleic acid with a complementary sequence, and is separated from most other nucleic acids present in the natural source of the nucleic acid molecule. Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule containing a SNP of the present invention, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. A nucleic acid molecule can be fused to other coding or regulatory sequences and still be considered “isolated”. Nucleic acid molecules present in non-human transgenic animals, which do not naturally occur in the animal, are also considered “isolated”. For example, recombinant DNA molecules contained in a vector are considered “isolated”. Further examples of “isolated” DNA molecules include recombinant DNA molecules maintained in heterologous host cells, and purified (partially or substantially) DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the isolated SNP-containing DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
[0164] Generally, an isolated SNP-containing nucleic acid molecule comprises one or more SNP positions disclosed by the present invention with flanking nucleotide sequences on either side of the SNP positions. A flanking sequence can include nucleotide residues that are naturally associated with the SNP site and/or heterologous nucleotide sequences. Preferably the flanking sequence is up to about 500, 300, 100, 60, 50, 30, 25, 20, 15, 10, 8, or 4 nucleotides (or any other length in-between) on either side of a SNP position, or as long as the full-length gene or entire protein-coding sequence (or any portion thereof such as an exon), especially if the SNP-containing nucleic acid molecule is to be used to produce a protein or protein fragment.
[0165] For full-length genes and entire protein-coding sequences, a SNP flanking sequence can be, for example, up to about 5 KB, 4 KB, 3 KB, 2 KB, 1 KB on either side of the SNP. Furthermore, in such instances, the isolated nucleic acid molecule comprises exonic sequences (including protein-coding and/or non-coding exonic sequences), but may also include intronic sequences. Thus, any protein coding sequence may be either contiguous or separated by introns. The important point is that the nucleic acid is isolated from remote and unimportant flanking sequences and is of appropriate length such that it can be subjected to the specific manipulations or uses described herein such as recombinant protein expression, preparation of probes and primers for assaying the SNP position, and other uses specific to the SNP-containing nucleic acid sequences.
[0166] An isolated SNP-containing nucleic acid molecule can comprise, for example, a full-length gene or transcript, such as a gene isolated from genomic DNA (e.g., by cloning or PCR amplification), a cDNA molecule, or an mRNA transcript molecule. Polymorphic transcript sequences are provided in Table 1 and in the Sequence Listing (SEQ ID NOS:1-80), and polymorphic genomic sequences are provided in Table 2 and in the Sequence Listing (SEQ ID NOS:260-435). Furthermore, fragments of such full-length genes and transcripts that contain one or more SNPs disclosed herein are also encompassed by the present invention, and such fragments may be used, for example, to express any part of a protein, such as a particular functional domain or an antigenic epitope.
[0167] Thus, the present invention also encompasses fragments of the nucleic acid sequences provided in Tables 1-2 (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566) and their complements. A fragment typically comprises a contiguous nucleotide sequence at least about 8 or more nucleotides, more preferably at least about 12 or more nucleotides, and even more preferably at least about 16 or more nucleotides. Further, a fragment could comprise at least about 18, 20, 22, 25, 30, 40, 50, 60, 80, 100, 150, 200, 250 or 500 (or any other number in-between) nucleotides in length. The length of the fragment will be based on its intended use. For example, the fragment can encode epitope-bearing regions of a variant peptide or regions of a variant peptide that differ from the normal/wild-type protein, or can be useful as a polynucleotide probe or primer. Such fragments can be isolated using the nucleotide sequences provided in Table 1 and/or Table 2 for the synthesis of a polynucleotide probe. A labeled probe can then be used, for example, to screen a cDNA library, genomic DNA library, or mRNA to isolate nucleic acid corresponding to the coding region. Further, primers can be used in amplification reactions, such as for purposes of assaying one or more SNPs sites or for cloning specific regions of a gene.
[0168] An isolated nucleic acid molecule of the present invention further encompasses a SNP-containing polynucleotide that is the product of any one of a variety of nucleic acid amplification methods, which are used to increase the copy numbers of a polynucleotide of interest in a nucleic acid sample. Such amplification methods are well known in the art, and they include but are not limited to, polymerase chain reaction (PCR) (U.S. Pat. Nos. 4,683,195; and 4,683,202; PCR Technology: Principles and Applications for DNA Amplification, ed. H. A. Erlich, Freeman Press, NY, N.Y., 1992), ligase chain reaction (LCR) (Wu and Wallace, Genomics 4:560, 1989; Landegren et al., Science 241:1077, 1988), strand displacement amplification (SDA) (U.S. Pat. Nos. 5,270,184; and 5,422,252), transcription-mediated amplification (TMA) (U.S. Pat. No. 5,399,491), linked linear amplification (LLA) (U.S. Pat. No. 6,027,923), and the like, and isothermal amplification methods such as nucleic acid sequence based amplification (NASBA), and self-sustained sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87: 1874, 1990). Based on such methodologies, a person skilled in the art can readily design primers in any suitable regions 5′ and 3′ to a SNP disclosed herein. Such primers may be used to amplify DNA of any length so long that it contains the SNP of interest in its sequence.
[0169] As used herein, an “amplified polynucleotide” of the invention is a SNP-containing nucleic acid molecule whose amount has been increased at least two fold by any nucleic acid amplification method performed in vitro as compared to its starting amount in a test sample. In other preferred embodiments, an amplified polynucleotide is the result of at least ten-fold, fifty-fold, one hundred-fold, one thousand-fold, or ten thousand-fold increase as compared to its starting amount in a test sample. In a typical PCR amplification, a polynucleotide of interest is often amplified at least fifty thousand-fold in amount over the unamplified genomic DNA, but the precise amount of amplification needed for an assay typically depends on the sensitivity of the subsequent detection method used.
[0170] Generally, an amplified polynucleotide is at least about 16 nucleotides in length. More typically, an amplified polynucleotide is at least about 20 nucleotides in length. In a preferred embodiment of the invention, an amplified polynucleotide is at least about 30 nucleotides in length. In a more preferred embodiment of the invention, an amplified polynucleotide is at least about 32, 40, 45, 50, or 60 nucleotides in length. In yet another preferred embodiment of the invention, an amplified polynucleotide is at least about 100, 200, 300, 400, or 500 nucleotides in length. While the total length of an amplified polynucleotide of the invention can be as long as an exon, an intron or the entire gene where the SNP of interest resides, an amplified product is typically up to about 1,000 nucleotides in length (although certain amplification methods may generate amplified products greater than 1000 nucleotides in length). More preferably, an amplified polynucleotide is not greater than about 600-700 nucleotides in length. It is understood that irrespective of the length of an amplified polynucleotide, a SNP of interest may be located anywhere along its sequence.
[0171] In a specific embodiment of the invention, the amplified product is at least about 201 nucleotides in length, comprises one of the transcript-based context sequences or the genomic-based context sequences shown in Tables 1-2. Such a product may have additional sequences on its 5′ end or 3′ end or both. In another embodiment, the amplified product is about 101 nucleotides in length, and it contains a SNP disclosed herein. Preferably, the SNP is located at the middle of the amplified product (e.g., at position 101 in an amplified product that is 201 nucleotides in length, or at position 51 in an amplified product that is 101 nucleotides in length), or within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, or 20 nucleotides from the middle of the amplified product (however, as indicated above, the SNP of interest may be located anywhere along the length of the amplified product).
[0172] The present invention provides isolated nucleic acid molecules that comprise, consist of, or consist essentially of one or more polynucleotide sequences that contain one or more SNPs disclosed herein, complements thereof, and SNP-containing fragments thereof.
[0173] Accordingly, the present invention provides nucleic acid molecules that consist of any of the nucleotide sequences shown in Table 1 and/or Table 2 (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS:81-160). A nucleic acid molecule consists of a nucleotide sequence when the nucleotide sequence is the complete nucleotide sequence of the nucleic acid molecule.
[0174] The present invention further provides nucleic acid molecules that consist essentially of any of the nucleotide sequences shown in Table 1 and/or Table 2 (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS:81-160). A nucleic acid molecule consists essentially of a nucleotide sequence when such a nucleotide sequence is present with only a few additional nucleotide residues in the final nucleic acid molecule.
[0175] The present invention further provides nucleic acid molecules that comprise any of the nucleotide sequences shown in Table 1 and/or Table 2 or a SNP-containing fragment thereof (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS:81-160). A nucleic acid molecule comprises a nucleotide sequence when the nucleotide sequence is at least part of the final nucleotide sequence of the nucleic acid molecule. In such a fashion, the nucleic acid molecule can be only the nucleotide sequence or have additional nucleotide residues, such as residues that are naturally associated with it or heterologous nucleotide sequences. Such a nucleic acid molecule can have one to a few additional nucleotides or can comprise many more additional nucleotides. A brief description of how various types of these nucleic acid molecules can be readily made and isolated is provided below, and such techniques are well known to those of ordinary skill in the art (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY).
[0176] The isolated nucleic acid molecules can encode mature proteins plus additional amino or carboxyl-terminal amino acids or both, or amino acids interior to the mature peptide (when the mature form has more than one peptide chain, for instance). Such sequences may play a role in processing of a protein from precursor to a mature form, facilitate protein trafficking, prolong or shorten protein half-life, or facilitate manipulation of a protein for assay or production. As generally is the case in situ, the additional amino acids may be processed away from the mature protein by cellular enzymes.
[0177] Thus, the isolated nucleic acid molecules include, but are not limited to, nucleic acid molecules having a sequence encoding a peptide alone, a sequence encoding a mature peptide and additional coding sequences such as a leader or secretory sequence (e.g., a pre-pro or pro-protein sequence), a sequence encoding a mature peptide with or without additional coding sequences, plus additional non-coding sequences, for example introns and non-coding 5′ and 3′ sequences such as transcribed but untranslated sequences that play a role in, for example, transcription, mRNA processing (including splicing and polyadenylation signals), ribosome binding, and/or stability of mRNA. In addition, the nucleic acid molecules may be fused to heterologous marker sequences encoding, for example, a peptide that facilitates purification.
[0178] Isolated nucleic acid molecules can be in the form of RNA, such as mRNA, or in the form DNA, including cDNA and genomic DNA, which may be obtained, for example, by molecular cloning or produced by chemical synthetic techniques or by a combination thereof (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY). Furthermore, isolated nucleic acid molecules, particularly SNP detection reagents such as probes and primers, can also be partially or completely in the form of one or more types of nucleic acid analogs, such as peptide nucleic acid (PNA) (U.S. Pat. Nos. 5,539,082; 5,527,675; 5,623,049; 5,714,331). The nucleic acid, especially DNA, can be double-stranded or single-stranded. Single-stranded nucleic acid can be the coding strand (sense strand) or the complementary non-coding strand (anti-sense strand). DNA, RNA, or PNA segments can be assembled, for example, from fragments of the human genome (in the case of DNA or RNA) or single nucleotides, short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic nucleic acid molecule. Nucleic acid molecules can be readily synthesized using the sequences provided herein as a reference; oligonucleotide and PNA oligomer synthesis techniques are well known in the art (see, e.g., Corey, “Peptide nucleic acids: expanding the scope of nucleic acid recognition”, Trends Biotechnol. 1997 June; 15(6):224-9, and Hyrup et al., “Peptide nucleic acids (PNA): synthesis, properties and potential applications”, Bioorg Med Chem. 1996 January; 4(1):5-23). Furthermore, large-scale automated oligonucleotide/PNA synthesis (including synthesis on an array or bead surface or other solid support) can readily be accomplished using commercially available nucleic acid synthesizers, such as the Applied Biosystems (Foster City, Calif.) 3900 High-Throughput DNA Synthesizer or Expedite 8909 Nucleic Acid Synthesis System, and the sequence information provided herein.
[0179] The present invention encompasses nucleic acid analogs that contain modified, synthetic, or non-naturally occurring nucleotides or structural elements or other alternative/modified nucleic acid chemistries known in the art. Such nucleic acid analogs are useful, for example, as detection reagents (e.g., primers/probes) for detecting one or more SNPs identified in Table 1 and/or Table 2. Furthermore, kits/systems (such as beads, arrays, etc.) that include these analogs are also encompassed by the present invention. For example, PNA oligomers that are based on the polymorphic sequences of the present invention are specifically contemplated. PNA oligomers are analogs of DNA in which the phosphate backbone is replaced with a peptide-like backbone (Lagriffoul et al., Bioorganic & Medicinal Chemistry Letters, 4: 1081-1082 (1994), Petersen et al., Bioorganic & Medicinal Chemistry Letters, 6: 793-796 (1996), Kumar et al., Organic Letters 3(9): 1269-1272 (2001), WO96/04000). PNA hybridizes to complementary RNA or DNA with higher affinity and specificity than conventional oligonucleotides and oligonucleotide analogs. The properties of PNA enable novel molecular biology and biochemistry applications unachievable with traditional oligonucleotides and peptides.
[0180] Additional examples of nucleic acid modifications that improve the binding properties and/or stability of a nucleic acid include the use of base analogs such as inosine, intercalators (U.S. Pat. No. 4,835,263) and the minor groove binders (U.S. Pat. No. 5,801,115). Thus, references herein to nucleic acid molecules, SNP-containing nucleic acid molecules, SNP detection reagents (e.g., probes and primers), oligonucleotides/polynucleotides include PNA oligomers and other nucleic acid analogs. Other examples of nucleic acid analogs and alternative/modified nucleic acid chemistries known in the art are described in Current Protocols in Nucleic Acid Chemistry, John Wiley & Sons, N.Y. (2002).
[0181] The present invention further provides nucleic acid molecules that encode fragments of the variant polypeptides disclosed herein as well as nucleic acid molecules that encode obvious variants of such variant polypeptides. Such nucleic acid molecules may be naturally occurring, such as paralogs (different locus) and orthologs (different organism), or may be constructed by recombinant DNA methods or by chemical synthesis. Non-naturally occurring variants may be made by mutagenesis techniques, including those applied to nucleic acid molecules, cells, or organisms. Accordingly, the variants can contain nucleotide substitutions, deletions, inversions and insertions (in addition to the SNPs disclosed in Tables 1-2). Variation can occur in either or both the coding and non-coding regions. The variations can produce conservative and/or non-conservative amino acid substitutions.
[0182] Further variants of the nucleic acid molecules disclosed in Tables 1-2, such as naturally occurring allelic variants (as well as orthologs and paralogs) and synthetic variants produced by mutagenesis techniques, can be identified and/or produced using methods well known in the art. Such further variants can comprise a nucleotide sequence that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with a nucleic acid sequence disclosed in Table 1 and/or Table 2 (or a fragment thereof) and that includes a novel SNP allele disclosed in Table 1 and/or Table 2. Further, variants can comprise a nucleotide sequence that encodes a polypeptide that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with a polypeptide sequence disclosed in Table 1 (or a fragment thereof) and that includes a novel SNP allele disclosed in Table 1 and/or Table 2. Thus, an aspect of the present invention that is specifically contemplated are isolated nucleic acid molecules that have a certain degree of sequence variation compared with the sequences shown in Tables 1-2, but that contain a novel SNP allele disclosed herein. In other words, as long as an isolated nucleic acid molecule contains a novel SNP allele disclosed herein, other portions of the nucleic acid molecule that flank the novel SNP allele can vary to some degree from the specific transcript, genomic, and context sequences shown in Tables 1-2, and can encode a polypeptide that varies to some degree from the specific polypeptide sequences shown in Table 1.
[0183] To determine the percent identity of two amino acid sequences or two nucleotide sequences of two molecules that share sequence homology, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the length of a reference sequence is aligned for comparison purposes. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein, amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
[0184] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch algorithm (J. Mol. Biol. (48):444-453 (1970)) which has been incorporated into the GAP program in the GCG software package, using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
[0185] In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (Devereux, J., et al., Nucleic Acids Res. 12(1):387 (1984)), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. In another embodiment, the percent identity between two amino acid or nucleotide sequences is determined using the algorithm of E. Myers and W. Miller (CABIOS, 4:11-17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.
[0186] The nucleotide and amino acid sequences of the present invention can further be used as a “query sequence” to perform a search against sequence databases to, for example, identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (J. Mol. Biol. 215:403-10 (1990)). BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the proteins of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Res. 25(17):3389-3402 (1997)). When utilizing BLAST and gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. In addition to BLAST, examples of other search and sequence comparison programs used in the art include, but are not limited to, FASTA (Pearson, Methods Mol. Biol. 25, 365-389 (1994)) and KERR (Dufresne et al., Nat Biotechnol 2002 December; 20(12):1269-71). For further information regarding bioinformatics techniques, see Current Protocols in Bioinformatics, John Wiley & Sons, Inc., N.Y.
[0187] The present invention further provides non-coding fragments of the nucleic acid molecules disclosed in Table 1 and/or Table 2. Preferred non-coding fragments include, but are not limited to, promoter sequences, enhancer sequences, intronic sequences, 5′ untranslated regions (UTRs), 3′ untranslated regions, gene modulating sequences and gene termination sequences. Such fragments are useful, for example, in controlling heterologous gene expression and in developing screens to identify gene-modulating agents.
[0188] SNP Detection Reagents
[0189] In a specific aspect of the present invention, the SNPs disclosed in Table 1 and/or Table 2, and their associated transcript sequences (provided in Table 1 as SEQ ID NOS:1-80), genomic sequences (provided in Table 2 as SEQ ID NOS:260-435), and context sequences (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:161-259; genomic-based context sequences are provided in Table 2 as SEQ ID NOS:436-1566), can be used for the design of SNP detection reagents. As used herein, a “SNP detection reagent” is a reagent that specifically detects a specific target SNP position disclosed herein, and that is preferably specific for a particular nucleotide (allele) of the target SNP position (i.e., the detection reagent preferably can differentiate between different alternative nucleotides at a target SNP position, thereby allowing the identity of the nucleotide present at the target SNP position to be determined). Typically, such detection reagent hybridizes to a target SNP-containing nucleic acid molecule by complementary base-pairing in a sequence specific manner, and discriminates the target variant sequence from other nucleic acid sequences such as an art-known form in a test sample. An example of a detection reagent is a probe that hybridizes to a target nucleic acid containing one or more of the SNPs provided in Table 1 and/or Table 2. In a preferred embodiment, such a probe can differentiate between nucleic acids having a particular nucleotide (allele) at a target SNP position from other nucleic acids that have a different nucleotide at the same target SNP position. In addition, a detection reagent may hybridize to a specific region 5′ and/or 3′ to a SNP position, particularly a region corresponding to the context sequences provided in Table 1 and/or Table 2 (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:161-259; genomic-based context sequences are provided in Table 2 as SEQ ID NOS:436-1566). Another example of a detection reagent is a primer which acts as an initiation point of nucleotide extension along a complementary strand of a target polynucleotide. The SNP sequence information provided herein is also useful for designing primers, e.g. allele-specific primers, to amplify (e.g., using PCR) any SNP of the present invention.
[0190] In one preferred embodiment of the invention, a SNP detection reagent is an isolated or synthetic DNA or RNA polynucleotide probe or primer or PNA oligomer, or a combination of DNA, RNA and/or PNA, that hybridizes to a segment of a target nucleic acid molecule containing a SNP identified in Table 1 and/or Table 2. A detection reagent in the form of a polynucleotide may optionally contain modified base analogs, intercalators or minor groove binders. Multiple detection reagents such as probes may be, for example, affixed to a solid support (e.g., arrays or beads) or supplied in solution (e.g., probe/primer sets for enzymatic reactions such as PCR, RT-PCR, TaqMan assays, or primer-extension reactions) to form a SNP detection kit.
[0191] A probe or primer typically is a substantially purified oligonucleotide or PNA oligomer. Such oligonucleotide typically comprises a region of complementary nucleotide sequence that hybridizes under stringent conditions to at least about 8, 10, 12, 16, 18, 20, 22, 25, 30, 40, 50, 55, 60, 65, 70, 80, 90, 100, 120 (or any other number in-between) or more consecutive nucleotides in a target nucleic acid molecule. Depending on the particular assay, the consecutive nucleotides can either include the target SNP position, or be a specific region in close enough proximity 5′ and/or 3′ to the SNP position to carry out the desired assay.
[0192] Other preferred primer and probe sequences can readily be determined using the transcript sequences (SEQ ID NOS:1-80), genomic sequences (SEQ ID NOS:260-435), and SNP context sequences (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:161-259; genomic-based context sequences are provided in Table 2 as SEQ ID NOS:436-1566) disclosed in the Sequence Listing and in Tables 1-2. It will be apparent to one of skill in the art that such primers and probes are directly useful as reagents for genotyping the SNPs of the present invention, and can be incorporated into any kit/system format.
[0193] In order to produce a probe or primer specific for a target SNP-containing sequence, the gene/transcript and/or context sequence surrounding the SNP of interest is typically examined using a computer algorithm which starts at the 5′ or at the 3′ end of the nucleotide sequence. Typical algorithms will then identify oligomers of defined length that are unique to the gene/SNP context sequence, have a GC content within a range suitable for hybridization, lack predicted secondary structure that may interfere with hybridization, and/or possess other desired characteristics or that lack other undesired characteristics.
[0194] A primer or probe of the present invention is typically at least about 8 nucleotides in length. In one embodiment of the invention, a primer or a probe is at least about 10 nucleotides in length. In a preferred embodiment, a primer or a probe is at least about 12 nucleotides in length. In a more preferred embodiment, a primer or probe is at least about 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. While the maximal length of a probe can be as long as the target sequence to be detected, depending on the type of assay in which it is employed, it is typically less than about 50, 60, 65, or 70 nucleotides in length. In the case of a primer, it is typically less than about 30 nucleotides in length. In a specific preferred embodiment of the invention, a primer or a probe is within the length of about 18 and about 28 nucleotides. However, in other embodiments, such as nucleic acid arrays and other embodiments in which probes are affixed to a substrate, the probes can be longer, such as on the order of 30-70, 75, 80, 90, 100, or more nucleotides in length (see the section below entitled “SNP Detection Kits and Systems”).
[0195] For analyzing SNPs, it may be appropriate to use oligonucleotides specific for alternative SNP alleles. Such oligonucleotides which detect single nucleotide variations in target sequences may be referred to by such terms as “allele-specific oligonucleotides”, “allele-specific probes”, or “allele-specific primers”. The design and use of allele-specific probes for analyzing polymorphisms is described in, e.g., Mutation Detection A Practical Approach, ed. Cotton et al. Oxford University Press, 1998; Saiki et al., Nature 324, 163-166 (1986); Dattagupta, EP235,726; and Saiki, WO 89/11548.
[0196] While the design of each allele-specific primer or probe depends on variables such as the precise composition of the nucleotide sequences flanking a SNP position in a target nucleic acid molecule, and the length of the primer or probe, another factor in the use of primers and probes is the stringency of the condition under which the hybridization between the probe or primer and the target sequence is performed. Higher stringency conditions utilize buffers with lower ionic strength and/or a higher reaction temperature, and tend to require a more perfect match between probe/primer and a target sequence in order to form a stable duplex. If the stringency is too high, however, hybridization may not occur at all. In contrast, lower stringency conditions utilize buffers with higher ionic strength and/or a lower reaction temperature, and permit the formation of stable duplexes with more mismatched bases between a probe/primer and a target sequence. By way of example and not limitation, exemplary conditions for high stringency hybridization conditions using an allele-specific probe are as follows: Prehybridization with a solution containing 5× standard saline phosphate EDTA (SSPE), 0.5% NaDodSO.sub.4 (SDS) at 55° C., and incubating probe with target nucleic acid molecules in the same solution at the same temperature, followed by washing with a solution containing 2× SSPE, and 0.1% SDS at 55° C. or room temperature.
[0197] Moderate stringency hybridization conditions may be used for allele-specific primer extension reactions with a solution containing, e.g., about 50 mM KCl at about 46° C. Alternatively, the reaction may be carried out at an elevated temperature such as 60° C. In another embodiment, a moderately stringent hybridization condition suitable for oligonucleotide ligation assay (OLA) reactions wherein two probes are ligated if they are completely complementary to the target sequence may utilize a solution of about 100 mM KCl at a temperature of 46° C.
[0198] In a hybridization-based assay, allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymorphic forms (e.g., alternative SNP alleles/nucleotides) in the respective DNA segments from the two individuals. Hybridization conditions should be sufficiently stringent that there is a significant detectable difference in hybridization intensity between alleles, and preferably an essentially binary response, whereby a probe hybridizes to only one of the alleles or significantly more strongly to one allele. While a probe may be designed to hybridize to a target sequence that contains a SNP site such that the SNP site aligns anywhere along the sequence of the probe, the probe is preferably designed to hybridize to a segment of the target sequence such that the SNP site aligns with a central position of the probe (e.g., a position within the probe that is at least three nucleotides from either end of the probe). This design of probe generally achieves good discrimination in hybridization between different allelic forms.
[0199] In another embodiment, a probe or primer may be designed to hybridize to a segment of target DNA such that the SNP aligns with either the 5′ most end or the 3′ most end of the probe or primer. In a specific preferred embodiment which is particularly suitable for use in a oligonucleotide ligation assay (U.S. Pat. No. 4,988,617), the 3′most nucleotide of the probe aligns with the SNP position in the target sequence.
[0200] Oligonucleotide probes and primers may be prepared by methods well known in the art. Chemical synthetic methods include, but are limited to, the phosphotriester method described by Narang et al., 1979, Methods in Enzymology 68:90; the phosphodiester method described by Brown et al., 1979, Methods in Enzymology 68:109, the diethylphosphoamidate method described by Beaucage et al., 1981, Tetrahedron Letters 22:1859; and the solid support method described in U.S. Pat. No. 4,458,066.
[0201] Allele-specific probes are often used in pairs (or, less commonly, in sets of 3 or 4, such as if a SNP position is known to have 3 or 4 alleles, respectively, or to assay both strands of a nucleic acid molecule for a target SNP allele), and such pairs may be identical except for a one nucleotide mismatch that represents the allelic variants at the SNP position. Commonly, one member of a pair perfectly matches a reference form of a target sequence that has a more common SNP allele (i.e., the allele that is more frequent in the target population) and the other member of the pair perfectly matches a form of the target sequence that has a less common SNP allele (i.e., the allele that is rarer in the target population). In the case of an array, multiple pairs of probes can be immobilized on the same support for simultaneous analysis of multiple different polymorphisms.
[0202] In one type of PCR-based assay, an allele-specific primer hybridizes to a region on a target nucleic acid molecule that overlaps a SNP position and only primes amplification of an allelic form to which the primer exhibits perfect complementarity (Gibbs, 1989, Nucleic Acid Res. 17 2427-2448). Typically, the primer's 3′-most nucleotide is aligned with and complementary to the SNP position of the target nucleic acid molecule. This primer is used in conjunction with a second primer that hybridizes at a distal site. Amplification proceeds from the two primers, producing a detectable product that indicates which allelic form is present in the test sample. A control is usually performed with a second pair of primers, one of which shows a single base mismatch at the polymorphic site and the other of which exhibits perfect complementarity to a distal site. The single-base mismatch prevents amplification or substantially reduces amplification efficiency, so that either no detectable product is formed or it is formed in lower amounts or at a slower pace. The method generally works most effectively when the mismatch is at the 3′-most position of the oligonucleotide (i.e., the 3′-most position of the oligonucleotide aligns with the target SNP position) because this position is most destabilizing to elongation from the primer (see, e.g., WO 93/22456). This PCR-based assay can be utilized as part of the TaqMan assay, described below.
[0203] In a specific embodiment of the invention, a primer of the invention contains a sequence substantially complementary to a segment of a target SNP-containing nucleic acid molecule except that the primer has a mismatched nucleotide in one of the three nucleotide positions at the 3′-most end of the primer, such that the mismatched nucleotide does not base pair with a particular allele at the SNP site. In a preferred embodiment, the mismatched nucleotide in the primer is the second from the last nucleotide at the 3′-most position of the primer. In a more preferred embodiment, the mismatched nucleotide in the primer is the last nucleotide at the 3′-most position of the primer.
[0204] In another embodiment of the invention, a SNP detection reagent of the invention is labeled with a fluorogenic reporter dye that emits a detectable signal. While the preferred reporter dye is a fluorescent dye, any reporter dye that can be attached to a detection reagent such as an oligonucleotide probe or primer is suitable for use in the invention. Such dyes include, but are not limited to, Acridine, AMCA, BODIPY, Cascade Blue, Cy2, Cy3, Cy5, Cy7, Dabcyl, Edans, Eosin, Erythrosin, Fluorescein, 6-Fam, Tet, Joe, Hex, Oregon Green, Rhodamine, Rhodol Green, Tamra, Rox, and Texas Red.
[0205] In yet another embodiment of the invention, the detection reagent may be further labeled with a quencher dye such as Tamra, especially when the reagent is used as a self-quenching probe such as a TaqMan (U.S. Pat. Nos. 5,210,015 and 5,538,848) or Molecular Beacon probe (U.S. Pat. Nos. 5,118,801 and 5,312,728), or other stemless or linear beacon probe (Livak et al., 1995, PCR Method Appl. 4:357-362; Tyagi et al., 1996, Nature Biotechnology 14: 303-308; Nazarenko et al., 1997, Nucl. Acids Res. 25:2516-2521; U.S. Pat. Nos. 5,866,336 and 6,117,635).
[0206] The detection reagents of the invention may also contain other labels, including but not limited to, biotin for streptavidin binding, hapten for antibody binding, and oligonucleotide for binding to another complementary oligonucleotide such as pairs of zipcodes.
[0207] The present invention also contemplates reagents that do not contain (or that are complementary to) a SNP nucleotide identified herein but that are used to assay one or more SNPs disclosed herein. For example, primers that flank, but do not hybridize directly to a target SNP position provided herein are useful in primer extension reactions in which the primers hybridize to a region adjacent to the target SNP position (i.e., within one or more nucleotides from the target SNP site). During the primer extension reaction, a primer is typically not able to extend past a target SNP site if a particular nucleotide (allele) is present at that target SNP site, and the primer extension product can be detected in order to determine which SNP allele is present at the target SNP site. For example, particular ddNTPs are typically used in the primer extension reaction to terminate primer extension once a ddNTP is incorporated into the extension product (a primer extension product which includes a ddNTP at the 3′-most end of the primer extension product, and in which the ddNTP is a nucleotide of a SNP disclosed herein, is a composition that is specifically contemplated by the present invention). Thus, reagents that bind to a nucleic acid molecule in a region adjacent to a SNP site and that are used for assaying the SNP site, even though the bound sequences do not necessarily include the SNP site itself, are also contemplated by the present invention.
[0208] SNP Detection Kits and Systems
[0209] A person skilled in the art will recognize that, based on the SNP and associated sequence information disclosed herein, detection reagents can be developed and used to assay any SNP of the present invention individually or in combination, and such detection reagents can be readily incorporated into one of the established kit or system formats which are well known in the art. The terms “kits” and “systems”, as used herein in the context of SNP detection reagents, are intended to refer to such things as combinations of multiple SNP detection reagents, or one or more SNP detection reagents in combination with one or more other types of elements or components (e.g., other types of biochemical reagents, containers, packages such as packaging intended for commercial sale, substrates to which SNP detection reagents are attached, electronic hardware components, etc.). Accordingly, the present invention further provides SNP detection kits and systems, including but not limited to, packaged probe and primer sets (e.g., TaqMan probe/primer sets), arrays/microarrays of nucleic acid molecules, and beads that contain one or more probes, primers, or other detection reagents for detecting one or more SNPs of the present invention. The kits/systems can optionally include various electronic hardware components; for example, arrays (“DNA chips”) and microfluidic systems (“lab-on-a-chip” systems) provided by various manufacturers typically comprise hardware components. Other kits/systems (e.g., probe/primer sets) may not include electronic hardware components, but may be comprised of, for example, one or more SNP detection reagents (along with, optionally, other biochemical reagents) packaged in one or more containers.
[0210] In some embodiments, a SNP detection kit typically contains one or more detection reagents and other components (e.g., a buffer, enzymes such as DNA polymerases or ligases, chain extension nucleotides such as deoxynucleotide triphosphates, and in the case of Sanger-type DNA sequencing reactions, chain terminating nucleotides, positive control sequences, negative control sequences, and the like) necessary to carry out an assay or reaction, such as amplification and/or detection of a SNP-containing nucleic acid molecule. A kit may further contain means for determining the amount of a target nucleic acid, and means for comparing the amount with a standard, and can comprise instructions for using the kit to detect the SNP-containing nucleic acid molecule of interest. In one embodiment of the present invention, kits are provided which contain the necessary reagents to carry out one or more assays to detect one or more SNPs disclosed herein. In a preferred embodiment of the present invention, SNP detection kits/systems are in the form of nucleic acid arrays, or compartmentalized kits, including microfluidic/lab-on-a-chip systems.
[0211] SNP detection kits/systems may contain, for example, one or more probes, or pairs of probes, that hybridize to a nucleic acid molecule at or near each target SNP position. Multiple pairs of allele-specific probes may be included in the kit/system to simultaneously assay large numbers of SNPs, at least one of which is a SNP of the present invention. In some kits/systems, the allele-specific probes are immobilized to a substrate such as an array or bead. For example, the same substrate can comprise allele-specific probes for detecting at least 1; 10; 100; 1000; 10,000; 100,000 (or any other number in-between) or substantially all of the SNPs shown in Table 1 and/or Table 2.
[0212] The terms “arrays”, “microarrays”, and “DNA chips” are used herein interchangeably to refer to an array of distinct polynucleotides affixed to a substrate, such as glass, plastic, paper, nylon or other type of membrane, filter, chip, or any other suitable solid support. The polynucleotides can be synthesized directly on the substrate, or synthesized separate from the substrate and then affixed to the substrate. In one embodiment, the microarray is prepared and used according to the methods described in U.S. Pat. No. 5,837,832, Chee et al., PCT application W095/11995 (Chee et al.), Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675-1680) and Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619), all of which are incorporated herein in their entirety by reference. In other embodiments, such arrays are produced by the methods described by Brown et al., U.S. Pat. No. 5,807,522.
[0213] Nucleic acid arrays are reviewed in the following references: Zammatteo et al., “New chips for molecular biology and diagnostics”, Biotechnol Annu Rev. 2002; 8:85-101; Sosnowski et al., “Active microelectronic array system for DNA hybridization, genotyping and pharmacogenomic applications”, Psychiatr Genet. 2002 December; 12(4):181-92; Heller, “DNA microarray technology: devices, systems, and applications”, Annu Rev Biomed Eng. 2002; 4:129-53. Epub 2002 Mar. 22; Kolchinsky et al., “Analysis of SNPs and other genomic variations using gel-based chips”, Hum Mutat. 2002 April; 19(4):343-60; and McGall et al., “High-density genechip oligonucleotide probe arrays”, Adv Biochem Eng Biotechnol. 2002; 77:21-42.
[0214] Any number of probes, such as allele-specific probes, may be implemented in an array, and each probe or pair of probes can hybridize to a different SNP position. In the case of polynucleotide probes, they can be synthesized at designated areas (or synthesized separately and then affixed to designated areas) on a substrate using a light-directed chemical process. Each DNA chip can contain, for example, thousands to millions of individual synthetic polynucleotide probes arranged in a grid-like pattern and miniaturized (e.g., to the size of a dime). Preferably, probes are attached to a solid support in an ordered, addressable array.
[0215] A microarray can be composed of a large number of unique, single-stranded polynucleotides, usually either synthetic antisense polynucleotides or fragments of cDNAs, fixed to a solid support. Typical polynucleotides are preferably about 6-60 nucleotides in length, more preferably about 15-30 nucleotides in length, and most preferably about 18-25 nucleotides in length. For certain types of microarrays or other detection kits/systems, it may be preferable to use oligonucleotides that are only about 7-20 nucleotides in length. In other types of arrays, such as arrays used in conjunction with chemiluminescent detection technology, preferred probe lengths can be, for example, about 15-80 nucleotides in length, preferably about 50-70 nucleotides in length, more preferably about 55-65 nucleotides in length, and most preferably about 60 nucleotides in length. The microarray or detection kit can contain polynucleotides that cover the known 5′ or 3′ sequence of a gene/transcript or target SNP site, sequential polynucleotides that cover the full-length sequence of a gene/transcript; or unique polynucleotides selected from particular areas along the length of a target gene/transcript sequence, particularly areas corresponding to one or more SNPs disclosed in Table 1 and/or Table 2. Polynucleotides used in the microarray or detection kit can be specific to a SNP or SNPs of interest (e.g., specific to a particular SNP allele at a target SNP site, or specific to particular SNP alleles at multiple different SNP sites), or specific to a polymorphic gene/transcript or genes/transcripts of interest.
[0216] Hybridization assays based on polynucleotide arrays rely on the differences in hybridization stability of the probes to perfectly matched and mismatched target sequence variants. For SNP genotyping, it is generally preferable that stringency conditions used in hybridization assays are high enough such that nucleic acid molecules that differ from one another at as little as a single SNP position can be differentiated (e.g., typical SNP hybridization assays are designed so that hybridization will occur only if one particular nucleotide is present at a SNP position, but will not occur if an alternative nucleotide is present at that SNP position). Such high stringency conditions may be preferable when using, for example, nucleic acid arrays of allele-specific probes for SNP detection. Such high stringency conditions are described in the preceding section, and are well known to those skilled in the art and can be found in, for example, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
[0217] In other embodiments, the arrays are used in conjunction with chemiluminescent detection technology. The following patents and patent applications, which are all hereby incorporated by reference, provide additional information pertaining to chemiluminescent detection: U.S. patent applications Ser. Nos. 10/620,332 and 10/620,333 describe chemiluminescent approaches for microarray detection; U.S. Pat. Nos. 6,124,478, 6,107,024, 5,994,073, 5,981,768, 5,871,938, 5,843,681, 5,800,999, and 5,773,628 describe methods and compositions of dioxetane for performing chemiluminescent detection; and U.S. published application US2002/0110828 discloses methods and compositions for microarray controls.
[0218] In one embodiment of the invention, a nucleic acid array can comprise an array of probes of about 15-25 nucleotides in length. In further embodiments, a nucleic acid array can comprise any number of probes, in which at least one probe is capable of detecting one or more SNPs disclosed in Table 1 and/or Table 2, and/or at least one probe comprises a fragment of one of the sequences selected from the group consisting of those disclosed in Table 1, Table 2, the Sequence Listing, and sequences complementary thereto, said fragment comprising at least about 8 consecutive nucleotides, preferably 10, 12, 15, 16, 18, 20, more preferably 22, 25, 30, 40, 47, 50, 55, 60, 65, 70, 80, 90, 100, or more consecutive nucleotides (or any other number in-between) and containing (or being complementary to) a novel SNP allele disclosed in Table 1 and/or Table 2. In some embodiments, the nucleotide complementary to the SNP site is within 5, 4, 3, 2, or 1 nucleotide from the center of the probe, more preferably at the center of said probe.
[0219] A polynucleotide probe can be synthesized on the surface of the substrate by using a chemical coupling procedure and an ink jet application apparatus, as described in PCT application W095/251116 (Baldeschweiler et al.) which is incorporated herein in its entirety by reference. In another aspect, a “gridded” array analogous to a dot (or slot) blot may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures. An array, such as those described above, may be produced by hand or by using available devices (slot blot or dot blot apparatus), materials (any suitable solid support), and machines (including robotic instruments), and may contain 8, 24, 96, 384, 1536, 6144 or more polynucleotides, or any other number which lends itself to the efficient use of commercially available instrumentation.
[0220] Using such arrays or other kits/systems, the present invention provides methods of identifying the SNPs disclosed herein in a test sample. Such methods typically involve incubating a test sample of nucleic acids with an array comprising one or more probes corresponding to at least one SNP position of the present invention, and assaying for binding of a nucleic acid from the test sample with one or more of the probes. Conditions for incubating a SNP detection reagent (or a kit/system that employs one or more such SNP detection reagents) with a test sample vary. Incubation conditions depend on such factors as the format employed in the assay, the detection methods employed, and the type and nature of the detection reagents used in the assay. One skilled in the art will recognize that any one of the commonly available hybridization, amplification and array assay formats can readily be adapted to detect the SNPs disclosed herein.
[0221] A SNP detection kit/system of the present invention may include components that are used to prepare nucleic acids from a test sample for the subsequent amplification and/or detection of a SNP-containing nucleic acid molecule. Such sample preparation components can be used to produce nucleic acid extracts (including DNA and/or RNA), proteins or membrane extracts from any bodily fluids (such as blood, serum, plasma, urine, saliva, phlegm, gastric juices, semen, tears, sweat, etc.), skin, hair, cells (especially nucleated cells), biopsies, buccal cells (e.g., as obtained by buccal swabs), or tissue specimens. The test samples used in the above-described methods will vary based on such factors as the assay format, nature of the detection method, and the specific tissues, cells or extracts used as the test sample to be assayed. Methods of preparing nucleic acids, proteins, and cell extracts are well known in the art and can be readily adapted to obtain a sample that is compatible with the system utilized. Automated sample preparation systems for extracting nucleic acids from a test sample are commercially available, and examples are Qiagen's BioRobot 9600, Applied Biosystems' PRISM™ 6700 sample preparation system, and Roche Molecular Systems' COBAS AmpliPrep System.
[0222] Another form of kit contemplated by the present invention is a compartmentalized kit. A compartmentalized kit includes any kit in which reagents are contained in separate containers. Such containers include, for example, small glass containers, plastic containers, strips of plastic, glass or paper, or arraying material such as silica. Such containers allow one to efficiently transfer reagents from one compartment to another compartment such that the test samples and reagents are not cross-contaminated, or from one container to another vessel not included in the kit, and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another or to another vessel. Such containers may include, for example, one or more containers which will accept the test sample, one or more containers which contain at least one probe or other SNP detection reagent for detecting one or more SNPs of the present invention, one or more containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, etc.), and one or more containers which contain the reagents used to reveal the presence of the bound probe or other SNP detection reagents. The kit can optionally further comprise compartments and/or reagents for, for example, nucleic acid amplification or other enzymatic reactions such as primer extension reactions, hybridization, ligation, electrophoresis (preferably capillary electrophoresis), mass spectrometry, and/or laser-induced fluorescent detection. The kit may also include instructions for using the kit. Exemplary compartmentalized kits include microfluidic devices known in the art (see, e.g., Weigl et al., “Lab-on-a-chip for drug development”, Adv Drug Deliv Rev. 2003 Feb. 24; 55(3):349-77). In such microfluidic devices, the containers may be referred to as, for example, microfluidic “compartments”, “chambers”, or “channels”.
[0223] Microfluidic devices, which may also be referred to as “lab-on-a-chip” systems, biomedical micro-electro-mechanical systems (bioMEMs), or multicomponent integrated systems, are exemplary kits/systems of the present invention for analyzing SNPs. Such systems miniaturize and compartmentalize processes such as probe/target hybridization, nucleic acid amplification, and capillary electrophoresis reactions in a single functional device. Such microfluidic devices typically utilize detection reagents in at least one aspect of the system, and such detection reagents may be used to detect one or more SNPs of the present invention. One example of a microfluidic system is disclosed in U.S. Pat. No. 5,589,136, which describes the integration of PCR amplification and capillary electrophoresis in chips. Exemplary microfluidic systems comprise a pattern of microchannels designed onto a glass, silicon, quartz, or plastic wafer included on a microchip. The movements of the samples may be controlled by electric, electroosmotic or hydrostatic forces applied across different areas of the microchip to create functional microscopic valves and pumps with no moving parts. Varying the voltage can be used as a means to control the liquid flow at intersections between the micro-machined channels and to change the liquid flow rate for pumping across different sections of the microchip. See, for example, U.S. Pat. No. 6,153,073, Dubrow et al., and U.S. Pat. No. 6,156,181, Parce et al.
[0224] For genotyping SNPs, an exemplary microfluidic system may integrate, for example, nucleic acid amplification, primer extension, capillary electrophoresis, and a detection method such as laser induced fluorescence detection. In a first step of an exemplary process for using such an exemplary system, nucleic acid samples are amplified, preferably by PCR. Then, the amplification products are subjected to automated primer extension reactions using ddNTPs (specific fluorescence for each ddNTP) and the appropriate oligonucleotide primers to carry out primer extension reactions which hybridize just upstream of the targeted SNP. Once the extension at the 3′ end is completed, the primers are separated from the unincorporated fluorescent ddNTPs by capillary electrophoresis. The separation medium used in capillary electrophoresis can be, for example, polyacrylamide, polyethyleneglycol or dextran. The incorporated ddNTPs in the single nucleotide primer extension products are identified by laser-induced fluorescence detection. Such an exemplary microchip can be used to process, for example, at least 96 to 384 samples, or more, in parallel.
[0225] Uses of Nucleic Acid Molecules
[0226] The nucleic acid molecules of the present invention have a variety of uses, especially in the diagnosis and treatment of stroke and related pathologies. For example, the nucleic acid molecules are useful as hybridization probes, such as for genotyping SNPs in messenger RNA, transcript, cDNA, genomic DNA, amplified DNA or other nucleic acid molecules, and for isolating full-length cDNA and genomic clones encoding the variant peptides disclosed in Table 1 as well as their orthologs.
[0227] A probe can hybridize to any nucleotide sequence along the entire length of a nucleic acid molecule provided in Table 1 and/or Table 2. Preferably, a probe of the present invention hybridizes to a region of a target sequence that encompasses a SNP position indicated in Table 1 and/or Table 2. More preferably, a probe hybridizes to a SNP-containing target sequence in a sequence-specific manner such that it distinguishes the target sequence from other nucleotide sequences which vary from the target sequence only by which nucleotide is present at the SNP site. Such a probe is particularly useful for detecting the presence of a SNP-containing nucleic acid in a test sample, or for determining which nucleotide (allele) is present at a particular SNP site (i.e., genotyping the SNP site).
[0228] A nucleic acid hybridization probe may be used for determining the presence, level, form, and/or distribution of nucleic acid expression. The nucleic acid whose level is determined can be DNA or RNA. Accordingly, probes specific for the SNPs described herein can be used to assess the presence, expression and/or gene copy number in a given cell, tissue, or organism. These uses are relevant for diagnosis of disorders involving an increase or decrease in gene expression relative to normal levels. In vitro techniques for detection of mRNA include, for example, Northern blot hybridizations and in situ hybridizations. In vitro techniques for detecting DNA include Southern blot hybridizations and in situ hybridizations (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.).
[0229] Probes can be used as part of a diagnostic test kit for identifying cells or tissues in which a variant protein is expressed, such as by measuring the level of a variant protein-encoding nucleic acid (e.g., mRNA) in a sample of cells from a subject or determining if a polynucleotide contains a SNP of interest.
[0230] Thus, the nucleic acid molecules of the invention can be used as hybridization probes to detect the SNPs disclosed herein, thereby determining whether an individual with the polymorphisms is at risk for stroke and related pathologies. Detection of a SNP associated with a disease phenotype provides a diagnostic tool for an active disease and/or genetic predisposition to the disease.
[0231] Furthermore, the nucleic acid molecules of the invention are therefore useful for detecting a gene (gene information is disclosed in Table 2, for example) which contains a SNP disclosed herein and/or products of such genes, such as expressed mRNA transcript molecules (transcript information is disclosed in Table 1, for example), and are thus useful for detecting gene expression. The nucleic acid molecules can optionally be implemented in, for example, an array or kit format for use in detecting gene expression.
[0232] The nucleic acid molecules of the invention are also useful as primers to amplify any given region of a nucleic acid molecule, particularly a region containing a SNP identified in Table 1 and/or Table 2.
[0233] The nucleic acid molecules of the invention are also useful for constructing recombinant vectors (described in greater detail below). Such vectors include expression vectors that express a portion of, or all of, any of the variant peptide sequences provided in Table 1. Vectors also include insertion vectors, used to integrate into another nucleic acid molecule sequence, such as into the cellular genome, to alter in situ expression of a gene and/or gene product. For example, an endogenous coding sequence can be replaced via homologous recombination with all or part of the coding region containing one or more specifically introduced SNPs.
[0234] The nucleic acid molecules of the invention are also useful for expressing antigenic portions of the variant proteins, particularly antigenic portions that contain a variant amino acid sequence (e.g., an amino acid substitution) caused by a SNP disclosed in Table 1 and/or Table 2.
[0235] The nucleic acid molecules of the invention are also useful for constructing vectors containing a gene regulatory region of the nucleic acid molecules of the present invention.
[0236] The nucleic acid molecules of the invention are also useful for designing ribozymes corresponding to all, or a part, of an mRNA molecule expressed from a SNP-containing nucleic acid molecule described herein.
[0237] The nucleic acid molecules of the invention are also useful for constructing host cells expressing a part, or all, of the nucleic acid molecules and variant peptides.
[0238] The nucleic acid molecules of the invention are also useful for constructing transgenic animals expressing all, or a part, of the nucleic acid molecules and variant peptides. The production of recombinant cells and transgenic animals having nucleic acid molecules which contain the SNPs disclosed in Table 1 and/or Table 2 allow, for example, effective clinical design of treatment compounds and dosage regimens.
[0239] The nucleic acid molecules of the invention are also useful in assays for drug screening to identify compounds that, for example, modulate nucleic acid expression.
[0240] The nucleic acid molecules of the invention are also useful in gene therapy in patients whose cells have aberrant gene expression. Thus, recombinant cells, which include a patient's cells that have been engineered ex vivo and returned to the patient, can be introduced into an individual where the recombinant cells produce the desired protein to treat the individual.
[0241] SNP Genotyping Methods
[0242] The process of determining which specific nucleotide (i.e., allele) is present at each of one or more SNP positions, such as a SNP position in a nucleic acid molecule disclosed in Table 1 and/or Table 2, is referred to as SNP genotyping. The present invention provides methods of SNP genotyping, such as for use in determining predisposition to stroke or related pathologies, or determining responsiveness to a form of treatment, or in genome mapping or SNP association analysis, etc.
[0243] Nucleic acid samples can be genotyped to determine which allele(s) is/are present at any given genetic region (e.g., SNP position) of interest by methods well known in the art. The neighboring sequence can be used to design SNP detection reagents such as oligonucleotide probes, which may optionally be implemented in a kit format. Exemplary SNP genotyping methods are described in Chen et al., “Single nucleotide polymorphism genotyping: biochemistry, protocol, cost and throughput”, Pharmacogenomics J. 2003; 3(2):77-96; Kwok et al., “Detection of single nucleotide polymorphisms”, Curr Issues Mol Biol. 2003 April; 5(2):43-60; Shi, “Technologies for individual genotyping: detection of genetic polymorphisms in drug targets and disease genes”, Am J Pharmacogenomics. 2002; 2(3):197-205; and Kwok, “Methods for genotyping single nucleotide polymorphisms”, Annu Rev Genomics Hum Genet 2001; 2:235-58. Exemplary techniques for high-throughput SNP genotyping are described in Marnellos, “High-throughput SNP analysis for genetic association studies”, Curr Opin Drug Discov Devel. 2003 May; 6(3):317-21. Common SNP genotyping methods include, but are not limited to, TaqMan assays, molecular beacon assays, nucleic acid arrays, allele-specific primer extension, allele-specific PCR, arrayed primer extension, homogeneous primer extension assays, primer extension with detection by mass spectrometry, pyrosequencing, multiplex primer extension sorted on genetic arrays, ligation with rolling circle amplification, homogeneous ligation, OLA (U.S. Pat. No. 4,988,167), multiplex ligation reaction sorted on genetic arrays, restriction-fragment length polymorphism, single base extension-tag assays, and the Invader assay. Such methods may be used in combination with detection mechanisms such as, for example, luminescence or chemiluminescence detection, fluorescence detection, time-resolved fluorescence detection, fluorescence resonance energy transfer, fluorescence polarization, mass spectrometry, and electrical detection.
[0244] Various methods for detecting polymorphisms include, but are not limited to, methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA duplexes (Myers et al., Science 230:1242 (1985); Cotton et al., PNAS 85:4397 (1988); and Saleeba et al., Meth. Enzymol. 217:286-295 (1992)), comparison of the electrophoretic mobility of variant and wild type nucleic acid molecules (Orita et al., PNAS 86:2766 (1989); Cotton et al., Mutat. Res. 285:125-144 (1993); and Hayashi et al., Genet. Anal. Tech. Appl. 9:73-79 (1992)), and assaying the movement of polymorphic or wild-type fragments in polyacrylamide gels containing a gradient of denaturant using denaturing gradient gel electrophoresis (DGGE) (Myers et al., Nature 313:495 (1985)). Sequence variations at specific locations can also be assessed by nuclease protection assays such as RNase and S1 protection or chemical cleavage methods.
[0245] In a preferred embodiment, SNP genotyping is performed using the TaqMan assay, which is also known as the 5′ nuclease assay (U.S. Pat. Nos. 5,210,015 and 5,538,848). The TaqMan assay detects the accumulation of a specific amplified product during PCR. The TaqMan assay utilizes an oligonucleotide probe labeled with a fluorescent reporter dye and a quencher dye. The reporter dye is excited by irradiation at an appropriate wavelength, it transfers energy to the quencher dye in the same probe via a process called fluorescence resonance energy transfer (FRET). When attached to the probe, the excited reporter dye does not emit a signal. The proximity of the quencher dye to the reporter dye in the intact probe maintains a reduced fluorescence for the reporter. The reporter dye and quencher dye may be at the 5′ most and the 3′ most ends, respectively, or vice versa. Alternatively, the reporter dye may be at the 5′ or 3′ most end while the quencher dye is attached to an internal nucleotide, or vice versa. In yet another embodiment, both the reporter and the quencher may be attached to internal nucleotides at a distance from each other such that fluorescence of the reporter is reduced.
[0246] During PCR, the 5′ nuclease activity of DNA polymerase cleaves the probe, thereby separating the reporter dye and the quencher dye and resulting in increased fluorescence of the reporter. Accumulation of PCR product is detected directly by monitoring the increase in fluorescence of the reporter dye. The DNA polymerase cleaves the probe between the reporter dye and the quencher dye only if the probe hybridizes to the target SNP-containing template which is amplified during PCR, and the probe is designed to hybridize to the target SNP site only if a particular SNP allele is present.
[0247] Preferred TaqMan primer and probe sequences can readily be determined using the SNP and associated nucleic acid sequence information provided herein. A number of computer programs, such as Primer Express (Applied Biosystems, Foster City, Calif.), can be used to rapidly obtain optimal primer/probe sets. It will be apparent to one of skill in the art that such primers and probes for detecting the SNPs of the present invention are useful in assays for determining predisposition to stroke and related pathologies, and can be readily incorporated into a kit format. The present invention also includes modifications of the Taqman assay well known in the art such as the use of Molecular Beacon probes (U.S. Pat. Nos. 5,118,801 and 5,312,728) and other variant formats (U.S. Pat. Nos. 5,866,336 and 6,117,635).
[0248] Another preferred method for genotyping the SNPs of the present invention is the use of two oligonucleotide probes in an OLA (see, e.g., U.S. Pat. No. 4,988,617). In this method, one probe hybridizes to a segment of a target nucleic acid with its 3′ most end aligned with the SNP site. A second probe hybridizes to an adjacent segment of the target nucleic acid molecule directly 3′ to the first probe. The two juxtaposed probes hybridize to the target nucleic acid molecule, and are ligated in the presence of a linking agent such as a ligase if there is perfect complementarity between the 3′ most nucleotide of the first probe with the SNP site. If there is a mismatch, ligation would not occur. After the reaction, the ligated probes are separated from the target nucleic acid molecule, and detected as indicators of the presence of a SNP.
[0249] The following patents, patent applications, and published international patent applications, which are all hereby incorporated by reference, provide additional information pertaining to techniques for carrying out various types of OLA: U.S. Pat. Nos. 6,027,889, 6,268,148, 5,494,810, 5,830,711, and 6,054,564 describe OLA strategies for performing SNP detection; WO 97/31256 and WO 00/56927 describe OLA strategies for performing SNP detection using universal arrays, wherein a zipcode sequence can be introduced into one of the hybridization probes, and the resulting product, or amplified product, hybridized to a universal zip code array; U.S. application US01/17329 (and Ser. No. 09/584,905) describes OLA (or LDR) followed by PCR, wherein zipcodes are incorporated into OLA probes, and amplified PCR products are determined by electrophoretic or universal zipcode array readout; U.S. applications 60/427,818, 60/445,636, and 60/445,494 describe SNPlex methods and software for multiplexed SNP detection using OLA followed by PCR, wherein zipcodes are incorporated into OLA probes, and amplified PCR products are hybridized with a zipchute reagent, and the identity of the SNP determined from electrophoretic readout of the zipchute. In some embodiments, OLA is carried out prior to PCR (or another method of nucleic acid amplification). In other embodiments, PCR (or another method of nucleic acid amplification) is carried out prior to OLA.
[0250] Another method for SNP genotyping is based on mass spectrometry. Mass spectrometry takes advantage of the unique mass of each of the four nucleotides of DNA. SNPs can be unambiguously genotyped by mass spectrometry by measuring the differences in the mass of nucleic acids having alternative SNP alleles. MALDI-TOF (Matrix Assisted Laser Desorption Ionization-Time of Flight) mass spectrometry technology is preferred for extremely precise determinations of molecular mass, such as SNPs. Numerous approaches to SNP analysis have been developed based on mass spectrometry. Preferred mass spectrometry-based methods of SNP genotyping include primer extension assays, which can also be utilized in combination with other approaches, such as traditional gel-based formats and microarrays.
[0251] Typically, the primer extension assay involves designing and annealing a primer to a template PCR amplicon upstream (5′) from a target SNP position. A mix of dideoxynucleotide triphosphates (ddNTPs) and/or deoxynucleotide triphosphates (dNTPs) are added to a reaction mixture containing template (e.g., a SNP-containing nucleic acid molecule which has typically been amplified, such as by PCR), primer, and DNA polymerase. Extension of the primer terminates at the first position in the template where a nucleotide complementary to one of the ddNTPs in the mix occurs. The primer can be either immediately adjacent (i.e., the nucleotide at the 3′ end of the primer hybridizes to the nucleotide next to the target SNP site) or two or more nucleotides removed from the SNP position. If the primer is several nucleotides removed from the target SNP position, the only limitation is that the template sequence between the 3′ end of the primer and the SNP position cannot contain a nucleotide of the same type as the one to be detected, or this will cause premature termination of the extension primer. Alternatively, if all four ddNTPs alone, with no dNTPs, are added to the reaction mixture, the primer will always be extended by only one nucleotide, corresponding to the target SNP position. In this instance, primers are designed to bind one nucleotide upstream from the SNP position (i.e., the nucleotide at the 3′ end of the primer hybridizes to the nucleotide that is immediately adjacent to the target SNP site on the 5′ side of the target SNP site). Extension by only one nucleotide is preferable, as it minimizes the overall mass of the extended primer, thereby increasing the resolution of mass differences between alternative SNP nucleotides. Furthermore, mass-tagged ddNTPs can be employed in the primer extension reactions in place of unmodified ddNTPs. This increases the mass difference between primers extended with these ddNTPs, thereby providing increased sensitivity and accuracy, and is particularly useful for typing heterozygous base positions. Mass-tagging also alleviates the need for intensive sample-preparation procedures and decreases the necessary resolving power of the mass spectrometer.
[0252] The extended primers can then be purified and analyzed by MALDI-TOF mass spectrometry to determine the identity of the nucleotide present at the target SNP position. In one method of analysis, the products from the primer extension reaction are combined with light absorbing crystals that form a matrix. The matrix is then hit with an energy source such as a laser to ionize and desorb the nucleic acid molecules into the gas-phase. The ionized molecules are then ejected into a flight tube and accelerated down the tube towards a detector. The time between the ionization event, such as a laser pulse, and collision of the molecule with the detector is the time of flight of that molecule. The time of flight is precisely correlated with the mass-to-charge ratio (m/z) of the ionized molecule. Ions with smaller m/z travel down the tube faster than ions with larger m/z and therefore the lighter ions reach the detector before the heavier ions. The time-of-flight is then converted into a corresponding, and highly precise, m/z. In this manner, SNPs can be identified based on the slight differences in mass, and the corresponding time of flight differences, inherent in nucleic acid molecules having different nucleotides at a single base position. For further information regarding the use of primer extension assays in conjunction with MALDI-TOF mass spectrometry for SNP genotyping, see, e.g., Wise et al., “A standard protocol for single nucleotide primer extension in the human genome using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry”, Rapid Commun Mass Spectrom. 2003; 17(11):1195-202.
[0253] The following references provide further information describing mass spectrometry-based methods for SNP genotyping: Bocker, “SNP and mutation discovery using base-specific cleavage and MALDI-TOF mass spectrometry”, Bioinformatics. 2003 July; 19 Suppl 1:144-153; Storm et al., “MALDI-TOF mass spectrometry-based SNP genotyping”, Methods Mol Biol. 2003; 212:241-62; Jurinke et al., “The use of Mass ARRAY technology for high throughput genotyping”, Adv Biochem Eng Biotechnol. 2002; 77:57-74; and Jurinke et al., “Automated genotyping using the DNA MassArray technology”, Methods Mol Biol. 2002; 187:179-92.
[0254] SNPs can also be scored by direct DNA sequencing. A variety of automated sequencing procedures can be utilized ((1995) Biotechniques 19:448), including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO94/16101; Cohen et al., Adv. Chromatogr. 36:127-162 (1996); and Griffin et al., Appl. Biochem. Biotechnol. 38:147-159 (1993)). The nucleic acid sequences of the present invention enable one of ordinary skill in the art to readily design sequencing primers for such automated sequencing procedures. Commercial instrumentation, such as the Applied Biosystems 377, 3100, 3700, 3730, and 3730xl DNA Analyzers (Foster City, Calif.), is commonly used in the art for automated sequencing.
[0255] Other methods that can be used to genotype the SNPs of the present invention include single-strand conformational polymorphism (SSCP), and denaturing gradient gel electrophoresis (DGGE) (Myers et al., Nature 313:495 (1985)). SSCP identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Single-stranded PCR products can be generated by heating or otherwise denaturing double stranded PCR products. Single-stranded nucleic acids may refold or form secondary structures that are partially dependent on the base sequence. The different electrophoretic mobilities of single-stranded amplification products are related to base-sequence differences at SNP positions. DGGE differentiates SNP alleles based on the different sequence-dependent stabilities and melting properties inherent in polymorphic DNA and the corresponding differences in electrophoretic migration patterns in a denaturing gradient gel (Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, W.H. Freeman and Co, New York, 1992, Chapter 7).
[0256] Sequence-specific ribozymes (U.S. Pat. No. 5,498,531) can also be used to score SNPs based on the development or loss of a ribozyme cleavage site. Perfectly matched sequences can be distinguished from mismatched sequences by nuclease cleavage digestion assays or by differences in melting temperature. If the SNP affects a restriction enzyme cleavage site, the SNP can be identified by alterations in restriction enzyme digestion patterns, and the corresponding changes in nucleic acid fragment lengths determined by gel electrophoresis
[0257] SNP genotyping can include the steps of, for example, collecting a biological sample from a human subject (e.g., sample of tissues, cells, fluids, secretions, etc.), isolating nucleic acids (e.g., genomic DNA, mRNA or both) from the cells of the sample, contacting the nucleic acids with one or more primers which specifically hybridize to a region of the isolated nucleic acid containing a target SNP under conditions such that hybridization and amplification of the target nucleic acid region occurs, and determining the nucleotide present at the SNP position of interest, or, in some assays, detecting the presence or absence of an amplification product (assays can be designed so that hybridization and/or amplification will only occur if a particular SNP allele is present or absent). In some assays, the size of the amplification product is detected and compared to the length of a control sample; for example, deletions and insertions can be detected by a change in size of the amplified product compared to a normal genotype.
[0258] SNP genotyping is useful for numerous practical applications, as described below. Examples of such applications include, but are not limited to, SNP-disease association analysis, disease predisposition screening, disease diagnosis, disease prognosis, disease progression monitoring, determining therapeutic strategies based on an individual's genotype (“pharmacogenomics”), developing therapeutic agents based on SNP genotypes associated with a disease or likelihood of responding to a drug, stratifying a patient population for clinical trial for a treatment regimen, predicting the likelihood that an individual will experience toxic side effects from a therapeutic agent, and human identification applications such as forensics.
[0259] Analysis of Genetic Association Between SNPs and Phenotypic Traits
[0260] SNP genotyping for disease diagnosis, disease predisposition screening, disease prognosis, determining drug responsiveness (pharmacogenomics), drug toxicity screening, and other uses described herein, typically relies on initially establishing a genetic association between one or more specific SNPs and the particular phenotypic traits of interest.
[0261] Different study designs may be used for genetic association studies (Modern Epidemiology, Lippincott Williams & Wilkins (1998), 609-622). Observational studies are most frequently carried out in which the response of the patients is not interfered with. The first type of observational study identifies a sample of persons in whom the suspected cause of the disease is present and another sample of persons in whom the suspected cause is absent, and then the frequency of development of disease in the two samples is compared. These sampled populations are called cohorts, and the study is a prospective study. The other type of observational study is case-control or a retrospective study. In typical case-control studies, samples are collected from individuals with the phenotype of interest (cases) such as certain manifestations of a disease, and from individuals without the phenotype (controls) in a population (target population) that conclusions are to be drawn from. Then the possible causes of the disease are investigated retrospectively. As the time and costs of collecting samples in case-control studies are considerably less than those for prospective studies, case-control studies are the more commonly used study design in genetic association studies, at least during the exploration and discovery stage.
[0262] In both types of observational studies, there may be potential confounding factors that should be taken into consideration. Confounding factors are those that are associated with both the real cause(s) of the disease and the disease itself, and they include demographic information such as age, gender, ethnicity as well as environmental factors. When confounding factors are not matched in cases and controls in a study, and are not controlled properly, spurious association results can arise. If potential confounding factors are identified, they should be controlled for by analysis methods explained below.
[0263] In a genetic association study, the cause of interest to be tested is a certain allele or a SNP or a combination of alleles or a haplotype from several SNPs. Thus, tissue specimens (e.g., whole blood) from the sampled individuals may be collected and genomic DNA genotyped for the SNP(s) of interest. In addition to the phenotypic trait of interest, other information such as demographic (e.g., age, gender, ethnicity, etc.), clinical, and environmental information that may influence the outcome of the trait can be collected to further characterize and define the sample set. In many cases, these factors are known to be associated with diseases and/or SNP allele frequencies. There are likely gene-environment and/or gene-gene interactions as well. Analysis methods to address gene-environment and gene-gene interactions (for example, the effects of the presence of both susceptibility alleles at two different genes can be greater than the effects of the individual alleles at two genes combined) are discussed below.
[0264] After all the relevant phenotypic and genotypic information has been obtained, statistical analyses are carried out to determine if there is any significant correlation between the presence of an allele or a genotype with the phenotypic characteristics of an individual. Preferably, data inspection and cleaning are first performed before carrying out statistical tests for genetic association. Epidemiological and clinical data of the samples can be summarized by descriptive statistics with tables and graphs. Data validation is preferably performed to check for data completion, inconsistent entries, and outliers. Chi-squared tests and t-tests (Wilcoxon rank-sum tests if distributions are not normal) may then be used to check for significant differences between cases and controls for discrete and continuous variables, respectively. To ensure genotyping quality, Hardy-Weinberg disequilibrium tests can be performed on cases and controls separately. Significant deviation from Hardy-Weinberg equilibrium (HWE) in both cases and controls for individual markers can be indicative of genotyping errors. If HWE is violated in a majority of markers, it is indicative of population substructure that should be further investigated. Moreover, Hardy-Weinberg disequilibrium in cases only can indicate genetic association of the markers with the disease (Genetic Data Analysis, Weir B., Sinauer (1990)).
[0265] To test whether an allele of a single SNP is associated with the case or control status of a phenotypic trait, one skilled in the art can compare allele frequencies in cases and controls. Standard chi-squared tests and Fisher exact tests can be carried out on a 2×2 table (2 SNP alleles×2 outcomes in the categorical trait of interest). To test whether genotypes of a SNP are associated, chi-squared tests can be carried out on a 3×2 table (3 genotypes×2 outcomes). Score tests are also carried out for genotypic association to contrast the three genotypic frequencies (major homozygotes, heterozygotes and minor homozygotes) in cases and controls, and to look for trends using 3 different modes of inheritance, namely dominant (with contrast coefficients 2, −1, −1), additive (with contrast coefficients 1, 0, −1) and recessive (with contrast coefficients 1, 1, −2). Odds ratios for minor versus major alleles, and odds ratios for heterozygote and homozygote variants versus the wild type genotypes are calculated with the desired confidence limits, usually 95%.
[0266] In order to control for confounders and to test for interaction and effect modifiers, stratified analyses may be performed using stratified factors that are likely to be confounding, including demographic information such as age, ethnicity, and gender, or an interacting element or effect modifier, such as a known major gene (e.g., APOE for Alzheimer's disease or HLA genes for autoimmune diseases), or environmental factors such as smoking in lung cancer. Stratified association tests may be carried out using Cochran-Mantel-Haenszel tests that take into account the ordinal nature of genotypes with 0, 1, and 2 variant alleles. Exact tests by StatXact may also be performed when computationally possible. Another way to adjust for confounding effects and test for interactions is to perform stepwise multiple logistic regression analysis using statistical packages such as SAS or R. Logistic regression is a model-building technique in which the best fitting and most parsimonious model is built to describe the relation between the dichotomous outcome (for instance, getting a certain disease or not) and a set of independent variables (for instance, genotypes of different associated genes, and the associated demographic and environmental factors). The most common model is one in which the logit transformation of the odds ratios is expressed as a linear combination of the variables (main effects) and their cross-product terms (interactions) (Applied Logistic Regression, Hosmer and Lemeshow, Wiley (2000)). To test whether a certain variable or interaction is significantly associated with the outcome, coefficients in the model are first estimated and then tested for statistical significance of their departure from zero.
[0267] In addition to performing association tests one marker at a time, haplotype association analysis may also be performed to study a number of markers that are closely linked together. Haplotype association tests can have better power than genotypic or allelic association tests when the tested markers are not the disease-causing mutations themselves but are in linkage disequilibrium with such mutations. The test will even be more powerful if the disease is indeed caused by a combination of alleles on a haplotype (e.g., APOE is a haplotype formed by 2 SNPs that are very close to each other). In order to perform haplotype association effectively, marker-marker linkage disequilibrium measures, both D′ and R.sup.2, are typically calculated for the markers within a gene to elucidate the haplotype structure. Recent studies (Daly et al, Nature Genetics, 29, 232-235, 2001) in linkage disequilibrium indicate that SNPs within a gene are organized in block pattern, and a high degree of linkage disequilibrium exists within blocks and very little linkage disequilibrium exists between blocks. Haplotype association with the disease status can be performed using such blocks once they have been elucidated.
[0268] Haplotype association tests can be carried out in a similar fashion as the allelic and genotypic association tests. Each haplotype in a gene is analogous to an allele in a multi-allelic marker. One skilled in the art can either compare the haplotype frequencies in cases and controls or test genetic association with different pairs of haplotypes. It has been proposed (Schaid et al, Am. J. Hum. Genet., 70, 425-434, 2002) that score tests can be done on haplotypes using the program “haplo.score”. In that method, haplotypes are first inferred by EM algorithm and score tests are carried out with a generalized linear model (GLM) framework that allows the adjustment of other factors.
[0269] An important decision in the performance of genetic association tests is the determination of the significance level at which significant association can be declared when the p-value of the tests reaches that level. In an exploratory analysis where positive hits will be followed up in subsequent confirmatory testing, an unadjusted p-value<0.2 (a significance level on the lenient side), for example, may be used for generating hypotheses for significant association of a SNP with certain phenotypic characteristics of a disease. It is preferred that a p-value<0.05 (a significance level traditionally used in the art) is achieved in order for a SNP to be considered to have an association with a disease. It is more preferred that a p-value<0.01 (a significance level on the stringent side) is achieved for an association to be declared. When hits are followed up in confirmatory analyses in more samples of the same source or in different samples from different sources, adjustment for multiple testing will be performed as to avoid excess number of hits while maintaining the experiment-wise error rates at 0.05. While there are different methods to adjust for multiple testing to control for different kinds of error rates, a commonly used but rather conservative method is Bonferroni correction to control the experiment-wise or family-wise error rate (Multiple comparisons and multiple tests, Westfall et al, SAS Institute (1999)). Permutation tests to control for the false discovery rates, FDR, can be more powerful (Benjamini and Hochberg, Journal of the Royal Statistical Society, Series B 57, 1289-1300, 1995, Resampling-based Multiple Testing, Westfall and Young, Wiley (1993)). Such methods to control for multiplicity would be preferred when the tests are dependent and controlling for false discovery rates is sufficient as opposed to controlling for the experiment-wise error rates.
[0270] In replication studies using samples from different populations after statistically significant markers have been identified in the exploratory stage, meta-analyses can then be performed by combining evidence of different studies (Modern Epidemiology, Lippincott Williams & Wilkins, 1998, 643-673). If available, association results known in the art for the same SNPs can be included in the meta-analyses.
[0271] Since both genotyping and disease status classification can involve errors, sensitivity analyses may be performed to see how odds ratios and p-values would change upon various estimates on genotyping and disease classification error rates.
[0272] It has been well known that subpopulation-based sampling bias between cases and controls can lead to spurious results in case-control association studies (Ewens and Spielman, Am. J. Hum. Genet. 62, 450-458, 1995) when prevalence of the disease is associated with different subpopulation groups. Such bias can also lead to a loss of statistical power in genetic association studies. To detect population stratification, Pritchard and Rosenberg (Pritchard et al. Am. J. Hum. Gen. 1999, 65:220-228) suggested typing markers that are unlinked to the disease and using results of association tests on those markers to determine whether there is any population stratification. When stratification is detected, the genomic control (GC) method as proposed by Devlin and Roeder (Devlin et al. Biometrics 1999, 55:997-1004) can be used to adjust for the inflation of test statistics due to population stratification. GC method is robust to changes in population structure levels as well as being applicable to DNA pooling designs (Devlin et al. Genet. Epidem. 20001, 21:273-284).
[0273] While Pritchard's method recommended using 15-20 unlinked microsatellite markers, it suggested using more than 30 biallelic markers to get enough power to detect population stratification. For the GC method, it has been shown (Bacanu et al. Am. J. Hum. Genet. 2000, 66:1933-1944) that about 60-70 biallelic markers are sufficient to estimate the inflation factor for the test statistics due to population stratification. Hence, 70 intergenic SNPs can be chosen in unlinked regions as indicated in a genome scan (Kehoe et al. Hum. Mol. Genet. 1999, 8:237-245).
[0274] Once individual risk factors, genetic or non-genetic, have been found for the predisposition to disease, the next step is to set up a classification/prediction scheme to predict the category (for instance, disease or no-disease) that an individual will be in depending on his genotypes of associated SNPs and other non-genetic risk factors. Logistic regression for discrete trait and linear regression for continuous trait are standard techniques for such tasks (Applied Regression Analysis, Draper and Smith, Wiley (1998)). Moreover, other techniques can also be used for setting up classification. Such techniques include, but are not limited to, MART, CART, neural network, and discriminant analyses that are suitable for use in comparing the performance of different methods (The Elements of Statistical Learning, Hastie, Tibshirani & Friedman, Springer (2002)).
[0275] Disease Diagnosis and Predisposition Screening
[0276] Information on association/correlation between genotypes and disease-related phenotypes can be exploited in several ways. For example, in the case of a highly statistically significant association between one or more SNPs with predisposition to a disease for which treatment is available, detection of such a genotype pattern in an individual may justify immediate administration of treatment, or at least the institution of regular monitoring of the individual. Detection of the susceptibility alleles associated with serious disease in a couple contemplating having children may also be valuable to the couple in their reproductive decisions. In the case of a weaker but still statistically significant association between a SNP and a human disease, immediate therapeutic intervention or monitoring may not be justified after detecting the susceptibility allele or SNP. Nevertheless, the subject can be motivated to begin simple life-style changes (e.g., diet, exercise) that can be accomplished at little or no cost to the individual but would confer potential benefits in reducing the risk of developing conditions for which that individual may have an increased risk by virtue of having the susceptibility allele(s).
[0277] The SNPs of the invention may contribute to stroke and related pathologies in an individual in different ways. Some polymorphisms occur within a protein coding sequence and contribute to disease phenotype by affecting protein structure. Other polymorphisms occur in noncoding regions but may exert phenotypic effects indirectly via influence on, for example, replication, transcription, and/or translation. A single SNP may affect more than one phenotypic trait. Likewise, a single phenotypic trait may be affected by multiple SNPs in different genes.
[0278] As used herein, the terms “diagnose”, “diagnosis”, and “diagnostics” include, but are not limited to any of the following: detection of a vascular disease that an individual may presently have, predisposition/susceptibility screening (i.e., determining an individual's risk of having a stroke, such as whether an individual has an increased or decreased risk of having a stroke in the future), determining a particular type or subclass of vascular disease or stroke in an individual who has a vascular disease or who has had a stroke, confirming or reinforcing a previously made diagnosis of stroke or vascular disease, pharmacogenomic evaluation of an individual to determine which therapeutic or preventive agent or strategy that individual is most likely to benefit from or to predict whether a patient is likely to benefit from a particular therapeutic or preventive agent or strategy, predicting whether a patient is likely to experience toxic or other undesirable side effects from a particular therapeutic or preventive agent or strategy, evaluating the future prognosis of an individual who has had a stroke or who has a vascular disease, and determining the risk that an individual who has already had a stroke will have one or more strokes again in the future (i.e., re-occurring strokes). Such diagnostic uses may be based on the SNPs individually or in combination or SNP haplotypes of the present invention.
[0279] Haplotypes are particularly useful in that, for example, fewer SNPs can be genotyped to determine if a particular genomic region harbors a locus that influences a particular phenotype, such as in linkage disequilibrium-based SNP association analysis.
[0280] Linkage disequilibrium (LD) refers to the co-inheritance of alleles (e.g., alternative nucleotides) at two or more different SNP sites at frequencies greater than would be expected from the separate frequencies of occurrence of each allele in a given population. The expected frequency of co-occurrence of two alleles that are inherited independently is the frequency of the first allele multiplied by the frequency of the second allele. Alleles that co-occur at expected frequencies are said to be in “linkage equilibrium”. In contrast, LD refers to any non-random genetic association between allele(s) at two or more different SNP sites, which is generally due to the physical proximity of the two loci along a chromosome. LD can occur when two or more SNPs sites are in close physical proximity to each other on a given chromosome and therefore alleles at these SNP sites will tend to remain unseparated for multiple generations with the consequence that a particular nucleotide (allele) at one SNP site will show a non-random association with a particular nucleotide (allele) at a different SNP site located nearby. Hence, genotyping one of the SNP sites will give almost the same information as genotyping the other SNP site that is in LD.
[0281] Various degrees of LD can be encountered between two or more SNPs with the result being that some SNPs are more closely associated (i.e., in stronger LD) than others. Furthermore, the physical distance over which LD extends along a chromosome differs between different regions of the genome, and therefore the degree of physical separation between two or more SNP sites necessary for LD to occur can differ between different regions of the genome.
[0282] For diagnostic purposes and similar uses, if a particular SNP site is found to be useful for determining predisposition to stroke and related pathologies (e.g., has a significant statistical association with the condition and/or is recognized as a causative polymorphism for the condition), then the skilled artisan would recognize that other SNP sites which are in LD with this SNP site would also be useful for diagnosing the condition. Thus, polymorphisms (e.g., SNPs and/or haplotypes) that are not the actual disease-causing (causative) polymorphisms, but are in LD with such causative polymorphisms, are also useful. In such instances, the genotype of the polymorphism(s) that is/are in LD with the causative polymorphism is predictive of the genotype of the causative polymorphism and, consequently, predictive of the phenotype (e.g., stroke) that is influenced by the causative SNP(s). Therefore, polymorphic markers that are in LD with causative polymorphisms are useful as diagnostic markers, and are particularly useful when the actual causative polymorphism(s) is/are unknown.
[0283] Examples of polymorphisms that can be in LD with one or more causative polymorphisms (and/or in LD with one or more polymorphisms that have a significant statistical association with a condition) and therefore useful for diagnosing the same condition that the causative/associated SNP(s) is used to diagnose, include, for example, other SNPs in the same gene, protein-coding, or mRNA transcript-coding region as the causative/associated SNP, other SNPs in the same exon or same intron as the causative/associated SNP, other SNPs in the same haplotype block as the causative/associated SNP, other SNPs in the same intergenic region as the causative/associated SNP, SNPs that are outside but near a gene (e.g., within 6 kb on either side, 5′ or 3′, of a gene boundary) that harbors a causative/associated SNP, etc. Such useful LD SNPs can be selected from among the SNPs disclosed in Table 4, for example.
[0284] Linkage disequilibrium in the human genome is reviewed in the following references: Wall et al., “Haplotype blocks and linkage disequilibrium in the human genome,”, Nat Rev Genet. 2003 August; 4(8):587-97 (August 2003); Garner et al. et al., “On selecting markers for association studies: patterns of linkage disequilibrium between two and three diallelic loci,”, Genet Epidemiol. 2003 January; 24(1):57-67 (January 2003); Ardlie et al. et al., “Patterns of linkage disequilibrium in the human genome,”, Nat Rev Genet. 2002 April; 3(4):299-309 (April 2002); (erratum in Nat Rev Genet 2002 July; 3(7):566 (July 2002); and Remm et al. et al., “High-density genotyping and linkage disequilibrium in the human genome using chromosome 22 as a model,”; Curr Opin Chem Biol. 2002 February; 6(1):24-30 (February 2002); J. B. S. Haldane, “JBS (1919) The combination of linkage values, and the calculation of distances between the loci of linked factors,”. J Genet 8:299-309 (1919); G. Mendel, G. (1866) Versuche über Pflanzen-Hybriden. Verhandlungen des naturforschenden Vereines in Brünn [(Proceedings of the Natural History Society of Brünn)] (1866); Lewin B (1990) Genes IV, B. Lewin, ed., Oxford University Press, N.Y. New York, USA (1990); D. L. Hartl DL and A. G. Clark AG (1989) Principles of Population Genetics 2.sup.nd ed., Sinauer Associates, Inc., Ma Sunderland, Mass., USA (1989); J. H. Gillespie JH (2004) Population Genetics: A Concise Guide. 2.sup.nd ed., Johns Hopkins University Press. (2004) USA; R. C. Lewontin, “RC (1964) The interaction of selection and linkage. I. General considerations; heterotic models,”. Genetics 49:49-67 (1964); P. G. Hoel, PG (1954) Introduction to Mathematical Statistics 2.sup.nd ed., John Wiley & Sons, Inc., N.Y. New York, USA (1954); R. R. Hudson, RR “(2001) Two-locus sampling distributions and their application,”. Genetics 159:1805-1817 (2001); A. P. Dempster AP, N. M. Laird, D. B. NM, Rubin, “DB (1977) Maximum likelihood from incomplete data via the EM algorithm,”. J R Stat Soc 39:1-48 (1977); L. Excoffier L, M. Slatkin, M “(1995) Maximum-likelihood estimation of molecular haplotype frequencies in a diploid population,”. Mol Biol Evol 12(5):921-927 (1995); D. A. Tregouet DA, S. Escolano S, L. Tiret L, A. Mallet A, J. L. Golmard, JL “(2004) A new algorithm for haplotype-based association analysis: the Stochastic-EM algorithm,”. Ann Hum Genet 68(Pt 2):165-177 (2004); A. D. Long AD and C. H. Langley CH, “(1999) The power of association studies to detect the contribution of candidate genetic loci to variation in complex traits,”. Genome Research 9:720-731 (1999); A. Agresti, A (1990) Categorical Data Analysis, John Wiley & Sons, Inc., N.Y. New York, USA (1990); K. Lange, K (1997) Mathematical and Statistical Methods for Genetic Analysis, Springer-Verlag New York, Inc., N.Y. New York, USA (1997); The International HapMap Consortium, “(2003) The International HapMap Project,”. Nature 426:789-796 (2003); The International HapMap Consortium, “(2005) A haplotype map of the human genome,”. Nature 437:1299-1320 (2005); G. A. Thorisson GA, A. V. Smith AV, L. Krishnan L, L. D. Stein LD (2005), “The International HapMap Project Web Site,”. Genome Research 15:1591-1593 (2005); G. McVean, C. C. A. G, Spencer CCA, R. Chaix R (2005), “Perspectives on human genetic variation from the HapMap project,”. PLoS Genetics 1(4):413-418 (2005); J. N. Hirschhorn JN, M. J. Daly, MJ “(2005) Genome-wide association studies for common diseases and complex traits,”. Nat Genet 6:95-108 (2005); S. J. Schrodi, “SJ (2005) A probabilistic approach to large-scale association scans: a semi-Bayesian method to detect disease-predisposing alleles,”. SAGMB 4(1):31 (2005); W. Y. S. Wang WYS, B. J. Barratt BJ, D. G. Clayton DG, J. A. Todd, “JA (2005) Genome-wide association studies: theoretical and practical concerns,”. Nat Rev Genet 6:109-118 (2005); J. K. Pritchard JK, M. Przeworski, “M (2001) Linkage disequilibrium in humans: models and data,”. Am J Hum Genet 69:1-14 (2001).
[0285] As discussed above, one aspect of the present invention is the discovery that SNPs which are in certain LD distance with the interrogated SNP can also be used as valid markers for identifying an increased or decreased risks of having or developing stroke. As used herein, the term “interrogated SNP” refers to SNPs that have been found to be associated with an increased or decreased risk of disease using genotyping results and analysis, or other appropriate experimental method as exemplified in the working examples described in this application. As used herein, the term “LD SNP” refers to a SNP that has been characterized as a SNP associating with an increased or decreased risk of diseases due to their being in LD with the “interrogated SNP” under the methods of calculation described in the application. Below, applicants describe the methods of calculation with which one of ordinary skilled in the art may determine if a particular SNP is in LD with an interrogated SNP. The parameter r.sup.2 is commonly used in the genetics art to characterize the extent of linkage disequilibrium between markers (Hudson, 2001). As used herein, the term “in LD with” refers to a particular SNP that is measured at above the threshold of a parameter such as r.sup.2 with an interrogated SNP.
[0286] It is now common place to directly observe genetic variants in a sample of chromosomes obtained from a population. Suppose one has genotype data at two genetic markers located on the same chromosome, for the markers A and B . Further suppose that two alleles segregate at each of these two markers such that alleles A.sub.1 and A.sub.2 can be found at marker A and alleles B.sub.1 and B.sub.2 at marker B. Also assume that these two markers are on a human autosome. If one is to examine a specific individual and find that they are heterozygous at both markers, such that their two-marker genotype is A.sub.1A.sub.2B.sub.1B.sub.2, then there are two possible configurations: the individual in question could have the alleles A.sub.1B.sub.1 on one chromosome and A.sub.2B.sub.2 on the remaining chromosome; alternatively, the individual could have alleles A.sub.1B.sub.2 on one chromosome and A.sub.2B.sub.1 on the other. The arrangement of alleles on a chromosome is called a haplotype. In this illustration, the individual could have haplotypes A.sub.1B.sub.1/A.sub.2B.sub.2 or A.sub.1B.sub.2/A.sub.2B.sub.1 (see Hartl and Clark (1989) for a more complete description). The concept of linkage equilibrium relates the frequency of haplotypes to the allele frequencies.
[0287] Assume that a sample of individuals is selected from a larger population. Considering the two markers described above, each having two alleles, there are four possible haplotypes: A.sub.1B.sub.1, A.sub.1B.sub.2, A.sub.2B.sub.1 and A.sub.2B.sub.2. Denote the frequencies of these four haplotypes with the following notation.
P.sub.11=freq(A.sub.1B.sub.1) (1)
P.sub.12=freq(A.sub.1B.sub.2) (2)
P.sub.21=freq(A.sub.2B.sub.1) (3)
P.sub.22=freq(A.sub.2B.sub.2) (4)
The allele frequencies at the two markers are then the sum of different haplotype frequencies, it is straightforward to write down a similar set of equations relating single-marker allele frequencies to two-marker haplotype frequencies:
p.sub.1=freq(A.sub.1)=P.sub.11+P.sub.12 (5)
p.sub.2=freq(A.sub.2)=P.sub.21+P.sub.22 (6)
q.sub.1=freq(B.sub.1)=P.sub.11+P.sub.21 (7)
q.sub.2=freq(B.sub.2)=P.sub.12+P.sub.22 (8)
Note that the four haplotype frequencies and the allele frequencies at each marker must sum to a frequency of 1.
P.sub.11+P.sub.12+P.sub.21+P.sub.22=1 (9)
p.sub.1+p.sub.2=1 (10)
q.sub.1+q.sub.2=1 (11)
If there is no correlation between the alleles at the two markers, one would expect that the frequency of the haplotypes would be approximately the product of the composite alleles. Therefore,
P.sub.11≈p.sub.1q.sub.1 (12)
P.sub.12≈p.sub.1q.sub.2 (13)
P.sub.21≈p.sub.2q.sub.1 (14)
P.sub.22≈p.sub.2q.sub.2 (15)
These approximating equations (12)-(15) represent the concept of linkage equilibrium where there is independent assortment between the two markers—the alleles at the two markers occur together at random. These are represented as approximations because linkage equilibrium and linkage disequilibrium are concepts typically thought of as properties of a sample of chromosomes; and as such they are susceptible to stochastic fluctuations due to the sampling process. Empirically, many pairs of genetic markers will be in linkage equilibrium, but certainly not all pairs.
[0288] Having established the concept of linkage equilibrium above, applicants can now describe the concept of linkage disequilibrium (LD), which is the deviation from linkage equilibrium. Since the frequency of the A.sub.1B.sub.1 haplotype is approximately the product of the allele frequencies for A.sub.1 and B.sub.1 under the assumption of linkage equilibrium as stated mathematically in (12), a simple measure for the amount of departure from linkage equilibrium is the difference in these two quantities, D,
D=P.sub.11−p.sub.1q.sub.1 (16)
D=0 indicates perfect linkage equilibrium. Substantial departures from D=0 indicates LD in the sample of chromosomes examined. Many properties of D are discussed in Lewontin (1964) including the maximum and minimum values that D can take. Mathematically, using basic algebra, it can be shown that D can also be written solely in terms of haplotypes:
D=P.sub.11P.sub.22−P.sub.12P.sub.21 (17)
If one transforms D by squaring it and subsequently dividing by the product of the allele frequencies of A.sub.1, A.sub.2, B.sub.1 and B.sub.2, the resulting quantity, called r.sup.2, is equivalent to the square of the Pearson's correlation coefficient commonly used in statistics (e.g. Hoel, 1954).
[0289] As with D, values of r.sup.2 close to 0 indicate linkage equilibrium between the two markers examined in the sample set. As values of r.sup.2 increase, the two markers are said to be in linkage disequilibrium. The range of values that r.sup.2 can take are from 0 to 1. r.sup.2=1 when there is a perfect correlation between the alleles at the two markers.
[0290] In addition, the quantities discussed above are sample-specific. And as such, it is necessary to formulate notation specific to the samples studied. In the approach discussed here, three types of samples are of primary interest: (i) a sample of chromosomes from individuals affected by a disease-related phenotype (cases), (ii) a sample of chromosomes obtained from individuals not affected by the disease-related phenotype (controls), and (iii) a standard sample set used for the construction of haplotypes and calculation pairwise linkage disequilibrium. For the allele frequencies used in the development of the method described below, an additional subscript will be added to denote either the case or control sample sets.
p.sub.1,cs=freq(A.sub.1 in cases) (19)
p.sub.2,cs=freq(A.sub.2 in cases) (20)
q.sub.1,cs=freq(B.sub.1 in cases) (21)
q.sub.2,cs=freq(B.sub.2 in cases) (22)
Similarly,
p.sub.1,ct=freq(A.sub.1 in controls) (23)
p.sub.2,ct=freq(A.sub.2 in controls) (24)
q.sub.1,ct=freq(B.sub.1 in controls) (25)
q.sub.2,ct=freq(B.sub.2 in controls) (26)
[0291] As a well-accepted sample set is necessary for robust linkage disequilibrium calculations, data obtained from the International HapMap project (The International HapMap Consortium 2003, 2005; Thorisson et al, 2005; McVean et al, 2005) can be used for the calculation of pairwise r.sup.2 values. Indeed, the samples genotyped for the International HapMap Project were selected to be representative examples from various human sub-populations with sufficient numbers of chromosomes examined to draw meaningful and robust conclusions from the patterns of genetic variation observed. The International HapMap project website (hapmap.org) contains a description of the project, methods utilized and samples examined. It is useful to examine empirical data to get a sense of the patterns present in such data.
[0292] Haplotype frequencies were explicit arguments in equation (18) above. However, knowing the 2-marker haplotype frequencies requires that phase to be determined for doubly heterozygous samples. When phase is unknown in the data examined, various algorithms can be used to infer phase from the genotype data. This issue was discussed earlier where the doubly heterozygous individual with a 2-SNP genotype of A.sub.1A.sub.2B.sub.1B.sub.2 could have one of two different sets of chromosomes: A.sub.1B.sub.1/A.sub.2B.sub.2 or A.sub.1B.sub.2/A.sub.2B.sub.1. One such algorithm to estimate haplotype frequencies is the expectation-maximization (EM) algorithm first formalized by Dempster et al. (1977). This algorithm is often used in genetics to infer haplotype frequencies from genotype data (e.g., Excoffier and Slatkin (1995); Tregouet et al., (2004)). It should be noted that for the two-SNP case explored here, EM algorithms have very little error provided that the allele frequencies and sample sizes are not too small. The impact on r.sup.2 values is typically negligible.
[0293] As correlated genetic markers share information, interrogation of SNP markers in LD with a disease-associated SNP marker can also have sufficient power to detect disease association (Long and Langley (1999)). The relationship between the power to directly find disease-associated alleles and the power to indirectly detect disease-association was investigated by Pritchard and Przeworski (2001). In a straight-forward derivation, it can be shown that the power to detect disease association indirectly at a marker locus in linkage disequilibrium with a disease-association locus is approximately the same as the power to detect disease-association directly at the disease-association locus if the sample size is increased by a factor of
(the reciprocal of equation 18) at the marker in comparison with the disease-association locus.
[0294] Therefore, if one calculated the power to detect disease-association indirectly with an experiment having N samples, then equivalent power to directly detect disease-association (at the actual disease-susceptibility locus) would necessitate an experiment using approximately r.sup.2 N samples. This elementary relationship between power, sample size and linkage disequilibrium can be used to derive an r.sup.2 threshold value useful in determining whether or not genotyping markers in linkage disequilibrium with a SNP marker directly associated with disease status has enough power to indirectly detect disease-association.
[0295] To commence a derivation of the power to detect disease-associated markers through an indirect process, define the effective chromosomal sample size as
where N.sub.cs and N.sub.ct are the numbers of diploid cases and controls, respectively. This is necessary to handle situations where the numbers of cases and controls are not equivalent. For equal case and control sample sizes, N.sub.cs=N.sub.ct=N, the value of the effective number of chromosomes is simply n=2N—as expected. Let power be calculated for a significance level α (such that traditional P-values below α will be deemed statistically significant). Define the standard Gaussian distribution function as Φ(.Math.). Mathematically,
Alternatively, the following error function notation (Erf) may also be used,
[0296] For example, Φ(1.644854)=0.95. The value of r.sup.2 may be derived to yield a pre-specified minimum amount of power to detect disease association though indirect interrogation. Noting that the LD SNP marker could be the one that is carrying the disease-association allele, therefore that this approach constitutes a lower-bound model where all indirect power results are expected to be at least as large as those interrogated.
[0297] Denote by β the error rate for not detecting truly disease-associated markers. Therefore, 1−β is the classical definition of statistical power. Substituting the Pritchard-Pzreworski result into the sample size, the power to detect disease association at a significance level of α is given by the approximation
where Z.sub.u is the inverse of the standard normal cumulative distribution evaluated at u (u ∈ (0,1)). Z.sub.u=Φ.sup.−1(u), where Φ(Φ.sup.−1(u))=Φ.sup.−1(Φ(u))=u. For example, setting α=0.05, and therefore 1−α/2=0.975, Z.sub.0.975=1.95996 is obtained. Next, setting power equal to a threshold of a minimum power of T,
and solving for r.sup.2, the following threshold r.sup.2 is obtained:
[0298] Suppose that r.sup.2 is calculated between an interrogated SNP and a number of other SNPs with varying levels of LD with the interrogated SNP. The threshold value r.sub.T.sup.2 is the minimum value of linkage disequilibrium between the interrogated SNP and the potential LD SNPs such that the LD SNP still retains a power greater or equal to T for detecting disease-association. For example, suppose that SNP rs200 is genotyped in a case-control disease-association study and it is found to be associated with a disease phenotype. Further suppose that the minor allele frequency in 1,000 case chromosomes was found to be 16% in contrast with a minor allele frequency of 10% in 1,000 control chromosomes. Given those measurements one could have predicted, prior to the experiment, that the power to detect disease association at a significance level of 0.05 was quite high—approximately 98% using a test of allelic association. Applying equation (32) one can calculate a minimum value of r.sup.2 to indirectly assess disease association assuming that the minor allele at SNP rs200 is truly disease-predisposing for a threshold level of power. If one sets the threshold level of power to be 80%, then r.sub.T.sup.2=0.489 given the same significance level and chromosome numbers as above. Hence, any SNP with a pairwise r.sup.2 value with rs200 greater than 0.489 is expected to have greater than 80% power to detect the disease association. Further, this is assuming the conservative model where the LD SNP is disease-associated only through linkage disequilibrium with the interrogated SNP rs200.
[0299] The contribution or association of particular SNPs and/or SNP haplotypes with disease phenotypes, such as stroke, enables the SNPs of the present invention to be used to develop superior diagnostic tests capable of identifying individuals who express a detectable trait, such as stroke, as the result of a specific genotype, or individuals whose genotype places them at an increased or decreased risk of developing a detectable trait at a subsequent time as compared to individuals who do not have that genotype. As described herein, diagnostics may be based on a single SNP or a group of SNPs. Combined detection of a plurality of SNPs (for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 24, 25, 30, 32, 48, 50, 64, 96, 100, or any other number in-between, or more, of the SNPs provided in Table 1 and/or Table 2) typically increases the probability of an accurate diagnosis. For example, the presence of a single SNP known to correlate with stroke might indicate a probability of 20% that an individual is at risk of having a stroke, whereas detection of five SNPs, each of which correlates with stroke, might indicate a probability of 80% that an individual is at risk of having a stroke. To further increase the accuracy of diagnosis or predisposition screening, analysis of the SNPs of the present invention can be combined with that of other polymorphisms or other risk factors of stroke, such as disease symptoms, pathological characteristics, family history, diet, environmental factors or lifestyle factors.
[0300] It will, of course, be understood by practitioners skilled in the treatment, prevention, or diagnosis of stroke that the present invention generally does not intend to provide an absolute identification of individuals who are at risk (or less at risk) of having a stroke, and/or pathologies related to stroke such as other vascular diseases, but rather to indicate a certain increased (or decreased) degree or likelihood of developing the disease (e.g., having a stroke) based on statistically significant association results. However, this information is extremely valuable as it can be used to, for example, initiate preventive treatments or to allow an individual carrying one or more significant SNPs or SNP haplotypes to foresee warning signs such as minor clinical symptoms, or to have regularly scheduled physical exams to monitor for appearance of a condition in order to identify and begin treatment of the condition at an early stage. Particularly with diseases that are extremely debilitating or fatal if not treated on time, the knowledge of a potential predisposition, even if this predisposition is not absolute, would likely contribute in a very significant manner to treatment efficacy.
[0301] The diagnostic techniques of the present invention may employ a variety of methodologies to determine whether a test subject has a SNP or a SNP pattern associated with an increased or decreased risk of developing a detectable trait or whether the individual suffers from a detectable trait as a result of a particular polymorphism/mutation, including, for example, methods which enable the analysis of individual chromosomes for haplotyping, family studies, single sperm DNA analysis, or somatic hybrids. The trait analyzed using the diagnostics of the invention may be any detectable trait that is commonly observed in pathologies and disorders related to stroke.
[0302] Another aspect of the present invention relates to a method of determining whether an individual is at risk (or less at risk) of developing one or more traits or whether an individual expresses one or more traits as a consequence of possessing a particular trait-causing or trait-influencing allele. These methods generally involve obtaining a nucleic acid sample from an individual and assaying the nucleic acid sample to determine which nucleotide(s) is/are present at one or more SNP positions, wherein the assayed nucleotide(s) is/are indicative of an increased or decreased risk of developing the trait or indicative that the individual expresses the trait as a result of possessing a particular trait-causing or trait-influencing allele.
[0303] In another embodiment, the SNP detection reagents of the present invention are used to determine whether an individual has one or more SNP allele(s) affecting the level (e.g., the concentration of mRNA or protein in a sample, etc.) or pattern (e.g., the kinetics of expression, rate of decomposition, stability profile, Km, Vmax, etc.) of gene expression (collectively, the “gene response” of a cell or bodily fluid). Such a determination can be accomplished by screening for mRNA or protein expression (e.g., by using nucleic acid arrays, RT-PCR, TaqMan assays, or mass spectrometry), identifying genes having altered expression in an individual, genotyping SNPs disclosed in Table 1 and/or Table 2 that could affect the expression of the genes having altered expression (e.g., SNPs that are in and/or around the gene(s) having altered expression, SNPs in regulatory/control regions, SNPs in and/or around other genes that are involved in pathways that could affect the expression of the gene(s) having altered expression, or all SNPs could be genotyped), and correlating SNP genotypes with altered gene expression. In this manner, specific SNP alleles at particular SNP sites can be identified that affect gene expression.
[0304] Pharmacogenomics and Therapeutics/Drug Development
[0305] The present invention provides methods for assessing the pharmacogenomics of a subject harboring particular SNP alleles or haplotypes or diplotypes to a particular therapeutic agent or pharmaceutical compound, or to a class of such compounds. Pharmacogenomics deals with the roles which clinically significant hereditary variations (e.g., SNPs) play in the response to drugs due to altered drug disposition and/or abnormal action in affected persons. See, e.g., Roses, Nature 405, 857-865 (2000); Gould Rothberg, Nature Biotechnology 19, 209-211 (2001); Eichelbaum, Clin. Exp. Pharmacol. Physiol. 23(10-11):983-985 (1996); and Linder, Clin. Chem. 43(2):254-266 (1997). The clinical outcomes of these variations can result in severe toxicity of therapeutic drugs in certain individuals or therapeutic failure of drugs in certain individuals as a result of individual variation in metabolism. Thus, the SNP genotype of an individual can determine the way a therapeutic compound acts on the body or the way the body metabolizes the compound. For example, SNPs in drug metabolizing enzymes can affect the activity of these enzymes, which in turn can affect both the intensity and duration of drug action, as well as drug metabolism and clearance.
[0306] The discovery of SNPs in drug metabolizing enzymes, drug transporters, proteins for pharmaceutical agents, and other drug targets has explained why some patients do not obtain the expected drug effects, show an exaggerated drug effect, or experience serious toxicity from standard drug dosages. SNPs can be expressed in the phenotype of the extensive metabolizer and in the phenotype of the poor metabolizer. Accordingly, SNPs may lead to allelic variants of a protein in which one or more of the protein functions in one population are different from those in another population. SNPs and the encoded variant peptides thus provide targets to ascertain a genetic predisposition that can affect treatment modality. For example, in a ligand-based treatment, SNPs may give rise to amino terminal extracellular domains and/or other ligand-binding regions of a receptor that are more or less active in ligand binding, thereby affecting subsequent protein activation. Accordingly, ligand dosage would necessarily be modified to maximize the therapeutic effect within a given population containing particular SNP alleles or haplotypes.
[0307] As an alternative to genotyping, specific variant proteins containing variant amino acid sequences encoded by alternative SNP alleles could be identified. Thus, pharmacogenomic characterization of an individual permits the selection of effective compounds and effective dosages of such compounds for prophylactic or therapeutic uses based on the individual's SNP genotype, thereby enhancing and optimizing the effectiveness of the therapy. Furthermore, the production of recombinant cells and transgenic animals containing particular SNPs/haplotypes allow effective clinical design and testing of treatment compounds and dosage regimens. For example, transgenic animals can be produced that differ only in specific SNP alleles in a gene that is orthologous to a human disease susceptibility gene.
[0308] Pharmacogenomic uses of the SNPs of the present invention provide several significant advantages for patient care, particularly in treating stroke. Pharmacogenomic characterization of an individual, based on an individual's SNP genotype, can identify those individuals unlikely to respond to treatment with a particular medication and thereby allows physicians to avoid prescribing the ineffective medication to those individuals. On the other hand, SNP genotyping of an individual may enable physicians to select the appropriate medication and dosage regimen that will be most effective based on an individual's SNP genotype. This information increases a physician's confidence in prescribing medications and motivates patients to comply with their drug regimens. Furthermore, pharmacogenomics may identify patients predisposed to toxicity and adverse reactions to particular drugs or drug dosages. Adverse drug reactions lead to more than 100,000 avoidable deaths per year in the United States alone and therefore represent a significant cause of hospitalization and death, as well as a significant economic burden on the healthcare system (Pfost et. al., Trends in Biotechnology, August 2000.). Thus, pharmacogenomics based on the SNPs disclosed herein has the potential to both save lives and reduce healthcare costs substantially.
[0309] It is also well known in the art that markers that are diagnostically useful in distinguishing patients at higher risk of developing a disease (such as stroke) from those who are at a decreased risk of developing the disease can be useful in identifying those patients who are more likely to respond to drug treatments targeting those pathways involving genes where the diagnostic SNPs reside. See references Gerdes, et al., Circulation, 2000; 101:1366-1371, Kuivenhoven, et al., N Engl J Med 1998; 338:86-93, Stolarz, et al., Hypertension 2004; 44:156-162, Chartier-Harlin, et al., Hum. Mol. Genet. 1994 April; 3(4):569-74, Roses, et al., The Pharmacogenomics Journal 2006, 1-19.
[0310] In that regard, embodiments of the present invention can be very useful in assisting clinicians to select individuals who are more likely to have a stroke and who are therefore good candidates for receiving therapy for the prevention or treatment of stroke, thus warranting administration of the above-mentioned drug treatments to such individuals. On the other hand, individuals who are deemed to have a low risk of having a stroke, using SNP markers discovered herein, can be spared the aggravation and wastefulness of the drug treatment due to the reduced benefit of such treatment in view of its cost and potential side effects.
[0311] Pharmacogenomics in general is discussed further in Rose et al., “Pharmacogenetic analysis of clinically relevant genetic polymorphisms”, Methods Mol Med. 2003; 85:225-37. Pharmacogenomics as it relates to Alzheimer's disease and other neurodegenerative disorders is discussed in Cacabelos, “Pharmacogenomics for the treatment of dementia”, Ann Med. 2002; 34(5):357-79, Maimone et al., “Pharmacogenomics of neurodegenerative diseases”, Eur J Pharmacol. 2001 Feb. 9; 413(1):11-29, and Poirier, “Apolipoprotein E: a pharmacogenetic target for the treatment of Alzheimer's disease”, Mol Diagn. 1999 December; 4(4):335-41. Pharmacogenomics as it relates to cardiovascular disorders is discussed in Siest et al., “Pharmacogenomics of drugs affecting the cardiovascular system”, Clin Chem Lab Med. 2003 April; 41(4):590-9, Mukherjee et al., “Pharmacogenomics in cardiovascular diseases”, Prog Cardiovasc Dis. 2002 May-June; 44(6):479-98, and Mooser et al., “Cardiovascular pharmacogenetics in the SNP era”, J Thromb Haemost. 2003 July; 1(7):1398-402. Pharmacogenomics as it relates to cancer is discussed in McLeod et al., “Cancer pharmacogenomics: SNPs, chips, and the individual patient”, Cancer Invest. 2003; 21(4):630-40 and Watters et al., “Cancer pharmacogenomics: current and future applications”, Biochim Biophys Acta. 2003 Mar. 17; 1603(2):99-111.
[0312] The SNPs of the present invention also can be used to identify novel therapeutic targets for stroke. For example, genes containing the disease-associated variants (“variant genes”) or their products, as well as genes or their products that are directly or indirectly regulated by or interacting with these variant genes or their products, can be targeted for the development of therapeutics that, for example, treat the disease or prevent or delay disease onset. The therapeutics may be composed of, for example, small molecules, proteins, protein fragments or peptides, antibodies, nucleic acids, or their derivatives or mimetics which modulate the functions or levels of the target genes or gene products.
[0313] The SNP-containing nucleic acid molecules disclosed herein, and their complementary nucleic acid molecules, may be used as antisense constructs to control gene expression in cells, tissues, and organisms. Antisense technology is well established in the art and extensively reviewed in Antisense Drug Technology: Principles, Strategies, and Applications, Crooke (ed.), Marcel Dekker, Inc.: New York (2001). An antisense nucleic acid molecule is generally designed to be complementary to a region of mRNA expressed by a gene so that the antisense molecule hybridizes to the mRNA and thereby blocks translation of mRNA into protein. Various classes of antisense oligonucleotides are used in the art, two of which are cleavers and blockers. Cleavers, by binding to target RNAs, activate intracellular nucleases (e.g., RNaseH or RNase L) that cleave the target RNA. Blockers, which also bind to target RNAs, inhibit protein translation through steric hindrance of ribosomes. Exemplary blockers include peptide nucleic acids, morpholinos, locked nucleic acids, and methylphosphonates (see, e.g., Thompson, Drug Discovery Today, 7 (17): 912-917 (2002)). Antisense oligonucleotides are directly useful as therapeutic agents, and are also useful for determining and validating gene function (e.g., in gene knock-out or knock-down experiments).
[0314] Antisense technology is further reviewed in: Lavery et al., “Antisense and RNAi: powerful tools in drug target discovery and validation”, Curr Opin Drug Discov Devel. 2003 July; 6(4):561-9; Stephens et al., “Antisense oligonucleotide therapy in cancer”, Curr Opin Mol Ther. 2003 April; 5(2):118-22; Kurreck, “Antisense technologies. Improvement through novel chemical modifications”, Eur J Biochem. 2003 April; 270(8):1628-44; Dias et al., “Antisense oligonucleotides: basic concepts and mechanisms”, Mol Cancer Ther. 2002 March; 1(5):347-55; Chen, “Clinical development of antisense oligonucleotides as anti-cancer therapeutics”, Methods Mol Med. 2003; 75:621-46; Wang et al., “Antisense anticancer oligonucleotide therapeutics”, Curr Cancer Drug Targets. 2001 November; 1(3):177-96; and Bennett, “Efficiency of antisense oligonucleotide drug discovery”, Antisense Nucleic Acid Drug Dev. 2002 June; 12(3):215-24.
[0315] The SNPs of the present invention are particularly useful for designing antisense reagents that are specific for particular nucleic acid variants. Based on the SNP information disclosed herein, antisense oligonucleotides can be produced that specifically target mRNA molecules that contain one or more particular SNP nucleotides. In this manner, expression of mRNA molecules that contain one or more undesired polymorphisms (e.g., SNP nucleotides that lead to a defective protein such as an amino acid substitution in a catalytic domain) can be inhibited or completely blocked. Thus, antisense oligonucleotides can be used to specifically bind a particular polymorphic form (e.g., a SNP allele that encodes a defective protein), thereby inhibiting translation of this form, but which do not bind an alternative polymorphic form (e.g., an alternative SNP nucleotide that encodes a protein having normal function).
[0316] Antisense molecules can be used to inactivate mRNA in order to inhibit gene expression and production of defective proteins. Accordingly, these molecules can be used to treat a disorder, such as stroke, characterized by abnormal or undesired gene expression or expression of certain defective proteins. This technique can involve cleavage by means of ribozymes containing nucleotide sequences complementary to one or more regions in the mRNA that attenuate the ability of the mRNA to be translated. Possible mRNA regions include, for example, protein-coding regions and particularly protein-coding regions corresponding to catalytic activities, substrate/ligand binding, or other functional activities of a protein.
[0317] The SNPs of the present invention are also useful for designing RNA interference reagents that specifically target nucleic acid molecules having particular SNP variants. RNA interference (RNAi), also referred to as gene silencing, is based on using double-stranded RNA (dsRNA) molecules to turn genes off. When introduced into a cell, dsRNAs are processed by the cell into short fragments (generally about 21, 22, or 23 nucleotides in length) known as small interfering RNAs (siRNAs) which the cell uses in a sequence-specific manner to recognize and destroy complementary RNAs (Thompson, Drug Discovery Today, 7 (17): 912-917 (2002)). Accordingly, an aspect of the present invention specifically contemplates isolated nucleic acid molecules that are about 18-26 nucleotides in length, preferably 19-25 nucleotides in length, and more preferably 20, 21, 22, or 23 nucleotides in length, and the use of these nucleic acid molecules for RNAi. Because RNAi molecules, including siRNAs, act in a sequence-specific manner, the SNPs of the present invention can be used to design RNAi reagents that recognize and destroy nucleic acid molecules having specific SNP alleles/nucleotides (such as deleterious alleles that lead to the production of defective proteins), while not affecting nucleic acid molecules having alternative SNP alleles (such as alleles that encode proteins having normal function). As with antisense reagents, RNAi reagents may be directly useful as therapeutic agents (e.g., for turning off defective, disease-causing genes), and are also useful for characterizing and validating gene function (e.g., in gene knock-out or knock-down experiments).
[0318] The following references provide a further review of RNAi: Reynolds et al., “Rational siRNA design for RNA interference”, Nat Biotechnol. 2004 March; 22(3):326-30. Epub 2004 Feb. 1; Chi et al., “Genomewide view of gene silencing by small interfering RNAs”, PNAS 100(11):6343-6346, 2003; Vickers et al., “Efficient Reduction of Target RNAs by Small Interfering RNA and RNase H-dependent Antisense Agents”, J. Biol. Chem. 278: 7108-7118, 2003; Agami, “RNAi and related mechanisms and their potential use for therapy”, Curr Opin Chem Biol. 2002 December; 6(6):829-34; Lavery et al., “Antisense and RNAi: powerful tools in drug target discovery and validation”, Curr Opin Drug Discov Devel. 2003 July; 6(4):561-9; Shi, “Mammalian RNAi for the masses”, Trends Genet 2003 January; 19(1):9-12), Shuey et al., “RNAi: gene-silencing in therapeutic intervention”, Drug Discovery Today 2002 October; 7(20):1040-1046; McManus et al., Nat Rev Genet 2002 October; 3(10):737-47; Xia et al., Nat Biotechnol 2002 October; 20(10):1006-10; Plasterk et al., Curr Opin Genet Dev 2000 October; 10(5):562-7; Bosher et al., Nat Cell Biol 2000 February; 2(2):E31-6; and Hunter, Curr Biol 1999 Jun. 17; 9(12):R440-2).
[0319] A subject suffering from a pathological condition, such as stroke, ascribed to a SNP may be treated so as to correct the genetic defect (see Kren et al., Proc. Natl. Acad. Sci. USA 96:10349-10354 (1999)). Such a subject can be identified by any method that can detect the polymorphism in a biological sample drawn from the subject. Such a genetic defect may be permanently corrected by administering to such a subject a nucleic acid fragment incorporating a repair sequence that supplies the normal/wild-type nucleotide at the position of the SNP. This site-specific repair sequence can encompass an RNA/DNA oligonucleotide that operates to promote endogenous repair of a subject's genomic DNA. The site-specific repair sequence is administered in an appropriate vehicle, such as a complex with polyethylenimine, encapsulated in anionic liposomes, a viral vector such as an adenovirus, or other pharmaceutical composition that promotes intracellular uptake of the administered nucleic acid. A genetic defect leading to an inborn pathology may then be overcome, as the chimeric oligonucleotides induce incorporation of the normal sequence into the subject's genome. Upon incorporation, the normal gene product is expressed, and the replacement is propagated, thereby engendering a permanent repair and therapeutic enhancement of the clinical condition of the subject.
[0320] In cases in which a cSNP results in a variant protein that is ascribed to be the cause of, or a contributing factor to, a pathological condition, a method of treating such a condition can include administering to a subject experiencing the pathology the wild-type/normal cognate of the variant protein. Once administered in an effective dosing regimen, the wild-type cognate provides complementation or remediation of the pathological condition.
[0321] The invention further provides a method for identifying a compound or agent that can be used to treat or prevent stroke. The SNPs disclosed herein are useful as targets for the identification and/or development of therapeutic agents. A method for identifying a therapeutic agent or compound typically includes assaying the ability of the agent or compound to modulate the activity and/or expression of a SNP-containing nucleic acid or the encoded product and thus identifying an agent or a compound that can be used to treat a disorder characterized by undesired activity or expression of the SNP-containing nucleic acid or the encoded product. The assays can be performed in cell-based and cell-free systems. Cell-based assays can include cells naturally expressing the nucleic acid molecules of interest or recombinant cells genetically engineered to express certain nucleic acid molecules.
[0322] Variant gene expression in a stroke patient can include, for example, either expression of a SNP-containing nucleic acid sequence (for instance, a gene that contains a SNP can be transcribed into an mRNA transcript molecule containing the SNP, which can in turn be translated into a variant protein) or altered expression of a normal/wild-type nucleic acid sequence due to one or more SNPs (for instance, a regulatory/control region can contain a SNP that affects the level or pattern of expression of a normal transcript).
[0323] Assays for variant gene expression can involve direct assays of nucleic acid levels (e.g., mRNA levels), expressed protein levels, or of collateral compounds involved in a signal pathway. Further, the expression of genes that are up- or down-regulated in response to the signal pathway can also be assayed. In this embodiment, the regulatory regions of these genes can be operably linked to a reporter gene such as luciferase.
[0324] Modulators of variant gene expression can be identified in a method wherein, for example, a cell is contacted with a candidate compound/agent and the expression of mRNA determined. The level of expression of mRNA in the presence of the candidate compound is compared to the level of expression of mRNA in the absence of the candidate compound. The candidate compound can then be identified as a modulator of variant gene expression based on this comparison and be used to treat a disorder such as stroke that is characterized by variant gene expression (e.g., either expression of a SNP-containing nucleic acid or altered expression of a normal/wild-type nucleic acid molecule due to one or more SNPs that affect expression of the nucleic acid molecule) due to one or more SNPs of the present invention. When expression of mRNA is statistically significantly greater in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of nucleic acid expression. When nucleic acid expression is statistically significantly less in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of nucleic acid expression.
[0325] The invention further provides methods of treatment, with the SNP or associated nucleic acid domain (e.g., catalytic domain, ligand/substrate-binding domain, regulatory/control region, etc.) or gene, or the encoded mRNA transcript, as a target, using a compound identified through drug screening as a gene modulator to modulate variant nucleic acid expression. Modulation can include either up-regulation (i.e., activation or agonization) or down-regulation (i.e., suppression or antagonization) of nucleic acid expression.
[0326] Expression of mRNA transcripts and encoded proteins, either wild type or variant, may be altered in individuals with a particular SNP allele in a regulatory/control element, such as a promoter or transcription factor binding domain, that regulates expression. In this situation, methods of treatment and compounds can be identified, as discussed herein, that regulate or overcome the variant regulatory/control element, thereby generating normal, or healthy, expression levels of either the wild type or variant protein.
[0327] The SNP-containing nucleic acid molecules of the present invention are also useful for monitoring the effectiveness of modulating compounds on the expression or activity of a variant gene, or encoded product, in clinical trials or in a treatment regimen. Thus, the gene expression pattern can serve as an indicator for the continuing effectiveness of treatment with the compound, particularly with compounds to which a patient can develop resistance, as well as an indicator for toxicities. The gene expression pattern can also serve as a marker indicative of a physiological response of the affected cells to the compound. Accordingly, such monitoring would allow either increased administration of the compound or the administration of alternative compounds to which the patient has not become resistant. Similarly, if the level of nucleic acid expression falls below a desirable level, administration of the compound could be commensurately decreased.
[0328] In another aspect of the present invention, there is provided a pharmaceutical pack comprising a therapeutic agent (e.g., a small molecule drug, antibody, peptide, antisense or RNAi nucleic acid molecule, etc.) and a set of instructions for administration of the therapeutic agent to humans diagnostically tested for one or more SNPs or SNP haplotypes provided by the present invention.
[0329] The SNPs/haplotypes of the present invention are also useful for improving many different aspects of the drug development process. For instance, an aspect of the present invention includes selecting individuals for clinical trials based on their SNP genotype. For example, individuals with SNP genotypes that indicate that they are likely to positively respond to a drug can be included in the trials, whereas those individuals whose SNP genotypes indicate that they are less likely to or would not respond to the drug, or who are at risk for suffering toxic effects or other adverse reactions, can be excluded from the clinical trials. This not only can improve the safety of clinical trials, but also can enhance the chances that the trial will demonstrate statistically significant efficacy. Furthermore, the SNPs of the present invention may explain why certain previously developed drugs performed poorly in clinical trials and may help identify a subset of the population that would benefit from a drug that had previously performed poorly in clinical trials, thereby “rescuing” previously developed drugs, and enabling the drug to be made available to a particular stroke patient population that can benefit from it.
[0330] SNPs have many important uses in drug discovery, screening, and development. A high probability exists that, for any gene/protein selected as a potential drug target, variants of that gene/protein will exist in a patient population. Thus, determining the impact of gene/protein variants on the selection and delivery of a therapeutic agent should be an integral aspect of the drug discovery and development process. (Jazwinska, A Trends Guide to Genetic Variation and Genomic Medicine, 2002 March; S30-S36).
[0331] Knowledge of variants (e.g., SNPs and any corresponding amino acid polymorphisms) of a particular therapeutic target (e.g., a gene, mRNA transcript, or protein) enables parallel screening of the variants in order to identify therapeutic candidates (e.g., small molecule compounds, antibodies, antisense or RNAi nucleic acid compounds, etc.) that demonstrate efficacy across variants (Rothberg, Nat Biotechnol 2001 March; 19(3):209-11). Such therapeutic candidates would be expected to show equal efficacy across a larger segment of the patient population, thereby leading to a larger potential market for the therapeutic candidate.
[0332] Furthermore, identifying variants of a potential therapeutic target enables the most common form of the target to be used for selection of therapeutic candidates, thereby helping to ensure that the experimental activity that is observed for the selected candidates reflects the real activity expected in the largest proportion of a patient population (Jazwinska, A Trends Guide to Genetic Variation and Genomic Medicine, 2002 March; S30-S36).
[0333] Additionally, screening therapeutic candidates against all known variants of a target can enable the early identification of potential toxicities and adverse reactions relating to particular variants. For example, variability in drug absorption, distribution, metabolism and excretion (ADME) caused by, for example, SNPs in therapeutic targets or drug metabolizing genes, can be identified, and this information can be utilized during the drug development process to minimize variability in drug disposition and develop therapeutic agents that are safer across a wider range of a patient population. The SNPs of the present invention, including the variant proteins and encoding polymorphic nucleic acid molecules provided in Tables 1-2, are useful in conjunction with a variety of toxicology methods established in the art, such as those set forth in Current Protocols in Toxicology, John Wiley & Sons, Inc., N.Y.
[0334] Furthermore, therapeutic agents that target any art-known proteins (or nucleic acid molecules, either RNA or DNA) may cross-react with the variant proteins (or polymorphic nucleic acid molecules) disclosed in Table 1, thereby significantly affecting the pharmacokinetic properties of the drug. Consequently, the protein variants and the SNP-containing nucleic acid molecules disclosed in Tables 1-2 are useful in developing, screening, and evaluating therapeutic agents that target corresponding art-known protein forms (or nucleic acid molecules). Additionally, as discussed above, knowledge of all polymorphic forms of a particular drug target enables the design of therapeutic agents that are effective against most or all such polymorphic forms of the drug target.
[0335] Pharmaceutical Compositions and Administration Thereof
[0336] Any of the stroke-associated proteins, and encoding nucleic acid molecules, disclosed herein can be used as therapeutic targets (or directly used themselves as therapeutic compounds) for treating or preventing stroke and related pathologies, and the present disclosure enables therapeutic compounds (e.g., small molecules, antibodies, therapeutic proteins, RNAi and antisense molecules, etc.) to be developed that target (or are comprised of) any of these therapeutic targets.
[0337] In general, a therapeutic compound will be administered in a therapeutically effective amount by any of the accepted modes of administration for agents that serve similar utilities. The actual amount of the therapeutic compound of this invention, i.e., the active ingredient, will depend upon numerous factors such as the severity of the disease to be treated, the age and relative health of the subject, the potency of the compound used, the route and form of administration, and other factors.
[0338] Therapeutically effective amounts of therapeutic compounds may range from, for example, approximately 0.01-50 mg per kilogram body weight of the recipient per day; preferably about 0.1-20 mg/kg/day. Thus, as an example, for administration to a 70 kg person, the dosage range would most preferably be about 7 mg to 1.4 g per day.
[0339] In general, therapeutic compounds will be administered as pharmaceutical compositions by any one of the following routes: oral, systemic (e.g., transdermal, intranasal, or by suppository), or parenteral (e.g., intramuscular, intravenous, or subcutaneous) administration. The preferred manner of administration is oral or parenteral using a convenient daily dosage regimen, which can be adjusted according to the degree of affliction. Oral compositions can take the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, elixirs, aerosols, or any other appropriate compositions.
[0340] The choice of formulation depends on various factors such as the mode of drug administration (e.g., for oral administration, formulations in the form of tablets, pills, or capsules are preferred) and the bioavailability of the drug substance. Recently, pharmaceutical formulations have been developed especially for drugs that show poor bioavailability based upon the principle that bioavailability can be increased by increasing the surface area, i.e., decreasing particle size. For example, U.S. Pat. No. 4,107,288 describes a pharmaceutical formulation having particles in the size range from 10 to 1,000 nm in which the active material is supported on a cross-linked matrix of macromolecules. U.S. Pat. No. 5,145,684 describes the production of a pharmaceutical formulation in which the drug substance is pulverized to nanoparticles (average particle size of 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium to give a pharmaceutical formulation that exhibits remarkably high bioavailability.
[0341] Pharmaceutical compositions are comprised of, in general, a therapeutic compound in combination with at least one pharmaceutically acceptable excipient. Acceptable excipients are non-toxic, aid administration, and do not adversely affect the therapeutic benefit of the therapeutic compound. Such excipients may be any solid, liquid, semi-solid or, in the case of an aerosol composition, gaseous excipient that is generally available to one skilled in the art.
[0342] Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk and the like. Liquid and semisolid excipients may be selected from glycerol, propylene glycol, water, ethanol and various oils, including those of petroleum, animal, vegetable or synthetic origin, e.g., peanut oil, soybean oil, mineral oil, sesame oil, etc. Preferred liquid carriers, particularly for injectable solutions, include water, saline, aqueous dextrose, and glycols.
[0343] Compressed gases may be used to disperse a compound of this invention in aerosol form. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc.
[0344] Other suitable pharmaceutical excipients and their formulations are described in Remington's Pharmaceutical Sciences, edited by E. W. Martin (Mack Publishing Company, 18.sup.th ed., 1990).
[0345] The amount of the therapeutic compound in a formulation can vary within the full range employed by those skilled in the art. Typically, the formulation will contain, on a weight percent (wt %) basis, from about 0.01-99.99 wt % of the therapeutic compound based on the total formulation, with the balance being one or more suitable pharmaceutical excipients. Preferably, the compound is present at a level of about 1-80 wt %.
[0346] Therapeutic compounds can be administered alone or in combination with other therapeutic compounds or in combination with one or more other active ingredient(s). For example, an inhibitor or stimulator of a stroke-associated protein can be administered in combination with another agent that inhibits or stimulates the activity of the same or a different stroke-associated protein to thereby counteract the affects of stroke.
[0347] For further information regarding pharmacology, see Current Protocols in Pharmacology, John Wiley & Sons, Inc., N.Y.
[0348] Human Identification Applications
[0349] In addition to their diagnostic, risk assessment, preventive, and therapeutic uses in stroke and related pathologies, the SNPs provided by the present invention are also useful as human identification markers for such applications as forensics, paternity testing, and biometrics (see, e.g., Gill, “An assessment of the utility of single nucleotide polymorphisms (SNPs) for forensic purposes”, Int J Legal Med. 2001; 114(4-5):204-10). Genetic variations in the nucleic acid sequences between individuals can be used as genetic markers to identify individuals and to associate a biological sample with an individual. Determination of which nucleotides occupy a set of SNP positions in an individual identifies a set of SNP markers that distinguishes the individual. The more SNP positions that are analyzed, the lower the probability that the set of SNPs in one individual is the same as that in an unrelated individual. Preferably, if multiple sites are analyzed, the sites are unlinked (i.e., inherited independently). Thus, preferred sets of SNPs can be selected from among the SNPs disclosed herein, which may include SNPs on different chromosomes, SNPs on different chromosome arms, and/or SNPs that are dispersed over substantial distances along the same chromosome arm.
[0350] Furthermore, among the SNPs disclosed herein, preferred SNPs for use in certain forensic/human identification applications include SNPs located at degenerate codon positions (i.e., the third position in certain codons which can be one of two or more alternative nucleotides and still encode the same amino acid), since these SNPs do not affect the encoded protein. SNPs that do not affect the encoded protein are expected to be under less selective pressure and are therefore expected to be more polymorphic in a population, which is typically an advantage for forensic/human identification applications. However, for certain forensics/human identification applications, such as predicting phenotypic characteristics (e.g., inferring ancestry or inferring one or more physical characteristics of an individual) from a DNA sample, it may be desirable to utilize SNPs that affect the encoded protein.
[0351] For many of the SNPs disclosed in Tables 1-2 (which are identified as “Applera” SNP source), Tables 1-2 provide SNP allele frequencies obtained by re-sequencing the DNA of chromosomes from 39 individuals (Tables 1-2 also provide allele frequency information for “Celera” source SNPs and, where available, public SNPs from dbEST, HGBASE, and/or HGMD). The allele frequencies provided in Tables 1-2 enable these SNPs to be readily used for human identification applications. Although any SNP disclosed in Table 1 and/or Table 2 could be used for human identification, the closer that the frequency of the minor allele at a particular SNP site is to 50%, the greater the ability of that SNP to discriminate between different individuals in a population since it becomes increasingly likely that two randomly selected individuals would have different alleles at that SNP site. Using the SNP allele frequencies provided in Tables 1-2, one of ordinary skill in the art could readily select a subset of SNPs for which the frequency of the minor allele is, for example, at least 1%, 2%, 5%, 10%, 20%, 25%, 30%, 40%, 45%, or 50%, or any other frequency in-between. Thus, since Tables 1-2 provide allele frequencies based on the re-sequencing of the chromosomes from 39 individuals, a subset of SNPs could readily be selected for human identification in which the total allele count of the minor allele at a particular SNP site is, for example, at least 1, 2, 4, 8, 10, 16, 20, 24, 30, 32, 36, 38, 39, 40, or any other number in-between.
[0352] Furthermore, Tables 1-2 also provide population group (interchangeably referred to herein as ethnic or racial groups) information coupled with the extensive allele frequency information. For example, the group of 39 individuals whose DNA was re-sequenced was made-up of 20 Caucasians and 19 African-Americans. This population group information enables further refinement of SNP selection for human identification. For example, preferred SNPs for human identification can be selected from Tables 1-2 that have similar allele frequencies in both the Caucasian and African-American populations; thus, for example, SNPs can be selected that have equally high discriminatory power in both populations. Alternatively, SNPs can be selected for which there is a statistically significant difference in allele frequencies between the Caucasian and African-American populations (as an extreme example, a particular allele may be observed only in either the Caucasian or the African-American population group but not observed in the other population group); such SNPs are useful, for example, for predicting the race/ethnicity of an unknown perpetrator from a biological sample such as a hair or blood stain recovered at a crime scene. For a discussion of using SNPs to predict ancestry from a DNA sample, including statistical methods, see Frudakis et al., “A Classifier for the SNP-Based Inference of Ancestry”, Journal of Forensic Sciences 2003; 48(4):771-782.
[0353] SNPs have numerous advantages over other types of polymorphic markers, such as short tandem repeats (STRs). For example, SNPs can be easily scored and are amenable to automation, making SNPs the markers of choice for large-scale forensic databases. SNPs are found in much greater abundance throughout the genome than repeat polymorphisms. Population frequencies of two polymorphic forms can usually be determined with greater accuracy than those of multiple polymorphic forms at multi-allelic loci. SNPs are mutationaly more stable than repeat polymorphisms. SNPs are not susceptible to artefacts such as stutter bands that can hinder analysis. Stutter bands are frequently encountered when analyzing repeat polymorphisms, and are particularly troublesome when analyzing samples such as crime scene samples that may contain mixtures of DNA from multiple sources. Another significant advantage of SNP markers over STR markers is the much shorter length of nucleic acid needed to score a SNP. For example, STR markers are generally several hundred base pairs in length. A SNP, on the other hand, comprises a single nucleotide, and generally a short conserved region on either side of the SNP position for primer and/or probe binding. This makes SNPs more amenable to typing in highly degraded or aged biological samples that are frequently encountered in forensic casework in which DNA may be fragmented into short pieces.
[0354] SNPs also are not subject to microvariant and “off-ladder” alleles frequently encountered when analyzing STR loci. Microvariants are deletions or insertions within a repeat unit that change the size of the amplified DNA product so that the amplified product does not migrate at the same rate as reference alleles with normal sized repeat units. When separated by size, such as by electrophoresis on a polyacrylamide gel, microvariants do not align with a reference allelic ladder of standard sized repeat units, but rather migrate between the reference alleles. The reference allelic ladder is used for precise sizing of alleles for allele classification; therefore alleles that do not align with the reference allelic ladder lead to substantial analysis problems. Furthermore, when analyzing multi-allelic repeat polymorphisms, occasionally an allele is found that consists of more or less repeat units than has been previously seen in the population, or more or less repeat alleles than are included in a reference allelic ladder. These alleles will migrate outside the size range of known alleles in a reference allelic ladder, and therefore are referred to as “off-ladder” alleles. In extreme cases, the allele may contain so few or so many repeats that it migrates well out of the range of the reference allelic ladder. In this situation, the allele may not even be observed, or, with multiplex analysis, it may migrate within or close to the size range for another locus, further confounding analysis.
[0355] SNP analysis avoids the problems of microvariants and off-ladder alleles encountered in STR analysis. Importantly, microvariants and off-ladder alleles may provide significant problems, and may be completely missed, when using analysis methods such as oligonucleotide hybridization arrays, which utilize oligonucleotide probes specific for certain known alleles. Furthermore, off-ladder alleles and microvariants encountered with STR analysis, even when correctly typed, may lead to improper statistical analysis, since their frequencies in the population are generally unknown or poorly characterized, and therefore the statistical significance of a matching genotype may be questionable. All these advantages of SNP analysis are considerable in light of the consequences of most DNA identification cases, which may lead to life imprisonment for an individual, or re-association of remains to the family of a deceased individual.
[0356] DNA can be isolated from biological samples such as blood, bone, hair, saliva, or semen, and compared with the DNA from a reference source at particular SNP positions. Multiple SNP markers can be assayed simultaneously in order to increase the power of discrimination and the statistical significance of a matching genotype. For example, oligonucleotide arrays can be used to genotype a large number of SNPs simultaneously. The SNPs provided by the present invention can be assayed in combination with other polymorphic genetic markers, such as other SNPs known in the art or STRs, in order to identify an individual or to associate an individual with a particular biological sample.
[0357] Furthermore, the SNPs provided by the present invention can be genotyped for inclusion in a database of DNA genotypes, for example, a criminal DNA databank such as the FBI's Combined DNA Index System (CODIS) database. A genotype obtained from a biological sample of unknown source can then be queried against the database to find a matching genotype, with the SNPs of the present invention providing nucleotide positions at which to compare the known and unknown DNA sequences for identity. Accordingly, the present invention provides a database comprising novel SNPs or SNP alleles of the present invention (e.g., the database can comprise information indicating which alleles are possessed by individual members of a population at one or more novel SNP sites of the present invention), such as for use in forensics, biometrics, or other human identification applications. Such a database typically comprises a computer-based system in which the SNPs or SNP alleles of the present invention are recorded on a computer readable medium (see the section of the present specification entitled “Computer-Related Embodiments”).
[0358] The SNPs of the present invention can also be assayed for use in paternity testing. The object of paternity testing is usually to determine whether a male is the father of a child. In most cases, the mother of the child is known and thus, the mother's contribution to the child's genotype can be traced. Paternity testing investigates whether the part of the child's genotype not attributable to the mother is consistent with that of the putative father. Paternity testing can be performed by analyzing sets of polymorphisms in the putative father and the child, with the SNPs of the present invention providing nucleotide positions at which to compare the putative father's and child's DNA sequences for identity. If the set of polymorphisms in the child attributable to the father does not match the set of polymorphisms of the putative father, it can be concluded, barring experimental error, that the putative father is not the father of the child. If the set of polymorphisms in the child attributable to the father match the set of polymorphisms of the putative father, a statistical calculation can be performed to determine the probability of coincidental match, and a conclusion drawn as to the likelihood that the putative father is the true biological father of the child.
[0359] In addition to paternity testing, SNPs are also useful for other types of kinship testing, such as for verifying familial relationships for immigration purposes, or for cases in which an individual alleges to be related to a deceased individual in order to claim an inheritance from the deceased individual, etc. For further information regarding the utility of SNPs for paternity testing and other types of kinship testing, including methods for statistical analysis, see Krawczak, “Informativity assessment for biallelic single nucleotide polymorphisms”, Electrophoresis 1999 June; 20(8):1676-81.
[0360] The use of the SNPs of the present invention for human identification further extends to various authentication systems, commonly referred to as biometric systems, which typically convert physical characteristics of humans (or other organisms) into digital data. Biometric systems include various technological devices that measure such unique anatomical or physiological characteristics as finger, thumb, or palm prints; hand geometry; vein patterning on the back of the hand; blood vessel patterning of the retina and color and texture of the iris; facial characteristics; voice patterns; signature and typing dynamics; and DNA. Such physiological measurements can be used to verify identity and, for example, restrict or allow access based on the identification. Examples of applications for biometrics include physical area security, computer and network security, aircraft passenger check-in and boarding, financial transactions, medical records access, government benefit distribution, voting, law enforcement, passports, visas and immigration, prisons, various military applications, and for restricting access to expensive or dangerous items, such as automobiles or guns (see, for example, O'Connor, Stanford Technology Law Review and U.S. Pat. No. 6,119,096).
[0361] Groups of SNPs, particularly the SNPs provided by the present invention, can be typed to uniquely identify an individual for biometric applications such as those described above. Such SNP typing can readily be accomplished using, for example, DNA chips/arrays. Preferably, a minimally invasive means for obtaining a DNA sample is utilized. For example, PCR amplification enables sufficient quantities of DNA for analysis to be obtained from buccal swabs or fingerprints, which contain DNA-containing skin cells and oils that are naturally transferred during contact. Further information regarding techniques for using SNPs in forensic/human identification applications can be found in, for example, Current Protocols in Human Genetics, John Wiley & Sons, N.Y. (2002), 14.1-14.7.
Variant Proteins, Antibodies, Vectors & Host Cells, & Uses Thereof
[0362] Variant Proteins Encoded by SNP-Containing Nucleic Acid Molecules
[0363] The present invention provides SNP-containing nucleic acid molecules, many of which encode proteins having variant amino acid sequences as compared to the art-known (i.e., wild-type) proteins. Amino acid sequences encoded by the polymorphic nucleic acid molecules of the present invention are provided as SEQ ID NOS:81-160 in Table 1 and the Sequence Listing. These variants will generally be referred to herein as variant proteins/peptides/polypeptides, or polymorphic proteins/peptides/polypeptides of the present invention. The terms “protein”, “peptide”, and “polypeptide” are used herein interchangeably.
[0364] A variant protein of the present invention may be encoded by, for example, a nonsynonymous nucleotide substitution at any one of the cSNP positions disclosed herein. In addition, variant proteins may also include proteins whose expression, structure, and/or function is altered by a SNP disclosed herein, such as a SNP that creates or destroys a stop codon, a SNP that affects splicing, and a SNP in control/regulatory elements, e.g. promoters, enhancers, or transcription factor binding domains.
[0365] As used herein, a protein or peptide is said to be “isolated” or “purified” when it is substantially free of cellular material or chemical precursors or other chemicals. The variant proteins of the present invention can be purified to homogeneity or other lower degrees of purity. The level of purification will be based on the intended use. The key feature is that the preparation allows for the desired function of the variant protein, even if in the presence of considerable amounts of other components.
[0366] As used herein, “substantially free of cellular material” includes preparations of the variant protein having less than about 30% (by dry weight) other proteins (i.e., contaminating protein), less than about 20% other proteins, less than about 10% other proteins, or less than about 5% other proteins. When the variant protein is recombinantly produced, it can also be substantially free of culture medium, i.e., culture medium represents less than about 20% of the volume of the protein preparation.
[0367] The language “substantially free of chemical precursors or other chemicals” includes preparations of the variant protein in which it is separated from chemical precursors or other chemicals that are involved in its synthesis. In one embodiment, the language “substantially free of chemical precursors or other chemicals” includes preparations of the variant protein having less than about 30% (by dry weight) chemical precursors or other chemicals, less than about 20% chemical precursors or other chemicals, less than about 10% chemical precursors or other chemicals, or less than about 5% chemical precursors or other chemicals.
[0368] An isolated variant protein may be purified from cells that naturally express it, purified from cells that have been altered to express it (recombinant host cells), or synthesized using known protein synthesis methods. For example, a nucleic acid molecule containing SNP(s) encoding the variant protein can be cloned into an expression vector, the expression vector introduced into a host cell, and the variant protein expressed in the host cell. The variant protein can then be isolated from the cells by any appropriate purification scheme using standard protein purification techniques. Examples of these techniques are described in detail below (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
[0369] The present invention provides isolated variant proteins that comprise, consist of or consist essentially of amino acid sequences that contain one or more variant amino acids encoded by one or more codons which contain a SNP of the present invention.
[0370] Accordingly, the present invention provides variant proteins that consist of amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein consists of an amino acid sequence when the amino acid sequence is the entire amino acid sequence of the protein.
[0371] The present invention further provides variant proteins that consist essentially of amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein consists essentially of an amino acid sequence when such an amino acid sequence is present with only a few additional amino acid residues in the final protein.
[0372] The present invention further provides variant proteins that comprise amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein comprises an amino acid sequence when the amino acid sequence is at least part of the final amino acid sequence of the protein. In such a fashion, the protein may contain only the variant amino acid sequence or have additional amino acid residues, such as a contiguous encoded sequence that is naturally associated with it or heterologous amino acid residues. Such a protein can have a few additional amino acid residues or can comprise many more additional amino acids. A brief description of how various types of these proteins can be made and isolated is provided below.
[0373] The variant proteins of the present invention can be attached to heterologous sequences to form chimeric or fusion proteins. Such chimeric and fusion proteins comprise a variant protein operatively linked to a heterologous protein having an amino acid sequence not substantially homologous to the variant protein. “Operatively linked” indicates that the coding sequences for the variant protein and the heterologous protein are ligated in-frame. The heterologous protein can be fused to the N-terminus or C-terminus of the variant protein. In another embodiment, the fusion protein is encoded by a fusion polynucleotide that is synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see Ausubel et al., Current Protocols in Molecular Biology, 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST protein). A variant protein-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the variant protein.
[0374] In many uses, the fusion protein does not affect the activity of the variant protein. The fusion protein can include, but is not limited to, enzymatic fusion proteins, for example, beta-galactosidase fusions, yeast two-hybrid GAL fusions, poly-His fusions, MYC-tagged, HI-tagged and Ig fusions. Such fusion proteins, particularly poly-His fusions, can facilitate their purification following recombinant expression. In certain host cells (e g , mammalian host cells), expression and/or secretion of a protein can be increased by using a heterologous signal sequence. Fusion proteins are further described in, for example, Terpe, “Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems”, Appl Microbiol Biotechnol. 2003 January; 60(5):523-33. Epub 2002 Nov. 7; Graddis et al., “Designing proteins that work using recombinant technologies”, Curr Pharm Biotechnol. 2002 December; 3(4):285-97; and Nilsson et al., “Affinity fusion strategies for detection, purification, and immobilization of recombinant proteins”, Protein Expr Purif. 1997 October; 11(1):1-16.
[0375] The present invention also relates to further obvious variants of the variant polypeptides of the present invention, such as naturally-occurring mature forms (e.g., alleleic variants), non-naturally occurring recombinantly-derived variants, and orthologs and paralogs of such proteins that share sequence homology. Such variants can readily be generated using art-known techniques in the fields of recombinant nucleic acid technology and protein biochemistry. It is understood, however, that variants exclude those known in the prior art before the present invention.
[0376] Further variants of the variant polypeptides disclosed in Table 1 can comprise an amino acid sequence that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with an amino acid sequence disclosed in Table 1 (or a fragment thereof) and that includes a novel amino acid residue (allele) disclosed in Table 1 (which is encoded by a novel SNP allele). Thus, an aspect of the present invention that is specifically contemplated are polypeptides that have a certain degree of sequence variation compared with the polypeptide sequences shown in Table 1, but that contain a novel amino acid residue (allele) encoded by a novel SNP allele disclosed herein. In other words, as long as a polypeptide contains a novel amino acid residue disclosed herein, other portions of the polypeptide that flank the novel amino acid residue can vary to some degree from the polypeptide sequences shown in Table 1.
[0377] Full-length pre-processed forms, as well as mature processed forms, of proteins that comprise one of the amino acid sequences disclosed herein can readily be identified as having complete sequence identity to one of the variant proteins of the present invention as well as being encoded by the same genetic locus as the variant proteins provided herein.
[0378] Orthologs of a variant peptide can readily be identified as having some degree of significant sequence homology/identity to at least a portion of a variant peptide as well as being encoded by a gene from another organism. Preferred orthologs will be isolated from non-human mammals, preferably primates, for the development of human therapeutic targets and agents. Such orthologs can be encoded by a nucleic acid sequence that hybridizes to a variant peptide-encoding nucleic acid molecule under moderate to stringent conditions depending on the degree of relatedness of the two organisms yielding the homologous proteins.
[0379] Variant proteins include, but are not limited to, proteins containing deletions, additions and substitutions in the amino acid sequence caused by the SNPs of the present invention. One class of substitutions is conserved amino acid substitutions in which a given amino acid in a polypeptide is substituted for another amino acid of like characteristics. Typical conservative substitutions are replacements, one for another, among the aliphatic amino acids Ala, Val, Leu, and Ile; interchange of the hydroxyl residues Ser and Thr; exchange of the acidic residues Asp and Glu; substitution between the amide residues Asn and Gln; exchange of the basic residues Lys and Arg; and replacements among the aromatic residues Phe and Tyr. Guidance concerning which amino acid changes are likely to be phenotypically silent are found in, for example, Bowie et al., Science 247:1306-1310 (1990).
[0380] Variant proteins can be fully functional or can lack function in one or more activities, e.g. ability to bind another molecule, ability to catalyze a substrate, ability to mediate signaling, etc. Fully functional variants typically contain only conservative variations or variations in non-critical residues or in non-critical regions. Functional variants can also contain substitution of similar amino acids that result in no change or an insignificant change in function. Alternatively, such substitutions may positively or negatively affect function to some degree. Non-functional variants typically contain one or more non-conservative amino acid substitutions, deletions, insertions, inversions, truncations or extensions, or a substitution, insertion, inversion, or deletion of a critical residue or in a critical region.
[0381] Amino acids that are essential for function of a protein can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham et al., Science 244:1081-1085 (1989)), particularly using the amino acid sequence and polymorphism information provided in Table 1. The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as enzyme activity or in assays such as an in vitro proliferative activity. Sites that are critical for binding partner/substrate binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904 (1992); de Vos et al. Science 255:306-312 (1992)).
[0382] Polypeptides can contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids. Further, many amino acids, including the terminal amino acids, may be modified by natural processes, such as processing and other post-translational modifications, or by chemical modification techniques well known in the art. Accordingly, the variant proteins of the present invention also encompass derivatives or analogs in which a substituted amino acid residue is not one encoded by the genetic code, in which a substituent group is included, in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (e.g., polyethylene glycol), or in which additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence for purification of the mature polypeptide or a pro-protein sequence.
[0383] Known protein modifications include, but are not limited to, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent crosslinks, formation of cystine, formation of pyroglutamate, formylation, gamma carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.
[0384] Such protein modifications are well known to those of skill in the art and have been described in great detail in the scientific literature. Several particularly common modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation, for instance, are described in most basic texts, such as Proteins—Structure and Molecular Properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993); Wold, F., Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York 1-12 (1983); Seifter et al., Meth. Enzymol. 182: 626-646 (1990); and Rattan et al., Ann. N.Y. Acad. Sci. 663:48-62 (1992).
[0385] The present invention further provides fragments of the variant proteins in which the fragments contain one or more amino acid sequence variations (e.g., substitutions, or truncations or extensions due to creation or destruction of a stop codon) encoded by one or more SNPs disclosed herein. The fragments to which the invention pertains, however, are not to be construed as encompassing fragments that have been disclosed in the prior art before the present invention.
[0386] As used herein, a fragment may comprise at least about 4, 8, 10, 12, 14, 16, 18, 20, 25, 30, 50, 100 (or any other number in-between) or more contiguous amino acid residues from a variant protein, wherein at least one amino acid residue is affected by a SNP of the present invention, e.g., a variant amino acid residue encoded by a nonsynonymous nucleotide substitution at a cSNP position provided by the present invention. The variant amino acid encoded by a cSNP may occupy any residue position along the sequence of the fragment. Such fragments can be chosen based on the ability to retain one or more of the biological activities of the variant protein or the ability to perform a function, e.g., act as an immunogen. Particularly important fragments are biologically active fragments. Such fragments will typically comprise a domain or motif of a variant protein of the present invention, e.g., active site, transmembrane domain, or ligand/substrate binding domain. Other fragments include, but are not limited to, domain or motif-containing fragments, soluble peptide fragments, and fragments containing immunogenic structures. Predicted domains and functional sites are readily identifiable by computer programs well known to those of skill in the art (e.g., PROSITE analysis) (Current Protocols in Protein Science, John Wiley & Sons, N.Y. (2002)).
[0387] Uses of Variant Proteins
[0388] The variant proteins of the present invention can be used in a variety of ways, including but not limited to, in assays to determine the biological activity of a variant protein, such as in a panel of multiple proteins for high-throughput screening; to raise antibodies or to elicit another type of immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the variant protein (or its binding partner) in biological fluids; as a marker for cells or tissues in which it is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); as a target for screening for a therapeutic agent; and as a direct therapeutic agent to be administered into a human subject. Any of the variant proteins disclosed herein may be developed into reagent grade or kit format for commercialization as research products. Methods for performing the uses listed above are well known to those skilled in the art (see, e.g., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Sambrook and Russell, 2000, and Methods in Enzymology: Guide to Molecular Cloning Techniques, Academic Press, Berger, S. L. and A. R. Kimmel eds., 1987).
[0389] In a specific embodiment of the invention, the methods of the present invention include detection of one or more variant proteins disclosed herein. Variant proteins are disclosed in Table 1 and in the Sequence Listing as SEQ ID NOS:81-160. Detection of such proteins can be accomplished using, for example, antibodies, small molecule compounds, aptamers, ligands/substrates, other proteins or protein fragments, or other protein-binding agents. Preferably, protein detection agents are specific for a variant protein of the present invention and can therefore discriminate between a variant protein of the present invention and the wild-type protein or another variant form. This can generally be accomplished by, for example, selecting or designing detection agents that bind to the region of a protein that differs between the variant and wild-type protein, such as a region of a protein that contains one or more amino acid substitutions that is/are encoded by a non-synonymous cSNP of the present invention, or a region of a protein that follows a nonsense mutation-type SNP that creates a stop codon thereby leading to a shorter polypeptide, or a region of a protein that follows a read-through mutation-type SNP that destroys a stop codon thereby leading to a longer polypeptide in which a portion of the polypeptide is present in one version of the polypeptide but not the other.
[0390] In another specific aspect of the invention, the variant proteins of the present invention are used as targets for diagnosing stroke or for determining predisposition to stroke in a human (e.g., determining whether an individual has an increased or decreased risk of having a stroke). Accordingly, the invention provides methods for detecting the presence of, or levels of, one or more variant proteins of the present invention in a cell, tissue, or organism. Such methods typically involve contacting a test sample with an agent (e.g., an antibody, small molecule compound, or peptide) capable of interacting with the variant protein such that specific binding of the agent to the variant protein can be detected. Such an assay can be provided in a single detection format or a multi-detection format such as an array, for example, an antibody or aptamer array (arrays for protein detection may also be referred to as “protein chips”). The variant protein of interest can be isolated from a test sample and assayed for the presence of a variant amino acid sequence encoded by one or more SNPs disclosed by the present invention. The SNPs may cause changes to the protein and the corresponding protein function/activity, such as through non-synonymous substitutions in protein coding regions that can lead to amino acid substitutions, deletions, insertions, and/or rearrangements; formation or destruction of stop codons; or alteration of control elements such as promoters. SNPs may also cause inappropriate post-translational modifications.
[0391] One preferred agent for detecting a variant protein in a sample is an antibody capable of selectively binding to a variant form of the protein (antibodies are described in greater detail in the next section). Such samples include, for example, tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject.
[0392] In vitro methods for detection of the variant proteins associated with stroke that are disclosed herein and fragments thereof include, but are not limited to, enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RIA), Western blots, immunoprecipitations, immunofluorescence, and protein arrays/chips (e.g., arrays of antibodies or aptamers). For further information regarding immunoassays and related protein detection methods, see Current Protocols in Immunology, John Wiley & Sons, N.Y., and Hage, “Immunoassays”, Anal Chem. 1999 Jun. 15; 71(12):294R-304R.
[0393] Additional analytic methods of detecting amino acid variants include, but are not limited to, altered electrophoretic mobility, altered tryptic peptide digest, altered protein activity in cell-based or cell-free assay, alteration in ligand or antibody-binding pattern, altered isoelectric point, and direct amino acid sequencing.
[0394] Alternatively, variant proteins can be detected in vivo in a subject by introducing into the subject a labeled antibody (or other type of detection reagent) specific for a variant protein. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
[0395] Other uses of the variant peptides of the present invention are based on the class or action of the protein. For example, proteins isolated from humans and their mammalian orthologs serve as targets for identifying agents (e.g., small molecule drugs or antibodies) for use in therapeutic applications, particularly for modulating a biological or pathological response in a cell or tissue that expresses the protein. Pharmaceutical agents can be developed that modulate protein activity.
[0396] As an alternative to modulating gene expression, therapeutic compounds can be developed that modulate protein function. For example, many SNPs disclosed herein affect the amino acid sequence of the encoded protein (e.g., non-synonymous cSNPs and nonsense mutation-type SNPs). Such alterations in the encoded amino acid sequence may affect protein function, particularly if such amino acid sequence variations occur in functional protein domains, such as catalytic domains, ATP-binding domains, or ligand/substrate binding domains. It is well established in the art that variant proteins having amino acid sequence variations in functional domains can cause or influence pathological conditions. In such instances, compounds (e.g., small molecule drugs or antibodies) can be developed that target the variant protein and modulate (e.g., up- or down-regulate) protein function/activity.
[0397] The therapeutic methods of the present invention further include methods that target one or more variant proteins of the present invention. Variant proteins can be targeted using, for example, small molecule compounds, antibodies, aptamers, ligands/substrates, other proteins, or other protein-binding agents. Additionally, the skilled artisan will recognize that the novel protein variants (and polymorphic nucleic acid molecules) disclosed in Table 1 may themselves be directly used as therapeutic agents by acting as competitive inhibitors of corresponding art-known proteins (or nucleic acid molecules such as mRNA molecules).
[0398] The variant proteins of the present invention are particularly useful in drug screening assays, in cell-based or cell-free systems. Cell-based systems can utilize cells that naturally express the protein, a biopsy specimen, or cell cultures. In one embodiment, cell-based assays involve recombinant host cells expressing the variant protein. Cell-free assays can be used to detect the ability of a compound to directly bind to a variant protein or to the corresponding SNP-containing nucleic acid fragment that encodes the variant protein.
[0399] A variant protein of the present invention, as well as appropriate fragments thereof, can be used in high-throughput screening assays to test candidate compounds for the ability to bind and/or modulate the activity of the variant protein. These candidate compounds can be further screened against a protein having normal function (e.g., a wild-type/non-variant protein) to further determine the effect of the compound on the protein activity. Furthermore, these compounds can be tested in animal or invertebrate systems to determine in vivo activity/effectiveness. Compounds can be identified that activate (agonists) or inactivate (antagonists) the variant protein, and different compounds can be identified that cause various degrees of activation or inactivation of the variant protein.
[0400] Further, the variant proteins can be used to screen a compound for the ability to stimulate or inhibit interaction between the variant protein and a target molecule that normally interacts with the protein. The target can be a ligand, a substrate or a binding partner that the protein normally interacts with (for example, epinephrine or norepinephrine). Such assays typically include the steps of combining the variant protein with a candidate compound under conditions that allow the variant protein, or fragment thereof, to interact with the target molecule, and to detect the formation of a complex between the protein and the target or to detect the biochemical consequence of the interaction with the variant protein and the target, such as any of the associated effects of signal transduction.
[0401] Candidate compounds include, for example, 1) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e.g., Lam et al., Nature 354:82-84 (1991); Houghten et al., Nature 354:84-86 (1991)) and combinatorial chemistry-derived molecular libraries made of D- and/or L-configuration amino acids; 2) phosphopeptides (e.g., members of random and partially degenerate, directed phosphopeptide libraries, see, e.g., Songyang et al., Cell 72:767-778 (1993)); 3) antibodies (e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies as well as Fab, F(ab′).sub.2, Fab expression library fragments, and epitope-binding fragments of antibodies); and 4) small organic and inorganic molecules (e.g., molecules obtained from combinatorial and natural product libraries).
[0402] One candidate compound is a soluble fragment of the variant protein that competes for ligand binding. Other candidate compounds include mutant proteins or appropriate fragments containing mutations that affect variant protein function and thus compete for ligand. Accordingly, a fragment that competes for ligand, for example with a higher affinity, or a fragment that binds ligand but does not allow release, is encompassed by the invention.
[0403] The invention further includes other end point assays to identify compounds that modulate (stimulate or inhibit) variant protein activity. The assays typically involve an assay of events in the signal transduction pathway that indicate protein activity. Thus, the expression of genes that are up or down-regulated in response to the variant protein dependent signal cascade can be assayed. In one embodiment, the regulatory region of such genes can be operably linked to a marker that is easily detectable, such as luciferase. Alternatively, phosphorylation of the variant protein, or a variant protein target, could also be measured. Any of the biological or biochemical functions mediated by the variant protein can be used as an endpoint assay. These include all of the biochemical or biological events described herein, in the references cited herein, incorporated by reference for these endpoint assay targets, and other functions known to those of ordinary skill in the art.
[0404] Binding and/or activating compounds can also be screened by using chimeric variant proteins in which an amino terminal extracellular domain or parts thereof, an entire transmembrane domain or subregions, and/or the carboxyl terminal intracellular domain or parts thereof, can be replaced by heterologous domains or subregions. For example, a substrate-binding region can be used that interacts with a different substrate than that which is normally recognized by a variant protein. Accordingly, a different set of signal transduction components is available as an end-point assay for activation. This allows for assays to be performed in other than the specific host cell from which the variant protein is derived.
[0405] The variant proteins are also useful in competition binding assays in methods designed to discover compounds that interact with the variant protein. Thus, a compound can be exposed to a variant protein under conditions that allow the compound to bind or to otherwise interact with the variant protein. A binding partner, such as ligand, that normally interacts with the variant protein is also added to the mixture. If the test compound interacts with the variant protein or its binding partner, it decreases the amount of complex formed or activity from the variant protein. This type of assay is particularly useful in screening for compounds that interact with specific regions of the variant protein (Hodgson, Bio/technology, 1992, Sep. 10(9), 973-80).
[0406] To perform cell-free drug screening assays, it is sometimes desirable to immobilize either the variant protein or a fragment thereof, or its target molecule, to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Any method for immobilizing proteins on matrices can be used in drug screening assays. In one embodiment, a fusion protein containing an added domain allows the protein to be bound to a matrix. For example, glutathione-S-transferase/.sup.125I fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined with the cell lysates (e.g., .sup.35S-labeled) and a candidate compound, such as a drug candidate, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads can be washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly, or in the supernatant after the complexes are dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of bound material found in the bead fraction quantitated from the gel using standard electrophoretic techniques.
[0407] Either the variant protein or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin. Alternatively, antibodies reactive with the variant protein but which do not interfere with binding of the variant protein to its target molecule can be derivatized to the wells of the plate, and the variant protein trapped in the wells by antibody conjugation. Preparations of the target molecule and a candidate compound are incubated in the variant protein-presenting wells and the amount of complex trapped in the well can be quantitated. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the protein target molecule, or which are reactive with variant protein and compete with the target molecule, and enzyme-linked assays that rely on detecting an enzymatic activity associated with the target molecule.
[0408] Modulators of variant protein activity identified according to these drug screening assays can be used to treat a subject with a disorder mediated by the protein pathway, such as stroke. These methods of treatment typically include the steps of administering the modulators of protein activity in a pharmaceutical composition to a subject in need of such treatment.
[0409] The variant proteins, or fragments thereof, disclosed herein can themselves be directly used to treat a disorder characterized by an absence of, inappropriate, or unwanted expression or activity of the variant protein. Accordingly, methods for treatment include the use of a variant protein disclosed herein or fragments thereof.
[0410] In yet another aspect of the invention, variant proteins can be used as “bait proteins” in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem. 268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924; Iwabuchi et al. (1993) Oncogene 8:1693-1696; and Brent WO94/10300) to identify other proteins that bind to or interact with the variant protein and are involved in variant protein activity. Such variant protein-binding proteins are also likely to be involved in the propagation of signals by the variant proteins or variant protein targets as, for example, elements of a protein-mediated signaling pathway. Alternatively, such variant protein-binding proteins are inhibitors of the variant protein.
[0411] The two-hybrid system is based on the modular nature of most transcription factors, which typically consist of separable DNA-binding and activation domains. Briefly, the assay typically utilizes two different DNA constructs. In one construct, the gene that codes for a variant protein is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein (“prey” or “sample”) is fused to a gene that codes for the activation domain of the known transcription factor. If the “bait” and the “prey” proteins are able to interact, in vivo, forming a variant protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) that is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene that encodes the protein that interacts with the variant protein.
[0412] Antibodies Directed to Variant Proteins
[0413] The present invention also provides antibodies that selectively bind to the variant proteins disclosed herein and fragments thereof. Such antibodies may be used to quantitatively or qualitatively detect the variant proteins of the present invention. As used herein, an antibody selectively binds a target variant protein when it binds the variant protein and does not significantly bind to non-variant proteins, i.e., the antibody does not significantly bind to normal, wild-type, or art-known proteins that do not contain a variant amino acid sequence due to one or more SNPs of the present invention (variant amino acid sequences may be due to, for example, nonsynonymous cSNPs, nonsense SNPs that create a stop codon, thereby causing a truncation of a polypeptide or SNPs that cause read-through mutations resulting in an extension of a polypeptide).
[0414] As used herein, an antibody is defined in terms consistent with that recognized in the art: they are multi-subunit proteins produced by an organism in response to an antigen challenge. The antibodies of the present invention include both monoclonal antibodies and polyclonal antibodies, as well as antigen-reactive proteolytic fragments of such antibodies, such as Fab, F(ab)′.sub.2, and Fv fragments. In addition, an antibody of the present invention further includes any of a variety of engineered antigen-binding molecules such as a chimeric antibody (U.S. Pat. Nos. 4,816,567 and 4,816,397; Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851, 1984; Neuberger et al., Nature 312:604, 1984), a humanized antibody (U.S. Pat. Nos. 5,693,762; 5,585,089; and 5,565,332), a single-chain Fv (U.S. Pat. No. 4,946,778; Ward et al., Nature 334:544, 1989), a bispecific antibody with two binding specificities (Segal et al., J. Immunol. Methods 248:1, 2001; Carter, J. Immunol. Methods 248:7, 2001), a diabody, a triabody, and a tetrabody (Todorovska et al., J. Immunol. Methods, 248:47, 2001), as well as a Fab conjugate (dimer or trimer), and a minibody.
[0415] Many methods are known in the art for generating and/or identifying antibodies to a given target antigen (Harlow, Antibodies, Cold Spring Harbor Press, (1989)). In general, an isolated peptide (e.g., a variant protein of the present invention) is used as an immunogen and is administered to a mammalian organism, such as a rat, rabbit, hamster or mouse. Either a full-length protein, an antigenic peptide fragment (e.g., a peptide fragment containing a region that varies between a variant protein and a corresponding wild-type protein), or a fusion protein can be used. A protein used as an immunogen may be naturally-occurring, synthetic or recombinantly produced, and may be administered in combination with an adjuvant, including but not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substance such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and the like.
[0416] Monoclonal antibodies can be produced by hybridoma technology (Kohler and Milstein, Nature, 256:495, 1975), which immortalizes cells secreting a specific monoclonal antibody. The immortalized cell lines can be created in vitro by fusing two different cell types, typically lymphocytes, and tumor cells. The hybridoma cells may be cultivated in vitro or in vivo. Additionally, fully human antibodies can be generated by transgenic animals (He et al., J. Immunol., 169:595, 2002). Fd phage and Fd phagemid technologies may be used to generate and select recombinant antibodies in vitro (Hoogenboom and Chames, Immunol. Today 21:371, 2000; Liu et al., J. Mol. Biol. 315:1063, 2002). The complementarity-determining regions of an antibody can be identified, and synthetic peptides corresponding to such regions may be used to mediate antigen binding (U.S. Pat. No. 5,637,677).
[0417] Antibodies are preferably prepared against regions or discrete fragments of a variant protein containing a variant amino acid sequence as compared to the corresponding wild-type protein (e.g., a region of a variant protein that includes an amino acid encoded by a nonsynonymous cSNP, a region affected by truncation caused by a nonsense SNP that creates a stop codon, or a region resulting from the destruction of a stop codon due to read-through mutation caused by a SNP). Furthermore, preferred regions will include those involved in function/activity and/or protein/binding partner interaction. Such fragments can be selected on a physical property, such as fragments corresponding to regions that are located on the surface of the protein, e.g., hydrophilic regions, or can be selected based on sequence uniqueness, or based on the position of the variant amino acid residue(s) encoded by the SNPs provided by the present invention. An antigenic fragment will typically comprise at least about 8-10 contiguous amino acid residues in which at least one of the amino acid residues is an amino acid affected by a SNP disclosed herein. The antigenic peptide can comprise, however, at least 12, 14, 16, 20, 25, 50, 100 (or any other number in-between) or more amino acid residues, provided that at least one amino acid is affected by a SNP disclosed herein.
[0418] Detection of an antibody of the present invention can be facilitated by coupling (i.e., physically linking) the antibody or an antigen-reactive fragment thereof to a detectable substance. Detectable substances include, but are not limited to, various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include .sup.125I, .sup.131I, .sup.35S or .sup.3H.
[0419] Antibodies, particularly the use of antibodies as therapeutic agents, are reviewed in: Morgan, “Antibody therapy for Alzheimer's disease”, Expert Rev Vaccines. 2003 February; 2(1):53-9; Ross et al., “Anticancer antibodies”, Am J Clin Pathol. 2003 April; 119(4):472-85; Goldenberg, “Advancing role of radiolabeled antibodies in the therapy of cancer”, Cancer Immunol Immunother. 2003 May; 52(5):281-96. Epub 2003 Mar. 11; Ross et al., “Antibody-based therapeutics in oncology”, Expert Rev Anticancer Ther. 2003 February; 3(1):107-21; Cao et al., “Bispecific antibody conjugates in therapeutics”, Adv Drug Deliv Rev. 2003 Feb. 10; 55(2):171-97; von Mehren et al., “Monoclonal antibody therapy for cancer”, Annu Rev Med. 2003; 54:343-69. Epub 2001 Dec. 3; Hudson et al., “Engineered antibodies”, Nat Med. 2003 January; 9(1):129-34; Brekke et al., “Therapeutic antibodies for human diseases at the dawn of the twenty-first century”, Nat Rev Drug Discov. 2003 January; 2(1):52-62 (Erratum in: Nat Rev Drug Discov. 2003 March; 2(3):240); Houdebine, “Antibody manufacture in transgenic animals and comparisons with other systems”, Curr Opin Biotechnol. 2002 December; 13(6):625-9; Andreakos et al., “Monoclonal antibodies in immune and inflammatory diseases”, Curr Opin Biotechnol. 2002 December; 13(6):615-20; Kellermann et al., “Antibody discovery: the use of transgenic mice to generate human monoclonal antibodies for therapeutics”, Curr Opin Biotechnol. 2002 December; 13(6):593-7; Pini et al., “Phage display and colony filter screening for high-throughput selection of antibody libraries”, Comb Chem High Throughput Screen. 2002 November; 5(7):503-10; Batra et al., “Pharmacokinetics and biodistribution of genetically engineered antibodies”, Curr Opin Biotechnol. 2002 December; 13(6):603-8; and Tangri et al., “Rationally engineered proteins or antibodies with absent or reduced immunogenicity”, Curr Med Chem. 2002 December; 9(24):2191-9.
[0420] Uses of Antibodies
[0421] Antibodies can be used to isolate the variant proteins of the present invention from a natural cell source or from recombinant host cells by standard techniques, such as affinity chromatography or immunoprecipitation. In addition, antibodies are useful for detecting the presence of a variant protein of the present invention in cells or tissues to determine the pattern of expression of the variant protein among various tissues in an organism and over the course of normal development or disease progression. Further, antibodies can be used to detect variant protein in situ, in vitro, in a bodily fluid, or in a cell lysate or supernatant in order to evaluate the amount and pattern of expression. Also, antibodies can be used to assess abnormal tissue distribution, abnormal expression during development, or expression in an abnormal condition, such as stroke. Additionally, antibody detection of circulating fragments of the full-length variant protein can be used to identify turnover.
[0422] Antibodies to the variant proteins of the present invention are also useful in pharmacogenomic analysis. Thus, antibodies against variant proteins encoded by alternative SNP alleles can be used to identify individuals that require modified treatment modalities.
[0423] Further, antibodies can be used to assess expression of the variant protein in disease states such as in active stages of the disease or in an individual with a predisposition to a disease related to the protein's function, particularly stroke. Antibodies specific for a variant protein encoded by a SNP-containing nucleic acid molecule of the present invention can be used to assay for the presence of the variant protein, such as to screen for predisposition to stroke as indicated by the presence of the variant protein.
[0424] Antibodies are also useful as diagnostic tools for evaluating the variant proteins in conjunction with analysis by electrophoretic mobility, isoelectric point, tryptic peptide digest, and other physical assays well known in the art.
[0425] Antibodies are also useful for tissue typing. Thus, where a specific variant protein has been correlated with expression in a specific tissue, antibodies that are specific for this protein can be used to identify a tissue type.
[0426] Antibodies can also be used to assess aberrant subcellular localization of a variant protein in cells in various tissues. The diagnostic uses can be applied, not only in genetic testing, but also in monitoring a treatment modality. Accordingly, where treatment is ultimately aimed at correcting the expression level or the presence of variant protein or aberrant tissue distribution or developmental expression of a variant protein, antibodies directed against the variant protein or relevant fragments can be used to monitor therapeutic efficacy.
[0427] The antibodies are also useful for inhibiting variant protein function, for example, by blocking the binding of a variant protein to a binding partner. These uses can also be applied in a therapeutic context in which treatment involves inhibiting a variant protein's function. An antibody can be used, for example, to block or competitively inhibit binding, thus modulating (agonizing or antagonizing) the activity of a variant protein. Antibodies can be prepared against specific variant protein fragments containing sites required for function or against an intact variant protein that is associated with a cell or cell membrane. For in vivo administration, an antibody may be linked with an additional therapeutic payload such as a radionuclide, an enzyme, an immunogenic epitope, or a cytotoxic agent. Suitable cytotoxic agents include, but are not limited to, bacterial toxin such as diphtheria, and plant toxin such as ricin. The in vivo half-life of an antibody or a fragment thereof may be lengthened by pegylation through conjugation to polyethylene glycol (Leong et al., Cytokine 16:106, 2001).
[0428] The invention also encompasses kits for using antibodies, such as kits for detecting the presence of a variant protein in a test sample. An exemplary kit can comprise antibodies such as a labeled or labelable antibody and a compound or agent for detecting variant proteins in a biological sample; means for determining the amount, or presence/absence of variant protein in the sample; means for comparing the amount of variant protein in the sample with a standard; and instructions for use.
[0429] Vectors and Host Cells
[0430] The present invention also provides vectors containing the SNP-containing nucleic acid molecules described herein. The term “vector” refers to a vehicle, preferably a nucleic acid molecule, which can transport a SNP-containing nucleic acid molecule. When the vector is a nucleic acid molecule, the SNP-containing nucleic acid molecule can be covalently linked to the vector nucleic acid. Such vectors include, but are not limited to, a plasmid, single or double stranded phage, a single or double stranded RNA or DNA viral vector, or artificial chromosome, such as a BAC, PAC, YAC, or MAC.
[0431] A vector can be maintained in a host cell as an extrachromosomal element where it replicates and produces additional copies of the SNP-containing nucleic acid molecules. Alternatively, the vector may integrate into the host cell genome and produce additional copies of the SNP-containing nucleic acid molecules when the host cell replicates.
[0432] The invention provides vectors for the maintenance (cloning vectors) or vectors for expression (expression vectors) of the SNP-containing nucleic acid molecules. The vectors can function in prokaryotic or eukaryotic cells or in both (shuttle vectors).
[0433] Expression vectors typically contain cis-acting regulatory regions that are operably linked in the vector to the SNP-containing nucleic acid molecules such that transcription of the SNP-containing nucleic acid molecules is allowed in a host cell. The SNP-containing nucleic acid molecules can also be introduced into the host cell with a separate nucleic acid molecule capable of affecting transcription. Thus, the second nucleic acid molecule may provide a trans-acting factor interacting with the cis-regulatory control region to allow transcription of the SNP-containing nucleic acid molecules from the vector. Alternatively, a trans-acting factor may be supplied by the host cell. Finally, a trans-acting factor can be produced from the vector itself. It is understood, however, that in some embodiments, transcription and/or translation of the nucleic acid molecules can occur in a cell-free system.
[0434] The regulatory sequences to which the SNP-containing nucleic acid molecules described herein can be operably linked include promoters for directing mRNA transcription. These include, but are not limited to, the left promoter from bacteriophage λ, the lac, TRP, and TAC promoters from E. coli, the early and late promoters from SV40, the CMV immediate early promoter, the adenovirus early and late promoters, and retrovirus long-terminal repeats.
[0435] In addition to control regions that promote transcription, expression vectors may also include regions that modulate transcription, such as repressor binding sites and enhancers. Examples include the SV40 enhancer, the cytomegalovirus immediate early enhancer, polyoma enhancer, adenovirus enhancers, and retrovirus LTR enhancers.
[0436] In addition to containing sites for transcription initiation and control, expression vectors can also contain sequences necessary for transcription termination and, in the transcribed region, a ribosome-binding site for translation. Other regulatory control elements for expression include initiation and termination codons as well as polyadenylation signals. A person of ordinary skill in the art would be aware of the numerous regulatory sequences that are useful in expression vectors (see, e.g., Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
[0437] A variety of expression vectors can be used to express a SNP-containing nucleic acid molecule. Such vectors include chromosomal, episomal, and virus-derived vectors, for example, vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, including yeast artificial chromosomes, from viruses such as baculoviruses, papovaviruses such as SV40, Vaccinia viruses, adenoviruses, poxviruses, pseudorabies viruses, and retroviruses. Vectors can also be derived from combinations of these sources such as those derived from plasmid and bacteriophage genetic elements, e.g., cosmids and phagemids. Appropriate cloning and expression vectors for prokaryotic and eukaryotic hosts are described in Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
[0438] The regulatory sequence in a vector may provide constitutive expression in one or more host cells (e.g., tissue specific expression) or may provide for inducible expression in one or more cell types such as by temperature, nutrient additive, or exogenous factor, e.g., a hormone or other ligand. A variety of vectors that provide constitutive or inducible expression of a nucleic acid sequence in prokaryotic and eukaryotic host cells are well known to those of ordinary skill in the art.
[0439] A SNP-containing nucleic acid molecule can be inserted into the vector by methodology well-known in the art. Generally, the SNP-containing nucleic acid molecule that will ultimately be expressed is joined to an expression vector by cleaving the SNP-containing nucleic acid molecule and the expression vector with one or more restriction enzymes and then ligating the fragments together. Procedures for restriction enzyme digestion and ligation are well known to those of ordinary skill in the art.
[0440] The vector containing the appropriate nucleic acid molecule can be introduced into an appropriate host cell for propagation or expression using well-known techniques. Bacterial host cells include, but are not limited to, E. coli, Streptomyces, and Salmonella typhimurium. Eukaryotic host cells include, but are not limited to, yeast, insect cells such as Drosophila, animal cells such as COS and CHO cells, and plant cells.
[0441] As described herein, it may be desirable to express the variant peptide as a fusion protein. Accordingly, the invention provides fusion vectors that allow for the production of the variant peptides. Fusion vectors can, for example, increase the expression of a recombinant protein, increase the solubility of the recombinant protein, and aid in the purification of the protein by acting, for example, as a ligand for affinity purification. A proteolytic cleavage site may be introduced at the junction of the fusion moiety so that the desired variant peptide can ultimately be separated from the fusion moiety. Proteolytic enzymes suitable for such use include, but are not limited to, factor Xa, thrombin, and enterokinase. Typical fusion expression vectors include pGEX (Smith et al., Gene 67:31-40 (1988)), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein. Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al., Gene 69:301-415 (1988)) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185:60-89 (1990)).
[0442] Recombinant protein expression can be maximized in a bacterial host by providing a genetic background wherein the host cell has an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119-128). Alternatively, the sequence of the SNP-containing nucleic acid molecule of interest can be altered to provide preferential codon usage for a specific host cell, for example, E. coli (Wada et al., Nucleic Acids Res. 20:2111-2118 (1992)).
[0443] The SNP-containing nucleic acid molecules can also be expressed by expression vectors that are operative in yeast. Examples of vectors for expression in yeast (e.g., S. cerevisiae) include pYepSec1 (Baldari, et al., EMBO J. 6:229-234 (1987)), pMFa (Kurjan et al., Cell 30:933-943(1982)), pJRY88 (Schultz et al., Gene 54:113-123 (1987)), and pYES2 (Invitrogen Corporation, San Diego, Calif.).
[0444] The SNP-containing nucleic acid molecules can also be expressed in insect cells using, for example, baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al., Mol. Cell Biol. 3:2156-2165 (1983)) and the pVL series (Lucklow et al., Virology 170:31-49 (1989)).
[0445] In certain embodiments of the invention, the SNP-containing nucleic acid molecules described herein are expressed in mammalian cells using mammalian expression vectors. Examples of mammalian expression vectors include pCDM8 (Seed, B. Nature 329:840(1987)) and pMT2PC (Kaufman et al., EMBO J. 6:187-195 (1987)).
[0446] The invention also encompasses vectors in which the SNP-containing nucleic acid molecules described herein are cloned into the vector in reverse orientation, but operably linked to a regulatory sequence that permits transcription of antisense RNA. Thus, an antisense transcript can be produced to the SNP-containing nucleic acid sequences described herein, including both coding and non-coding regions. Expression of this antisense RNA is subject to each of the parameters described above in relation to expression of the sense RNA (regulatory sequences, constitutive or inducible expression, tissue-specific expression).
[0447] The invention also relates to recombinant host cells containing the vectors described herein. Host cells therefore include, for example, prokaryotic cells, lower eukaryotic cells such as yeast, other eukaryotic cells such as insect cells, and higher eukaryotic cells such as mammalian cells.
[0448] The recombinant host cells can be prepared by introducing the vector constructs described herein into the cells by techniques readily available to persons of ordinary skill in the art. These include, but are not limited to, calcium phosphate transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, lipofection, and other techniques such as those described in Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
[0449] Host cells can contain more than one vector. Thus, different SNP-containing nucleotide sequences can be introduced in different vectors into the same cell. Similarly, the SNP-containing nucleic acid molecules can be introduced either alone or with other nucleic acid molecules that are not related to the SNP-containing nucleic acid molecules, such as those providing trans-acting factors for expression vectors. When more than one vector is introduced into a cell, the vectors can be introduced independently, co-introduced, or joined to the nucleic acid molecule vector.
[0450] In the case of bacteriophage and viral vectors, these can be introduced into cells as packaged or encapsulated virus by standard procedures for infection and transduction. Viral vectors can be replication-competent or replication-defective. In the case in which viral replication is defective, replication can occur in host cells that provide functions that complement the defects.
[0451] Vectors generally include selectable markers that enable the selection of the subpopulation of cells that contain the recombinant vector constructs. The marker can be inserted in the same vector that contains the SNP-containing nucleic acid molecules described herein or may be in a separate vector. Markers include, for example, tetracycline or ampicillin-resistance genes for prokaryotic host cells, and dihydrofolate reductase or neomycin resistance genes for eukaryotic host cells. However, any marker that provides selection for a phenotypic trait can be effective.
[0452] While the mature variant proteins can be produced in bacteria, yeast, mammalian cells, and other cells under the control of the appropriate regulatory sequences, cell-free transcription and translation systems can also be used to produce these variant proteins using RNA derived from the DNA constructs described herein.
[0453] Where secretion of the variant protein is desired, which is difficult to achieve with multi-transmembrane domain containing proteins such as G-protein-coupled receptors (GPCRs), appropriate secretion signals can be incorporated into the vector. The signal sequence can be endogenous to the peptides or heterologous to these peptides.
[0454] Where the variant protein is not secreted into the medium, the protein can be isolated from the host cell by standard disruption procedures, including freeze/thaw, sonication, mechanical disruption, use of lysing agents, and the like. The variant protein can then be recovered and purified by well-known purification methods including, for example, ammonium sulfate precipitation, acid extraction, anion or cationic exchange chromatography, phosphocellulose chromatography, hydrophobic-interaction chromatography, affinity chromatography, hydroxylapatite chromatography, lectin chromatography, or high performance liquid chromatography.
[0455] It is also understood that, depending upon the host cell in which recombinant production of the variant proteins described herein occurs, they can have various glycosylation patterns, or may be non-glycosylated, as when produced in bacteria. In addition, the variant proteins may include an initial modified methionine in some cases as a result of a host-mediated process.
[0456] For further information regarding vectors and host cells, see Current Protocols in Molecular Biology, John Wiley & Sons, N.Y.
[0457] Uses of Vectors and Host Cells, and Transgenic Animals
[0458] Recombinant host cells that express the variant proteins described herein have a variety of uses. For example, the cells are useful for producing a variant protein that can be further purified into a preparation of desired amounts of the variant protein or fragments thereof. Thus, host cells containing expression vectors are useful for variant protein production.
[0459] Host cells are also useful for conducting cell-based assays involving the variant protein or variant protein fragments, such as those described above as well as other formats known in the art. Thus, a recombinant host cell expressing a variant protein is useful for assaying compounds that stimulate or inhibit variant protein function. Such an ability of a compound to modulate variant protein function may not be apparent from assays of the compound on the native/wild-type protein, or from cell-free assays of the compound. Recombinant host cells are also useful for assaying functional alterations in the variant proteins as compared with a known function.
[0460] Genetically-engineered host cells can be further used to produce non-human transgenic animals. A transgenic animal is preferably a non-human mammal, for example, a rodent, such as a rat or mouse, in which one or more of the cells of the animal include a transgene. A transgene is exogenous DNA containing a SNP of the present invention which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal in one or more of its cell types or tissues. Such animals are useful for studying the function of a variant protein in vivo, and identifying and evaluating modulators of variant protein activity. Other examples of transgenic animals include, but are not limited to, non-human primates, sheep, dogs, cows, goats, chickens, and amphibians. Transgenic non-human mammals such as cows and goats can be used to produce variant proteins which can be secreted in the animal's milk and then recovered.
[0461] A transgenic animal can be produced by introducing a SNP-containing nucleic acid molecule into the male pronuclei of a fertilized oocyte, e.g., by microinjection or retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Any nucleic acid molecules that contain one or more SNPs of the present invention can potentially be introduced as a transgene into the genome of a non-human animal.
[0462] Any of the regulatory or other sequences useful in expression vectors can form part of the transgenic sequence. This includes intronic sequences and polyadenylation signals, if not already included. A tissue-specific regulatory sequence(s) can be operably linked to the transgene to direct expression of the variant protein in particular cells or tissues.
[0463] Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described in, for example, U.S. Pat. Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al., and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the transgene in its genome and/or expression of transgenic mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene can further be bred to other transgenic animals carrying other transgenes. A transgenic animal also includes a non-human animal in which the entire animal or tissues in the animal have been produced using the homologously recombinant host cells described herein.
[0464] In another embodiment, transgenic non-human animals can be produced which contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system of bacteriophage P1 (Lakso et al. PNAS 89:6232-6236 (1992)). Another example of a recombinase system is the FLP recombinase system of S. cerevisiae (O'Gorman et al. Science 251:1351-1355 (1991)). If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are generally needed. Such animals can be provided through the construction of “double” transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected variant protein and the other containing a transgene encoding a recombinase.
[0465] Clones of the non-human transgenic animals described herein can also be produced according to the methods described in, for example, Wilmut, I. et al. Nature 385:810-813 (1997) and PCT International Publication Nos. WO 97/07668 and WO 97/07669. In brief, a cell (e.g., a somatic cell) from the transgenic animal can be isolated and induced to exit the growth cycle and enter G.sub.o phase. The quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated. The reconstructed oocyte is then cultured such that it develops to morula or blastocyst and then transferred to pseudopregnant female foster animal. The offspring born of this female foster animal will be a clone of the animal from which the cell (e.g., a somatic cell) is isolated.
[0466] Transgenic animals containing recombinant cells that express the variant proteins described herein are useful for conducting the assays described herein in an in vivo context. Accordingly, the various physiological factors that are present in vivo and that could influence ligand or substrate binding, variant protein activation, signal transduction, or other processes or interactions, may not be evident from in vitro cell-free or cell-based assays. Thus, non-human transgenic animals of the present invention may be used to assay in vivo variant protein function as well as the activities of a therapeutic agent or compound that modulates variant protein function/activity or expression. Such animals are also suitable for assessing the effects of null mutations (i.e., mutations that substantially or completely eliminate one or more variant protein functions).
[0467] For further information regarding transgenic animals, see Houdebine, “Antibody manufacture in transgenic animals and comparisons with other systems”, Curr Opin Biotechnol. 2002 December; 13(6):625-9; Petters et al., “Transgenic animals as models for human disease”, Transgenic Res. 2000; 9(4-5):347-51; discussion 345-6; Wolf et al., “Use of transgenic animals in understanding molecular mechanisms of toxicity”, J Pharm Pharmacol. 1998 June; 50(6):567-74; Echelard, “Recombinant protein production in transgenic animals”, Curr Opin Biotechnol. 1996 October; 7(5):536-40; Houdebine, “Transgenic animal bioreactors”, Transgenic Res. 2000; 9(4-5):305-20; Pirity et al., “Embryonic stem cells, creating transgenic animals”, Methods Cell Biol. 1998; 57:279-93; and Robl et al., “Artificial chromosome vectors and expression of complex proteins in transgenic animals”, Theriogenology. 2003 Jan. 1; 59 (1):107-13.
EXAMPLES
[0468] The following examples are offered to illustrate, but not to limit the claimed invention.
Example One
SNPs Associated with Stroke in the Atherosclerosis Risk in Communities (ARIC) Study
[0469] Overview
[0470] 51 SNPs associated with coronary heart disease (CHD) in multiple antecedent studies (Bare et al. 2007) were analyzed to determine whether these SNPs are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. To carry out this analysis, 495 validated ischemic strokes were identified from the multi-ethnic ARIC cohort of 14,215 individuals by following the cohort for an average of 13.5 years for potential cerebrovascular events. Risk alleles for 51 SNPs were specified based on the results from at least two antecedent studies in which these SNPs were associated with CHD. As a result of this analysis, Cox proportional hazards models, adjusted for age and gender, identified three SNPs in whites/Caucasians (these terms are used herein interchangeably) and two SNPs in blacks/African Americans (these terms are used herein interchangeably) that were associated (p≤0.05) with incident stroke and had the same risk allele as specified by the antecedent studies. The rs11628722 polymorphism in SERPINA9 was associated with incident ischemic stroke in both whites and blacks. Thus, genetic variation in SERPINA9 was associated with incident stroke in both whites and blacks, even after taking into account traditional risk factors.
[0471] Subjects and Methods
[0472] The Atherosclerosis Risk in Communities (ARIC) Study
[0473] Study participants were selected from the ARIC Study, a prospective investigation of atherosclerosis and its clinical sequelae involving 15,792 individuals aged 45-64 years at recruitment (1986-1989). Subjects were selected by probability sampling from four communities: Forsyth County, NC; Jackson, Miss. (blacks only); Northwestern suburbs of Minneapolis, Minn.; and Washington County, MD. The initial clinical exams included a home interview to ascertain cardiovascular risk factors, socioeconomic factors and family medical history, clinical examination and blood drawing for laboratory determinations. A detailed description of the ARIC study design and methods has been published elsewhere (ARIC Investigators (1989) “The Atherosclerosis Risk in Communities (ARIC) Study: design and objectives”. American Journal of Epidemiology 129: 687-702).
[0474] Incident Ischemic Stroke
[0475] Ischemic stroke was determined by contacting participants annually to identify hospitalizations during the previous year, and by surveying discharge lists from local hospitals and death certificates from state vital statistics offices for potential cerebrovascular events (ARIC Investigators (1989) American Journal of Epidemiology 129: 687-702; Rosamond et al. (1999) Stroke 30: 736-743). Hospital records were obtained, abstracted and classified by computer algorithm and physician review. Details on quality assurance for ascertainment and classification of ischemic stroke events have been published elsewhere (Rosamond et al. (1999) Stroke 30: 736-743). Ischemic stroke events were defined as validated definite or probable hospitalized embolic or thrombotic brain infarctions. Participants were excluded from this analysis if they had a positive or unknown history of prevalent stroke; transient ischemic attack/stroke symptoms or CHD at the initial visit; ethnic background other than white or black; an ethnic background of black but were not from Jackson, MS; restrictions on use of their DNA; or missing data for any of the traditional cardiovascular or cerebrovascular risk factors. The remaining 14,215 participants were followed for incident ischemic stroke for a mean of 13.5 years and 495 incident ischemic stroke cases were identified.
[0476] Examination and Laboratory Measures
[0477] Cardiovascular risk factors considered in this study were measured at baseline and included age, gender, waist-to-hip ratio, diabetes, hypertension, and smoking status. The ratio of waist (umbilical level) and hip (maximum buttocks) circumference was calculated as a measure of fat distribution. Diabetes was defined by a fasting glucose level≥126 mg/dl, a nonfasting glucose level≥200 mg/dl, or a self-reported physician diagnosis of diabetes or use of diabetes medication. Seated blood pressure was measured three times with a random-zero sphygmomanometer and the last two measurements were averaged. An interviewer-administered questionnaire was used to assess use of antihypertensive medications. Hypertension was defined as systolic blood pressure≥140 mmHg or diastolic blood pressure≥90 mmHg or current use of antihypertensive medication. Cigarette smoking status was classified as current or not current. The study protocol was approved by the Institutional Review Boards of the collaborating institutions, and informed written consent was obtained from each participant.
[0478] SNP Selection and Genotype Determination
[0479] Fifty-one functional SNPs associated with CHD in multiple antecedent studies, other than the ARIC study, were considered in this study. A detailed description of the antecedent studies is presented elsewhere (Bare et al., Genetics in Medicine. 2007 October; 9(10):682-9). Briefly, risk alleles for 49 SNPs were specified based on significant association with myocardial infarction in at least two antecedent case-control studies. These studies involved myocardial infarction cases and controls recruited by either the Cleveland Clinic Foundation Heart Center, Cleveland, Ohio (CCF) or the Genomic Resource in Arteriosclerosis at the University of California, San Francisco (UCSF). All cases in these two studies had a history of myocardial infarction and the controls did not, and all subjects were self-described, non-Hispanic Caucasians. The risk alleles for two additional SNPs were specified based on an association with CHD in the placebo arms of two CHD prevention trials: the Cholesterol and Recurrent Events (CARE) study (Sacks et al. (1996) New England Journal of Medicine 335: 1001-1009) and the West of Scotland Coronary Prevention Study (WOSCOPS) (Packard et al. (2000) New England Journal of Medicine 343: 1148-1155). One of these SNPs (rs20455 in KIF6) was significantly associated with CHD after correction for multiple testing (Iakoubova et al., Journal of the American College of Cardiology. 2008; 51:435-43). The second SNP associated with CHD in CARE and WOSCOPS was rs11666735 in FCAR (Iakoubova et al. (2006) Arteriosclerosis, Thrombosis and Vascular Biology 26: 2763-2768).
[0480] Genotyping of the 51 SNPs in the ARIC study was carried out using PCR-based amplification of genomic DNA followed by an allele-specific oligonucleotide ligation assay similar to a previously described procedure (Iannone et al. (2000) Cytometry 39: 131-140).
[0481] Statistical Analyses
[0482] Agreement of genotype frequencies with Hardy-Weinberg equilibrium expectations was tested separately in whites and blacks using a χ.sup.2 goodness-of-fit test in non-cases, stratified by ethnicity. Deviation from Hardy-Weinberg equilibrium was determined by a p-value less than 0.05. Cox proportional hazards models were used to model time to incident ischemic stroke. The follow-up time interval was defined as the time between the initial clinical visit and the end of follow-up, which for cases was the date of the first ischemic stroke event and for non-cases was Dec. 31, 2002, the date of death, or the date of last contact if lost to follow-up. Each model was evaluated separately in whites and blacks and included a given SNP (modeled as the additive effect of the pre-specified risk allele), age and gender. Additional risk factors evaluated as potential confounders in the Cox proportional hazards models included waist-to-hip ratio, diabetes, hypertension, and smoking status (Folsom et al., (1999) Diabetes Care 22: 1077-1083). SNPs and risk factors were assessed for statistical significance in the models by the Wald statistic. A two-sided p-value of 0.05 was used to assess statistical significance with ischemic stroke and no attempt was made to adjust for multiple comparisons within this study.
[0483] Results
[0484] Race-specific proportions, means and standard deviations for the traditional risk factors are presented in Table 5. Mean values and proportions differed significantly (p≤0.03) between incident ischemic stroke cases and non-cases for all risk factors.
[0485] Three SNPs in whites (in SERPINA9, PALLD and IER2) and two SNPs in blacks (in SERPINA9 and EXOD1) were associated (p≤0.05) with ischemic stroke, after adjusting for age and gender, and had the same risk allele as specified by the antecedent studies (Table 6, Model 1). One additional SNP in EIF2AK2 was associated with ischemic stroke in whites, but the risk allele in the ARIC study differed from the risk allele identified in the antecedent CHD studies. The rs11628722 polymorphism in SERPINA9 was associated with incident ischemic stroke in both ethnicities (whites HRR=1.31, 95% CI: 1.00-1.70; blacks HRR=1.26, 95% CI: 1.03-1.53).
[0486] For the four SNPs that were associated in either ethnic group, traditional cardiovascular risk factors were included in the Cox proportional hazards models to evaluate possible confounding. The observed hazards ratios were essentially unchanged with addition of these risk factors to the prediction models (Table 6, Model 2).
[0487] Discussion
[0488] This study investigated whether 51 putative functional SNPs associated with CHD in multiple antecedent studies predict ischemic stroke among white and black individuals from the large prospective ARIC study. Three SNPs in whites and two SNPs in blacks were associated with incident ischemic stroke, even after taking into account established risk factors. The rs11628722 polymorphism in SERPINA9 was associated with ischemic stroke in both whites and blacks from the ARIC study.
[0489] It is noteworthy that the association between SERPINA9 and stroke was observed in both whites and blacks in this study. This SNP has been associated with myocardial infarction in two case-control studies and this study shows an association with stroke in both whites and blacks from the ARIC study. SERPINA9 is a member of Glade A of the large superfamily of serine peptidase inhibitors known as serpins. Serpins are protease inhibitors that use a conformational change to inhibit target enzymes, and are involved in many cellular processes, such as coagulation, fibrinolysis, complement fixation, matrix remodeling and apoptosis (Law et al. (2006) Genome Biology 7: 216). A recent study indicated that SERPINA9 was significantly upregulated in the hippocampal tissues from Alzheimer's disease transgenic mice versus age-matched controls (Jee et al (2006) Neurochemistry Research 31: 1035-1044). This study suggests that SERPINA9 may also be expressed in the human brain, consistent with the findings described herein of an association between polymorphic variation in this gene and ischemic stroke.
[0490] In addition to SERPINA9, polymorphisms in palladin (PALLD) and immediate early response 2 (IER2) were associated with ischemic stroke in whites and a polymorphism in exonuclease domain containing 1 (EXOD1) was associated in blacks. PALLD encodes a component of the cytoskeleton that controls cell shape and motility. Vascular remodeling may lead to atherosclerosis, and the shape and cytoskeletal organization of endothelial cells is an important part of this process. Mechanical stress and strain also plays a role in atherosclerotic vascular remodeling and immediate early response genes have been shown to mediate the mechanical stress-induced pathological process in the blood vessel (Liu et al. (1999) Critical Reviews in Biomedical Engineering 27: 75-148). Although little is known about EXOD1, exonucleases have been shown to play a role in both myocardial infarction and stroke. Given their functional roles, PALLD, IER2 and EXOD1 potentially play a role in the atherosclerotic pathway. Additionally, PALLD, IER2 and EXOD1 are all expressed in the heart and brain.
[0491] A strength of this study is the prospective cohort design. The large sample size allows for the assessment of exposures (e.g. genetic factors) of modest effect. All analyses for this study were performed separately in whites and blacks.
[0492] Thus, a small subset of gene variants previously associated with CHD in antecedent studies were found to also be associated with incident ischemic stroke in ARIC. In particular, SERPINA9 was associated with stroke in both whites and blacks and this association does not appear to be mediated by traditional risk factors.
[0493] Supplemental Analysis of SNPs in the ARIC Study
[0494] In a further analysis of the 51 SNPs in the ARIC participants, SNPs that predict ischemic stroke risk were identified by Cox proportional hazard analysis and included SNPs with a two-sided p-value of <0.2 after adjusting for age and sex and a hazard ratio (HRR)>1.0. These SNPs are shown in Tables 7-9 (the p-values shown in Tables 7-9 are two-sided p-values; thus, the one-sided p-values for these SNPs are half of these two-sided p-values). SNPs that predict ischemic stroke after adjusting for age and sex (two-sided p-value<0.2 and HRR>1.0) in the white ARIC participants and separately in the black ARIC participants are shown in Table 7 (whites) and Table 8 (blacks). SNPs that predict ischemic stroke after adjusting for age and sex in both the black and the white ARIC populations with the same risk alleles are listed in Table 9.
Example Two
SNPs Associated with Stroke in the Cardiovascular Health Study (CHS)
[0495] Overview
[0496] 74 SNPs, which had been associated with coronary heart disease (CHD) (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9, incorporated herein by reference in its entirety), were analyzed to determine whether these SNPs are associated with incident ischemic stroke. To carry out this analysis, the risk allele was prespecified for each of the 74 SNPs based on antecedent studies of CHD. Cox proportional hazards models were used that adjusted for traditional risk factors to estimate the associations of these SNPs with incident ischemic stroke during 14 years of follow-up in a population-based study of older adults referred to as the Cardiovascular Health Study (CHS). As a result of this analysis, the prespecified risk alleles of 7 of the 74 SNPs (in HPS1, ITGAE, ABCG2, MYH15, FSTL4, CALM1, and BAT2) were associated with increased risk of stroke in white CHS participants (1-sided P<0.05, false discovery rate (FDR)=0.42). In African American participants, the prespecified risk alleles of 5 SNPs (in KRT4, LY6G5B, EDG1, DMXL2, and ABCG2) were associated with stroke (1-sided P<0.05, FDR=0.55). The Val12Met SNP in ABCG2 was associated with stroke in both white (hazard ratio 1.46, 90% CI 1.05 to 2.03) and African American (hazard ratio 3.59, 90% CI 1.11 to 11.6) participants of CHS. Kaplan-Meier estimates of the 10 year cumulative incidence of stroke were greater among Val allele homozygotes than among Met allele carriers in both white (10% versus 6%) and African American (12% versus 3%) participants of CHS. Thus, the Val12Met SNP in ABCG2 (encoding a transporter of sterols and xenobiotics) was associated with incident ischemic stroke in white and African American participants of CHS.
[0497] Materials and Methods
[0498] Cardiovascular Health Study
[0499] CHS is a prospective population-based study of risk factors for cardiovascular disease, including CHD and stroke, in older adults. Men and women aged 65 years and older were recruited from random samples of individuals on Medicare eligibility lists in four U.S. communities (Sacramento County, California; Washington County, Maryland; Forsyth County, North Carolina; and Pittsburgh, Allegheny County, Pennsylvania) and from age-eligible members of the same households. Potential participants were excluded if they were institutionalized, not ambulatory at home, under hospice care, receiving radiation or chemotherapy for cancer, not expected to remain in the area for at least three years, or unable to be interviewed. CHS enrolled 5201 participants in 1989-90. An additional 687 African American participants entered the cohort in 1992-93. Participants who did not donate DNA or who did not consent to the use of their DNA for studies by private companies (n=514) as well as participants for whom the amount of DNA samples were insufficient (n=130) were excluded, leaving 5244 participants available for a genetic study. The institutional review board at each site approved the study methods, and all participants gave written informed consent. Details of CHS design.sup.7 and recruitment.sup.8 have been reported.
[0500] Participants completed a baseline clinic examination that included a medical history interview, physical examination, and blood draw..sup.9 Baseline self-reported myocardial infarction (MI) or stroke was confirmed by information from the clinic examination or by review of medical records or physician questionnaires..sup.10 Cardiovascular events during follow-up were identified at semi-annual contacts, which alternated between clinic visits and telephone calls. Suspected events were adjudicated according to standard criteria by a physician review panel using information from medical records, brain imaging studies.sup.11 and, in some cases, interviews with the physician, participant, or a proxy informant..sup.12 Medicare utilization files were searched to ascertain events that may have been missed..sup.13
[0501] At baseline, 722 of the 5244 participants available for a genetic study had a history of stroke or MI. Since the risk of incident ischemic stroke might be influenced by whether a patient had had a prior stroke or MI, these 722 participants were excluded from the analysis, leaving 4522 (3849 white and 673 African American) participants in this genetic study of first incident ischemic stroke. Baseline characteristics of these 4522 participants are presented in Table 10. During follow-up, 642 participants had an incident non-procedure-related stroke, and 47 of these 642 had an MI before their stroke, leaving 595 stroke events. Of these 595 stroke events, 72 (12%) were hemorrhagic, 46 (8%) were not classified for type, and the remaining 477 stroke events were classified as ischemic stroke events: the end point for this analysis.
[0502] Covariates
[0503] Risk estimates for ischemic stroke were adjusted for the following traditional risk factors: diabetes mellitus (defined by fasting serum glucose levels of at least 126 mg/dL or the use of either insulin or oral hypoglycemic medications), impaired fasting glucose (defined as fasting glucose levels between 110 and 125 mg/dL.sup.14), hypertension (defined by systolic blood pressure of at least 140 mmHg, diastolic blood pressure of at least 90 mmHg, or a physician's diagnosis of hypertension plus the use of anti-hypertensive medications.sup.10), current smoking, LDL-cholesterol, HDL-cholesterol, and body mass index (BMI). Other covariates included atrial fibrillation, carotid intima-media thickness (IMT), and genotypes. Atrial fibrillation was identified on the basis of 12-lead resting ECGs performed at the baseline examination. Tracings were read for atrial fibrillation or flutter at the CHS Electrocardiography Reading Center..sup.15 Ultrasonography of the common and internal carotid arteries was also performed at baseline. The IMT was defined as the mean of the maximum IMTs of the near and far walls of the left and right carotid arteries..sup.16 Genotypes of the CHS participants were determined by a multiplex method that combines PCR, allele-specific oligonucleotide ligation assays, and hybridization to oligonucleotides coupled to Luminex®100™ xMAP microspheres (Luminex, Austin, Tex.), followed by detection of the spectrally distinct microsphere on a Luminex 100 instrument (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9).
[0504] Prespecification of Risk Alleles for 74 SNPs Investigated in CHS
[0505] For each of the 74 SNPs that were genotyped in CHS, a risk allele was prespecified based on antecedent data (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9). For 14 of the 74 SNPs, genetic associations with CHD have been previously published..sup.17-21 The remaining 60 SNPs were associated with MI in one or more antecedent studies of MI as described (Shiffman et al., Arterioscler Thromb Vase Biol. 2008 January; 28(1):173-9).
[0506] Statistics
[0507] Since the risk estimate for gene variants can differ between whites and African Americans, the association of SNPs with incident ischemic stroke in CHS was investigated in each race separately. Analyses of time to primary end point were conducted. Follow-up began at CHS enrollment and ended on the date of incident stroke of any type, incident MI, death, loss to follow-up, or Jun. 30, 2004, whichever occurred first. The median follow-up time was 11.2 years (11.9 years for the 1989-90 cohort and 10.7 years for the African American cohort).
[0508] Cox regression models were used to estimate hazard ratios of each SNP. In Model 1, Cox models were adjusted for baseline age (continuous) and sex. In Model 2, Cox models were adjusted for baseline age (continuous), sex, body mass index (continuous), current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol (continuous), and HDL-cholesterol (continuous). Risk estimates were also further adjusted for two additional risk factors of ischemic stroke: atrial fibrillation and carotid IMT. The SNP variable in the Cox models was coded as 0 for the non-risk homozygote, 1 for those who carried 1 copy of the risk allele and 2 for those who carried 2 copies of the risk allele. Thus, the hazard ratios represent the log-additive increase in risk for each additional copy of the risk allele a subject carried, compared with the non-risk homozygotes. Because the hypotheses that the allele associated with increased risk of CHD would also be associated with increased risk of ischemic stroke was being testing, a 1-sided P-value was used to test the significance of the Cox model coefficients. Correspondingly, 90% confidence intervals were estimated for the hazard ratios (for hazard ratios greater than one, there is 95% confidence that a true risk estimate is greater than the lower bound of a 90% confidence interval). In white participants, this study had 80% or more power to detect associations between SNPs and incident ischemic stroke for SNPs that have relative risks of 1.3 and 1.5 (in an additive model) and risk allele frequencies of 0.13 and 0.05, respectively, assuming an alpha level of 0.05 and a 1-sided test. In African American participants, this study had 80% or more power to detect associations between SNPs and incident ischemic stroke for SNPs that have relative risks of 1.6 and 1.8 (in an additive model) and risk allele frequencies of 0.3 and 0.14, respectively. The cumulative incidence of stroke was estimated by the method of Kaplan and Meier. Data were analyzed using Stata Statistical Software..sup.22 The influence of multiple testing was evaluated using the false discovery rate (FDR).sup.23 to estimate the expected fraction of false positives in a group of SNPs with P values below a given threshold. FDR calculations were performed with R Statistical Software..sup.24
[0509] Results
[0510] The baseline characteristics of the 3,849 white and 673 African American participants of CHS in this genetic study of ischemic stroke are presented in Table 10. There were 407 first incident ischemic stroke events in the white participants and 70 in the African American participants during follow-up (median of 11.2 years). The association between incident ischemic stroke and 74 SNPs that had previously been found to be associated with coronary heart disease (CHD) in one or more antecedent studies (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9) was investigated. Specifically, for each SNP, it was determined whether the allele that had been associated with increased risk of CHD (the risk allele) was also associated with increased risk of stroke.
[0511] In white participants of CHS, it was found that the risk alleles of 7 of these 74 SNPs were associated (P<0.05) with increased risk of stroke after adjusting for traditional risk factors (age, sex, body mass index, smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol). These 7 SNPs were in HPS1, ITGAE, ABCG2, MYH15, FSTL4, CALM1, and BAT2. The additive (per allele) hazard ratios for stroke ranged from 1.15 to 1.49 (Table 11). In African American participants of CHS, it was found that the risk alleles of 5 SNPs (in KRT4, LY6G5B, EDG1, DMXL2, and ABCG2) were associated (P<0.05) with increased risk of stroke after adjusting for traditional risk factors. The hazard ratios for these 5 SNPs ranged from 1.40 to 3.59 (Table 12). The risk estimates for the 11 SNPs that were associated with stroke in either whites or African Americans (Tables 11 and 12) were essentially unchanged when further adjusted for atrial fibrillation and internal carotid artery IMT (data not shown).
[0512] To account for multiple comparisons, the FDR.sup.23 was estimated for the set of SNPs found to be associated with incident ischemic stroke in CHS participants. These FDRs were 0.42 for the 7 SNPs in white participants and 0.55 for the 5 SNPs in African American participants of CHS.
[0513] ABCG2 Val12Met (rs2231137) was associated with incident ischemic stroke in both white and African American participants of CHS. The risk of ischemic stroke was higher in Val allele homozygotes than in Met allele carriers. The adjusted hazard ratio for Val allele homozygotes, compared with Met allele carriers, was 1.50 (90% CI 1.06 to 2.12) in white participants and 3.62 (90% CI 1.11 to 11.9) in African American participants (Table 13). The 10-year cumulative incidence of ischemic stroke was greater in Val allele homozygotes than in Met allele carriers in both the white (10% versus 6%) and African American (12% versus 3%,
[0514] Discussion
[0515] Among 74 genetic variants tested in CHS, it was found that 7 were associated with incident ischemic stroke in white participants and 5 were associated with incident ischemic stroke in African American participants. In particular, an association between the Val allele of ABCG2 Val12Met and increased risk of incident ischemic stroke was identified, and this association was consistent in both whites and African Americans.
[0516] Three of the 11 gene variants associated with incident ischemic stroke in CHS had particularly notable associations with CHD in the antecedent studies. The first of these 3 gene variants was the Val allele of ABCG2 Val12Met (rs2231137). This gene variant had previously been found to be associated with angiographically defined severe coronary artery disease (CAD) in two case-control studies..sup.20
[0517] ABCG2 encodes ATP-binding cassette, subfamily G, member 2, which is a protein that belongs to a large family of transporters. It is expressed on the cell surface of stem cells in bone marrow and skeletal muscle,.sup.25 progenitor endothelial cells that are capable of vasculogenesis in adipose tissue,.sup.26 and endothelial cells in blood vessels of the heart.sup.27 and brain.sup.28. The ABCG2 protein has been reported recently to transport sterols..sup.29, 30 It is interesting to note that the related ATP-binding cassette proteins ABCA1,.sup.31 ABCG5, and ABCG8.sup.32 are transporters of lipids: variants of these transporters have been shown to cause lipid disorders such as Tangier disease.sup.31 and sitosterolemia..sup.32 However, a well known function of the ABCG2 protein is to act as a multi-drug transporter of anticancer drugs, and the ABCG2 protein is over-expressed in drug-resistant cancer cells..sup.33 The Met variant of ABCG2 has been reported to confer lower drug resistance and has an altered pattern of localization when compared with the Val variant..sup.34 It is possible that the Met variant of the ABCG2 protein may function in the vascular endothelium and have an altered function as a transporter. Homozygotes of the Val allele of ABCG2 (88% of whites and 88% of African Americans) were at higher risk of stroke than carriers of the Met allele in CHS. Since there were only 16 homozygotes of the Met allele, the Met homozygotes were pooled with heterozygotes and used as the reference group. The Met allele could also be considered to be a protective allele in that the Met allele carriers had a lower risk of incident ischemic stroke than the Val allele homozygotes.
[0518] The second of the 3 gene variants with notable findings in antecedent studies is the Ala allele of MYH15 Thr1125Ala (rs3900940). In addition to being associated with MI in two antecedent association studies,.sup.6 it was associated with increased risk of incident CHD in the white participants of the Atherosclerosis Risk in Communities Study..sup.21 MYH15 encodes myosin heavy polypeptide 15 and the Thr1125Ala SNP is located in the tail domain of the MYH15 protein..sup.35
[0519] The third gene variant with notable findings in antecedent studies is the G allele of rs3814843 in the 3′untranslated region in CALM1. This SNP was associated with angiographically defined severe CAD in two case-control studies..sup.20 CALM1 encodes calmodulin 1 which binds calcium and functions in diverse signaling pathways, including those involved in cell division,.sup.36 membrane trafficking,.sup.37 and platelet aggregation..sup.38
[0520] Thus, a small subset of gene variants previously associated with CHD in antecedent studies were found to also be associated with incident ischemic stroke in CHS. Notably, the Val allele of the Val12Met SNP in ABCG2 (which encodes a transporter of sterols and anticancer drugs) was associated with increased risk of incident ischemic stroke in both white and African American participants of CHS.
REFERENCES (CORRESPONDING TO EXAMPLE TWO)
[0521] 1. Brass L M, Isaacsohn J L, Merikangas K R, Robinette C D. A study of twins and stroke. Stroke. 1992; 23:221-223 [0522] 2. Bak S, Gaist D, Sindrup S H, Skytthe A, Christensen K. Genetic liability in stroke: a long-term follow-up study of Danish twins. Stroke. 2002; 33:769-774 [0523] 3. Welin L, Svardsudd K, Wilhelmsen L, Larsson B, Tibblin G. Analysis of risk factors for stroke in a cohort of men born in 1913. N Engl J Med. 1987; 317:521-526 [0524] 4. Jousilahti P, Rastenyte D, Tuomilehto J, Sarti C, Vartiainen E. Parental history of cardiovascular disease and risk of stroke. A prospective follow-up of 14371 middle-aged men and women in Finland. Stroke. 1997; 28:1361-1366 [0525] 5. Rosamond W, Flegal K, Friday G, Furie K, Go A, Greenlund K, Haase N, Ho M, Howard V, Kissela B, Kittner S, Lloyd-Jones D, McDermott M, Meigs J, Moy C, Nichol G, O'Donnell C J, Roger V, Rumsfeld J, Sorlie P, Steinberger J, Thom T, Wasserthiel-Smoller S, Hong Y. Heart disease and stroke statistics—2007 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation. 2007; 115:e69-171 [0526] 6. Shiffman D, O'Meara E S, Bare L A, Rowland C M, Louie J Z, Arellano A R, Lumley T, Rice K, Iakoubova O, Luke M M, Young B A, Malloy M J, Kane J P, Ellis S G, Tracy R P, Devlin J J, Psaty B M. Association of gene variants with incident myocardial infarction in the Cardiovascular Health Study. Arterioscler Thromb Vasc Biol. 2008; 28:173-179 [0527] 7. Fried L P, Borhani N O, Enright P, Furberg C D, Gardin J M, Kronmal R A, Kuller L H, Manolio T A, Mittelmark M B, Newman A, et al. The Cardiovascular Health Study: design and rationale. Ann Epidemiol. 1991; 1:263-276 [0528] 8. Tell G S, Fried L P, Hermanson B, Manolio T A, Newman A B, Borhani N O. Recruitment of adults 65 years and older as participants in the Cardiovascular Health Study. Ann Epidemiol. 1993; 3:358-366 [0529] 9. Cushman M, Cornell E S, Howard P R, Bovill E G, Tracy R P. Laboratory methods and quality assurance in the Cardiovascular Health Study. Clin Chem. 1995; 41:264-270 [0530] 10. Psaty B M, Kuller L H, Bild D, Burke G L, Kittner S J, Mittelmark M, Price T R, Rautaharju P M, Robbins J. Methods of assessing prevalent cardiovascular disease in the Cardiovascular Health Study. Ann Epidemiol. 1995; 5:270-277 [0531] 11. Longstreth W T, Jr., Bernick C, Fitzpatrick A, Cushman M, Knepper L, Lima J, Furberg C D. Frequency and predictors of stroke death in 5,888 participants in the Cardiovascular Health Study. Neurology. 2001; 56:368-375 [0532] 12. Price T R, Psaty B, O'Leary D, Burke G, Gardin J. Assessment of cerebrovascular disease in the Cardiovascular Health Study. Ann Epidemiol. 1993; 3:504-507 [0533] 13. Ives D G, Fitzpatrick A L, Bild D E, Psaty B M, Kuller L H, Crowley P M, Cruise R G, Theroux S. Surveillance and ascertainment of cardiovascular events. The Cardiovascular Health Study. Ann Epidemiol. 1995; 5:278-285 [0534] 14. American Diabetes Association. Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes Care. 1997; 20:1183-1197 [0535] 15. Rautaharju P M, MacInnis P J, Warren J W, Wolf H K, Rykers P M, Calhoun H P. Methodology of ECG interpretation in the Dalhousie program; NOVACODE ECG classification procedures for clinical trials and population health surveys. Methods Inf Med. 1990; 29:362-374 [0536] 16. O'Leary D H, Polak J F, Wolfson S K, Jr., Bond M G, Bommer W, Sheth S, Psaty B M, Sharrett A R, Manolio T A. Use of sonography to evaluate carotid atherosclerosis in the elderly. The Cardiovascular Health Study. CHS Collaborative Research Group. Stroke. 1991; 22:1155-1163 [0537] 17. Shiffman D, Ellis S G, Rowland C M, Malloy M J, Luke M M, Iakoubova O A, Pullinger C R, Cassano J, Aouizerat B E, Fenwick R G, Reitz R E, Catanese J J, Leong D U, Zellner C, Sninsky J J, Topol E J, Devlin J J, Kane J P. Identification of four gene variants associated with myocardial infarction. Am J Hum Genet. 2005; 77:596-605 [0538] 18. Shiffman D, Rowland C M, Louie J Z, Luke M M, Bare L A, Bolonick J I, Young B A, Catanese J J, Stiggins C F, Pullinger C R, Topol E J, Malloy M J, Kane J P, Ellis S G, Devlin J J. Gene variants of VAMP8 and HNRPUL1 are associated with early-onset myocardial infarction. Arterioscler Thromb Vasc Biol. 2006; 26:1613-1618 [0539] 19. Iakoubova O A, Tong C H, Chokkalingam A P, Rowland C M, Kirchgessner T G, Louie J Z, Ploughman L M, Sabatine M S, Campos H, Catanese J J, Leong D U, Young B A, Lew D, Tsuchihashi Z, Luke M M, Packard C J, Zerba K E, Shaw P M, Shepherd J, Devlin J J, Sacks F M. Asp92Asn polymorphism in the myeloid IgA Fc receptor is associated with myocardial infarction in two disparate populations: CARE and WOSCOPS. Arterioscler Thromb Vasc Biol. 2006; 26:2763-2768 [0540] 20. Luke M M, Kane J P, Liu D M, Rowland C M, Shiffman D, Cassano J, Catanese J J, Pullinger C R, Leong D U, Arellano A R, Tong C H, Movsesyan I, Naya-Vigne J, Noordhof C, Feric N T, Malloy M J, Topol E J, Koschinsky M L, Devlin J J, Ellis S G. A polymorphism in the protease-like domain of apolipoprotein(a) is associated with severe coronary artery disease. Arterioscler Thromb Vasc Biol. 2007; 27:2030-2036 [0541] 21. Bare L A, Morrison A C, Rowland C M, Shiffman D, Luke M M, Iakoubova O A, Kane J P, Malloy M J, Ellis S G, Pankow J S, Willerson J T, Devlin J J, Boerwinkle E. Five common gene variants identify elevated genetic risk for coronary heart disease. Genet Med. 2007; 9:682-689 [0542] 22. StataCorp. Stata Statistical Software: Release 9. 2005 [0543] 23. Benjamini Y, Hochberg Y. Controlling the false discovery rate: A new and powerful approach to multiple testing. Journal of the Royal Statistical Society. 1995; Serials B:1289-1300 [0544] 24. R Development Core Team. R: A language and environment for statistical computing, reference index version 2.3.0. 2005 [0545] 25. Zhou S, Schuetz J D, Bunting K D, Colapietro A M, Sampath J, Morris J J, Lagutina I, Grosveld G C, Osawa M, Nakauchi H, Sorrentino B P. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nat Med. 2001; 7:1028-1034 [0546] 26. Miranville A, Heeschen C, Sengenes C, Curat C A, Busse R, Bouloumie A. Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation. 2004; 110:349-355 [0547] 27. Meissner K, Heydrich B, Jedlitschky G, Meyer Zu Schwabedissen H, Mosyagin I, Dazert P, Eckel L, Vogelgesang S, Warzok R W, Bohm M, Lehmann C, Wendt M, Cascorbi I, Kroemer H K. The ATP-binding cassette transporter ABCG2 (BCRP), a marker for side population stem cells, is expressed in human heart. J Histochern Cytochem. 2006; 54:215-221 [0548] 28. Zhang W, Mojsilovic-Petrovic J, Andrade M F, Zhang H, Ball M, Stanimirovic D B. The expression and functional characterization of ABCG2 in brain endothelial cells and vessels. Faseb J. 2003; 17:2085-2087 [0549] 29. Janvilisri T, Venter H, Shahi S, Reuter G, Balakrishnan L, van Veen H W. Sterol transport by the human breast cancer resistance protein (ABCG2) expressed in Lactococcus lactis. J Biol Chem. 2003; 278:20645-20651 [0550] 30. Janvilisri T, Shahi S, Venter H, Balakrishnan L, van Veen H W. Arginine-482 is not essential for transport of antibiotics, primary bile acids and unconjugated sterols by the human breast cancer resistance protein (ABCG2). Biochem J. 2005; 385:419-426 [0551] 31. Oram J F. Tangier disease and ABCA1. Biochim Biophys Acta. 2000; 1529:321-330 [0552] 32. Schmitz G, Langmann T, Heimerl S. Role of ABCG1 and other ABCG family members in lipid metabolism. J Lipid Res. 2001; 42:1513-1520 [0553] 33. Maliepaard M, van Gastelen M A, de Jong L A, Pluim D, van Waardenburg R C, Ruevekamp-Helmers M C, Floot B G, Schellens J H. Overexpression of the BCRP/MXR/ABCP gene in a topotecan-selected ovarian tumor cell line. Cancer Res. 1999; 59:4559-4563 [0554] 34. Mizuarai S, Aozasa N, Kotani H. Single nucleotide polymorphisms result in impaired membrane localization and reduced atpase activity in multidrug transporter ABCG2. Int J Cancer. 2004; 109:238-246 [0555] 35. Desjardins P R, Burkman J M, Shrager J B, Allmond L A, Stedman H H. Evolutionary implications of three novel members of the human sarcomeric myosin heavy chain gene family. Mol Biol Evol. 2002; 19:375-393 [0556] 36. Moisoi N, Erent M, Whyte S, Martin S, Bayley P M. Calmodulin-containing substructures of the centrosomal matrix released by microtubule perturbation. J Cell Sci. 2002; 115:2367-2379 [0557] 37. Tyteca D, van Ijzendoorn S C, Hoekstra D. Calmodulin modulates hepatic membrane polarity by protein kinase C-sensitive steps in the basolateral endocytic pathway. Exp Cell Res. 2005; 310:293-302 [0558] 38. Oury C, Sticker E, Cornelissen H, De Vos R, Vermylen J, Hoylaerts M F. ATP augments von Willebrand factor-dependent shear-induced platelet aggregation through Ca2+-calmodulin and myosin light chain kinase activation. J Biol Chem. 2004; 279:26266-26273.
[0559] Supplemental Analysis of SNPs in the CHS Study
[0560] In a further analysis of 77 SNPs, which include the SNPs analyzed in the CHS study described herein in Example Two along with additional SNPs found to be associated with CHD risk in a Cholesterol and Recurrent Event (CARE) trial and a WOSCOPS trial (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-977), three additional SNPs that predict ischemic stroke risk were identified by Cox proportional hazard analysis that had one-sided p-values of <=0.05 in whites after adjusting for age and sex, and also after adjusting for all traditional risk factors including smoking, diabetes, hypertension, HDL-C, LDL-C, and BMI (similar to what was described in Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9). These three SNPs are shown in Table 14. Also, as shown in Table 14, the hazard ratios were consistent in blacks and whites for SNPs rs2243682/hCV1624173 and rs34868416/hCV25951678.
Example Three
SNPs Associated with Noncardioembolic Stroke in the Vienna Stroke Registry
[0561] Overview
[0562] For SNPs that had been associated with coronary heart disease (CHD) in previous studies such as Atherosclerosis Risk in Communities (ARIC) (e.g., Bare, et al. (2007), Genet Med 9(10):682-9 and McPherson, et al. (2007), Science 316(5830):1488-91), carriers of the CHD risk alleles for each SNP were analyzed for increased risk of noncardioembolic stroke in the Vienna Stroke Registry (VSR). In a case-control study, 562 noncardioembolic stroke cases from VSR.sup.7 and 815 healthy controls from the city of Vienna.sup.8 were genotyped for each of the SNPs. The allele previously associated with CHD risk was pre-specified as the risk allele, and this risk allele was tested for association with noncardioembolic stroke.
[0563] It was determined that carriers of the CHD risk allele of the following four SNPs had increased risk of noncardioembolic stroke (the name of the gene or chromosome that contains each SNP is indicated in parentheses): rs3900940 (MYH15), rs20455 (KIF6), rs1010 (VAMP8), and rs10757274 (chromosome 9p21) (characteristics of these SNPs are presented in Table 16). The odds ratios (OR) for the associations of these SNPs with noncardioembolic stroke were as follows: 1.20 (90% confidence interval 0.95-1.50) for rs10757274 on chromosome 9p21, 1.24 (1.01-1.5) for rs20455 in KIF6, 1.31 (1.07-1.60) for rs3900940 in MYH15, and 1.21 (0.99-1.49) for rs1010 in VAMP8.
[0564] Subjects and Methods
[0565] Study Population
[0566] The stroke cases in VSR are consecutive Caucasian patients admitted to stroke units in Vienna within 72 hours of onset of acute ischemic stroke between October 1998 and June 2001. All patients underwent cranial CT or MRI and were documented according to a standardized protocol including stroke severity, risk factors, and medical history. Only patients with noncardioembolic stroke were included as cases in this study. Controls were unrelated Caucasian participants in a health care program in Vienna, 45 years old or older, free of arterial vascular disease, and reported no arterial vascular diseases in first degree relatives.sup.8. Genotypes were determined as described previously.sup.9. This study complied with the Declaration of Helsinki and was approved by the Ethics Committee of Medical University Vienna. All subjects gave written informed consent.
[0567] Statistics
[0568] Differences in traditional risk factors between cases and controls were assessed by the Wilcoxon rank sum test (continuous variables) or by the chi-square test (discrete variables). Odds ratios estimated from logistic regression models were adjusted for traditional risk factors including age (at the index stroke event for cases, at enrollment for controls), sex, current smoker (versus not), diabetes mellitus (defined by a physician's diagnosis or the use of either insulin or oral hypoglycemic medications), hypertension (defined by systolic blood pressure>140 mmHg, diastolic blood pressure>90 mmHg, a physician's diagnosis of hypertension, or the use of anti-hypertensive medications), dyslipidemia (defined by a total cholesterol≥240 mg/dL (6.2 mmol/L), LDL-C≥160 mg/dL (4.1 mmol/L), HDL-C<40 mg/dL (1.0 mmol/L), or the use of lipid lowering medications), and body mass index (BMI). Since the purpose of this study was to determine if the same alleles found to be associated with increased risk of CHD in previous studies would be associated with increased risk of noncardioembolic stroke in VSR, one-sided p values and 90% confidence intervals (because there was 95% confidence that the true risk estimates were greater than the lower bounds of the 90% confidence intervals) were used. All other p values are two-sided. Effect sizes for carriers of the CHD risk alleles, compared with noncarriers, detectable with 90% power were calculated using QUANTO.sup.10 assuming a one-sided test and an alpha of 0.05. To account for multiple hypothesis testing, the false discovery rate q values were estimated by the method of Benjamini and Hochberg.sup.11 using the p values for CHD risk allele carrier status from the age and sex adjusted models. The q value of a given SNP represents the expected proportion of false positives among the set of SNPs with equal or lower q values.
[0569] Structure software was used to estimate both the number of subpopulations (due to ancestry) in this study and the degree of ancestry admixture for each individual subject.sup.12 based on genotypes of 130 SNPs whose minor allele frequencies ranged from 0.95% to 49.8%. The probable degree of admixture was included as a covariate in logistic regression models to adjust risk estimates for potential confounding due to population structure. Models that assumed one, two, three, or four subpopulations were tested, and replicate runs of the Structure program were performed for each model with a burn-in of 20,000 repetitions followed by 10,000 repetitions using the admixture model with independent allele frequencies and default values for other parameters.
[0570] Results
[0571] The clinical characteristics of the cases and controls are presented in Table 15. It was determined whether carriers of the alleles of SNPs that had previously been associated with increased risk of CHD.sup.2,3 were also associated with increased risk of noncardioembolic stroke. The genotype distribution of these SNPs did not deviate from Hardy Weinberg equilibrium (p>0.17). To account for multiple testing, false discovery rate q values were estimated for the SNPs. Four of the SNPs were found to be associated with noncardioembolic stroke with false discovery rate q values at or below 0.15. For these four SNPs, carriers of the CHD risk allele, compared with noncarriers, had increased risk of noncardioembolic stroke after adjusting for age and sex: the odds ratios were 1.20 (90% confidence interval (CI) 0.95-1.50) for the C9p21 SNP, 1.24 (CI 1.01-1.52) for the KIF6 SNP, 1.31 (CI 1.07-1.60) for the MYH15 SNP, and 1.21 (CI 0.99-1.49) for the VAMP8 SNP (Model 1, Table 17). On examination of the homozygous and heterozygous carriers separately, it was found that for the C9p21 SNP, the homozygous carriers (OR=1.59) in particular had increased risk (OR of heterozygous carriers=1.05). These odds ratios decreased somewhat after adjustment for additional risk factors (smoking, hypertension, diabetes, dyslipidemia, and BMI) with the exception of the odds ratio for the VAMP8 SNP which increased (Model 2, Table 17). Removal of all cases with a history of myocardial infarction (n=40) from the analysis did not appreciably change the fully adjusted odds ratios for the C9p21 homozygotes (1.45, CI 1.05-1.99), MYH15 carriers (1.24, CI 0.99-1.55), and VAMP8 carriers (1.28, CI 1.01-1.61). However, removal of cases with a history of myocardial infarction reduced the odds ratio for KIF6 carriers to 1.15 (CI 0.91-1.45).
[0572] Population structure was investigated in this study using a Bayesian clustering approach.sup.12 to evaluate models that assumed one, two, three, or four distinct subpopulations. A model assuming two subpopulations was found to result in the highest estimated log likelihood. Using the two subpopulation model, the degree of ancestry admixture was estimated for individual subjects. The fully adjusted odds ratios of the SNPs shown in Table 17 were not appreciably changed (the largest change was a decrease of 0.01 in the odds ratio for C9p21 homozygotes) when further adjusted for the ancestry of the subjects.
[0573] Discussion
[0574] It was determined that four SNPs were associated with noncardioembolic stroke after adjusting for age and sex when controlling the false discovery rate at 0.15. For these four SNPs, carriers of the CHD risk allele (G of rs10757274 on C9p21, Arg of Trp719Arg (rs20455) in KIF6, Ala of Thr1125Ala (rs3900940) in MYH15, and C of rs1010 in VAMP8) also had increased risk of noncardioembolic stroke.
[0575] MYH15 encodes myosin heavy polypeptide 15, a motor protein of the class-II sarcomeric myosin heavy chain family. The Thr1125Ala SNP is located in the coiled-coil rod domain of the MYH15 protein, and the Thr1125 residue has been shown to be phosphorylated.sup.13,14. Since the Ala1125 residue could not be phosphorylated, this substitution could affect the function of the MYH15 protein.
[0576] VAMP8 encodes vesicle associated membrane protein 8 which functions in platelet degranulation pathways.sup.15. The rs1010 SNP is located in the 3′ untranslated region of VAMP8 in a potential microRNA binding site.sup.16.
[0577] Thus, this Example demonstrates that carriers of the CHD risk allele of SNPs rs20455 in KIF6, rs3900940 in MYH15, rs1010 in VAMP8, and rs10757274 on chromosome 9p21 had increased risk of noncardioembolic stroke in VSR.
REFERENCES (CORRESPONDING TO EXAMPLE THREE)
[0578] 1. Rosamond W, Flegal K, Furie K, Go A, Greenlund K, Haase N, Hailpern S M, Ho M, Howard V, Kissela B, Kittner S, Lloyd-Jones D, McDermott M, Meigs J, Moy C, Nichol G, O'Donnell C, Roger V, Sorlie P, Steinberger J, Thom T, Wilson M, Hong Y: Heart disease and stroke statistics—2008 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation 2008; 117:e25-146.
[0579] 2. Bare L A, Morrison A C, Rowland C M, Shiffman D, Luke M M, Iakoubova O A, Kane J P, Malloy M J, Ellis S G, Pankow J S, Willerson J T, Devlin J J, Boerwinkle E: Five common gene variants identify elevated genetic risk for coronary heart disease. Genet Med 2007; 9:682-689.
[0580] 3. McPherson R, Pertsemlidis A, Kavaslar N, Stewart A, Roberts R, Cox D R, Hinds D A, Pennacchio L A, Tybjaerg-Hansen A, Folsom A R, Boerwinkle E, Hobbs H H, Cohen J C: A common allele on chromosome 9 associated with coronary heart disease. Science 2007; 316:1488-1491.
[0581] 4. Morrison A C, Bare L A, Luke M M, Pankow J S, Mosley T H, Devlin J J, Willerson J T, Boerwinkle E: Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. Cerebrovascular Disease 2008; 26:420-424.
[0582] 5. Zee R Y, Ridker P M: Two common gene variants on chromosome 9 and risk of atherothrombosis. Stroke 2007; 38:e111.
[0583] 6. Luke M M, O'Meara E S, Rowland C M, Shiffman D, Bare L A, Arellano A R, Longstreth W T, Jr., Lumley T, Rice K, Tracy R P, Devlin J J, Psaty B M: Gene Variants Associated With Ischemic Stroke. The Cardiovascular Health Study. Stroke 2008.
[0584] 7. Lang W: The Vienna Stroke Registry—objectives and methodology. The Vienna Stroke Study Group. Wien Klin Wochenschr 2001; 113:141-147.
[0585] 8. Lalouschek W, Lang W, Mullner M: Current strategies of secondary prevention after a cerebrovascular event: the Vienna stroke registry. Stroke 2001; 32:2860-2866.
[0586] 9. Shiffman D, Ellis S G, Rowland C M, Malloy M J, Luke M M, Iakoubova O A, Pullinger C R, Cassano J, Aouizerat B E, Fenwick R G, Reitz R E, Catanese J J, Leong D U, Zellner C, Sninsky J J, Topol E J, Devlin J J, Kane J P: Identification of four gene variants associated with myocardial infarction. Am J Hum Genet 2005; 77:596-605.
[0587] 10. QUANTO: Release 1.1 A computer program for power and sample size calculations for genetic epidemiology studies. Gauderman WJMJ. 2006.
[0588] 11. Benjamini Y, Hochberg Y: Controlling the false discovery rate: A new and powerful approach to multiple testing. Journal of the Royal Statistical Society 1995; Serials B:1289-1300.
[0589] 12. Pritchard J K, Stephens M, Donnelly P: Inference of population structure using multilocus genotype data. Genetics 2000; 155:945-959.
[0590] 13. Gnad F, Ren S, Cox J, Olsen J V, Macek B, Oroshi M, Mann M: PHOSIDA (phosphorylation site database): management, structural and evolutionary investigation, and prediction of phosphosites. Genome Biol 2007; 8:R250.
[0591] 14. Olsen J V, Blagoev B, Gnad F, Macek B, Kumar C, Mortensen P, Mann M: Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell 2006; 127:635-648.
[0592] 15. Polgar J, Chung S H, Reed G L: Vesicle-associated membrane protein 3 (VAMP-3) and VAMP-8 are present in human platelets and are required for granule secretion. Blood 2002; 100:1081-1083.
[0593] 16. Shiffman D, Rowland C M, Louie J Z, Luke M M, Bare L A, Bolonick J I, Young B A, Catanese J J, Stiggins C F, Pullinger C R, Topol E J, Malloy M J, Kane J P, Ellis S G, Devlin J J: Gene variants of VAMP8 and HNRPUL1 are associated with early-onset myocardial infarction. Arterioscler Thromb Vasc Biol 2006; 26:1613-1618.
[0594] 17. Helgadottir et al.: The same sequence variant on 9p21 associates with myocardial infarction, abdominal aortic aneurysm and intracranial aneurysm. Nat Genet 2008; 40:217-224.
[0595] Supplemental Analysis of SNPs in the Vienna Stroke Registry
[0596] In a further analysis, the genotype of 19 SNPs (which were previously found to be associated with incident CHD in white or black participants of the ARIC study) were determined in the cases and controls of the Vienna Stroke Registry (“VSR”, approximately 764 ischemic stroke cases which included 562 atherothrombotic stroke cases, and 815 controls who were 45 or older from the same region).
[0597] As shown in Table 18, the risk alleles (which were associated with CHD in ARIC) for certain of these 19 SNPs were found to be associated (2-sided p-value of <0.2) with ischemic stroke (labeled “ischemic” in the “outcome” column of Table 18), atherothrombotic stroke (labeled “athero” in the “outcome” column of Table 18), and/or early-onset stroke (labeled “early-onset” in the “outcome” column of Table 18) in VSR before and/or after adjustment for traditional risk factors such as age, sex, body mass index, smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol (results after adjustment are labeled “yes” and results before adjustment are labeled “no” in the “adjust?” column of Table 18) (the p-values shown in Table 18 are two-sided p-values; thus, the one-sided p-values for these SNPs are half of these two-sided p-values).
[0598] Early-onset stroke is ischemic stroke that occurs early in life. As used herein, early-onset stroke is defined as those stroke events that happened before the median stroke age of the ischemic cases. The controls for these early-onset cases are those controls who were at ages above the median age of all controls in the study (i.e., young cases versus old controls was the study design).
Example Four
SNPs Associated with Stroke in the UCSF/CCF Study
[0599] The allele frequencies of 25,878 putative functional SNPs were determined in atherothrombotic stroke cases and healthy controls of the Vienna Stroke Registry (“VSR”, about 562 cases and 815 controls, Study ID V0031), and the allele frequencies of about 3,300 of these 25,878 SNPs were found to be associated with atherothrombotic (noncardioembolic) stroke (2-sided p value of less than or equal to 0.05). These 3,300 SNPs were then further tested in a stroke study of cases with a history of stroke and controls with no history of stroke or myocardial infarction from the UCSF and the CCF sample sets (Study ID GS41). The allele frequencies of 292 of these 3,300 SNPs were again associated with stroke risk (1-sided p<0.05) in the UCSF/CCF stroke study (approximately 570 cases and 1604 controls), and the risk alleles were the same in VSR and in UCSF/CCF studies. These stroke associations were then confirmed by individually genotyping the 292 SNPs in VSR subjects, and 101 of these SNPs were again found to be associated with stroke risk (p<0.05 in allelic, additive, dominant, or recessive mode). These 101 SNPs were then genotyped in the UCSF/CCF stroke study and it was determined that 61 of these SNPs were still associated with stroke in the UCSF/CCF study (1-sided p<0.05 or 2-sided p<0.1) and have the same risk allele as in the VSR study.
[0600] These 61 SNPs and the stroke association data in both the UCSF/CCF and the VSR studies are provided in Table 19. These SNPs were further analyzed in additional sample sets, as discussed below in Examples Five, Six, and Seven.
Example Five
SNPs Associated with Stroke in the German West Study
[0601] The identification of 61 SNPs that are associated with stroke in both of two case-control studies (Vienna Stroke Registry and the UCSF/CCF Stroke Study) is described in Example Four above. Here, Example Five describes the analysis of these 61 SNPs, plus 17 additional SNPs, in the German West Study (which may be interchangeably referred to herein as the “Muenster” Stroke Study).
[0602] The German West Study, which is a stroke case-control study, included 1,300 ischemic stroke cases and 1,000 healthy controls. The ischemic stroke cases were further classified by TOAST criteria into several stroke subtypes, allowing analyses of the association of genotypes of the tested SNPs with the following endpoints: 1) ischemic stroke (outcome: “ischemic_stk” in Tables 20-21), 2) noncardioembolic stroke (outcome: “nonce_stk” in Tables 20-21; ischemic stroke that were not cardioembolic in origin), 3) cardioembolic stroke (outcome: “CE_stk” in Tables 20-21), 4) atherothrombotic stroke (outcome: “athero_stk” in Tables 20-21), 5) Lacunar stroke (outcome: “lacunar_stk” in Tables 20-21), 6) no heart disease stroke (outcome: “nohd_stk” in Tables 20-21; ischemic stroke cases excluding those with a history of heart disease), 7) recurrent stroke (outcome: “recurrent_stk” in Tables 20-21; stroke cases that also had a prior history of stroke), and 8) early onset stroke (outcome: “EO_stk” in Tables 20-21; cases that are younger than the median age of all cases, and controls that were older than the median age of all controls).
[0603] Potential population stratification was also adjusted for (in addition to traditional risk factors) in assessing the risk estimates of the SNPs. The risk allele of each of the SNPs tested in this study was pre-specified to be the same as in antecedent studies, and a 2-sided p-value of less than 0.1 (equivalent to 1-sided p-values less than 0.05) or a 2-sided p-value less than 0.2 (equivalent to 1-sided p-values less than 0.1) were used as cutoffs for statistical significance.
[0604] SNPs that showed significant association with stroke risk in the German West Study are provided in Tables 20-21. Table 20 provides SNPs associated with stroke that have the same risk allele and 2-sided p-values that are less than 0.1 (equivalent to 1-sided p-values that are less than 0.05), and Table 21 provides SNPs associated with stroke that have the same risk allele and 2-sided p-values that are between 0.1 and 0.2 (equivalent to 1-sided p-values that are between 0.05 and 0.1).
[0605] Supplemental Analysis of SNPs in the German West Study
[0606] Overview and Results
[0607] Also in the German West Study, SNPs were identified that are associated with noncardioembolic stroke in three large study populations (the German West Study, as well as in the Vienna and UCSF/CCF Studies described above). A case-control study design was used: the Vienna Study, the UCSF/CCF Study, and the German West Study (728 noncardioembolic stroke cases, 1,041 controls). It was determined whether the alleles of those SNPs that were associated with increased risk in both the Vienna and UCSF/CCF studies were also associated with increased risk in the German West Study (thus, 1-sided tests of significance were used). Logistic regression analysis adjusting for age, sex, hypertension, and diabetes was performed.
[0608] Four SNPs were determined to be associated with noncardioembolic stroke (p<0.05) in the German West Study (before correcting for multiple testing—46 SNPs and 3 genetic models), as well as also being associated with noncardioembolic stroke in the UCSF/CCF and Vienna studies described above. These four SNPs (and the genes which they are in or near) are as follows: rs544115 in NEU3, rs1264352 near DDR1, rs10948059 in GNMT, and rs362277 in HD. An increased risk for noncardioembolic stroke was observed for carriers of the following genotypes, compared with noncarriers, for each of these four SNPs (with carrier frequency in controls, odds ratio, and 90% confidence interval indicated): CT or CC carriers of rs544115 (96.0% of controls, OR 2.39, CI 1.31-4.36), CG or CC carriers of rs1264352 (23.9% of controls, OR 1.38, CI 1.08-1.76), CT or CC carriers of rs10948059 (77% of controls, OR 1.38, CI 1.06-1.79), and CC carriers of rs362277 (80.0% of controls, OR 1.39, CI 1.05-1.84). After correcting for multiple testing, this set of 4 SNPs had a false discovery rate (FDR) of 0.67.
[0609] Subjects and Methods
[0610] Study Subjects
[0611] Subjects in all three studies (the German West Study, as well as the Vienna and UCSF/CCF Studies) were unrelated men and women of European decent and have given written informed consent. In the Vienna Study, the noncardioembolic stroke cases (defined as ischemic stroke cases that are not of cardioembolic origin, and included large vessel and small vessel stroke) were drawn from the Vienna Stroke Registry (VSR). Stroke cases in VSR were consecutive Caucasian patients admitted to stroke units in Vienna within 72 hours of onset of acute ischemic stroke between October 1998 and June 2001. All patients underwent cranial CT or MRI and were documented according to a standardized protocol including stroke severity, risk factors, and medical history. Controls were unrelated Caucasian participants in a health care program in Vienna, 45 years old or older, free of arterial vascular disease, and reported no arterial vascular diseases in first degree relatives. This study complied with the Declaration of Helsinki and was approved by the Ethics Committee of Medical University Vienna.
[0612] The UCSF/CCF study included 416 cases and 977 controls drawn from Genomic Resource at University of California San Francisco (UCSF) as well as 154 cases and 627 controls drawn from the Genebank of Cleveland Clinic Foundation (CCF). Cases in the UCSF/CCF study did not have stroke subtype information. To enrich for noncardioembolic stroke cases, patients with a history of stroke were excluded who also had a history of heart rhythm or heart valve diseases that could have lead to cardioembolic stroke. Cases from UCSF had a history of stroke and no history of abnormal heart rhythm, heart valve disease or surgery. Controls from UCSF did not have a history of stroke, atherectomy, or CHD (including coronary stenosis, myocardial infarction, or coronary revascularization procedures). Cases and controls from CCF were patients who have had coronary angiography. Cases had a history of stroke and no history of atrial fibrillation, heart valve disease, or surgery. Controls did not have a history of stroke or CHD (including myocardial infarction, coronary stenosis greater than 50%, peripheral vascular disease, or revascularization procedures).
[0613] The German West Study included 728 noncardioembolic cases (ischemic strokes that were not of cardioembolic origin) from Westphalia Stroke Registry and 1,041 controls from the same region of Germany recruited by the Dortmund Health Study for the noncardioembolic stroke analysis. For the cardioembolic stroke analysis, 462 cardioembolic stroke cases (ischemic strokes of cardioembolic origin), also enrolled in the Westphalia Stroke Registry, were compared with the same 1401 controls from the Dortmund Health Study.
[0614] Statistics
[0615] Differences in traditional risk factors between cases and controls were assessed by the Wilcoxon rank sum test (continuous variables) or by the chi-square test (discrete variables). Odds ratios for the Vienna Study or the UCSF/CCF Study were not adjusted, and odds ratios for the German West Study were estimated from logistic regression models and adjusted for traditional risk factors including age (at the index stroke event for cases, at enrollment for controls), sex, diabetes mellitus (defined by a physician's diagnosis or the use of either insulin or oral hypoglycemic medications), hypertension (defined by systolic blood pressure>140 mmHg, diastolic blood pressure>90 mmHg, a physician's diagnosis of hypertension, or the use of anti-hypertensive medications). To account for multiple hypothesis testing, the false discovery rate (FDR) q values were estimated by the method of Benjamini and Hochberg (Journal of the Royal Statistical Society 1995; Serials B:1289-1300) using the p-values for risk genotype carrier status from the model adjusted for age, sex, hypertension, and diabetes.
Example Six
SNPs Associated with Stroke or Statin Response in CARE or PROSPER Studies
[0616] The identification of 61 SNPs that are associated with stroke in both of two case-control studies (Vienna Stroke Registry and the UCSF/CCF Stroke Study) is described in Example Four above. Example Five above describes the analysis of these 61 SNPs plus 17 additional SNPs in the German West Study. Here, Example Six describes the analysis of SNPs for association with stroke risk and stroke statin response (SSR) in two pravastatin trials: CARE (“Cholesterol and Recurrent Events” study, which is comprised of individuals who have previously had an MI) and PROSPER (“Prospective Study of Pravastatin in the Elderly at Risk” study, which is comprised of elderly individuals with or without a history of cardiovascular disease (CVD)).
[0617] In CARE, SNPs were analyzed for association with stroke risk or SSR. SNPs that were significantly associated with stroke risk or SSR in CARE (which were also associated with stroke risk in the German West Study described above in Example Five) are provided in Table 22 (stroke risk) and Table 23 (SSR). Additional SNPs that were significantly associated with stroke risk or SSR in CARE are provided in Table 24 (stroke risk) and Table 25 (SSR). Further SNPs that were significantly associated with stroke risk or SSR in CARE are provided in Table 26 (stroke risk) and Table 27 (SSR).
[0618] Table 26 shows that, for example, individuals in CARE who were G/G homozygotes at the CALM1 SNP (rs3814843/hCV11474611) had an increased risk for stroke (HR=7.54 with a 2-sided p-value of 0.0441 for genotypic mode and adjusted for statin use; HR=7.43 with a 2-sided p-value of 0.0455 for recessive mode and adjusted for statin use; HR=6.64 with a 2-sided p-value of 0.0606 for genotypic mode and unadjusted; and HR=6.67 with a 2-sided p-value of 0.0599 for recessive mode and unadjusted).
[0619] Results of the analysis of the MYH15 SNP (rs3900940/hcv7425232) for association with stroke risk in CARE are provided in Table 28. Table 28 shows that, for example, individuals in CARE who were C/C homozygotes at the MYH15 SNP (rs3900940/hcv7425232) had an increased risk for stroke (HR=1.403 with a 2-sided p-value of 0.153 when adjusted for statin use; HR=1.51 with a 2-sided p-value of 0.086 when adjusted for traditional risk factors, BMI, and statin use; and HR=1.49 with a 2-sided p-value of 0.094 when adjusted for CHD, traditional risk factors, BMI, and statin use). All the p-values (including P.sub.int values) provided in Tables 22-28 are two-sided p-values.
[0620] In PROSPER, SNPs were analyzed for association with stroke risk or SSR, in the whole study cohort (strata: “ALL”), or in the subgroup with a history of CVD (strata: “hist”) or without a CVD history (strata: “no hist”). SNPs were considered significantly associated with stroke risk if they met the p-value cutoffs and had the same risk allele as in antecedent studies (e.g., as described herein in Examples Four, Five, and Six), and these SNPs that are significantly associated with stroke risk are provided in Tables 29-30. Specifically, Table 29 lists SNPs associated with stroke risk that have P_all<0.2 (which is the p-value based on the entire study cohort), and Table 30 lists SNPs associated with stroke risk that have P_placebo<0.2 (which is the p-value based on just the placebo arm of the trial). For SSR, the results of the analyses of pravastatin-treated versus placebo-treated individuals are provided in Table 31 (which lists SNPs having P.sub.int<0.1) and Table 32 (which lists SNPs having P.sub.int<0.2). All the p-values (including P.sub.int values) provided in Tables 29-32 are two-sided p-values (two-sided p-value cutoffs of 0.1 and 0.2 are equivalent to one-sided p-value cutoffs of 0.05 and 0.1, respectively).
[0621] Table 30 shows that, for example, individuals in PROSPER who were A/G heterozygotes at the chromosome 9p21 SNP (rs1075727/hCV26505812) had an increased risk for stroke (HR=1.464 with a 2-sided p-value of 0.035 based on the placebo group; see the first row for rs10757274/hCV26505812 in Table 30).
[0622] Table 30 also shows that, for example, individuals in PROSPER who were T/T homozygotes at the chromosome 4q25 SNP (rs2200733/hCV16158671) had an increased risk for stroke (HR=3.711 with a 2-sided p-value of 0.025 based on the placebo group).
[0623] Also in the CARE and PROSPER trials, the chromosome 9p21 SNP rs10757274 (hCV26505812) was analyzed further for association with SSR, including unadjusted and adjusted analysis. Adjusted analysis in CARE (Table 37) was adjusted for age, gender, smoking status, hypertension, diabetes, body mass index (BMI), and LDL and HDL levels, and adjusted analysis in PROSPER (Table 38) was adjusted for country, gender, age, LDL, HDL, smoking status (current vs. past or never), history of hypertension, and diabetes. Table 37 provides results in CARE, and Table 38 provides results in PROSPER (whether each analysis is unadjusted or adjusted is indicated in the “adjust” column in Table 37, or by “unadj” and “adj” column labels in Tables 38). All the p-values (including P.sub.int values) provided in Tables 37-38 are two-sided p-values.
[0624] In CARE, among the three genotypes of SNP rs1075727 (homozygous carriers of each of the two alternative alleles plus heterozygous carriers), the heterozygous carriers of SNP rs10757274 (49% genotype frequency) had the greatest reduction in the number of stroke events (HR=0.61) upon pravastatin treatment after adjusting for traditional risk factors (2-sided p-value=0.034, and the genotype by treatment interaction had a 2-sided p-interaction value (“pval_intx” or P.sub.int)=0.44; see the 13.sup.th row under the column headings in Table 37). In PROSPER, heterozygous carriers of the G allele (risk allele) at SNP rs1075727 in the placebo arm had an increased stroke risk (for example, see the first row for rs10757274/hCV26505812 in Table 30), as indicated above. Furthermore, in PROSPER, after stratifying by rs10757274 genotype, heterozygous carriers of this SNP (51% of the population) also had the greatest reduction in the number of stroke events (unadjusted HR=0.777) in the pravastatin-treated versus the placebo-treated arms of the trial (2 sided p-value=0.066; see the 3rd row under the column headings in Table 38), whether unadjusted or adjusted for traditional risk factors.
Example Seven
SNPs Associated with Stroke in the Cardiovascular Health Study (CHS)
[0625] The identification of 61 SNPs that are associated with stroke in both of two case-control studies (Vienna Stroke Registry and the UCSF/CCF Stroke Study) is described in Example Four above. Example Five above describes the analysis of these 61 SNPs plus 17 additional SNPs in the German West Study. Here, Example Seven describes the analysis of SNPs previously found to be associated with stroke (e.g., in Examples Four, Five, and/or Six above) for association with incident stroke events in the Cardiovascular Health Study (CHS), which is a population-based study of elderly white or black participants in the United States. Association was analyzed for three related stroke end points: stroke (all subtypes) (endpoint: “stroke” in Tables 33-36), ischemic stroke (excludes hemorrhagic stroke) (endpoint: “ischem” in Tables 33-36), and atherothrombotic stroke (excludes hemorrhagic stroke and cardioembolic stroke) (endpoint: “athero” in Tables 33-36).
[0626] The results in the CHS Study are provided in Tables 33-36. Specifically, SNPs that are associated with stroke risk in white or black individuals with 2-sided p-values less than 0.1 (equivalent to 1-sided p-values less than 0.05) are provided in Table 33 (white individuals) and Table 34 (black individuals), and SNPs that are associated with stroke in white or black individuals with 2-sided p-values between 0.1 and 0.2 (equivalent to 1-sided p-values between 0.05 and 0.1) are provided in Table 35 (white individuals) and Table 36 (black individuals).
Example Eight
Additional LD SNPs Associated with Stroke
[0627] Another investigation was conducted to identify SNPs in linkage disequilibrium (LD) with certain “interrogated SNPs” which have been found to be associated with stroke, as described herein and shown in the tables. The interrogated SNPs are shown in column 1 (which indicates the hCV identification numbers of each interrogated SNP) and column 2 (which indicates the public rs identification numbers of each interrogated SNP) of Table 4. The methodology is described earlier in the instant application. To summarize briefly, the power threshold (T) was set at an appropriate level, such as 51%, for detecting disease association using LD markers. This power threshold is based on equation (31) above, which incorporates allele frequency data from previous disease association studies, the predicted error rate for not detecting truly disease-associated markers, and a significance level of 0.05. Using this power calculation and the sample size, a threshold level of LD, or r.sup.2 value, was derived for each interrogated SNP (r.sub.T.sup.2, equations (32) and (33) above). The threshold value r.sub.T.sup.2 is the minimum value of linkage disequilibrium between the interrogated SNP and its LD SNPs possible such that the non-interrogated SNP still retains a power greater or equal to T for detecting disease association.
[0628] Based on the above methodology, LD SNPs were found for the interrogated SNPs. Several exemplary LD SNPs for the interrogated SNPs are listed in Table 4; each LD SNP is associated with its respective interrogated SNP. Also shown are the public SNP IDs (rs numbers) for the interrogated and LD SNPs, when available, and the threshold r.sup.2 value and the power used to determine this, and the r.sup.2 value of linkage disequilibrium between the interrogated SNP and its corresponding LD SNP. As an example in Table 4, the interrogated, stroke-associated SNP rs11580249 (hCV11548152) was calculated to be in LD with rs12137135 (hCV30715059) at an r.sup.2 value of 0.4781, based on a 51% power calculation, thus establishing the latter SNP as a marker associated with stroke as well.
[0629] In general, the threshold r.sub.T.sup.2 value can be set such that one of ordinary skill in the art would consider that any two SNPs having an r.sup.2 value greater than or equal to the threshold r.sup.2 value would be in sufficient LD with each other such that either SNP is useful for the same utilities, such as determing an individual's risk for stroke. For example, in various embodiments, the threshold r.sub.T.sup.2 value used to classify SNPs as being in sufficient LD with an interrogated SNP (such that these LD SNPs can be used for the same utilities as the interrogated SNP, for example, such as determining stroke risk) can be set at, for example, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 0.96, 0.97, 0.98, 0.99, 1, etc. (or any other r.sup.2 value in-between these values). Threshold r.sub.T.sup.2 values may be utilized with or without considering power or other calculations.
[0630] All publications and patents cited in this specification are herein incorporated by reference in their entirety. Various modifications and variations of the described compositions, methods and systems of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments and certain working examples, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described modes for carrying out the invention that are obvious to those skilled in the field of molecular biology, genetics and related fields are intended to be within the scope of the following claims.
TABLE-US-00001 TABLE 3 Marker Alleles Primer 1 (Allele-specific Primer) Primer 2 (Allele-specific Primer) Common Primer hCV1022614 C/T CTGCAGCCTCTCCTACG (SEQ ID NO: 1567) CCTGCAGCCTCTCCTACA (SEQ ID NO: 1568) GATTCCCCATCGGTCATAA (SEQ ID NO: 1569) hCV1053082 C/T TTGCAGAGAAGCGTTCC (SEQ ID NO: 1570) CTTTGCAGAGAAGCGTTCT (SEQ ID NO: 1571) CTGAGCTTTGTGAAGAGAAACTGA (SEQ ID NO: 1572) hCV1116757 C/T GACAAACTGAGGGACAACG (SEQ ID NO: 1573) GACAAACTGAGGGACAACA (SEQ ID NO: 1574) CCTCTGACAGACGCTTCTTGA (SEQ ID NO: 1575) hCV1116793 C/T GGAAGGTCATCCTGGG (SEQ ID NO: 1576) GGAAGGTCATCCTGGA (SEQ ID NO: 1577) CGAAGAGTTTCTGTGTGGTACAG (SEQ ID NO: 1578) hCV11354788 C/T TGAGACGGGTGGTAACC (SEQ ID NO: 1579) TTGAGACGGGTGGTAACT (SEQ ID NO: 1580) CAGCTTTGAAGGGCATCCATATGA (SEQ ID NO: 1581) hCV11425801 C/T TCCCACACCACCTGC (SEQ ID NO: 1582) CTCCCACACCACCTGT (SEQ ID NO: 1583) GCCACCACAATGTCTCTCAATAC (SEQ ID NO: 1584) hCV11425842 C/T CCGCTCCGCACTTAAAG (SEQ ID NO: 1585) CCGCTCCGCACTTAAAA (SEQ ID NO: 1586) CCTGCAGCTGGACAGACTC (SEQ ID NO: 1587) hCV11450563 G/T TAAAGAATGCATAAATTAGTGTGG (SEQ ID TTAAAGAATGCATAAATTAGTGTGT (SEQ ID NO: 1589) GATCCTAATTGGATTTGAAGACTTA (SEQ ID NO: 1590) NO: 1588) hCV11474611 G/T ATCGCCCATGTGCTG (SEQ ID NO: 1591) CATCGCCCATGTGCTT (SEQ ID NO: 1592) TCAAACCAGGAACCCTATCT (SEQ ID NO: 1593) hCV11548152 G/T CTGTAAACGCTGGTCTGG (SEQ ID NO: 1594) ACTGTAAACGCTGGTCTGT (SEQ ID NO: 1595) CCTTGTCCCTGATTGCTTCTTCA (SEQ ID NO: 1596) hCV11738775 C/T CCCCGCTTCAACACG (SEQ ID NO: 1597) TCCCCGCTTCAACACA (SEQ ID NO: 1598) AACTTCATTCGGCACTTGCTACAA (SEQ ID NO: 1599) hCV11758801 C/G AGTACCTCTTGGTCTCTCTCC (SEQ ID NO: 1600) AGTACCTCTTGGTCTCTCTCG (SEQ ID NO: 1601) GCATGTTGTGTTTCTGATTGTAC (SEQ ID NO: 1602) hCV11861255 A/G AAAGGGCCGAGCTGATA (SEQ ID NO: 1603) AGGGCCGAGCTGATG (SEQ ID NO: 1604) GGGAGGTTTGGAGAGAGAGTAT (SEQ ID NO: 1605) hCV12071939 G/T GACCGTGGTCCCTTG (SEQ ID NO: 1606) TGACCGTGGTCCCTTT (SEQ ID NO: 1607) CGCCCGGAGACAGAA (SEQ ID NO: 1608) hCV1209800 G/T TAGCAACTGCTATCAATGACAG (SEQ ID NO: 1609) TAGCAACTGCTATCAATGACAT (SEQ ID NO: 1610) AGTGAAGGAGTTAACTGAGTGTGTA (SEQ ID NO: 1611) hCV1262973 A/G TGGGTCCCAAGCTCAT (SEQ ID NO: 1612) TGGGTCCCAAGCTCAC (SEQ ID NO: 1613) GGCTCGCCGACACTG (SEQ ID NO: 1614) hCV1305848 A/G ACATTTATACCATTTCCCGAGT (SEQ ID NO: 1615) ACATTTATACCATTTCCCGAGC (SEQ ID NO: 1616) GCCTAACAACAGTACCTACTCCATAGG (SEQ ID NO: 1617) hCV1348610 A/G CATTTGTCCTAAAAGTACCTCTCT (SEQ ID CATTTGTCCTAAAAGTACCTCTCC (SEQ ID NO: 1619) CAAGGCTAAGCATGCTGAACACA (SEQ ID NO: 1620) NO: 1618) hCV1408483 C/T TGCTAAGGCCTGTGAAC (SEQ ID NO: 1621) TTGCTAAGGCCTGTGAAT (SEQ ID NO: 1622) TCTGTTTTCGCTGGAGTCTT (SEQ ID NO: 1623) hCV1452085 A/C ACACCCTGACACCTCTTTTACT (SEQ ID NO: 1624) ACCCTGACACCTCTTTTACG (SEQ ID NO: 1625) CGTTCCAGTCCATATTCACAT (SEQ ID NO: 1626) hCV1463226 C/T ATTTCCTCCCTCACATGATAC (SEQ ID NO: 1627) ATTTCCTCCCTCACATGATAT (SEQ ID NO: 1628) TCAAAGAATGAAGAGTGAAGACA (SEQ ID NO: 1629) hCV15752716 C/T ACGCTGCTGTTCCG (SEQ ID NO: 1630) ACGCTGCTGTTCCA (SEQ ID NO: 1631) CAGACAGACAACAATTCAGAAGAA (SEQ ID NO: 1632) hCV15770510 G/T TGAAGACTGATTGTTGTACTTGC (SEQ ID CTGAAGACTGATTGTTGTACTTGA (SEQ ID NO: 1634) TGGTGGAGAGGGTTGTAGAA (SEQ ID NO: 1635) NO: 1633) hCV15851766 A/G GAGTTTTCGCCATCCACT (SEQ ID NO: 1636) GTTTTCGCCATCCACC (SEQ ID NO: 1637) GAATCTGCTTCATTTGAATCTCT (SEQ ID NO: 1638) hCV15854171 C/T TTGGTGTTTCCTTGTGACAC (SEQ ID NO: 1639) TTGGTGTTTCCTTGTGACAT (SEQ ID NO: 1640) CCTAGTGTTTGCAATCTCATTTATC (SEQ ID NO: 1641) hCV15857769 C/T CACTCCTAAGTGAGCAGC (SEQ ID NO: 1642) ATCACTCCTAAGTGAGCAGT (SEQ ID NO: 1643) CTGCTTCAGTGTTATCTCAGTCTT (SEQ ID NO: 1644) hCV15879601 C/T CCACCAGGATGTAACAGTCC (SEQ ID NO: 1645) CCCACCAGGATGTAACAGTCT (SEQ ID NO: 1646) TGTGGATGCAGCAGTGAC (SEQ ID NO: 1647) hCV16093418 A/G CAAGAAGTTCACAGCTGAAGA (SEQ ID NO: 1648) AAGAAGTTCACAGCTGAAGG (SEQ ID NO: 1649) CCTGCTGGAGAGACAGAGTG (SEQ ID NO: 1650) hCV16134786 A/G GGCAGGGGTGAGATTGA (SEQ ID NO: 1651) GGCAGGGGTGAGATTGG (SEQ ID NO: 1652) GTCGTGAGGTCAGATGCTATGAG (SEQ ID NO: 1653) hCV16158671 C/T CTTAAATATTACCTGTTCTAATTTTCTCTG (SEQ ID CCTTAAATATTACCTGTTCTAATTTTCTCTA (SEQ ID GAAATGCTGTGGGAACATAAACTAACTAGG (SEQ ID NO: 1654) NO: 1655) NO: 1656) hCV16164743 NC GAGCAATAGTAAGTATACACAATGAAATAA (SEQ ID GAGCAATAGTAAGTATACACAATGAAATAC (SEQ ID GATCACGGGCCTCTAGATTGATTACA (SEQ ID NO: 1659) NO: 1657) NO: 1658) hCV1619596 A/G GAGGAGCCCGTTGCA (SEQ ID NO: 1660) AGGAGCCCGTTGCG (SEQ ID NO: 1661) TCACCATGCACAAGGACA (SEQ ID NO: 1662) hCV1624173 A/G TGGACAACAGCACCTTAT (SEQ ID NO: 1663) TGGACAACAGCACCTTAC (SEQ ID NO: 1664) TTCCAGAGGTTCCTTCAATC (SEQ ID NO: 1665) hCV16336 C/T CCCCTCAAGCACTCTGAC (SEQ ID NO: 1666) CCCCTCAAGCACTCTGAT (SEQ ID NO: 1667) TCTGCCCCTCGTCTTTCTCT (SEQ ID NO: 1668) hCV1690777 A/G GGCTTTACAGAAGGAAATGCT (SEQ ID NO: 1669) GCTTTACAGAAGGAAATGCC (SEQ ID NO: 1670) GCATGCGCTGAATTTTATATAG (SEQ ID NO: 1671) hCV1723718 A/G CAGCCGTTTCTTCATATAATCCA (SEQ ID AGCCGTTTCTTCATATAATCCG (SEQ ID NO: 1673) CTTGCTAATTCATTCTGTGACCTCAAT (SEQ ID NO: 1674) NO: 1672) hCV1746715 A/G GCGCCTTTCTGTGTAGTT (SEQ ID NO: 1675) GCGCCTTTCTGTGTAGTC (SEQ ID NO: 1676) CACAACAGTTGTTAAGTTGTTAGCAAACC (SEQ ID NO: 1677) hCV1754669 A/G TTCAGGCCATCTTGCAAAT (SEQ ID NO: 1678) TCAGGCCATCTTGCAAAC (SEQ ID NO: 1679) CTCATGGCCCGATGATTTTCAGTTA (SEQ ID NO: 1680) hCV1846459 C/T CAGGCTCGTCTTGAACTC (SEQ ID NO: 1681) CAGGCTCGTCTTGAACTT (SEQ ID NO: 1682) CAAGAGTGGGAACTGCAGGTTT (SEQ ID NO: 1683) hCV1958451 G/T GTGGGAGTCTTATGTTTGTAGATG (SEQ ID GTGGGAGTCTTATGTTTGTAGATT (SEQ ID NO: 1685) GCTTGACAATGCGCAGTTGT (SEQ ID NO: 1686) NO: 1684) hCV2091644 C/T TTCTGGGGCATACAACG (SEQ ID NO: 1687) CTTCTGGGGCATACAACA (SEQ ID NO: 1688) AGGGACAACCCTCCATAAA (SEQ ID NO: 1689) hCV2121658 A/G AGTGGAGATTTAGCACCAGA (SEQ ID NO: 1690) GTGGAGATTTAGCACCAGG (SEQ ID NO: 1691) GTACATTTTGGATTGGGAGAGGATAT (SEQ ID NO: 1692) hCV2169762 G/T CGAGTCGGTCTGCTGC (SEQ ID NO: 1693) CGAGTCGGTCTGCTGA (SEQ ID NO: 1694) TGCCTACCTCATTCCATCTG (SEQ ID NO: 1695) hCV2192261 C/T CCTACCTTGAATTCACCTATCTG (SEQ ID CCTACCTTGAATTCACCTATCTA (SEQ ID NO: 1697) CATTTCCAAATCAGAAACATGA (SEQ ID NO: 1698) NO: 1696) hCV22275299 C/G GCAACTTGTTGAATGCCAG (SEQ ID NO: 1699) GCAACTTGTTGAATGCCAC (SEQ ID NO: 1700) GTGCTGTCACACCCAAGAAGTAC (SEQ ID NO: 1701) hCV2358247 A/G GGTTGGGCGTAAGGGTT (SEQ ID NO: 1702) GGTTGGGCGTAAGGGTC (SEQ ID NO: 1703) CCCTAGCTTTGCATAAATCATAC (SEQ ID NO: 1704) hCV2390937 A/C GTGGAAATGCAAGCTCTTCA (SEQ ID NO: 1705) TGGAAATGCAAGCTCTTCC (SEQ ID NO: 1706) CCAGATCGCTTTGGTAAAGGATTAA (SEQ ID NO: 1707) hCV2442143 C/T ATTTAAGCATCATAGCATACCAC (SEQ ID ATTTAAGCATCATAGCATACCAT (SEQ ID NO: 1 709) TGGTACACCATAAATCTTGACTTAC (SEQ ID NO: 1710) NO: 1708) hCV25473186 C/T ATCTTCACAGTGTTCCACATC (SEQ ID NO: 1711) ATCTTCACAGTGTTCCACATT (SEQ ID NO: 1712) TTCTGACCTCCAGGTTCTTT (SEQ ID NO: 1713) hCV25596936 C/T GGCAGGCGAAGAGTCAC (SEQ ID NO: 1714) GGCAGGCGAAGAGTCAT (SEQ ID NO: 1715) GGGTCAATCCACAGTCTAGATG (SEQ ID NO: 1716) hCV25609987 A/G TGAGCAGGTAGCCTGTATTT (SEQ ID NO: 1717) TGAGCAGGTAGCCTGTATTC (SEQ ID NO: 1718) TGCTGCCTTGGTTGTGA (SEQ ID NO: 1719) hCV25615822 C/T CGGATCTTCTCCAGCG (SEQ ID NO: 1720) CCGGATCTTCTCCAGCA (SEQ ID NO: 1721) TGAAGCCACATCCTTCTTTAT (SEQ ID NO: 1722) hCV25623804 A/G TTTCAAGCTGTCTCCTACCAT (SEQ ID NO: 1723) TTTCAAGCTGTCTCCTACCAC (SEQ ID NO: 1724) GGAGAGAAGGGAAGGACTAAAG (SEQ ID NO: 1725) hCV25637605 A/G GCGGCTCTGCACAT (SEQ ID NO: 1726) GCGGCTCTGCACAC (SEQ ID NO: 1727) GCGGGTGGCTCCTTTAA (SEQ ID NO: 1728) hCV25651109 C/G GGTCCTGCTTGATGCG (SEQ ID NO: 1729) AGGTCCTGCTTGATGCC (SEQ ID NO: 1730) CGACCATGGACATTCACAT (SEQ ID NO: 1731) hCV25742059 A/G CTGCCTCTTCTGCATTAGA (SEQ ID NO: 1732) TGCCTCTTCTGCATTAGG (SEQ ID NO: 1733) CCTTCACTGCCTGTTTCTCT (SEQ ID NO: 1734) hCV25924894 A/G GGGAAGTTCTTTCTTGTATATTCAA (SEQ ID GGGAAGTTCTTTCTTGTATATTCAG (SEQ ID NO: 1736) TGCTGTCTTTGCCTCACTAAT (SEQ ID NO: 1737) NO: 1735) hCV25925481 A/G AATCAGCATTTTTGTCAAAGA (SEQ ID NO: 1738) ATCAGCATTTTTGTCAAAGG (SEQ ID NO: 1739) GGCTTGTGACCTCATTGTTT (SEQ ID NO: 1740) hCV25951678 A/G AATGCAGCTGCTCAAAGA (SEQ ID NO: 1741) ATGCAGCTGCTCAAAGG (SEQ ID NO: 1742) GTTCCCGGGCTCACA (SEQ ID NO: 1743) hCV25952089 A/C CCCTGCCTCTGTCTGACTA (SEQ ID NO: 1744) CCCTGCCTCTGTCTGACTC (SEQ ID NO: 1745) AAGACAAGCCCAGGTTCA (SEQ ID NO: 1746) hCV25983294 GTA CCATCATTTACTCCTACCGC (SEQ ID NO: 1747) CCCATCATTTACTCCTACCGT (SEQ ID NO: 1748) GCCGAGCGGTCTGAG (SEQ ID NO: 1749) hCV2637554 C/T ACATCCCAATAAAAGAGCAGG (SEQ ID NO: 1750) AAACATCCCAATAAAAGAGCAGA (SEQ ID NO: 1751) ACTTTGTTTCTTTCAGTATTTATGGCAGTGG (SEQ ID NO: 1752) hCV26478797 A/G GAAATCCTCCCACTGATGA (SEQ ID NO: 1753) AAATCCTCCCACTGATGG (SEQ ID NO: 1754) GCCAGATAGAATGACTTTATTGTAGA (SEQ ID NO: 1755) hCV26505812 A/G GTCAAATCTAAGCTGAGTGTTGA (SEQ ID TCAAATCTAAGCTGAGTGTTGG (SEQ ID NO: 1757) GCTTTCCCAGATGCACTGTATTGT (SEQ ID NO: 1758) NO: 1756) hCV26682080 A/G TCTCGGGTAGACCACACT (SEQ ID NO: 1759) CTCGGGTAGACCACACC (SEQ ID NO: 1760) GGCCCAGAGAGGTGAAGTTACT (SEQ ID NO: 1761) hCV26881276 A/G GAGTTGCTCACAAAAGGCA (SEQ ID NO: 1762) AGTTGCTCACAAAAGGCG (SEQ ID NO: 1763) GCAGGCCATGTGAATAGACATAC (SEQ ID NO: 1764) hCV27077072 C/T ATCCTGGTATGGCCCC (SEQ ID NO: 1765) CATCCTGGTATGGCCCT (SEQ ID NO: 1766) GTCACACAAGCCAAGAAGAATTAGA (SEQ ID NO: 1767) hCV2741051 C/T GCAGCCAGTTTCTCCC (SEQ ID NO: 1768) TGCAGCCAGTTTCTCCT (SEQ ID NO: 1769) CATGAAATGCTTCCAGGTATT (SEQ ID NO: 1770) hCV27473671 C/T CTGACCTCCTGAATAATCCATC (SEQ ID NO: 1771) TCTGACCTCCTGAATAATCCATT (SEQ ID NO: 1772) CAGGGCTTCCCTAGCAGATAG (SEQ ID NO: 1773) hCV27494483 C/T AACAGCCATTCCTTGTCC (SEQ ID NO: 1774) GAACAGCCATTCCTTGTCT (SEQ ID NO: 1775) CCAGAAGCAGATGAAATGAGTAC (SEQ ID NO: 1776) hCV27504565 C/G GCTCCCAACACTGGACAG (SEQ ID NO: 1777) GCTCCCAACACTGGACAC (SEQ ID NO: 1778) GGTGGCAGAGCTCTCCT (SEQ ID NO: 1779) hCV27511436 C/T GGCCCCCATACATTACAAC (SEQ ID NO: 1780) GGCCCCCATACATTACAAT (SEQ ID NO: 1781) TGGAGGAAAGTTCTGGACAGTTA (SEQ ID NO: 1782) hCV2769503 A/G GGATTCGAGCCGACATCT (SEQ ID NO: 1783) GATTCGAGCCGACATCC (SEQ ID NO: 1784) TTGAGGATTAGCCTAGAACCACACA (SEQ ID NO: 1785) hCV27830265 A/G CGACCCATGAGAGAATCAGA (SEQ ID NO: 1786) CGACCCATGAGAGAATCAGG (SEQ ID NO: 1787) GCAGGTCCAGCCAGTGAA (SEQ ID NO: 1788) hCV27892569 C/T ATGTGAAATTGCATGCACTTAG (SEQ ID NO: 1789) GTATGTGAAATTGCATGCACTTAA (SEQ ID NO: 1790) TGTGTGTACAACACCTATACATGTGTGT (SEQ ID NO: 1791) hCV28036404 A/T CATGAGACTCAACTTCTTAGGAAA (SEQ ID CATGAGACTCAACTTCTTAGGAAT (SEQ ID NO: 1793) GCACCAGCCAAGGTTTACTTTATAG (SEQ ID NO: 1794) NO: 1792) hCV2851380 C/G CTTGCTACCAATTCCATTTTCC (SEQ ID NO: 1795) CTTGCTACCAATTCCATTTTCG (SEQ ID NO: 1796) GGATCTCAGGGGCAAGTCTT (SEQ ID NO: 1797) hCV2862873 C/T TCAACAAATGTATTGATCAGCAAAC (SEQ ID CTCAACAAATGTATTGATCAGCAAAT (SEQ ID NO: 1799) CAGACAGGAGGAGTGGGATTCAT (SEQ ID NO: 1800) NO: 1798) hCV2930693 A/C GAAGAAGTACAACCCACAT (SEQ ID NO: 1801) GAAGAAGTACAACCCACAG (SEQ ID NO: 1802) GACACATGTAAGTTCCACTCATATG (SEQ ID NO: 1803) hCV29401764 C/T AAGGTGAGCTTGCCAATC (SEQ ID NO: 1804) AAGGTGAGCTTGCCAATT (SEQ ID NO: 1805) CATGGCGAGGAAGACACATAT (SEQ ID NO: 1806) hCV29480044 C/T GGTGGGCCTTTTGAAATAAAC (SEQ ID NO: 1807) TGGTGGGCCTTTTGAAATAAAT (SEQ ID NO: 1808) CTTGAAGTGAAGGCACCTGTCAT (SEQ ID NO: 1809) hCV29537898 C/T ACCACAGCTGTCCCTC (SEQ ID NO: 1810) TACCACAGCTGTCCCTT (SEQ ID NO: 1811) GCCTCCCAGTGGGAATCT (SEQ ID NO: 1812) hCV29539757 A/C TCCAGTTAGGGATAAAGAAAGGA (SEQ ID CCAGTTAGGGATAAAGAAAGGC (SEQ ID NO: 1814) CCAGGCTGATCTCGAACTTCT (SEQ ID NO: 1815) NO: 1813) hCV29566897 C/T GAAGATAGATTCTGCCAAATCATTC (SEQ ID GAAGATAGATTCTGCCAAATCATTT (SEQ ID NO: 1817) GGTAAACTCCTGTTGCCTCAGTA (SEQ ID NO: 1818) NO: 1816) hCV2959482 A/G ACACCTGCGGTTAGATTGA (SEQ ID NO: 1819) CACCTGCGGTTAGATTGG (SEQ ID NO: 1820) CGAAGCTTCACAGATGACATC (SEQ ID NO: 1821) hCV29881864 C/G CTTTCTTGACATCAGTGCTTC (SEQ ID NO: 1822) CTTTCTTGACATCAGTGCTTG (SEQ ID NO: 1823) CAAAGTCCTCCTTTTCCTTGACTCTG (SEQ ID NO: 1824) hCV302629 A/G AGCTGCTGCTTGCTAAATAT (SEQ ID NO: 1825) AGCTGCTGCTTGCTAAATAC (SEQ ID NO: 1826) CCTGGAAAGGTCATGCTACTCATACT (SEQ ID NO: 1827) hCV30308202 C/G TGGCAGGAGATGGATGTAC (SEQ ID NO: 1828) TGGCAGGAGATGGATGTAG (SEQ ID NO: 1829) CCAGTTACTTGACTTTTGGCGTTTCT (SEQ ID NO: 1830) hCV30454150 C/T TCTAGCAGATTTGTATCAGAACC (SEQ ID TAATCTAGCAGATTTGTATCAGAACT (SEQ ID NO: 1832) GCGACCCTCTCTGGTTAAACA (SEQ ID NO: 1833) NO: 1831) hCV3054550 C/T TCCTGTCTCTGTCCCTTTC (SEQ ID NO: 1834) ATCCTGTCTCTGTCCCTTTT (SEQ ID NO: 1835) CGGAGTGCCCTCTTGTCT (SEQ ID NO: 1836) hCV3054799 A/G TGACTCCCAGCATGAAT (SEQ ID NO: 1837) TGACTCCCAGCATGAAC (SEQ ID NO: 1838) TGGCTTATCAAGAGACATGAGA (SEQ ID NO: 1839) hCV3082219 A/G AGAGATAGTGGAAGCTTTGACA (SEQ ID NO: 1840) GAGATAGTGGAAGCTTTGACG (SEQ ID NO: 1841) CCTGCAGCACACTTTGTAATCTAC (SEQ ID NO: 1842) hCV31137507 C/G CCTGGGCAACAAAGTCAC (SEQ ID NO: 1843) CCTGGGCAACAAAGTCAG (SEQ ID NO: 1844) CAAGAATATTGGCCTGCTTCAAACTAG (SEQ ID NO: 1845) hCV31227848 C/T CCTTGGGGTAGTCCCC (SEQ ID NO: 1846) TCCTTGGGGTAGTCCCT (SEQ ID NO: 1847) GCTGGAGTCCCACTGAGA (SEQ ID NO: 1848) hCV31573621 C/T TGTAATTGGCCCAGAACAC (SEQ ID NO: 1849) ATGTAATTGGCCCAGAACAT (SEQ ID NO: 1850) CCTTCCAGGCTTCTCTCTGAT (SEQ ID NO: 1851) hCV31705214 A/T GTTGGTGAAGAAGGATTTGTAGT (SEQ ID GTTGGTGAAGAAGGATTTGTAGA (SEQ ID NO: 1853) GCTGGAAGCTTGACACTTGTTGAA (SEQ ID NO: 1854) NO: 1852) hCV32160712 A/T TGTGCCTTCCACATCTCA (SEQ ID NO: 1855) TGTGCCTTCCACATCTCT (SEQ ID NO: 1856) CAGGCTTTGGTCTGGGTTAAA (SEQ ID NO: 1857) hCV3216551 A/G GCATACATCACATTTTCTTTACCT (SEQ ID GCATACATCACATTTTCTTTACCC (SEQ ID NO: 1859) GTTCATTGCAGCATTTTCCCCAATAC (SEQ ID NO: 1860) NO: 1858) hCV323071 A/G AAACCAGGATATCAGAACATTTTA (SEQ ID ACCAGGATATCAGAACATTTTG (SEQ ID NO: 1862) GGTCTTAGGAATTATCTGACATCTT (SEQ ID NO: 1863) NO: 1861) hCV435733 C/G CAACTACTCGGGAGACAG (SEQ ID NO: 1864) CAACTACTCGGGAGACAC (SEQ ID NO: 1865) CCTCTCAGCCCTCTCTCCATAAAG (SEQ ID NO: 1866) hCV454333 C/T GTATGGGCTTGAGGAAATCAC (SEQ ID NO: 1867) GTATGGGCTTGAGGAAATCAT (SEQ ID NO: 1868) TGCACAGATGGCTTCTGTATGT (SEQ ID NO: 1869) hCV540056 C/T AACTACTTCTGGATGGTCAGC (SEQ ID NO: 1870) AAACTACTTCTGGATGGTCAGT (SEQ ID NO: 1871) GGGTCCTGCAAGTAGACACTAAG (SEQ ID NO: 1872) hCV7425232 C/T TCAAAATTATTTCTTGCTACAGG (SEQ ID GTCAAAATTATTTCTTGCTACAGA (SEQ ID NO: 1874) TCCTCCAGCCTCTCATTC (SEQ ID NO: 1875) NO: 1873) hCV7917138 A/G CAGTAGCAATGGTAAAGATTTGAAT (SEQ ID CAGTAGCAATGGTAAAGATTTGAAC (SEQ ID NO: 1877) TTCCACTGTATAGACTCTCCTGTACAGAT (SEQ ID NO: 1876) NO: 1878) hCV8147903 A/G GGCTCTCTCGTGAGCA (SEQ ID NO: 1879) GGCTCTCTCGTGAGCG (SEQ ID NO: 1880) GAAGGGGCACAGTGCCTTTTAG (SEQ ID NO: 1881) hCV8754449 C/T GCAGCTGAGGATTTAGCAC (SEQ ID NO: 1882) GCAGCTGAGGATTTAGCAT (SEQ ID NO: 1883) CAGAGCAAGACCCTGTCTCTAA (SEQ ID NO: 1884) hCV8757333 C/T CGTCAGCTCCTTTTGACAC (SEQ ID NO: 1885) CGTCAGCTCCTTTTGACAT (SEQ ID NO: 1886) CCCCAGAGGGTCCAAATTTCT (SEQ ID NO: 1887) hCV8820007 A/T CTTGGATAGCCTGAACCAATAA (SEQ ID NO: 1888) CTTGGATAGCCTGAACCAATAT (SEQ ID NO: 1889) CGTGAATAGGGTCCAGAGTCTA (SEQ ID NO: 1890) hCV8942032 G/G TTTGGACATGGGCAAGC (SEQ ID NO: 1891) CTTTGGACATGGGCAAGG (SEQ ID NO: 1892) CCCTGCATGGAAAGGTAAGAAAGT (SEQ ID NO: 1893) hCV9296529 A/G CTCATCCTTAATATTGTTTACTTGTGAT (SEQ ID CTCATCCTTAATATTGTTTACTTGTGAC (SEQ ID NO: 1895 CAAGACAGCCGCCTACAAGA (SEQ ID NO: 1896) NO: 1894 hCV9324316 C/T GCAGGGGTTTCTCACC (SEQ ID NO: 1897) TGCAGGGGTTTCTCACT (SEQ ID NO: 1898) CCCTCCGGCTCAATGTCA (SEQ ID NO: 1899) hCV9326822 C/T CTCGGGACCAGTCCAG (SEQ ID NO: 1900) CTCGGGACCAGTCCAA (SEQ ID NO: 1901) CCGACAGCCGAGGAGA (SEQ ID NO: 1902) hCV945276 G/T CGCCACAAACACATACCTG (SEQ ID NO: 1903) CGCCACAAACACATACCTT (SEQ ID NO: 1904) CCGCTGCTTGGAACAG (SEQ ID NO: 1905) hCV9473891 C/T AGACTTTGATGCCAACGAG (SEQ ID NO: 1906) CAGACTTTGATGCCAACGAA (SEQ ID NO: 1907) CCAAGCACATTTATTGAGCACTCAA (SEQ ID NO: 1908) hDV70959216 G/T CAAACAGTGATGCAAATCAATTTC (SEQ ID ACAAACAGTGATGCAAATCAATTTA (SEQ ID NO: 1910) GAAGGGGGACGAAGAAGCTAGAA (SEQ ID NO: 1911) NO: 1909) hDV77718013 C/T GGGACCCTATAGGAGCTTC (SEQ ID NO: 1912) GGGACCCTATAGGAGCTTT (SEQ ID NO: 1913) TCATTCTTGGGGGAGAGGCTATTC (SEQ ID NO: 1914)
TABLE-US-00002 TABLE 4 Interrogated SNP Interrogated rs LD SNP LD SNP rs Power Threshold r.sup.2 r.sup.2 hCV11548152 rs11580249 hCV30715059 rs12137135 0.51 0.477953358 0.4781 hCV11548152 rs11580249 hCV31574252 rs12128312 0.51 0.477953358 0.6764 hCV11738775 rs6754561 hCV27153776 rs10164837 0.51 0.66106443 0.8444 hCV11738775 rs6754561 hCV3232568 rs3795880 0.51 0.66106443 0.8552 hCV11758801 rs11841997 hCV30023295 rs9591381 0.51 0.58648249 1 hCV1408483 rs17070848 hCV1408479 rs12961976 0.51 0.685992147 0.8832 hCV1408483 rs17070848 hCV1408480 rs11663275 0.51 0.685992147 0.8379 hCV1408483 rs17070848 hCV1408481 rs11152374 0.51 0.685992147 0.8946 hCV1408483 rs17070848 hCV1408515 rs12967026 0.51 0.685992147 0.7306 hCV1408483 rs17070848 hCV29202466 rs7234941 0.51 0.685992147 0.8379 hCV1408483 rs17070848 hCV31494763 rs7242542 0.51 0.685992147 0.9429 hCV1408483 rs17070848 hCV31494861 rs12970840 0.51 0.685992147 0.8379 hCV15857769 rs2924914 hCV1379455 rs2942805 0.51 0.948384617 1 hCV15857769 rs2924914 hCV1379456 rs2978341 0.51 0.948384617 1 hCV15857769 rs2924914 hCV15857755 rs2924920 0.51 0.948384617 0.9584 hCV15857769 rs2924914 hCV15857780 rs2924912 0.51 0.948384617 0.9584 hCV15857769 rs2924914 hCV15878591 rs2978339 0.51 0.948384617 0.9594 hCV15857769 rs2924914 hCV15878604 rs2978352 0.51 0.948384617 0.9594 hCV15857769 rs2924914 hCV16167752 rs2930285 0.51 0.948384617 1 hCV15857769 rs2924914 hCV27184738 rs2942808 0.51 0.948384617 1 hCV15857769 rs2924914 hCV29765690 rs9644266 0.51 0.948384617 0.9582 hCV15879601 rs2275769 hCV11396361 rs9370261 0.51 0.394289193 0.6541 hCV15879601 rs2275769 hCV15879602 rs2275770 0.51 0.394289193 1 hCV15879601 rs2275769 hCV16113165 rs2792634 0.51 0.394289193 1 hCV15879601 rs2275769 hCV2140762 rs2792638 0.51 0.394289193 1 hCV15879601 rs2275769 hCV2140766 rs1340667 0.51 0.394289193 1 hCV15879601 rs2275769 hCV2140769 rs1150875 0.51 0.394289193 1 hCV15879601 rs2275769 hCV2140770 rs2792635 0.51 0.394289193 1 hCV15879601 rs2275769 hCV2140772 rs11963558 0.51 0.394289193 1 hCV15879601 rs2275769 hCV25929027 rs6934690 0.51 0.394289193 1 hCV15879601 rs2275769 hCV25930618 rs10484648 0.51 0.394289193 1 hCV15879601 rs2275769 hCV26548331 rs2145761 0.51 0.394289193 1 hCV15879601 rs2275769 hCV26548343 rs2754795 0.51 0.394289193 1 hCV15879601 rs2275769 hCV26548347 rs2754798 0.51 0.394289193 1 hCV15879601 rs2275769 hCV29161504 rs6914051 0.51 0.394289193 0.5561 hCV15879601 rs2275769 hCV29161551 rs6924913 0.51 0.394289193 1 hCV15879601 rs2275769 hCV29649198 rs9885975 0.51 0.394289193 1 hCV15879601 rs2275769 hCV29649199 rs9474772 0.51 0.394289193 1 hCV15879601 rs2275769 hCV29667033 rs9474754 0.51 0.394289193 1 hCV15879601 rs2275769 hCV29703373 rs9474766 0.51 0.394289193 1 hCV15879601 rs2275769 hCV29703374 rs9283919 0.51 0.394289193 1 hCV15879601 rs2275769 hCV29721486 rs9370254 0.51 0.394289193 0.5549 hCV15879601 rs2275769 hCV29721492 rs9474762 0.51 0.394289193 1 hCV15879601 rs2275769 hCV29811423 rs10484647 0.51 0.394289193 1 hCV15879601 rs2275769 hCV29902056 rs9464034 0.51 0.394289193 1 hCV15879601 rs2275769 hCV30082095 rs9357788 0.51 0.394289193 0.5896 hCV15879601 rs2275769 hCV30136287 rs9367551 0.51 0.394289193 0.5567 hCV15879601 rs2275769 hCV30154225 rs10155669 0.51 0.394289193 1 hCV15879601 rs2275769 hCV30190199 rs9474748 0.51 0.394289193 0.7432 hCV15879601 rs2275769 hCV30225881 rs9370259 0.51 0.394289193 0.5567 hCV15879601 rs2275769 hCV30225882 rs9283918 0.51 0.394289193 0.5567 hCV15879601 rs2275769 hCV30298175 rs9382281 0.51 0.394289193 0.5567 hCV15879601 rs2275769 hCV30298180 rs10080252 0.51 0.394289193 1 hCV15879601 rs2275769 hCV30370722 rs9942457 0.51 0.394289193 1 hCV15879601 rs2275769 hCV30370723 rs9474771 0.51 0.394289193 1 hCV15879601 rs2275769 hCV30388486 rs9382285 0.51 0.394289193 0.6552 hCV15879601 rs2275769 hCV30424487 rs9296737 0.51 0.394289193 0.5553 hCV15879601 rs2275769 hCV30514288 rs10484649 0.51 0.394289193 1 hCV15879601 rs2275769 hCV30586618 rs4329099 0.51 0.394289193 1 hCV15879601 rs2275769 hCV31341134 rs10948793 0.51 0.394289193 0.5567 hCV15879601 rs2275769 hCV31341182 rs11969948 0.51 0.394289193 1 hCV15879601 rs2275769 hCV31341185 rs9474746 0.51 0.394289193 1 hCV15879601 rs2275769 hCV31341188 rs6905950 0.51 0.394289193 1 hCV15879601 rs2275769 hCV31341214 rs9474774 0.51 0.394289193 1 hCV15879601 rs2275769 hCV3248104 rs1340664 0.51 0.394289193 1 hCV15879601 rs2275769 hCV3248105 rs7751241 0.51 0.394289193 1 hCV15879601 rs2275769 hCV7807314 rs9382274 0.51 0.394289193 0.5564 hCV15879601 rs2275769 hCV7807316 rs9357783 0.51 0.394289193 0.5567 hCV15879601 rs2275769 hCV7807392 rs9349691 0.51 0.394289193 0.5567 hCV15879601 rs2275769 hCV7807393 rs9349692 0.51 0.394289193 0.6541 hCV15879601 rs2275769 hCV7807402 rs1325821 0.51 0.394289193 0.5567 hCV15879601 rs2275769 hCV7807421 rs9395899 0.51 0.394289193 0.7931 hCV15879601 rs2275769 hCV7807440 rs12662586 0.51 0.394289193 0.7931 hCV15879601 rs2275769 hCV8767722 rs1342831 0.51 0.394289193 1 hCV15879601 rs2275769 hCV8768817 rs1325833 0.51 0.394289193 0.5567 hCV15879601 rs2275769 hCV8768819 rs991199 0.51 0.394289193 0.5564 hCV15879601 rs2275769 hCV8768954 rs1150884 0.51 0.394289193 1 hCV15879601 rs2275769 hCV8768992 rs1299293 0.51 0.394289193 1 hCV15879601 rs2275769 hCV8769017 rs1150874 0.51 0.394289193 1 hCV15879601 rs2275769 hCV8769025 rs1340665 0.51 0.394289193 1 hCV15879601 rs2275769 hDV70700190 rs16869492 0.51 0.394289193 1 hCV15879601 rs2275769 hDV70710884 rs16884761 0.51 0.394289193 1 hCV15879601 rs2275769 hDV70711006 rs16884943 0.51 0.394289193 1 hCV15879601 rs2275769 hDV70711009 rs16884946 0.51 0.394289193 1 hCV15879601 rs2275769 hDV70711130 rs16885091 0.51 0.394289193 1 hCV15879601 rs2275769 hDV71001425 rs17755375 0.51 0.394289193 1 hCV15879601 rs2275769 hDV77036921 rs4715443 0.51 0.394289193 0.7436 hCV16134786 rs2857595 hCV15896673 rs2596430 0.51 0.570810789 0.6215 hCV16134786 rs2857595 hCV26778946 rs2734583 0.51 0.570810789 0.6706 hCV16134786 rs2857595 hCV27300892 rs2922994 0.51 0.570810789 0.6198 hCV16134786 rs2857595 hCV27300895 rs2156874 0.51 0.570810789 0.6215 hCV16134786 rs2857595 hCV27301030 rs2844531 0.51 0.570810789 0.5926 hCV16134786 rs2857595 hCV27301032 rs2596565 0.51 0.570810789 0.6215 hCV16134786 rs2857595 hCV27452303 rs3094005 0.51 0.570810789 0.6706 hCV16134786 rs2857595 hCV27455402 rs3099844 0.51 0.570810789 0.6706 hCV16134786 rs2857595 hCV27462380 rs3130614 0.51 0.570810789 0.6592 hCV16134786 rs2857595 hCV27463679 rs3132472 0.51 0.570810789 0.6706 hCV16134786 rs2857595 hCV30109416 rs4143332 0.51 0.570810789 0.6084 hCV16134786 rs2857595 hCV30127488 rs3132473 0.51 0.570810789 0.7159 hCV16134786 rs2857595 hCV30319025 rs3093988 0.51 0.570810789 0.95 hCV16134786 rs2857595 hCV30589567 rs3093975 0.51 0.570810789 0.9498 hCV16134786 rs2857595 hCV50000055 rs1800629 0.51 0.570810789 0.8562 hCV16134786 rs2857595 hDV75435585 rs3134792 0.51 0.570810789 0.6582 hCV16336 rs362277 hCV1084102 rs363141 0.51 0.668699498 0.83 hCV16336 rs362277 hCV1084108 rs363100 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV1084110 rs363101 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV1084117 rs363106 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV11764409 rs6834455 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV11764411 rs6843895 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV2229297 rs362303 0.51 0.668699498 0.6732 hCV16336 rs362277 hCV2229306 rs362310 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV2231776 rs363091 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV2231787 rs363124 0.51 0.668699498 0.8176 hCV16336 rs362277 hCV2231788 rs363125 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV2231789 rs363093 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV2231797 rs363095 0.51 0.668699498 0.8023 hCV16336 rs362277 hCV2231805 rs363097 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV2231808 rs363098 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV2231925 rs362274 0.51 0.668699498 0.8911 hCV16336 rs362277 hCV2231935 rs362276 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV2231937 rs362323 0.51 0.668699498 0.8486 hCV16336 rs362277 hCV2231938 rs362325 0.51 0.668699498 1 hCV16336 rs362277 hCV2231953 rs362338 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV2484952 rs363094 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV29284939 rs6839081 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV29284940 rs6446725 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV29284943 rs6839274 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV29726333 rs10021254 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV29816351 rs10155264 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV30627341 rs10488840 0.51 0.668699498 0.7513 hCV16336 rs362277 hCV31758114 rs7688390 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV3266236 rs7654034 0.51 0.668699498 0.8413 hCV16336 rs362277 hCV3266250 rs7665816 0.51 0.668699498 0.8413 hCV16336 rs362277 hDV70681393 rs16844026 0.51 0.668699498 0.8413 hCV16336 rs362277 hDV70681394 rs16844028 0.51 0.668699498 0.8413 hCV16336 rs362277 hDV71057631 rs7683309 0.51 0.668699498 0.8294 hCV1958451 rs2985822 hCV11288054 rs3008858 0.51 0.59989501 1 hCV1958451 rs2985822 hCV11288055 rs1886686 0.51 0.59989501 1 hCV1958451 rs2985822 hCV11728590 rs2065002 0.51 0.59989501 0.6298 hCV1958451 rs2985822 hCV11731325 rs1925411 0.51 0.59989501 1 hCV1958451 rs2985822 hCV118052 rs6673462 0.51 0.59989501 0.9559 hCV1958451 rs2985822 hCV11863077 rs12137403 0.51 0.59989501 1 hCV1958451 rs2985822 hCV11864627 rs4620509 0.51 0.59989501 1 hCV1958451 rs2985822 hCV11864638 rs4486425 0.51 0.59989501 0.6247 hCV1958451 rs2985822 hCV12102654 rs1925413 0.51 0.59989501 1 hCV1958451 rs2985822 hCV1464018 rs2985826 0.51 0.59989501 1 hCV1958451 rs2985822 hCV1464019 rs2985825 0.51 0.59989501 1 hCV1958451 rs2985822 hCV15755638 rs3008853 0.51 0.59989501 1 hCV1958451 rs2985822 hCV15755654 rs3008871 0.51 0.59989501 1 hCV1958451 rs2985822 hCV16119992 rs2815349 0.51 0.59989501 0.6298 hCV1958451 rs2985822 hCV16120003 rs2815359 0.51 0.59989501 1 hCV1958451 rs2985822 hCV16120009 rs2815361 0.51 0.59989501 1 hCV1958451 rs2985822 hCV16120017 rs2815370 0.51 0.59989501 1 hCV1958451 rs2985822 hCV16120018 rs2815371 0.51 0.59989501 1 hCV1958451 rs2985822 hCV16186149 rs2985797 0.51 0.59989501 1 hCV1958451 rs2985822 hCV16186183 rs2182143 0.51 0.59989501 1 hCV1958451 rs2985822 hCV16186204 rs2985821 0.51 0.59989501 1 hCV1958451 rs2985822 hCV16186205 rs2985824 0.51 0.59989501 1 hCV1958451 rs2985822 hCV16286251 rs2755256 0.51 0.59989501 1 hCV1958451 rs2985822 hCV1958424 rs1925408 0.51 0.59989501 1 hCV1958451 rs2985822 hCV1958425 rs1925409 0.51 0.59989501 0.6298 hCV1958451 rs2985822 hCV1958426 rs1925410 0.51 0.59989501 0.6141 hCV1958451 rs2985822 hCV1958427 rs1118392 0.51 0.59989501 0.6632 hCV1958451 rs2985822 hCV1958436 rs3008854 0.51 0.59989501 1 hCV1958451 rs2985822 hCV1958439 rs4655658 0.51 0.59989501 1 hCV1958451 rs2985822 hCV1958440 rs3736905 0.51 0.59989501 0.6247 hCV1958451 rs2985822 hCV1958441 rs3929738 0.51 0.59989501 0.6298 hCV1958451 rs2985822 hCV1958444 rs2985818 0.51 0.59989501 1 hCV1958451 rs2985822 hCV1958449 rs1570838 0.51 0.59989501 0.6298 hCV1958451 rs2985822 hCV1958456 rs10789219 0.51 0.59989501 0.6298 hCV1958451 rs2985822 hCV1958457 rs2025608 0.51 0.59989501 1 hCV1958451 rs2985822 hCV2142099 rs2065000 0.51 0.59989501 1 hCV1958451 rs2985822 hCV2142100 rs2755253 0.51 0.59989501 0.9196 hCV1958451 rs2985822 hCV2142101 rs2755254 0.51 0.59989501 0.6247 hCV1958451 rs2985822 hCV2142106 rs2755271 0.51 0.59989501 0.6182 hCV1958451 rs2985822 hCV2142112 rs2815351 0.51 0.59989501 1 hCV1958451 rs2985822 hCV2142114 rs2755242 0.51 0.59989501 0.6379 hCV1958451 rs2985822 hCV2142122 rs2755244 0.51 0.59989501 1 hCV1958451 rs2985822 hCV2142125 rs2065001 0.51 0.59989501 1 hCV1958451 rs2985822 hCV2142126 rs2755245 0.51 0.59989501 1 hCV1958451 rs2985822 hCV2142127 rs2755246 0.51 0.59989501 1 hCV1958451 rs2985822 hCV2142133 rs2815360 0.51 0.59989501 0.6273 hCV1958451 rs2985822 hCV2142134 rs2755250 0.51 0.59989501 1 hCV1958451 rs2985822 hCV2142135 rs2755251 0.51 0.59989501 0.6298 hCV1958451 rs2985822 hCV2142137 rs2815363 0.51 0.59989501 0.6467 hCV1958451 rs2985822 hCV2142138 rs1535365 0.51 0.59989501 0.6298 hCV1958451 rs2985822 hCV2142160 rs2815380 0.51 0.59989501 0.7025 hCV1958451 rs2985822 hCV2142162 rs1024229 0.51 0.59989501 0.7254 hCV1958451 rs2985822 hCV2142163 rs1024230 0.51 0.59989501 0.7254 hCV1958451 rs2985822 hCV2142165 rs2208577 0.51 0.59989501 0.6618 hCV1958451 rs2985822 hCV26465724 rs12044278 0.51 0.59989501 1 hCV1958451 rs2985822 hCV26465735 rs12131222 0.51 0.59989501 1 hCV1958451 rs2985822 hCV27868373 rs4582760 0.51 0.59989501 0.6141 hCV1958451 rs2985822 hCV27996044 rs4655662 0.51 0.59989501 0.6298 hCV1958451 rs2985822 hCV287782 rs11208979 0.51 0.59989501 1 hCV1958451 rs2985822 hCV30441499 rs4655663 0.51 0.59989501 1 hCV1958451 rs2985822 hCV3144208 rs912797 0.51 0.59989501 1 hCV1958451 rs2985822 hCV3144211 rs2985794 0.51 0.59989501 1 hCV1958451 rs2985822 hCV3144213 rs3008873 0.51 0.59989501 1 hCV1958451 rs2985822 hCV3144214 rs2985795 0.51 0.59989501 1 hCV1958451 rs2985822 hCV79872 rs12132532 0.51 0.59989501 1 hCV1958451 rs2985822 hCV92092 rs12041926 0.51 0.59989501 1 hCV1958451 rs2985822 hCV9510886 rs1137656 0.51 0.59989501 1 hCV1958451 rs2985822 hDV70961073 rs17497828 0.51 0.59989501 1 hCV2121658 rs1187332 hCV1050736 rs726433 0.51 0.493100715 0.8585 hCV2121658 rs1187332 hCV1050741 rs1001904 0.51 0.493100715 0.7897 hCV2121658 rs1187332 hCV1050742 rs1001905 0.51 0.493100715 0.7897 hCV2121658 rs1187332 hCV11868553 rs2378669 0.51 0.493100715 0.914 hCV2121658 rs1187332 hCV11930968 rs1837305 0.51 0.493100715 0.7769 hCV2121658 rs1187332 hCV16035227 rs2579375 0.51 0.493100715 0.7769 hCV2121658 rs1187332 hCV16094752 rs2378670 0.51 0.493100715 1 hCV2121658 rs1187332 hCV16094754 rs2799484 0.51 0.493100715 1 hCV2121658 rs1187332 hCV2121649 rs17087514 0.51 0.493100715 1 hCV2121658 rs1187332 hCV2121666 rs1187326 0.51 0.493100715 0.5394 hCV2121658 rs1187332 hCV26567602 rs17087497 0.51 0.493100715 1 hCV2121658 rs1187332 hCV26567643 rs1187370 0.51 0.493100715 0.5824 hCV2121658 rs1187332 hCV29169653 rs7468983 0.51 0.493100715 0.8585 hCV2121658 rs1187332 hCV29169655 rs7045967 0.51 0.493100715 1 hCV2121658 rs1187332 hCV3237574 rs1211443 0.51 0.493100715 1 hCV2121658 rs1187332 hCV3237587 rs1187333 0.51 0.493100715 1 hCV2121658 rs1187332 hCV3237592 rs1147193 0.51 0.493100715 0.5562 hCV2121658 rs1187332 hCV7423840 rs1443441 0.51 0.493100715 0.5299 hCV2121658 rs1187332 hCV7423871 rs1209068 0.51 0.493100715 0.5284 hCV2121658 rs1187332 hCV7424026 rs1307279 0.51 0.493100715 0.5562 hCV2121658 rs1187332 hCV7424033 rs1659412 0.51 0.493100715 0.7897 hCV2121658 rs1187332 hCV7424042 rs1147198 0.51 0.493100715 0.5562 hCV2121658 rs1187332 hCV7424057 rs1147195 0.51 0.493100715 0.7897 hCV2121658 rs1187332 hCV7424077 rs1201364 0.51 0.493100715 0.7897 hCV2121658 rs1187332 hCV7424082 rs1659415 0.51 0.493100715 1 hCV2121658 rs1187332 hCV7424093 rs1147190 0.51 0.493100715 1 hCV2121658 rs1187332 hCV7424099 rs1332894 0.51 0.493100715 1 hCV2121658 rs1187332 hCV7424100 rs1332893 0.51 0.493100715 0.8585 hCV2121658 rs1187332 hDV70859017 rs17087470 0.51 0.493100715 0.8585 hCV2121658 rs1187332 hDV70859019 rs17087472 0.51 0.493100715 0.8585 hCV2121658 rs1187332 hDV70859037 rs17087496 0.51 0.493100715 1 hCV2358247 rs415989 hCV26338105 rs1013561 0.51 0.799037114 1 hCV2358247 rs415989 hCV29881294 rs6073814 0.51 0.799037114 0.826 hCV2358247 rs415989 hCV30007459 rs10485460 0.51 0.799037114 1 hCV2358247 rs415989 hCV7499352 rs1516579 0.51 0.799037114 1 hCV2358247 rs415989 hDV70786842 rs16990761 0.51 0.799037114 1 hCV2358247 rs415989 hDV72026194 rs800683 0.51 0.799037114 1 hCV2390937 rs739719 hCV2390936 rs739718 0.51 0.633865259 1 hCV25473186 rs2880415 hCV11313256 rs1947069 0.51 0.877072532 1 hCV25473186 rs2880415 hCV11313258 rs1947067 0.51 0.877072532 1 hCV25473186 rs2880415 hCV16209365 rs2342652 0.51 0.877072532 1 hCV25473186 rs2880415 hCV26159412 rs2342653 0.51 0.877072532 1 hCV25473186 rs2880415 hCV29013151 rs7688639 0.51 0.877072532 1 hCV25473186 rs2880415 hCV29987400 rs4234915 0.51 0.877072532 1 hCV25473186 rs2880415 hCV30852132 rs7673498 0.51 0.877072532 1 hCV25473186 rs2880415 hCV7427258 rs1047214 0.51 0.877072532 1 hCV25473186 rs2880415 hCV7428282 rs1444792 0.51 0.877072532 1 hCV25473186 rs2880415 hCV7428284 rs1444799 0.51 0.877072532 1 hCV25596936 rs6967117 hCV25596967 rs7800937 0.51 0.9709961 1 hCV25596936 rs6967117 hCV485060 rs1804527 0.51 0.9709961 1 hCV25983294 rs3739709 hCV1316797 rs1043128 0.51 0.483483129 0.9447 hCV25983294 rs3739709 hCV1316809 rs12555590 0.51 0.483483129 0.8857 hCV25983294 rs3739709 hCV27503139 rs3936868 0.51 0.483483129 0.7051 hCV25983294 rs3739709 hCV27883057 rs4978964 0.51 0.483483129 0.5049 hCV25983294 rs3739709 hCV31956059 rs10980596 0.51 0.483483129 0.5434 hCV25983294 rs3739709 hCV31956067 rs10980602 0.51 0.483483129 0.6012 hCV25983294 rs3739709 hCV31956070 rs10980605 0.51 0.483483129 0.6847 hCV25983294 rs3739709 hCV31956071 rs10980607 0.51 0.483483129 0.898 hCV25983294 rs3739709 hCV31956076 rs10817101 0.51 0.483483129 0.6835 hCV25983294 rs3739709 hCV31959065 rs10980575 0.51 0.483483129 0.7051 hCV25983294 rs3739709 hCV613577 rs551517 0.51 0.483483129 0.6445 hCV25983294 rs3739709 hCV8780367 rs1061548 0.51 0.483483129 1 hCV2637554 rs3205421 hCV11704313 rs2041149 0.51 0.586104829 0.706 hCV2637554 rs3205421 hCV11704321 rs1811338 0.51 0.586104829 0.6624 hCV2637554 rs3205421 hCV2411030 rs741645 0.51 0.586104829 1 hCV2637554 rs3205421 hCV2637556 rs2041150 0.51 0.586104829 0.5966 hCV2637554 rs3205421 hCV2637560 rs9669539 0.51 0.586104829 1 hCV2637554 rs3205421 hCV2637565 rs10860779 0.51 0.586104829 1 hCV2637554 rs3205421 hCV2637574 rs730013 0.51 0.586104829 0.6624 hCV2637554 rs3205421 hCV2637576 rs3817305 0.51 0.586104829 1 hCV2637554 rs3205421 hCV2637583 rs4764813 0.51 0.586104829 1 hCV2637554 rs3205421 hCV2637585 rs10492085 0.51 0.586104829 0.6624 hCV2637554 rs3205421 hCV27278316 rs10778146 0.51 0.586104829 0.6395 hCV2637554 rs3205421 hCV27480555 rs3764973 0.51 0.586104829 0.7373 hCV2637554 rs3205421 hCV2905213 rs11832844 0.51 0.586104829 0.7378 hCV2637554 rs3205421 hCV29407507 rs7957655 0.51 0.586104829 0.6624 hCV2637554 rs3205421 hCV29407514 rs7960795 0.51 0.586104829 0.7391 hCV2637554 rs3205421 hCV29407573 rs7965541 0.51 0.586104829 0.7373 hCV2637554 rs3205421 hCV32176762 rs7135472 0.51 0.586104829 0.7602 hCV2637554 rs3205421 hCV32176795 rs4764814 0.51 0.586104829 0.6624 hCV2637554 rs3205421 hCV8698769 rs919214 0.51 0.586104829 0.6391 hCV26478797 rs2015018 hCV2553995 rs10057898 0.51 0.783014529 0.8829 hCV26478797 rs2015018 hCV2554001 rs6861345 0.51 0.783014529 0.8487 hCV26478797 rs2015018 hCV2554006 rs1557759 0.51 0.783014529 0.8487 hCV26478797 rs2015018 hCV2557450 rs42250 0.51 0.783014529 1 hCV26478797 rs2015018 hCV29134287 rs6878107 0.51 0.783014529 0.7886 hCV26478797 rs2015018 hCV30441646 rs6883532 0.51 0.783014529 0.8098 hCV27473671 rs3750465 hCV11265714 rs12686736 0.51 0.86047945 1 hCV27473671 rs3750465 hCV15849807 rs2900481 0.51 0.86047945 0.962 hCV27473671 rs3750465 hCV15961264 rs2271878 0.51 0.86047945 0.962 hCV27473671 rs3750465 hCV1751510 rs11789624 0.51 0.86047945 0.9259 hCV27473671 rs3750465 hCV1751522 rs11792861 0.51 0.86047945 0.9259 hCV27473671 rs3750465 hCV1751524 rs10512391 0.51 0.86047945 0.962 hCV27473671 rs3750465 hCV1751537 rs11788825 0.51 0.86047945 0.962 hCV27473671 rs3750465 hCV1751538 rs11794648 0.51 0.86047945 0.9259 hCV27473671 rs3750465 hCV1751568 rs11788904 0.51 0.86047945 0.9207 hCV27473671 rs3750465 hCV1751573 rs7870597 0.51 0.86047945 0.962 hCV27473671 rs3750465 hCV25805845 rs3750451 0.51 0.86047945 0.962 hCV27473671 rs3750465 hCV27507261 rs3829084 0.51 0.86047945 0.9259 hCV27473671 rs3750465 hCV27511474 rs3750454 0.51 0.86047945 0.922 hCV27473671 rs3750465 hCV29343287 rs7855282 0.51 0.86047945 0.962 hCV27473671 rs3750465 hCV29343294 rs7470160 0.51 0.86047945 0.962 hCV27473671 rs3750465 hCV8779898 rs1333344 0.51 0.86047945 0.962 hCV27473671 rs3750465 hDV70967853 rs17552292 0.51 0.86047945 1 hCV27473671 rs3750465 hDV70979148 rs17628095 0.51 0.86047945 1 hCV27473671 rs3750465 hDV70997039 rs17729523 0.51 0.86047945 0.9617 hCV27473671 rs3750465 hDV74776655 rs1044905 0.51 0.86047945 0.962 hCV27494483 rs3748743 hCV12084456 rs1935829 0.51 0.567281167 0.5874 hCV27494483 rs3748743 hCV12085551 rs1994830 0.51 0.567281167 1 hCV27494483 rs3748743 hCV12085641 rs699753 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV12085820 rs815124 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV15752023 rs2995522 0.51 0.567281167 1 hCV27494483 rs3748743 hCV16027831 rs2488452 0.51 0.567281167 1 hCV27494483 rs3748743 hCV16052590 rs1689088 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV16250228 rs2486081 0.51 0.567281167 1 hCV27494483 rs3748743 hCV16250229 rs2486080 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV25763709 rs2488429 0.51 0.567281167 1 hCV27494483 rs3748743 hCV26680298 rs4839049 0.51 0.567281167 0.7078 hCV27494483 rs3748743 hCV26680430 rs2488433 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV26680450 rs2488449 0.51 0.567281167 1 hCV27494483 rs3748743 hCV26681176 rs11810230 0.51 0.567281167 1 hCV27494483 rs3748743 hCV29197202 rs1775518 0.51 0.567281167 1 hCV27494483 rs3748743 hCV29723037 rs1775698 0.51 0.567281167 0.7927 hCV27494483 rs3748743 hCV31476567 rs10923675 0.51 0.567281167 0.6429 hCV27494483 rs3748743 hCV31476715 rs10923964 0.51 0.567281167 0.6807 hCV27494483 rs3748743 hCV31477547 rs10923969 0.51 0.567281167 1 hCV27494483 rs3748743 hCV31477571 rs10923965 0.51 0.567281167 1 hCV27494483 rs3748743 hCV8690513 rs1342718 0.51 0.567281167 1 hCV27494483 rs3748743 hCV8690516 rs1418656 0.51 0.567281167 0.8808 hCV27494483 rs3748743 hCV8690521 rs1767265 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8691661 rs815105 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8691672 rs815107 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8691697 rs815118 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8691711 rs1281540 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8692279 rs1466812 0.51 0.567281167 0.8673 hCV27494483 rs3748743 hCV8692280 rs815102 0.51 0.567281167 0.6071 hCV27494483 rs3748743 hCV8692287 rs864175 0.51 0.567281167 0.7078 hCV27494483 rs3748743 hCV8692304 rs1767259 0.51 0.567281167 1 hCV27494483 rs3748743 hCV8692310 rs1775519 0.51 0.567281167 0.7078 hCV27494483 rs3748743 hCV8692311 rs1767258 0.51 0.567281167 0.7078 hCV27494483 rs3748743 hCV8701061 rs1689087 0.51 0.567281167 0.7498 hCV27494483 rs3748743 hCV8701081 rs1775702 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8701111 rs1281693 0.51 0.567281167 0.642 hCV27494483 rs3748743 hCV8701127 rs1798109 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8701139 rs1798110 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8701140 rs699768 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8701141 rs1689096 0.51 0.567281167 0.8808 hCV27494483 rs3748743 hCV8701148 rs699766 0.51 0.567281167 0.7917 hCV27494483 rs3748743 hCV8701153 rs699765 0.51 0.567281167 0.8668 hCV27494483 rs3748743 hCV8701160 rs699761 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8701179 rs699755 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8701181 rs699754 0.51 0.567281167 1 hCV27494483 rs3748743 hCV8701183 rs699752 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8701197 rs699748 0.51 0.567281167 0.881 hCV27494483 rs3748743 hCV8701213 rs1342719 0.51 0.567281167 0.881 hCV27494483 rs3748743 hDV70820092 rs17034936 0.51 0.567281167 0.867 hCV27494483 rs3748743 hDV70820421 rs17035363 0.51 0.567281167 0.6589 hCV27504565 rs3219489 hCV148812 rs2153608 0.51 0.960429702 1 hCV27504565 rs3219489 hCV16138635 rs2153609 0.51 0.960429702 1 hCV27504565 rs3219489 hCV16154820 rs2185549 0.51 0.960429702 1 hCV27504565 rs3219489 hCV16188158 rs2298018 0.51 0.960429702 1 hCV27504565 rs3219489 hCV27913398 rs4660853 0.51 0.960429702 1 hCV27504565 rs3219489 hCV27967653 rs4660854 0.51 0.960429702 1 hCV27504565 rs3219489 hCV27968738 rs4660849 0.51 0.960429702 1 hCV27504565 rs3219489 hCV27989232 rs4660852 0.51 0.960429702 1 hCV27504565 rs3219489 hCV29054909 rs4520450 0.51 0.960429702 1 hCV27504565 rs3219489 hCV29482894 rs9326141 0.51 0.960429702 1 hCV27504565 rs3219489 hCV29609344 rs9429160 0.51 0.960429702 1 hCV27504565 rs3219489 hCV29681797 rs9429072 0.51 0.960429702 1 hCV27504565 rs3219489 hCV29736116 rs3219472 0.51 0.960429702 1 hCV27504565 rs3219489 hCV30258653 rs9429076 0.51 0.960429702 1 hCV27504565 rs3219489 hCV30456994 rs9429158 0.51 0.960429702 1 hCV27504565 rs3219489 hCV30874754 rs11211101 0.51 0.960429702 1 hCV27504565 rs3219489 hCV32304101 rs4660851 0.51 0.960429702 1 hCV27504565 rs3219489 hCV469305 rs7543428 0.51 0.960429702 1 hCV27504565 rs3219489 hCV519782 rs2492840 0.51 0.960429702 1 hCV27511436 rs3750145 hCV106815 rs11771236 0.51 0.469307594 0.555 hCV27511436 rs3750145 hCV188768 rs10953041 0.51 0.469307594 0.653 hCV27511436 rs3750145 hCV27170501 rs12533378 0.51 0.469307594 0.7892 hCV27511436 rs3750145 hCV2835970 rs12540728 0.51 0.469307594 0.764 hCV27511436 rs3750145 hCV2835987 rs10953044 0.51 0.469307594 0.8598 hCV27511436 rs3750145 hCV29373899 rs7781027 0.51 0.469307594 0.686 hCV27511436 rs3750145 hCV32068681 rs11761729 0.51 0.469307594 0.8598 hCV27511436 rs3750145 hCV8315224 rs1052015 0.51 0.469307594 0.8598 hCV27511436 rs3750145 hDV72086373 rs34899057 0.51 0.469307594 0.8598 hCV2769503 rs4787956 hCV2769507 rs3024685 0.51 0.516261595 0.7057 hCV2769503 rs4787956 hCV8903080 rs1029489 0.51 0.516261595 0.7456 hCV2769503 rs4787956 hCV8903085 rs8832 0.51 0.516261595 0.5477 hCV2769503 rs4787956 hCV8903086 rs1049631 0.51 0.516261595 0.5278 hCV2769503 rs4787956 hDV70776992 rs16976728 0.51 0.516261595 0.7051 hCV27892569 rs4903741 hCV27198279 rs4903749 0.51 0.955713817 1 hCV27892569 rs4903741 hDV71062438 rs8006711 0.51 0.955713817 1 hCV2851380 rs12445805 hCV11667261 rs12446178 0.51 0.45310779 1 hCV2851380 rs12445805 hCV11667266 rs12448204 0.51 0.45310779 1 hCV2851380 rs12445805 hCV1565864 rs12447158 0.51 0.45310779 0.6364 hCV2851380 rs12445805 hCV26981883 rs12447735 0.51 0.45310779 1 hCV2851380 rs12445805 hCV2851355 rs12446298 0.51 0.45310779 1 hCV2851380 rs12445805 hCV2851356 rs12449083 0.51 0.45310779 0.8182 hCV2851380 rs12445805 hCV2851359 rs12446840 0.51 0.45310779 1 hCV2851380 rs12445805 hCV2851368 rs12447812 0.51 0.45310779 1 hCV2851380 rs12445805 hCV29564089 rs9924583 0.51 0.45310779 0.5385 hCV2851380 rs12445805 hCV31815677 rs12446340 0.51 0.45310779 1 hCV2851380 rs12445805 hCV31815680 rs12448935 0.51 0.45310779 1 hCV2851380 rs12445805 hCV31815681 rs12448739 0.51 0.45310779 1 hCV2851380 rs12445805 hCV31815709 rs12927043 0.51 0.45310779 0.5898 hCV29537898 rs6073804 hCV2358247 rs415989 0.51 0.552444046 0.7016 hCV29537898 rs6073804 hCV26338105 rs1013561 0.51 0.552444046 0.7016 hCV29537898 rs6073804 hCV26534413 rs544055 0.51 0.552444046 0.6811 hCV29537898 rs6073804 hCV27947632 rs4812932 0.51 0.552444046 1 hCV29537898 rs6073804 hCV27947633 rs4812930 0.51 0.552444046 1 hCV29537898 rs6073804 hCV27947636 rs4812923 0.51 0.552444046 1 hCV29537898 rs6073804 hCV29610044 rs6073808 0.51 0.552444046 1 hCV29537898 rs6073804 hCV29827054 rs6073795 0.51 0.552444046 1 hCV29537898 rs6073804 hCV29881294 rs6073814 0.51 0.552444046 0.8494 hCV29537898 rs6073804 hCV29899344 rs4812922 0.51 0.552444046 1 hCV29537898 rs6073804 hCV29935270 rs6073796 0.51 0.552444046 1 hCV29537898 rs6073804 hCV30007459 rs10485460 0.51 0.552444046 0.7016 hCV29537898 rs6073804 hCV30133494 rs6073819 0.51 0.552444046 1 hCV29537898 rs6073804 hCV30169599 rs6073794 0.51 0.552444046 1 hCV29537898 rs6073804 hCV30187505 rs6065834 0.51 0.552444046 0.6134 hCV29537898 rs6073804 hCV30241248 rs6073789 0.51 0.552444046 1 hCV29537898 rs6073804 hCV30259333 rs10485458 0.51 0.552444046 1 hCV29537898 rs6073804 hCV30259338 rs6073797 0.51 0.552444046 1 hCV29537898 rs6073804 hCV30277376 rs6073810 0.51 0.552444046 1 hCV29537898 rs6073804 hCV30349417 rs6032347 0.51 0.552444046 0.6134 hCV29537898 rs6073804 hCV30511464 rs6073791 0.51 0.552444046 1 hCV29537898 rs6073804 hCV30529696 rs6073813 0.51 0.552444046 1 hCV29537898 rs6073804 hCV30601833 rs6073793 0.51 0.552444046 1 hCV29537898 rs6073804 hCV30601834 rs6073792 0.51 0.552444046 1 hCV29537898 rs6073804 hCV7499352 rs1516579 0.51 0.552444046 0.7016 hCV29537898 rs6073804 hDV70786611 rs16990423 0.51 0.552444046 1 hCV29537898 rs6073804 hDV70786630 rs16990452 0.51 0.552444046 1 hCV29537898 rs6073804 hDV70786842 rs16990761 0.51 0.552444046 0.7016 hCV29537898 rs6073804 hDV72026194 rs800683 0.51 0.552444046 0.6545 hCV29539757 rs10110659 hCV16018696 rs2116465 0.51 0.486011754 0.5448 hCV29539757 rs10110659 hCV1894171 rs2469505 0.51 0.486011754 0.5448 hCV29539757 rs10110659 hCV1894196 rs9642905 0.51 0.486011754 0.5894 hCV29539757 rs10110659 hCV29774726 rs10108362 0.51 0.486011754 0.8046 hCV29539757 rs10110659 hCV29991301 rs10111409 0.51 0.486011754 0.5523 hCV29539757 rs10110659 hCV30513298 rs9297840 0.51 0.486011754 0.8063 hCV29539757 rs10110659 hCV31233524 rs10956635 0.51 0.486011754 0.6776 hCV29539757 rs10110659 hCV3218376 rs959003 0.51 0.486011754 0.5698 hCV29539757 rs10110659 hDV70983393 rs17652451 0.51 0.486011754 1 hCV302629 rs9284183 hCV11491432 rs7992229 0.51 0.476125719 0.827 hCV302629 rs9284183 hCV11697373 rs7332672 0.51 0.476125719 0.5308 hCV302629 rs9284183 hCV16091979 rs2182885 0.51 0.476125719 0.4929 hCV302629 rs9284183 hCV1619929 rs9300542 0.51 0.476125719 0.901 hCV302629 rs9284183 hCV1619953 rs9517704 0.51 0.476125719 0.9036 hCV302629 rs9284183 hCV1619954 rs912130 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV1619955 rs912131 0.51 0.476125719 0.9036 hCV302629 rs9284183 hCV1619962 rs1923895 0.51 0.476125719 0.9512 hCV302629 rs9284183 hCV2028227 rs9517637 0.51 0.476125719 0.4953 hCV302629 rs9284183 hCV2028228 rs9517638 0.51 0.476125719 0.9512 hCV302629 rs9284183 hCV2028233 rs9517642 0.51 0.476125719 0.8581 hCV302629 rs9284183 hCV2028235 rs9517644 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV2028239 rs11069357 0.51 0.476125719 0.9473 hCV302629 rs9284183 hCV2028241 rs2296860 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV2028245 rs7995524 0.51 0.476125719 0.9496 hCV302629 rs9284183 hCV26560448 rs7983491 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV26560464 rs7335403 0.51 0.476125719 0.8573 hCV302629 rs9284183 hCV2699349 rs7999348 0.51 0.476125719 0.9041 hCV302629 rs9284183 hCV28038226 rs4772201 0.51 0.476125719 0.5153 hCV302629 rs9284183 hCV29166806 rs7999077 0.51 0.476125719 0.4956 hCV302629 rs9284183 hCV2950553 rs7322572 0.51 0.476125719 0.533 hCV302629 rs9284183 hCV3042329 rs4511390 0.51 0.476125719 0.9457 hCV302629 rs9284183 hCV3042331 rs2181502 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV3042333 rs9517686 0.51 0.476125719 1 hCV302629 rs9284183 hCV3042336 rs7339230 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV3042337 rs7338726 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV3042339 rs1887704 0.51 0.476125719 0.7119 hCV302629 rs9284183 hCV31358927 rs9554573 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV31358982 rs11842736 0.51 0.476125719 0.9465 hCV302629 rs9284183 hCV3193760 rs9585021 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV3193775 rs7338177 0.51 0.476125719 0.5308 hCV302629 rs9284183 hCV3193777 rs7139964 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV3193779 rs731955 0.51 0.476125719 0.5137 hCV302629 rs9284183 hCV3193781 rs984477 0.51 0.476125719 0.509 hCV302629 rs9284183 hCV3193783 rs9513584 0.51 0.476125719 0.8558 hCV302629 rs9284183 hCV3193794 rs2296911 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV3193798 rs6491493 0.51 0.476125719 0.9514 hCV302629 rs9284183 hCV8698973 rs927989 0.51 0.476125719 0.8886 hCV302629 rs9284183 hDV70984009 rs17655647 0.51 0.476125719 0.9512 hCV30308202 rs9482985 hCV11200332 rs9492268 0.51 0.712481366 0.7376 hCV30308202 rs9482985 hCV11200405 rs6569582 0.51 0.712481366 1 hCV30308202 rs9482985 hCV11692112 rs1979404 0.51 0.712481366 1 hCV30308202 rs9482985 hCV15796613 rs2448013 0.51 0.712481366 1 hCV30308202 rs9482985 hCV15886692 rs2494937 0.51 0.712481366 1 hCV30308202 rs9482985 hCV15967216 rs2279165 0.51 0.712481366 0.955 hCV30308202 rs9482985 hCV16163318 rs2219787 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889342 rs899350 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889343 rs1478800 0.51 0.712481366 0.7698 hCV30308202 rs9482985 hCV1889344 rs9492240 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889345 rs1382515 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889346 rs2448012 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889347 rs7751112 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889348 rs17056825 0.51 0.712481366 0.8924 hCV30308202 rs9482985 hCV1889349 rs9492243 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889355 rs11751534 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889357 rs11756052 0.51 0.712481366 0.955 hCV30308202 rs9482985 hCV1889358 rs11758207 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889359 rs9492248 0.51 0.712481366 0.9525 hCV30308202 rs9482985 hCV1889367 rs2876021 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889371 rs6925197 0.51 0.712481366 1 hCV30308202 rs9482985 hCV1889378 rs9492271 0.51 0.712481366 0.7467 hCV30308202 rs9482985 hCV1889383 rs265334 0.51 0.712481366 0.7778 hCV30308202 rs9482985 hCV1889389 rs265332 0.51 0.712481366 0.7776 hCV30308202 rs9482985 hCV1889390 rs265380 0.51 0.712481366 0.7778 hCV30308202 rs9482985 hCV26000215 rs17056847 0.51 0.712481366 0.7765 hCV30308202 rs9482985 hCV27442718 rs7744609 0.51 0.712481366 1 hCV30308202 rs9482985 hCV27442721 rs10499150 0.51 0.712481366 1 hCV30308202 rs9482985 hCV27480203 rs3778132 0.51 0.712481366 0.7698 hCV30308202 rs9482985 hCV27480208 rs3778137 0.51 0.712481366 0.7391 hCV30308202 rs9482985 hCV27480211 rs3778141 0.51 0.712481366 0.955 hCV30308202 rs9482985 hCV27499807 rs3778134 0.51 0.712481366 1 hCV30308202 rs9482985 hCV27499808 rs3778135 0.51 0.712481366 1 hCV30308202 rs9482985 hCV29433849 rs6569585 0.51 0.712481366 0.955 hCV30308202 rs9482985 hCV29433859 rs7756786 0.51 0.712481366 1 hCV30308202 rs9482985 hCV29433860 rs7738316 0.51 0.712481366 1 hCV30308202 rs9482985 hCV29496377 rs6569583 0.51 0.712481366 1 hCV30308202 rs9482985 hCV29532686 rs9492262 0.51 0.712481366 0.7698 hCV30308202 rs9482985 hCV30020211 rs9492237 0.51 0.712481366 1 hCV30308202 rs9482985 hCV30056140 rs7748051 0.51 0.712481366 1 hCV30308202 rs9482985 hCV30092368 rs9492241 0.51 0.712481366 1 hCV30308202 rs9482985 hCV30092369 rs6941264 0.51 0.712481366 1 hCV30308202 rs9482985 hCV30110237 rs9492245 0.51 0.712481366 0.955 hCV30308202 rs9482985 hCV30128317 rs9492253 0.51 0.712481366 1 hCV30308202 rs9482985 hCV30182412 rs9482989 0.51 0.712481366 0.9548 hCV30308202 rs9482985 hCV30200320 rs6569584 0.51 0.712481366 0.955 hCV30308202 rs9482985 hCV30308200 rs9492263 0.51 0.712481366 1 hCV30308202 rs9482985 hCV30308204 rs9492238 0.51 0.712481366 0.9537 hCV30308202 rs9482985 hCV30398657 rs9492247 0.51 0.712481366 0.955 hCV30308202 rs9482985 hCV30452477 rs9492265 0.51 0.712481366 1 hCV30308202 rs9482985 hCV30470292 rs9492234 0.51 0.712481366 1 hCV30308202 rs9482985 hCV30506242 rs9492264 0.51 0.712481366 1 hCV30308202 rs9482985 hCV30560754 rs9492254 0.51 0.712481366 1 hCV30308202 rs9482985 hCV30632610 rs7762236 0.51 0.712481366 1 hCV30308202 rs9482985 hCV32245443 rs12210504 0.51 0.712481366 0.7521 hCV30308202 rs9482985 hCV32245454 rs6569586 0.51 0.712481366 1 hCV30308202 rs9482985 hCV32245465 rs12179603 0.51 0.712481366 1 hCV30308202 rs9482985 hCV8922745 rs1478804 0.51 0.712481366 1 hCV30308202 rs9482985 hCV8922746 rs1478803 0.51 0.712481366 1 hCV30308202 rs9482985 hCV8922755 rs1478802 0.51 0.712481366 1 hCV30308202 rs9482985 hCV8922768 rs1478798 0.51 0.712481366 1 hCV30308202 rs9482985 hCV8922785 rs1478793 0.51 0.712481366 1 hCV30308202 rs9482985 hCV8922791 rs1478792 0.51 0.712481366 0.955 hCV30308202 rs9482985 hCV8922793 rs1478808 0.51 0.712481366 0.9509 hCV30308202 rs9482985 hCV923718 rs727183 0.51 0.712481366 1 hCV30308202 rs9482985 hCV923730 rs265361 0.51 0.712481366 0.8035 hCV30308202 rs9482985 hCV923731 rs265360 0.51 0.712481366 0.7371 hCV30308202 rs9482985 hCV923753 rs265382 0.51 0.712481366 0.7778 hCV30308202 rs9482985 hCV923754 rs265381 0.51 0.712481366 0.7778 hCV30308202 rs9482985 hCV923758 rs265388 0.51 0.712481366 0.7778 hCV30308202 rs9482985 hCV923759 rs265387 0.51 0.712481366 0.7778 hCV30308202 rs9482985 hCV923761 rs265385 0.51 0.712481366 0.7778 hCV30308202 rs9482985 hCV923762 rs265384 0.51 0.712481366 0.7778 hCV30308202 rs9482985 hDV70836483 rs17056909 0.51 0.712481366 1 hCV30308202 rs9482985 hDV71969667 rs7767990 0.51 0.712481366 0.955 hCV3054550 rs1559599 hCV11208814 rs4896640 0.51 0.580062034 0.8025 hCV3054550 rs1559599 hCV11208823 rs9403478 0.51 0.580062034 0.83 hCV3054550 rs1559599 hCV1649763 rs11155286 0.51 0.580062034 0.6394 hCV3054550 rs1559599 hCV1649764 rs11155287 0.51 0.580062034 0.6113 hCV3054550 rs1559599 hCV1649774 rs11754096 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV1649776 rs4896633 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV1649777 rs11752523 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV1649778 rs11753048 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV1649779 rs11755477 0.51 0.580062034 0.8476 hCV3054550 rs1559599 hCV1649780 rs4896636 0.51 0.580062034 0.8463 hCV3054550 rs1559599 hCV1649781 rs4896637 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV1649782 rs9496565 0.51 0.580062034 0.8025 hCV3054550 rs1559599 hCV1649784 rs11753012 0.51 0.580062034 0.8481 hCV3054550 rs1559599 hCV1649785 rs967633 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV1649786 rs9376741 0.51 0.580062034 0.8463 hCV3054550 rs1559599 hCV1649787 rs11754065 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV27888181 rs4896650 0.51 0.580062034 1 hCV3054550 rs1559599 hCV27888182 rs4896635 0.51 0.580062034 0.8476 hCV3054550 rs1559599 hCV27888183 rs4896634 0.51 0.580062034 0.8476 hCV3054550 rs1559599 hCV27888184 rs4895606 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV27937623 rs4895607 0.51 0.580062034 0.8476 hCV3054550 rs1559599 hCV28024244 rs4896653 0.51 0.580062034 0.6324 hCV3054550 rs1559599 hCV2867272 rs11758932 0.51 0.580062034 1 hCV3054550 rs1559599 hCV29604750 rs9390074 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV29930123 rs9496561 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV29947932 rs9496594 0.51 0.580062034 0.9498 hCV3054550 rs1559599 hCV30146228 rs9403485 0.51 0.580062034 0.9438 hCV3054550 rs1559599 hCV30217924 rs9399434 0.51 0.580062034 0.6673 hCV3054550 rs1559599 hCV30272167 rs9390075 0.51 0.580062034 0.8476 hCV3054550 rs1559599 hCV30344162 rs9390076 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV30398541 rs9285499 0.51 0.580062034 0.6394 hCV3054550 rs1559599 hCV30524360 rs9403486 0.51 0.580062034 0.9498 hCV3054550 rs1559599 hCV3054531 rs6937858 0.51 0.580062034 0.894 hCV3054550 rs1559599 hCV3054542 rs9399439 0.51 0.580062034 1 hCV3054550 rs1559599 hCV3054556 rs11751030 0.51 0.580062034 1 hCV3054550 rs1559599 hCV32241095 rs11757293 0.51 0.580062034 1 hCV3054550 rs1559599 hCV32241106 rs11753058 0.51 0.580062034 0.8737 hCV3054550 rs1559599 hCV32404557 rs4896632 0.51 0.580062034 0.8482 hCV3054550 rs1559599 hCV7576514 rs9908 0.51 0.580062034 0.95 hCV3054550 rs1559599 hCV9783869 rs4896639 0.51 0.580062034 0.8476 hCV3082219 rs1884833 hCV1781515 rs13218371 0.51 0.822864328 1 hCV3082219 rs1884833 hCV1802750 rs13213246 0.51 0.822864328 0.9393 hCV3082219 rs1884833 hCV1802756 rs13216434 0.51 0.822864328 1 hCV3082219 rs1884833 hCV3082214 rs17208849 0.51 0.822864328 1 hCV3082219 rs1884833 hCV3082227 rs2180621 0.51 0.822864328 1 hCV31137507 rs7660668 hCV11746020 rs1979605 0.51 0.891437139 1 hCV31137507 rs7660668 hCV11746021 rs1979604 0.51 0.891437139 1 hCV31137507 rs7660668 hCV15809632 rs2101476 0.51 0.891437139 1 hCV31137507 rs7660668 hCV16072560 rs2130040 0.51 0.891437139 1 hCV31137507 rs7660668 hCV26406027 rs4336288 0.51 0.891437139 1 hCV31137507 rs7660668 hCV27941642 rs4865012 0.51 0.891437139 1 hCV31137507 rs7660668 hCV29101714 rs6851971 0.51 0.891437139 1 hCV31137507 rs7660668 hCV29101718 rs7665846 0.51 0.891437139 1 hCV31137507 rs7660668 hCV29882171 rs9993599 0.51 0.891437139 1 hCV31137507 rs7660668 hCV30440588 rs6554291 0.51 0.891437139 1 hCV31137507 rs7660668 hCV30494157 rs10012559 0.51 0.891437139 1 hCV31137507 rs7660668 hCV31137533 rs6853506 0.51 0.891437139 1 hCV31137507 rs7660668 hCV31137546 rs11732481 0.51 0.891437139 0.9502 hCV31137507 rs7660668 hCV31137548 rs6554290 0.51 0.891437139 0.9594 hCV31137507 rs7660668 hCV31137562 rs6830728 0.51 0.891437139 1 hCV31137507 rs7660668 hCV31137564 rs6842960 0.51 0.891437139 0.9183 hCV31137507 rs7660668 hCV769774 rs550144 0.51 0.891437139 1 hCV31137507 rs7660668 hCV8746676 rs880358 0.51 0.891437139 1 hCV31137507 rs7660668 hCV8746701 rs6802 0.51 0.891437139 1 hCV31137507 rs7660668 hCV8746719 rs1801260 0.51 0.891437139 1 hCV31137507 rs7660668 hCV8746730 rs11240 0.51 0.891437139 1 hCV31137507 rs7660668 hCV8746755 rs1021307 0.51 0.891437139 1 hCV31137507 rs7660668 hCV8746756 rs1021306 0.51 0.891437139 1 hCV31137507 rs7660668 hCV8746776 rs972446 0.51 0.891437139 1 hCV31137507 rs7660668 hDV70995909 rs17722979 0.51 0.891437139 1 hCV31137507 rs7660668 hDV71005355 rs17776975 0.51 0.891437139 1 hCV31137507 rs7660668 hDV71953492 rs7698022 0.51 0.891437139 1 hCV31137507 rs7660668 hDV75174888 rs17721497 0.51 0.891437139 1 hCV31137507 rs7660668 hDV75209995 rs2070062 0.51 0.891437139 1 hCV31227848 rs11809423 hCV11874240 rs12731266 0.51 0.290800579 0.2996 hCV31227848 rs11809423 hCV15842490 rs2181276 0.51 0.290800579 0.355 hCV31227848 rs11809423 hCV1654102 rs12740722 0.51 0.290800579 0.2996 hCV31227848 rs11809423 hCV3056582 rs12757352 0.51 0.290800579 0.2996 hCV31227848 rs11809423 hDV70662612 rs17363472 0.51 0.290800579 0.2988 hCV31227848 rs11809423 hDV71039510 rs6600383 0.51 0.290800579 0.2996 hCV31705214 rs12804599 hCV107313 rs10833000 0.51 0.618581044 0.8531 hCV31705214 rs12804599 hCV11594063 rs11024880 0.51 0.618581044 0.7562 hCV31705214 rs12804599 hCV1950266 rs11024863 0.51 0.618581044 1 hCV31705214 rs12804599 hCV1950274 rs10833015 0.51 0.618581044 1 hCV31705214 rs12804599 hCV1950287 rs12787111 0.51 0.618581044 1 hCV31705214 rs12804599 hCV29267415 rs7948997 0.51 0.618581044 0.8406 hCV31705214 rs12804599 hCV31705227 rs11024850 0.51 0.618581044 1 hCV31705214 rs12804599 hCV31705248 rs7931749 0.51 0.618581044 0.8479 hCV31705214 rs12804599 hDV74880995 rs10832987 0.51 0.618581044 0.6552 hCV31705214 rs12804599 hDV74888902 rs11024797 0.51 0.618581044 0.8369 hCV31705214 rs12804599 hDV75065597 rs12275926 0.51 0.618581044 0.8191 hCV32160712 rs11079160 hCV11616144 rs11656978 0.51 0.436836227 0.6753 hCV32160712 rs11079160 hCV1388786 rs11079157 0.51 0.436836227 0.6444 hCV32160712 rs11079160 hCV1388790 rs955734 0.51 0.436836227 0.5822 hCV32160712 rs11079160 hCV1388795 rs11651545 0.51 0.436836227 0.7495 hCV32160712 rs11079160 hCV1388815 rs12453442 0.51 0.436836227 0.7267 hCV32160712 rs11079160 hCV1388823 rs9895713 0.51 0.436836227 0.8877 hCV32160712 rs11079160 hCV1388832 rs12453544 0.51 0.436836227 0.8868 hCV32160712 rs11079160 hCV27267033 rs11079158 0.51 0.436836227 0.5822 hCV32160712 rs11079160 hCV29495159 rs9903045 0.51 0.436836227 1 hCV32160712 rs11079160 hCV30379482 rs9895210 0.51 0.436836227 0.8507 hCV32160712 rs11079160 hCV32160720 rs11656169 0.51 0.436836227 0.5822 hCV32160712 rs11079160 hCV32160723 rs11654125 0.51 0.436836227 0.6208 hCV32160712 rs11079160 hCV7595955 rs1465353 0.51 0.436836227 0.7565 hCV32160712 rs11079160 hCV7595964 rs2010671 0.51 0.436836227 1 hCV32160712 rs11079160 hCV8675361 rs7223639 0.51 0.436836227 0.5555 hCV32160712 rs11079160 hDV70999843 rs17746075 0.51 0.436836227 0.942 hCV32160712 rs11079160 hDV70999855 rs17746146 0.51 0.436836227 1 hCV32160712 rs11079160 hDV71012207 rs17818816 0.51 0.436836227 1 hCV454333 rs10916581 hCV31711080 rs10916583 0.51 0.908108083 1 hCV540056 rs346802 hCV31556699 rs12165049 0.51 0.491985177 1 hCV540056 rs346802 hCV540057 rs346801 0.51 0.491985177 1 hCV540056 rs346802 hCV540061 rs346816 0.51 0.491985177 1 hCV540056 rs346802 hCV540062 rs346817 0.51 0.491985177 1 hCV540056 rs346802 hCV540063 rs453116 0.51 0.491985177 1 hCV540056 rs346802 hCV540071 rs443112 0.51 0.491985177 1 hCV540056 rs346802 hCV540074 rs369654 0.51 0.491985177 0.8251 hCV540056 rs346802 hCV7446926 rs495055 0.51 0.491985177 0.6606 hCV7917138 rs9822460 hCV11538341 rs9848078 0.51 0.404318811 0.4871 hCV7917138 rs9822460 hCV11538354 rs11708509 0.51 0.404318811 1 hCV7917138 rs9822460 hCV11556848 rs4857380 0.51 0.404318811 0.9027 hCV7917138 rs9822460 hCV130955 rs9862953 0.51 0.404318811 0.5658 hCV7917138 rs9822460 hCV159392 rs1497530 0.51 0.404318811 1 hCV7917138 rs9822460 hCV246831 rs7640341 0.51 0.404318811 0.6769 hCV7917138 rs9822460 hCV246832 rs7640257 0.51 0.404318811 0.6769 hCV7917138 rs9822460 hCV26005059 rs13093620 0.51 0.404318811 0.6769 hCV7917138 rs9822460 hCV26008835 rs9821488 0.51 0.404318811 0.4212 hCV7917138 rs9822460 hCV26158969 rs4630981 0.51 0.404318811 1 hCV7917138 rs9822460 hCV26158970 rs7616504 0.51 0.404318811 0.4212 hCV7917138 rs9822460 hCV26922520 rs9869161 0.51 0.404318811 0.5455 hCV7917138 rs9822460 hCV26922587 rs13069360 0.51 0.404318811 0.9026 hCV7917138 rs9822460 hCV26922590 rs7646920 0.51 0.404318811 0.6769 hCV7917138 rs9822460 hCV29281482 rs6439825 0.51 0.404318811 0.6202 hCV7917138 rs9822460 hCV29644396 rs9877169 0.51 0.404318811 0.4212 hCV7917138 rs9822460 hCV30212818 rs9826529 0.51 0.404318811 0.6346 hCV7917138 rs9822460 hCV30320887 rs9289589 0.51 0.404318811 0.6346 hCV7917138 rs9822460 hCV362321 rs9847827 0.51 0.404318811 0.4777 hCV7917138 rs9822460 hCV362323 rs13068323 0.51 0.404318811 0.5932 hCV7917138 rs9822460 hCV362326 rs9289587 0.51 0.404318811 0.9027 hCV7917138 rs9822460 hCV362328 rs6799469 0.51 0.404318811 0.9027 hCV7917138 rs9822460 hCV362329 rs9844815 0.51 0.404318811 0.9027 hCV7917138 rs9822460 hCV362331 rs13086478 0.51 0.404318811 0.6305 hCV7917138 rs9822460 hCV362335 rs6439823 0.51 0.404318811 0.6769 hCV7917138 rs9822460 hCV362337 rs7630351 0.51 0.404318811 0.6769 hCV7917138 rs9822460 hCV50572 rs11721164 0.51 0.404318811 0.5526 hCV7917138 rs9822460 hCV50573 rs10433345 0.51 0.404318811 0.5526 hCV7917138 rs9822460 hCV7917329 rs904143 0.51 0.404318811 0.6276 hCV7917138 rs9822460 hDV77184830 rs6796827 0.51 0.404318811 0.6769 hCV7917138 rs9822460 hDV77231044 rs7638805 0.51 0.404318811 0.6769 hCV8147903 rs680014 hCV11785233 rs2460397 0.51 0.400661237 1 hCV8147903 rs680014 hCV11788458 rs2460386 0.51 0.400661237 1 hCV8147903 rs680014 hCV11788468 rs553352 0.51 0.400661237 1 hCV8147903 rs680014 hCV11788533 rs4799084 0.51 0.400661237 0.6566 hCV8147903 rs680014 hCV12091565 rs629084 0.51 0.400661237 0.5434 hCV8147903 rs680014 hCV1731571 rs580675 0.51 0.400661237 1 hCV8147903 rs680014 hCV26871521 rs12605631 0.51 0.400661237 1 hCV8147903 rs680014 hCV2744994 rs2510276 0.51 0.400661237 1 hCV8147903 rs680014 hCV2745000 rs2680752 0.51 0.400661237 1 hCV8147903 rs680014 hCV2745001 rs1788659 0.51 0.400661237 1 hCV8147903 rs680014 hCV27516223 rs3786238 0.51 0.400661237 0.7292 hCV8147903 rs680014 hCV27877725 rs4799077 0.51 0.400661237 0.8788 hCV8147903 rs680014 hCV29779584 rs4799081 0.51 0.400661237 0.9183 hCV8147903 rs680014 hCV3068685 rs3859321 0.51 0.400661237 0.7991 hCV8147903 rs680014 hCV3068718 rs673590 0.51 0.400661237 1 hCV8147903 rs680014 hCV3068726 rs685665 0.51 0.400661237 1 hCV8147903 rs680014 hCV3068731 rs522723 0.51 0.400661237 0.9587 hCV8147903 rs680014 hCV3068735 rs517479 0.51 0.400661237 1 hCV8147903 rs680014 hCV3068736 rs485400 0.51 0.400661237 1 hCV8147903 rs680014 hCV3068738 rs503615 0.51 0.400661237 1 hCV8147903 rs680014 hCV3068739 rs603957 0.51 0.400661237 1 hCV8147903 rs680014 hCV3068757 rs3826573 0.51 0.400661237 0.4225 hCV8147903 rs680014 hCV3068760 rs585571 0.51 0.400661237 0.8509 hCV8147903 rs680014 hCV805999 rs649763 0.51 0.400661237 1 hCV8147903 rs680014 hCV806002 rs681631 0.51 0.400661237 1 hCV8147903 rs680014 hCV806008 rs655609 0.51 0.400661237 0.8402 hCV8147903 rs680014 hCV806012 rs671424 0.51 0.400661237 0.4335 hCV8147903 rs680014 hCV806021 rs618342 0.51 0.400661237 0.4335 hCV8147903 rs680014 hCV8155000 rs605183 0.51 0.400661237 1 hCV8147903 rs680014 hCV8155010 rs570029 0.51 0.400661237 1 hCV8147903 rs680014 hCV8155011 rs589394 0.51 0.400661237 1 hCV8147903 rs680014 hCV8831345 rs529195 0.51 0.400661237 1 hCV8147903 rs680014 hCV8831346 rs1239783 0.51 0.400661237 1 hCV8147903 rs680014 hCV8831352 rs500795 0.51 0.400661237 0.4335 hCV8942032 rs1264352 hCV11196362 rs3129820 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV11690723 rs886424 0.51 0.674510346 0.9461 hCV8942032 rs1264352 hCV15885725 rs2532923 0.51 0.674510346 0.8224 hCV8942032 rs1264352 hCV15947385 rs2233980 0.51 0.674510346 0.7828 hCV8942032 rs1264352 hCV16027870 rs2517578 0.51 0.674510346 0.8297 hCV8942032 rs1264352 hCV2437063 rs3131060 0.51 0.674510346 0.9468 hCV8942032 rs1264352 hCV2437065 rs3129985 0.51 0.674510346 0.9468 hCV8942032 rs1264352 hCV2437122 rs3095337 0.51 0.674510346 0.7947 hCV8942032 rs1264352 hCV2437158 rs2284174 0.51 0.674510346 0.8428 hCV8942032 rs1264352 hCV2452431 rs3132625 0.51 0.674510346 0.6845 hCV8942032 rs1264352 hCV25606044 rs7750641 0.51 0.674510346 0.6923 hCV8942032 rs1264352 hCV25606244 rs3130247 0.51 0.674510346 0.7442 hCV8942032 rs1264352 hCV25966128 rs9262135 0.51 0.674510346 0.7934 hCV8942032 rs1264352 hCV26544258 rs1634726 0.51 0.674510346 0.7745 hCV8942032 rs1264352 hCV26546104 rs8233 0.51 0.674510346 0.7955 hCV8942032 rs1264352 hCV26546345 rs2535332 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV26546351 rs2263298 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV27452306 rs3094032 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27452307 rs3094036 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27452310 rs3094057 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27452312 rs3094061 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27452313 rs3094064 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27452317 rs3094034 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27452321 rs3094031 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27452331 rs3094086 0.51 0.674510346 0.8942 hCV8942032 rs1264352 hCV27452332 rs3094035 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27452369 rs3094127 0.51 0.674510346 0.7955 hCV8942032 rs1264352 hCV27452387 rs3094222 0.51 0.674510346 0.7571 hCV8942032 rs1264352 hCV27452568 rs3094703 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27452590 rs3094717 0.51 0.674510346 0.6845 hCV8942032 rs1264352 hCV27452726 rs3095329 0.51 0.674510346 0.7945 hCV8942032 rs1264352 hCV27452728 rs3095336 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV27452739 rs3095330 0.51 0.674510346 0.8339 hCV8942032 rs1264352 hCV27452751 rs3095338 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV27452792 rs3095153 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV27452821 rs3095340 0.51 0.674510346 0.8428 hCV8942032 rs1264352 hCV27462338 rs3130353 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27462341 rs3130374 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27462390 rs3130660 0.51 0.674510346 0.7934 hCV8942032 rs1264352 hCV27462600 rs3131050 0.51 0.674510346 0.942 hCV8942032 rs1264352 hCV27462601 rs3131064 0.51 0.674510346 0.9485 hCV8942032 rs1264352 hCV27462862 rs3131788 0.51 0.674510346 0.7415 hCV8942032 rs1264352 hCV27462962 rs3129812 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27462963 rs3129815 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27462964 rs3129818 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27462981 rs3129973 0.51 0.674510346 0.8435 hCV8942032 rs1264352 hCV27462982 rs3129984 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV27462996 rs3130123 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27463014 rs3130352 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27463047 rs3130782 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV27463445 rs3131783 0.51 0.674510346 0.7423 hCV8942032 rs1264352 hCV27463454 rs3131934 0.51 0.674510346 0.7955 hCV8942032 rs1264352 hCV27463630 rs3130557 0.51 0.674510346 0.7415 hCV8942032 rs1264352 hCV27463637 rs3130641 0.51 0.674510346 0.942 hCV8942032 rs1264352 hCV27463692 rs3132580 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV27463694 rs3132610 0.51 0.674510346 0.7442 hCV8942032 rs1264352 hCV27463813 rs3131044 0.51 0.674510346 0.9447 hCV8942032 rs1264352 hCV27464298 rs3132600 0.51 0.674510346 0.7998 hCV8942032 rs1264352 hCV27464300 rs3132605 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV27464304 rs3132630 0.51 0.674510346 0.6845 hCV8942032 rs1264352 hCV27464305 rs3132631 0.51 0.674510346 0.6845 hCV8942032 rs1264352 hCV27464307 rs3132645 0.51 0.674510346 0.7345 hCV8942032 rs1264352 hCV27465359 rs3129978 0.51 0.674510346 0.8905 hCV8942032 rs1264352 hCV27465360 rs3129980 0.51 0.674510346 0.942 hCV8942032 rs1264352 hCV27465386 rs3130350 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27465389 rs3130364 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27465407 rs3130544 0.51 0.674510346 0.7218 hCV8942032 rs1264352 hCV27465417 rs3130673 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV27465853 rs3132634 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV27465855 rs3132649 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV29486333 rs3132584 0.51 0.674510346 0.7955 hCV8942032 rs1264352 hCV29504305 rs3094712 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV29522452 rs3095334 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV29540580 rs3094067 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV29558680 rs3132599 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV29594803 rs9262204 0.51 0.674510346 0.9398 hCV8942032 rs1264352 hCV29666963 rs3130363 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV29666973 rs9262130 0.51 0.674510346 0.7768 hCV8942032 rs1264352 hCV29703261 rs3095155 0.51 0.674510346 0.8696 hCV8942032 rs1264352 hCV29721426 rs3132616 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV29775548 rs3132647 0.51 0.674510346 0.6952 hCV8942032 rs1264352 hCV29847742 rs3129809 0.51 0.674510346 0.7345 hCV8942032 rs1264352 hCV29883892 rs3132581 0.51 0.674510346 0.8865 hCV8942032 rs1264352 hCV29992126 rs3094627 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV29992140 rs9262200 0.51 0.674510346 0.9468 hCV8942032 rs1264352 hCV30028026 rs3130372 0.51 0.674510346 0.6845 hCV8942032 rs1264352 hCV30045930 rs3095326 0.51 0.674510346 0.8435 hCV8942032 rs1264352 hCV30045931 rs3131055 0.51 0.674510346 0.8951 hCV8942032 rs1264352 hCV30172261 rs3130365 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV30190135 rs3094621 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV30262083 rs3094050 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV30262102 rs3130665 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV30280013 rs3094024 0.51 0.674510346 0.7442 hCV8942032 rs1264352 hCV30352101 rs3129821 0.51 0.674510346 0.6845 hCV8942032 rs1264352 hCV30424437 rs9262143 0.51 0.674510346 0.7934 hCV8942032 rs1264352 hCV30442461 rs9262141 0.51 0.674510346 0.7768 hCV8942032 rs1264352 hCV30496055 rs3130117 0.51 0.674510346 0.7442 hCV8942032 rs1264352 hCV30622443 rs3129823 0.51 0.674510346 0.6845 hCV8942032 rs1264352 hCV3273752 rs3130370 0.51 0.674510346 0.6845 hCV8942032 rs1264352 hCV7926405 rs3130126 0.51 0.674510346 0.6961 hCV8942032 rs1264352 hCV8692767 rs1264376 0.51 0.674510346 0.9468 hCV8942032 rs1264352 hCV8692768 rs1264377 0.51 0.674510346 0.8951 hCV8942032 rs1264352 hCV8692796 rs1059612 0.51 0.674510346 0.7934 hCV8942032 rs1264352 hCV8692806 rs1064627 0.51 0.674510346 0.7955 hCV8942032 rs1264352 hCV8941738 rs1634721 0.51 0.674510346 0.8435 hCV8942032 rs1264352 hCV8941879 rs1264308 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV8941918 rs1049633 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV8941930 rs886422 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV8941940 rs1264322 0.51 0.674510346 0.8905 hCV8942032 rs1264352 hCV8941988 rs2535340 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV8942006 rs1264341 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV8942015 rs1264347 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV8942025 rs1264349 0.51 0.674510346 0.8946 hCV8942032 rs1264352 hCV8942026 rs1264350 0.51 0.674510346 0.8812 hCV8942032 rs1264352 hCV8942038 rs1264353 0.51 0.674510346 0.9427 hCV8942032 rs1264352 hCV9481170 rs886423 0.51 0.674510346 1 hCV8942032 rs1264352 hDV75255684 rs2517546 0.51 0.674510346 0.6985
TABLE-US-00003 TABLE 5 Baseline Characteristics of ARIC Participants in Ischemic Stroke Study Whites (N = 10401) Blacks(N = 3814) Cases Non-cases Cases Non-cases (N = 275) (N = 10126) (N = 220) (N = 3594) Characteristics Mean (SD) Mean (SD) p-value* Mean (SD) Mean (SD) p-value* Age 57.59 (5.32) 54.10 (5.69) <0.01 55.21 (5.79) 53.25 (5.79) <0.01 Waist-to-hip ratio 0.96 (0.07) 0.92 (0.08) <0.01 0.94 (0.07) 0.92 (0.08) <0.01 N (%) N (%) p-value* N (%) N (%) p-value* Male 162 (59) 4569 (45) <0.01 97 (44) 1318 (37) 0.03 Hypertensive 137 (50) 2516 (25) <0.01 168 (77) 1903 (53) <0.01 Diabetic 55 (20) 799 (8) <0.01 94 (44) 596 (17) <0.01 Smoker 90 (33) 2455 (24) <0.01 81 (37) 1036 (29) 0.01 *p-value represents a comparison between cases and non-cases within an ethnic group
TABLE-US-00004 TABLE 6 SNPs Associated with Incident Ischemic Stroke in the ARIC Study Risk- Risk- raising lowering Model 1.sup.† Model 2.sup.‡ allele allele 95% p- 95% p- Gene Symbol SNP ID Function* (frequency) (frequency) HRR CI value HRR CI value Whites SERPINA9 rs11628722 Nonsynonymous G (0.84) A (0.16) 1.31 1.00-1.70 0.05 1.32 1.02-1.72 0.03 Ala348Val PALLD rs7439293 Intronic A (0.62) G (0.38) 1.24 1.03-1.49 0.02 1.21 1.01-1.46 0.04 IER2 rs1042164 Nonsynonymous T (0.17) C (0.83) 1.38 1.12-1.71 0.003 1.39 1.12-1.72 0.003 Val133Ala Blacks SERPINA9 rs11628722 Nonsynonymous G (0.45) A (0.55) 1.26 1.03-1.53 0.02 1.27 1.04-1.54 0.02 Ala348Val EXOD1 rs3213646 Intronic C (0.16) T (0.84) 1.29 1.01-1.64 0.04 1.29 1.01-1.65 0.04 *First amino acid corresponds to risk raising allele for nonsynonymous SNPs. .sup.†Model 1 was adjusted for age and gender. .sup.‡Model 2 was adjusted for age, gender, waist-to-hip ratio and diabetes, hypertension and smoking status.
TABLE-US-00005 TABLE 7 p-value p-value Risk White (two- Black (two- hCV number rs number Gene Symbol Allele HRR 95% CI sided) HRR 95% CI sided) hCV2091644 rs1010 VAMP8 C 1.16 0.97-1.38 0.1 0.9 0.74-1.10 0.3 hCV25925481 rs11628722 SERPINA9 G 1.31 1.00-1.70 0.05 1.26 1.03-1.53 0.02 hCV323071 rs7439293 PALLD A 1.24 1.03-1.49 0.02 1.2 0.93-1.56 0.16 hCV7425232 rs3900940 MYH15 C 1.18 0.98-1.42 0.08 1.1 0.85-1.43 0.49 hCV9326822 rs1042164 IER2 T 1.38 1.12-1.71 0 0.54 0.27-1.09 0.08 hCV15770510 rs3027309 ALOX12B T 1.17 0.95-1.46 0.14 1.25 0.88-1.77 0.21 hCV9626088 rs943133 LOC391102 A 1.13 0.94-1.36 0.19 1 0.69-1.45 1
TABLE-US-00006 TABLE 8 p-value Gene Risk White (two- Black p-value hCV number rs number Symbol Allele HRR 95% CI sided) HRR 95% CI (two-sided) hCV25924894 rs17090921 SERPINA9 A 1.12 0.93-1.35 0.23 1.19 0.92-1.52 0.18 hCV1690777 rs12684749 NFIB G 0.99 0.64-1.53 0.97 1.68 0.90-3.13 0.1 hCV25925481 rs11628722 SERPINA9 G 1.31 1.00-1.70 0.05 1.26 1.03-1.53 0.02 hCV323071 rs7439293 PALLD A 1.24 1.03-1.49 0.02 1.2 0.93-1.56 0.16 hCV25609987 rs10817479 WDR31 A 0.93 0.65-1.32 0.67 5.15 0.72-36.78 0.1 hCV2192261 rs3213646 EXOD1 C 0.98 0.82-1.17 0.82 1.29 1.01-1.64 0.04
TABLE-US-00007 TABLE 9 p-value Risk White (two- Black p-value hCV number rs number Gene Symbol Allele HRR 95% CI sided) HRR 95% CI (two-sided) hCV25924894 rs17090921 SERPINA9 A 1.12 0.93-1.35 0.23 1.19 0.92-1.52 0.18 hCV25925481 rs11628722 SERPINA9 G 1.31 1.00-1.70 0.05 1.26 1.03-1.53 0.02 hCV323071 rs7439293 PALLD A 1.24 1.03-1.49 0.02 1.2 0.93-1.56 0.16
TABLE-US-00008 TABLE 10 Baseline Characteristics of CHS Participants in Ischemic Stroke Study African Characteristic Whites Americans Number of individuals in this analysis 3849 673 Male 1575 (41) 243 (36) Age, mean (SD), y 72.7 (5.6) 72.9 (5.7) BMI, mean (SD), kg/m.sup.2 26.3 (4.5) 28.5 (5.6) Smoking, current 423 (11) 113 (17) Diabetes 511 (13) 151 (23) Impaired fasting glucose 522 (14) 92 (14) Hypertension 2110 (55) 490 (73) LDL cholesterol, mean (SD), mg/dL 130 (36) 129 (36) HDL cholesterol, mean (SD), mg/dL 54 (16) 58 (15) Total cholesterol, mean (SD), mg/dL 212 (39) 210 (39) Data presented as number of participants (%) unless otherwise indicated.
TABLE-US-00009 TABLE 11 SNPs Associated with Incident Ischemic Stroke in White Participants of CHS Prespecified Risk Allele Gene dbSNP Risk Allele Frequency HR (90% CI)* P HPS1 rs1804689 T 0.30 1.23 (1.09-1.40) 0.003 ITGAE rs220479 C 0.82 1.26 (1.08-1.48) 0.008 ABCG2 rs2231137 C 0.95 1.46 (1.05-2.03) 0.03 MYH15 rs3900940 C 0.29 1.15 (1.02-1.31) 0.03 FSTL4 rs13183672 A 0.76 1.17 (1.01-1.35) 0.04 CALM1 rs3814843 G 0.05 1.31 (1.02-1.68) 0.04 BAT2 rs11538264 G 0.97 1.49 (1.02-2.16) 0.04 *Hazard ratios (HR) are adjusted for baseline age, sex, body mass index, current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol at baseline. Hazard ratios are per copy of the risk allele.
TABLE-US-00010 TABLE 12 SNPs Associated with Incident Ischemic Stroke in African American Participants of CHS Pre- Risk specified Allele Gene dbSNP Risk Allele Frequency HR (90% CI)* P KRT4 rs89962 T 0.11 2.08 (1.48-2.94) <0.001 LY6G5B rs11758242 C 0.89 2.28 (1.20-4.33) 0.02 EDG1 rs2038366 G 0.73 1.59 (1.08-2.35) 0.02 DMXL2 rs12102203 G 0.47 1.40 (1.03-1.90) 0.04 ABCG2 rs2231137 C 0.95 3.59 (1.11-11.7) 0.04 *Hazard ratios (HR) are adjusted for baseline age, sex, body mass index, current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol at baseline. Hazard ratios are per copy of the risk allele.
TABLE-US-00011 TABLE 13 The Val Allele Homozygotes of ABCG2 Val12Met (rs2231137), Compared with the Met Allele Carriers, are Associated With Increased Risk of Incident Ischemic Stroke in Both White and African American Participants of CHS ABCG2 Events Total Model 1* Model 2* Genotype n n HR (90% CI) P HR (90% CI) P White ValVal 370 3398 1.58 (1.12-2.23) 0.02 1.50 (1.06-2.12) 0.03 ValMet + MetMet 24 335 1 (Reference) 1 (Reference) ValMet 23 321 MetMet 1 14 Af. Am. ValVal 66 592 3.80 (1.16-12.4) 0.03 3.62 (1.11-11.9) 0.04 ValMet + MetMet 2 70 1 (Reference) 1 (Reference) ValMet 2 69 MetMet 0 1 *Model 1 was adjusted for baseline age and sex. Model 2 was adjusted for baseline age, sex, body mass index, current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol.
TABLE-US-00012 TABLE 14 HR (90% CI) risk AgeSex p-value gene rs # hCV# allele mode (whites) (whites) CENPE rs2243682 hCV1624173 A dom 1.2 (1.02, 1.42) 0.034 FCRLB rs34868416 hCV25951678 A rec 2.01 (1.07, 3.76) 0.034 FSTL4 rs3749817 hCV25637605 G dom 2.04 (1.2, 3.45) 0.013 HR (90% CI) HR (90% CI) HR (90% CI) Full p-value AgeSex p-value Full p-value gene (whites) (whites) (blacks) (blacks) (blacks) (blacks) CENPE 1.2 (1.01, 1.42) 0.037 .98 (.51, 1.9) 0.517 1.17 (.6, 2.28) 0.352 FCRLB 2.18 (1.16, 4.09) 0.021 1.52 (.84, 2.74) 0.122 1.82 (.97, 3.44) 0.06 FSTL4 2.04 (1.2, 3.46) 0.013 “HR (90% CI) AgeSex” = hazard ratio (with 90% confidence intervals) adjusted for age and sex “HR (90% CI) Full” = hazard ratio (with 90% confidence intervals) fully adjusted for all traditional risk factors including smoking, diabetes, hypertension, HDL-C, LDL-C, and BMI
TABLE-US-00013 TABLE 15 Characteristics of noncardioembolic stroke cases and healthy controls in VSR Cases Controls Characteristics n = 562 n = 815 p Age (SD) 66.0 (14) 58.8 (8.5) <0.0001 Male 326 (58.0) 397 (48.7) 0.0007 Smoking 172 (32.0) 147 (18.7) <0.0001 Hypertension 400 (71.2) 403 (49.5) <0.0001 Diabetes 191 (34.0) 36 (4.4) <0.0001 Dyslipidemia 347 (61.7) 464 (56.9) 0.07 BMI (SD) 26.8 (4.9) 26.0 (3.8) 0.004 Age and BMI are presented as means (standard deviation, SD) Other risk factors are presented as counts (%) having the risk factor
TABLE-US-00014 TABLE 16 Characteristics of six SNPs tested for association with noncardioembolic stroke in VSR. CHD Risk Frequency in Frequency in Gene Allele VSR Controls ARIC Whites* Chrom Loc.sup.† SNP ID SNP Type SNP Source MYH15 C 0.29 0.30 3q13.13 rs3900940 Thr1125Ala Bare et al KIF6 G 0.37 0.36 6p21.2 rs20455 Trp719Arg Bare et al VAMP8 C 0.38 0.42 2p12 rs1010 3′UTR Bare et al Chr9p21 G 0.46 0.49 9p21 rs10757274 Intergenic McPherson et al
TABLE-US-00015 TABLE 17 Adjusted association of six SNPs with noncardioembolic stroke in VSR Locus Case Control Model 1 Model 2 Genotype n (%) n (%) OR (90% CI) p q OR (90% CI) p C9p21 GG + GA 386 (76.7) 568 (72.4) 1.20 (0.95-1.50) 0.10 0.15 1.14 (0.89-1.46) 0.20 GG 139 (27.6) 154 (19.6) 1.59 (1.20-2.11) 0.004 1.45 (1.06-1.98) 0.03 GA 247 (49.1) 414 (52.8) 1.05 (0.82-1.34) 0.38 1.02 (0.78-1.33) 0.45 AA 117 (23.3) 216 (27.6) ref ref KIF6 GG + GA 327 (64.8) 475 (60.7) 1.24 (1.01-1.52) 0.05 0.12 1.23 (0.98-1.54) 0.07 GG 73 (14.5) 102 (13.0) 1.24 (0.91-1.69) 0.13 1.30 (0.93-1.83) 0.10 GA 254 (50.3) 373 (47.7) 1.24 (1.00-1.53) 0.05 1.20 (0.95-1.53) 0.10 AA 178 (35.3) 307 (39.3) ref ref MYH15 CC + CT 281 (55.6) 390 (49.8) 1.31 (1.07-1.60) 0.01 0.06 1.25 (1.00-1.56) 0.05 CC 56 (11.1) 72 (9.2) 1.50 (1.06-2.11) 0.03 1.19 (0.80-1.75) 0.24 CT 225 (44.5) 318 (40.6) 1.27 (1.03-1.56) 0.03 1.26 (1.00-1.59) 0.05 TT 225 (44.5) 394 (50.3) ref ref VAMP8 CC + CT 326 (64.4) 483 (61.6) 1.21 (0.99-1.49) 0.06 0.12 1.33 (1.06-1.67) 0.02 CC 77 (15.2) 112 (14.3) 1.27 (0.93-1.72) 0.10 1.37 (0.98-1.91) 0.06 CT 249 (49.2) 371 (47.3) 1.20 (0.96-1.49) 0.09 1.32 (1.04-1.68) 0.03 TT 180 (35.6) 301 (38.4) ref ref
TABLE-US-00016 TABLE 18 p-value GENO- OR Lower OR Upper (two- SNP Gene OUTCOME ADJUST? MODE TYPE OR 90% CI 90% CI sided) hCV1116793 ZNF132 ISCHEMIC NO GEN TC 0.83 0.69375216 0.992667515 0.0869 hCV1116793 ZNF132 ISCHEMIC NO ADD T 0.84 0.724853655 0.974320962 0.053 hCV1116793 ZNF132 ISCHEMIC NO DOM TC or TT 0.819 0.689223622 0.973935207 0.0578 hCV16093418 LOC646377 ISCHEMIC NO GEN AA 1.483 0.912916828 2.408756165 0.1815 hCV16093418 LOC646377 ISCHEMIC NO ADD A 1.16 0.992191149 1.356678591 0.118 hCV16093418 LOC646377 ISCHEMIC NO DOM AG or AA 1.161 0.968083437 1.392968387 0.1766 hCV1754669 Chr 9 ISCHEMIC NO GEN AG 0.849 0.694898144 1.0380978 0.1806 hCV1754669 Chr 9 ISCHEMIC NO GEN AA 0.704 0.553438026 0.894406866 0.016 hCV1754669 Chr 9 ISCHEMIC NO ADD A 0.839 0.744293003 0.946031417 0.0161 hCV1754669 Chr 9 ISCHEMIC NO DOM AG or AA 0.802 0.663035663 0.970180153 0.0566 hCV1754669 Chr 9 ISCHEMIC NO REC AA 0.785 0.643446754 0.957447873 0.0451 hCV25637605 FSTL4 ISCHEMIC NO DOM AG or AA 1.141 0.96474641 1.349440416 0.1959 hCV26505812 Chr 9 ISCHEMIC NO GEN GG 1.434 1.126756329 1.825140554 0.0139 hCV26505812 Chr 9 ISCHEMIC NO ADD G 1.193 1.057688641 1.345699564 0.0159 hCV26505812 Chr 9 ISCHEMIC NO DOM GA or GG 1.175 0.971230942 1.421611376 0.1636 hCV26505812 Chr 9 ISCHEMIC NO REC GG 1.362 1.115126666 1.663679973 0.0111 hCV7425232 MYH15 ISCHEMIC NO GEN CT 1.207 1.013056501 1.437676114 0.0772 hCV7425232 MYH15 ISCHEMIC NO ADD C 1.138 1.002467038 1.290637136 0.0933 hCV7425232 MYH15 ISCHEMIC NO DOM CT or CC 1.207 1.022059286 1.424442487 0.0628 hCV1116793 ZNF132 ISCHEMIC YES GEN TC 0.703 0.562477582 0.877572242 0.0091 hCV1116793 ZNF132 ISCHEMIC YES ADD T 0.75 0.624608329 0.899631989 0.0093 hCV1116793 ZNF132 ISCHEMIC YES DOM TC or TT 0.701 0.565686919 0.867894166 0.0063 hCV16093418 LOC646377 ISCHEMIC YES GEN AA 1.866 1.045328301 3.330322013 0.0766 hCV16093418 LOC646377 ISCHEMIC YES ADD A 1.162 0.960599702 1.404663117 0.1948 hCV16093418 LOC646377 ISCHEMIC YES REC AA 1.841 1.034539603 3.275411467 0.0815 hCV1754669 Chr 9 ISCHEMIC YES GEN AA 0.76 0.568372651 1.01549685 0.1192 hCV1754669 Chr 9 ISCHEMIC YES ADD A 0.87 0.752699651 1.006107576 0.1151 hCV1754669 Chr 9 ISCHEMIC YES DOM AG or AA 0.805 0.638680148 1.014657888 0.1232 hCV2091644 VAMP8 ISCHEMIC YES GEN CT 1.401 1.120353768 1.751995633 0.0131 hCV2091644 VAMP8 ISCHEMIC YES GEN CC 1.38 1.009559907 1.885674346 0.0901 hCV2091644 VAMP8 ISCHEMIC YES ADD C 1.221 1.052766014 1.416485778 0.0267 hCV2091644 VAMP8 ISCHEMIC YES DOM CT or CC 1.396 1.129256555 1.725713348 0.0096 hCV26505812 Chr 9 ISCHEMIC YES GEN GG 1.388 1.036839351 1.858599041 0.0645 hCV26505812 Chr 9 ISCHEMIC YES ADD G 1.171 1.011727737 1.355459485 0.0756 hCV26505812 Chr 9 ISCHEMIC YES REC GG 1.398 1.096801262 1.782473489 0.0232 hCV945276 KRT5 ISCHEMIC YES REC TT 1.232 0.957897979 1.585681051 0.1725 hCV1116793 ZNF132 ATHERO NO GEN TC 0.787 0.646590569 0.95833488 0.0454 hCV1116793 ZNF132 ATHERO NO ADD T 0.819 0.696165402 0.962297139 0.0419 hCV1116793 ZNF132 ATHERO NO DOM TC or TT 0.784 0.648664594 0.947280056 0.0344 hCV1754669 Chr 9 ATHERO NO GEN AG 0.833 0.670269439 1.034455809 0.165 hCV1754669 Chr 9 ATHERO NO GEN AA 0.676 0.520352663 0.878840811 0.014 hCV1754669 Chr 9 ATHERO NO ADD A 0.823 0.72208458 0.937642062 0.0141 hCV1754669 Chr 9 ATHERO NO DOM AG or AA 0.782 0.636551788 0.960683278 0.0493 hCV1754669 Chr 9 ATHERO NO REC AA 0.764 0.614147286 0.950963593 0.043 hCV26505812 Chr 9 ATHERO NO GEN GG 1.571 1.210420113 2.038944965 0.0044 hCV26505812 Chr 9 ATHERO NO ADD G 1.251 1.097125415 1.426047313 0.005 hCV26505812 Chr 9 ATHERO NO DOM GA or GG 1.218 0.987731875 1.501018684 0.1217 hCV26505812 Chr 9 ATHERO NO REC GG 1.485 1.199236975 1.839906031 0.0024 hCV7425232 MYH15 ATHERO NO GEN CT 1.291 1.06621554 1.562183465 0.028 hCV7425232 MYH15 ATHERO NO GEN CC 1.36 0.995974126 1.856019239 0.1044 hCV7425232 MYH15 ATHERO NO ADD C 1.209 1.05488262 1.385651602 0.0221 hCV7425232 MYH15 ATHERO NO DOM CT or CC 1.304 1.087542975 1.562799868 0.0161 hCV945276 KRT5 ATHERO NO GEN TT 1.226 0.944746161 1.589848931 0.1986 hCV1116793 ZNF132 ATHERO YES GEN TC 0.639 0.501790288 0.814951237 0.0024 hCV1116793 ZNF132 ATHERO YES ADD T 0.698 0.570892416 0.853128157 0.0032 hCV1116793 ZNF132 ATHERO YES DOM TC or TT 0.64 0.507110931 0.808823546 0.0017 hCV16093418 LOC646377 ATHERO YES GEN AA 1.762 0.928367604 3.34386559 0.1459 hCV16093418 LOC646377 ATHERO YES REC AA 1.74 0.920040581 3.292138982 0.1527 hCV1754669 Chr 9 ATHERO YES GEN AA 0.765 0.558483335 1.046582925 0.1596 hCV1754669 Chr 9 ATHERO YES ADD A 0.874 0.746743893 1.022073084 0.1568 hCV2091644 VAMP8 ATHERO YES GEN CT 1.322 1.038739023 1.682015035 0.0569 hCV2091644 VAMP8 ATHERO YES GEN CC 1.366 0.976758835 1.910405456 0.126 hCV2091644 VAMP8 ATHERO YES ADD C 1.2 1.023536718 1.407388698 0.0592 hCV2091644 VAMP8 ATHERO YES DOM CT or CC 1.332 1.06021742 1.673849394 0.0388 hCV26505812 Chr 9 ATHERO YES GEN GG 1.449 1.059805605 1.98082713 0.0512 hCV26505812 Chr 9 ATHERO YES ADD G 1.201 1.025903307 1.405546929 0.056 hCV26505812 Chr 9 ATHERO YES REC GG 1.431 1.106229626 1.851215592 0.022 hCV3054799 KIF6 ATHERO YES ADD G 1.156 0.984174559 1.356831226 0.1385 hCV3054799 KIF6 ATHERO YES DOM GA or GG 1.226 0.976764207 1.538041725 0.1403 hCV323071 PALLD ATHERO YES GEN GA 0.822 0.647104489 1.044405162 0.178 hCV7425232 MYH15 ATHERO YES GEN CT 1.263 1.002774843 1.590469093 0.0961 hCV7425232 MYH15 ATHERO YES ADD C 1.152 0.973983418 1.361464556 0.1655 hCV7425232 MYH15 ATHERO YES DOM CT or CC 1.248 1.002130266 1.555305517 0.0966 hCV1116793 ZNF132 EARLY-ONSET NO GEN TC 0.721 0.555259615 0.93717945 0.0401 hCV1116793 ZNF132 EARLY-ONSET NO ADD T 0.742 0.596550429 0.9231085 0.0246 hCV1116793 ZNF132 EARLY-ONSET NO DOM TC or TT 0.709 0.550475956 0.912444516 0.025 hCV16093418 LOC646377 EARLY-ONSET NO GEN AA 2.279 1.165213696 4.458870577 0.0434 hCV16093418 LOC646377 EARLY-ONSET NO REC AA 2.283 1.172006222 4.448126516 0.0417 hCV1754669 Chr 9 EARLY-ONSET NO GEN AA 0.638 0.449570543 0.904532087 0.0342 hCV1754669 Chr 9 EARLY-ONSET NO ADD A 0.805 0.677020314 0.957005634 0.0392 hCV1754669 Chr 9 EARLY-ONSET NO REC AA 0.657 0.491043284 0.880225636 0.0181 hCV26505812 Chr 9 EARLY-ONSET NO GEN GG 1.454 1.031679957 2.049942 0.0727 hCV26505812 Chr 9 EARLY-ONSET NO ADD G 1.205 1.015074491 1.431092302 0.0737 hCV26505812 Chr 9 EARLY-ONSET NO DOM GA or GG 1.257 0.954270123 1.654681429 0.1722 hCV26505812 Chr 9 EARLY-ONSET NO REC GG 1.308 0.984656431 1.736831541 0.1199 hCV3054799 KIF6 EARLY-ONSET NO GEN GA 1.256 0.968081501 1.629118384 0.1499 hCV3054799 KIF6 EARLY-ONSET NO DOM GA or GG 1.215 0.949308931 1.553982515 0.1942 hCV7425232 MYH15 EARLY-ONSET NO GEN CC 1.411 0.92477899 2.153297741 0.18 hCV7425232 MYH15 EARLY-ONSET NO ADD C 1.188 0.989106766 1.42696955 0.1219 hCV7425232 MYH15 EARLY-ONSET NO DOM CT or CC 1.227 0.964448349 1.560176569 0.1624 hCV1116793 ZNF132 EARLY-ONSET YES GEN TC 0.569 0.383972632 0.843482605 0.0184 hCV1116793 ZNF132 EARLY-ONSET YES GEN TT 0.257 0.07724157 0.857115583 0.0635 hCV1116793 ZNF132 EARLY-ONSET YES ADD T 0.551 0.390357614 0.77793835 0.0045 hCV1116793 ZNF132 EARLY-ONSET YES DOM TC or TT 0.536 0.36534707 0.78765705 0.0076 hCV1116793 ZNF132 EARLY-ONSET YES REC TT 0.312 0.09554036 1.01979997 0.1057 hCV1754669 Chr 9 EARLY-ONSET YES GEN AA 0.531 0.310682745 0.90627091 0.0515 hCV1754669 Chr 9 EARLY-ONSET YES ADD A 0.754 0.582569376 0.975219212 0.071 hCV1754669 Chr 9 EARLY-ONSET YES REC AA 0.471 0.300175493 0.740364979 0.0061 hCV26505812 Chr 9 EARLY-ONSET YES GEN GA 1.613 1.036095685 2.50964297 0.0756 hCV26505812 Chr 9 EARLY-ONSET YES GEN GG 1.607 0.955315621 2.704490393 0.1335 hCV26505812 Chr 9 EARLY-ONSET YES ADD G 1.267 0.980473167 1.638072097 0.129 hCV26505812 Chr 9 EARLY-ONSET YES DOM GA or GG 1.611 1.056911526 2.455300114 0.0627 hCV3054799 KIF6 EARLY-ONSET YES GEN GA 1.469 0.997042382 2.16444072 0.1027 hCV3054799 KIF6 EARLY-ONSET YES DOM GA or GG 1.423 0.980591812 2.063903309 0.1192 hCV323071 PALLD EARLY-ONSET YES GEN GA 0.722 0.490060464 1.064203359 0.1673 hCV323071 PALLD EARLY-ONSET YES DOM GA or GG 0.74 0.515454368 1.061949638 0.1704
TABLE-US-00017 TABLE 19A Ref ALL Case Case Control Study Marker Gene rs Allele Allele cnt ALL frq cnt frq cnt UCSF hCV1053082 NEU3 rs544115 C T 884 0.2039 216 0.1898 668 CCF VSR hCV1053082 NEU3 rs544115 C T 500 0.1836 177 0.1615 323 UCSF hCV1116757 rs3794971 T C 844 0.1946 206 0.181 638 CCF VSR hCV1116757 rs3794971 T C 454 0.1695 164 0.1513 290 UCSF hCV11425801 PEX6 rs3805953 T C 2068 0.4763 570 0.5009 1498 CCF VSR hCV11425801 PEX6 rs3805953 T C 1320 0.4857 554 0.5064 766 UCSF hCV11425842 GNMT rs10948059 C T 2048 0.4723 513 0.4516 1535 CCF VSR hCV11425842 GNMT rs10948059 C T 1258 0.4618 485 0.4425 773 UCSF hCV11548152 rs11580249 G T 707 0.1631 210 0.1845 497 CCF VSR hCV11548152 rs11580249 G T 413 0.1513 184 0.1673 229 UCSF hCV11738775 rs6754561 T C 1616 0.3725 394 0.3462 1222 CCF VSR hCV11738775 rs6754561 T C 1025 0.3766 387 0.3531 638 UCSF hCV11758801 GUCY1B2 rs11841997 C G 131 0.0302 44 0.0387 87 CCF VSR hCV11758801 GUCY1B2 rs11841997 C G 87 0.0319 44 0.04 43 UCSF hCV11861255 GRIK3 rs529407 A G 1038 0.2392 260 0.2285 778 CCF VSR hCV11861255 GRIK3 rs529407 A G 674 0.2506 245 0.226 429 UCSF hCV12071939 rs1950943 G T 929 0.2142 221 0.1942 708 CCF VSR hCV12071939 rs1950943 G T 532 0.1952 193 0.1755 339 UCSF hCV1209800 CLIC5 rs35067690 G T 207 0.0477 38 0.0335 169 CCF VSR hCV1209800 CLIC5 rs35067690 G T 111 0.0406 34 0.0309 77 UCSF hCV1262973 PLEKHG3 rs229653 G A 382 0.088 114 0.1002 268 CCF VSR hCV1262973 PLEKHG3 rs229653 G A 277 0.1024 127 0.118 150 UCSF hCV1348610 C9orf46 rs3739636 G A 2013 0.4645 559 0.4921 1454 CCF VSR hCV1348610 C9orf46 rs3739636 G A 1223 0.4567 512 0.4794 711 UCSF hCV1408483 BCL2 rs17070848 C T 719 0.1657 209 0.1837 510 CCF VSR hCV1408483 BCL2 rs17070848 C T 526 0.1931 232 0.2117 294 UCSF hCV1452085 TRIM22 rs12223005 C A 468 0.1078 111 0.0975 357 CCF VSR hCV1452085 TRIM22 rs12223005 C A 279 0.1021 98 0.0889 181 UCSF hCV15851766 APC rs2229995 G A 87 0.0201 14 0.0123 73 CCF VSR hCV15851766 APC rs2229995 G A 59 0.022 15 0.0139 44 UCSF hCV15857769 rs2924914 C T 1314 0.3029 368 0.3234 946 CCF VSR hCV15857769 rs2924914 C T 786 0.2883 331 0.3015 455 UCSF hCV15879601 C6orf142 rs2275769 C T 333 0.0767 70 0.0615 263 CCF VSR hCV15879601 C6orf142 rs2275769 C T 171 0.0628 59 0.0537 112 UCSF hCV16134786 rs2857595 G A 774 0.1785 226 0.1989 548 CCF VSR hCV16134786 rs2857595 G A 510 0.1868 227 0.2064 283 UCSF hCV1619596 FKBP1A rs1048621 G A 1198 0.2764 337 0.2961 861 CCF VSR hCV1619596 FKBP1A rs1048621 G A 675 0.2474 297 0.27 378 UCSF hCV16336 HD rs362277 C T 469 0.108 107 0.094 362 CCF VSR hCV16336 HD rs362277 C T 294 0.1079 97 0.0885 197 UCSF hCV1723718 UMODL1 rs12481805 G A 1336 0.3081 377 0.3313 959 CCF VSR hCV1723718 UMODL1 rs12481805 G A 779 0.2858 336 0.306 443 UCSF hCV1958451 MIER1 rs2985822 G T 1073 0.2475 256 0.225 817 CCF VSR hCV1958451 MIER1 rs2985822 G T 676 0.2487 248 0.2271 428 UCSF hCV2121658 rs1187332 G A 534 0.1232 120 0.1058 414 CCF VSR hCV2121658 rs1187332 G A 331 0.1226 119 0.1104 212 UCSF hCV2358247 SPINT4 rs415989 A G 290 0.0669 88 0.0775 202 CCF VSR hCV2358247 SPINT4 rs415989 A G 150 0.0549 77 0.0699 73 UCSF hCV2390937 LOC441108 rs739719 C A 318 0.0733 70 0.0615 248 CCF VSR hCV2390937 LOC441108 rs739719 C A 185 0.0678 60 0.0545 125 UCSF hCV25473186 NPY2R rs2880415 T C 2044 0.4708 566 0.4974 1478 CCF VSR hCV25473186 NPY2R rs2880415 T C 1181 0.4336 509 0.4653 672 UCSF hCV25596936 EPHA1 rs6967117 C T 308 0.0709 92 0.0808 216 CCF VSR hCV25596936 EPHA1 rs6967117 C T 241 0.0884 118 0.1073 123 UCSF hCV25615822 DHODH NONE C T 114 0.0263 35 0.0308 79 CCF VSR hCV25615822 DHODH NONE C T 113 0.0414 56 0.0508 57 UCSF hCV25983294 EDG2 rs3739709 G A 821 0.1892 190 0.1673 631 CCF VSR hCV25983294 EDG2 rs3739709 G A 541 0.1988 197 0.1794 344 UCSF hCV2637554 CHPT1 rs3205421 T C 1293 0.2985 368 0.3245 925 CCF VSR hCV2637554 CHPT1 rs3205421 T C 842 0.3109 363 0.3336 479 UCSF hCV26478797 CHSY-2 rs2015018 G A 1100 0.2537 266 0.2337 834 CCF VSR hCV26478797 CHSY-2 rs2015018 G A 721 0.2653 270 0.2473 451 UCSF hCV26881276 C11orf47 rs2344829 A G 1429 0.3297 392 0.3451 1037 CCF VSR hCV26881276 C11orf47 rs2344829 A G 963 0.3527 418 0.38 545 UCSF hCV27077072 rs8060368 C T 1429 0.3293 353 0.3102 1076 CCF VSR hCV27077072 rs8060368 C T 911 0.3339 346 0.3145 565 UCSF hCV27473671 C9orf4 rs3750465 T C 1270 0.2925 357 0.3137 913 CCF VSR hCV27473671 C9orf4 rs3750465 T C 738 0.2709 324 0.2945 414 UCSF hCV27494483 SLC22A15 rs3748743 C T 226 0.0521 72 0.0633 154 CCF VSR hCV27494483 SLC22A15 rs3748743 C T 127 0.0466 63 0.0573 64 UCSF hCV27504565 MUTYH rs3219489 C G 1135 0.2618 277 0.2434 858 CCF VSR hCV27504565 MUTYH rs3219489 C G 594 0.2174 213 0.1933 381 UCSF hCV27511436 FZD1 rs3750145 T C 687 0.1592 157 0.1389 530 CCF VSR hCV27511436 FZD1 rs3750145 T C 474 0.1736 173 0.1573 301 UCSF hCV2769503 rs4787956 A G 1495 0.3445 426 0.3743 1069 CCF VSR hCV2769503 rs4787956 A G 891 0.3317 393 0.3666 498 UCSF hCV27892569 NRXN3 rs4903741 T C 1022 0.2364 289 0.2544 733 CCF VSR hCV27892569 NRXN3 rs4903741 T C 626 0.23 268 0.2432 358 UCSF hCV28036404 RBL1 rs4812768 T A 875 0.2017 216 0.1905 659 CCF VSR hCV28036404 RBL1 rs4812768 T A 511 0.1879 182 0.1667 329 UCSF hCV2851380 rs12445805 G C 450 0.1037 99 0.0871 351 CCF VSR hCV2851380 rs12445805 G C 320 0.1173 113 0.1027 207 UCSF hCV29401764 LOC646588 rs7793552 C T 1402 0.3233 347 0.3049 1055 CCF VSR hCV29401764 LOC646588 rs7793552 C T 913 0.3357 337 0.3086 576 UCSF hCV29537898 rs6073804 C T 393 0.0907 120 0.1056 273 CCF VSR hCV29537898 rs6073804 C T 216 0.0796 100 0.0921 116 UCSF hCV29539757 KCNQ3 rs10110659 C A 1311 0.3022 312 0.2746 999 CCF VSR hCV29539757 KCNQ3 rs10110659 C A 870 0.3191 318 0.2896 552 UCSF hCV302629 UBAC2 rs9284183 A G 1247 0.2876 359 0.316 888 CCF VSR hCV302629 UBAC2 rs9284183 A G 763 0.2815 319 0.2932 444 UCSF hCV30308202 LAMA2 rs9482985 G C 917 0.2115 219 0.1924 698 CCF VSR hCV30308202 LAMA2 rs9482985 G C 549 0.2017 200 0.1828 349 UCSF hCV3054550 AIG1 rs1559599 C T 641 0.1476 189 0.1661 452 CCF VSR hCV3054550 AIG1 rs1559599 C T 434 0.1589 189 0.1715 245 UCSF hCV3082219 RFXDC1 rs1884833 G A 505 0.1164 148 0.1301 357 CCF VSR hCV3082219 RFXDC1 rs1884833 G A 344 0.127 159 0.147 185 UCSF hCV31137507 CLOCK rs7660668 G C 1165 0.2683 328 0.2882 837 CCF VSR hCV31137507 CLOCK rs7660668 G C 741 0.272 317 0.2892 424 UCSF hCV31227848 HIVEP3 rs11809423 C T 172 0.0396 61 0.0536 111 CCF VSR hCV31227848 HIVEP3 rs11809423 C T 120 0.044 64 0.0583 56 UCSF hCV31573621 SKAP1 rs11079818 T C 1223 0.2817 295 0.2592 928 CCF VSR hCV31573621 SKAP1 rs11079818 T C 739 0.2751 276 0.2575 463 UCSF hCV31705214 LOC645397 rs12804599 A T 984 0.2266 283 0.2487 701 CCF VSR hCV31705214 LOC645397 rs12804599 A T 596 0.2183 266 0.2418 330 UCSF hCV32160712 rs11079160 A T 743 0.1713 221 0.1942 522 CCF VSR hCV32160712 rs11079160 A T 432 0.1595 191 0.1752 241 UCSF hCV435733 rs10276935 C G 1346 0.3103 383 0.3366 963 CCF VSR hCV435733 rs10276935 C G 819 0.3004 345 0.3142 474 UCSF hCV454333 NVL rs10916581 C T 590 0.136 139 0.1224 451 CCF VSR hCV454333 NVL rs10916581 C T 324 0.1194 110 0.0998 214 UCSF hCV540056 SPHK1 rs346802 C T 163 0.0376 32 0.0281 131 CCF VSR hCV540056 SPHK1 rs346802 C T 90 0.033 26 0.0237 64 UCSF hCV7917138 OR5H8P rs9822460 A G 860 0.1984 255 0.2241 605 CCF VSR hCV7917138 OR5H8P rs9822460 A G 538 0.1981 231 0.2115 307 UCSF hCV8147903 FLJ25715 rs680014 G A 971 0.2237 225 0.1977 746 CCF VSR hCV8147903 FLJ25715 rs680014 G A 577 0.2124 214 0.1963 363 UCSF hCV8754449 TESK2 rs781226 C T 1126 0.2596 277 0.2434 849 CCF VSR hCV8754449 TESK2 rs781226 C T 606 0.2226 218 0.1989 388 UCSF hCV8820007 rs938390 T A 1055 0.2432 265 0.2333 790 CCF VSR hCV8820007 rs938390 T A 651 0.2399 234 0.2135 417 UCSF hCV8942032 DDR1 rs1264352 G C 610 0.1406 179 0.1573 431 CCF VSR hCV8942032 DDR1 rs1264352 G C 366 0.1343 165 0.1505 201 Control ALL ALL Case Case Control Control Study Marker frq Allele cnt frq cnt frq cnt frq UCSF hCV1053082 0.2089 C 3452 0.796 922 0.8102 2530 0.7911 CCF VSR hCV1053082 0.1984 C 2224 0.816 919 0.8385 1305 0.8016 UCSF hCV1116757 0.1994 T 3494 0.805 932 0.819 2562 0.8006 CCF VSR hCV1116757 0.1819 T 2224 0.831 920 0.8487 1304 0.8181 UCSF hCV11425801 0.4675 T 2274 0.524 568 0.4991 1706 0.5325 CCF VSR hCV11425801 0.4717 T 1398 0.514 540 0.4936 858 0.5283 UCSF hCV11425842 0.4797 C 2288 0.528 623 0.5484 1665 0.5203 CCF VSR hCV11425842 0.4748 C 1466 0.538 611 0.5575 855 0.5252 UCSF hCV11548152 0.1555 G 3627 0.837 928 0.8155 2699 0.8445 CCF VSR hCV11548152 0.1405 G 2317 0.849 916 0.8327 1401 0.8595 UCSF hCV11738775 0.3819 T 2722 0.628 744 0.6538 1978 0.6181 CCF VSR hCV11738775 0.3924 T 1697 0.623 709 0.6469 988 0.6076 UCSF hCV11758801 0.0272 C 4207 0.97 1092 0.9613 3115 0.9728 CCF VSR hCV11758801 0.0264 C 2643 0.968 1056 0.96 1587 0.9736 UCSF hCV11861255 0.243 A 3302 0.761 878 0.7715 2424 0.757 CCF VSR hCV11861255 0.2671 A 2016 0.749 839 0.774 1177 0.7329 UCSF hCV12071939 0.2212 G 3409 0.786 917 0.8058 2492 0.7788 CCF VSR hCV12071939 0.2085 G 2194 0.805 907 0.8245 1287 0.7915 UCSF hCV1209800 0.0527 G 4133 0.952 1098 0.9665 3035 0.9473 CCF VSR hCV1209800 0.0472 G 2621 0.959 1068 0.9691 1553 0.9528 UCSF hCV1262973 0.0837 G 3958 0.912 1024 0.8998 2934 0.9163 CCF VSR hCV1262973 0.0921 G 2427 0.898 949 0.882 1478 0.9079 UCSF hCV1348610 0.4547 G 2321 0.536 577 0.5079 1744 0.5453 CCF VSR hCV1348610 0.4416 G 1455 0.543 556 0.5206 899 0.5584 UCSF hCV1408483 0.1594 C 3619 0.834 929 0.8163 2690 0.8406 CCF VSR hCV1408483 0.1806 C 2198 0.807 864 0.7883 1334 0.8194 UCSF hCV1452085 0.1115 C 3872 0.892 1027 0.9025 2845 0.8885 CCF VSR hCV1452085 0.111 C 2453 0.898 1004 0.9111 1449 0.889 UCSF hCV15851766 0.0228 G 4245 0.98 1122 0.9877 3123 0.9772 CCF VSR hCV15851766 0.0274 G 2621 0.978 1061 0.9861 1560 0.9726 UCSF hCV15857769 0.2956 C 3024 0.697 770 0.6766 2254 0.7044 CCF VSR hCV15857769 0.2795 C 1940 0.712 767 0.6985 1173 0.7205 UCSF hCV15879601 0.0821 C 4009 0.923 1068 0.9385 2941 0.9179 CCF VSR hCV15879601 0.0689 C 2553 0.937 1039 0.9463 1514 0.9311 UCSF hCV16134786 0.1712 G 3562 0.822 910 0.8011 2652 0.8288 CCF VSR hCV16134786 0.1736 G 2220 0.813 873 0.7936 1347 0.8264 UCSF hCV1619596 0.2694 G 3136 0.724 801 0.7039 2335 0.7306 CCF VSR hCV1619596 0.2322 G 2053 0.753 803 0.73 1250 0.7678 UCSF hCV16336 0.113 C 3873 0.892 1031 0.906 2842 0.887 CCF VSR hCV16336 0.121 C 2430 0.892 999 0.9115 1431 0.879 UCSF hCV1723718 0.2999 G 3000 0.692 761 0.6687 2239 0.7001 CCF VSR hCV1723718 0.2721 G 1947 0.714 762 0.694 1185 0.7279 UCSF hCV1958451 0.2555 G 3263 0.753 882 0.775 2381 0.7445 CCF VSR hCV1958451 0.2632 G 2042 0.751 844 0.7729 1198 0.7368 UCSF hCV2121658 0.1294 G 3800 0.877 1014 0.8942 2786 0.8706 CCF VSR hCV2121658 0.1307 G 2369 0.877 959 0.8896 1410 0.8693 UCSF hCV2358247 0.0631 A 4046 0.933 1048 0.9225 2998 0.9369 CCF VSR hCV2358247 0.0448 A 2582 0.945 1025 0.9301 1557 0.9552 UCSF hCV2390937 0.0775 C 4022 0.927 1068 0.9385 2954 0.9225 CCF VSR hCV2390937 0.0767 C 2545 0.932 1040 0.9455 1505 0.9233 UCSF hCV25473186 0.4613 T 2298 0.529 572 0.5026 1726 0.5387 CCF VSR hCV25473186 0.4123 T 1543 0.566 585 0.5347 958 0.5877 UCSF hCV25596936 0.0674 C 4034 0.929 1046 0.9192 2988 0.9326 CCF VSR hCV25596936 0.0756 C 2485 0.912 982 0.8927 1503 0.9244 UCSF hCV25615822 0.0247 C 4224 0.974 1101 0.9692 3123 0.9753 CCF VSR hCV25615822 0.035 C 2617 0.959 1046 0.9492 1571 0.965 UCSF hCV25983294 0.1969 G 3519 0.811 946 0.8327 2573 0.8031 CCF VSR hCV25983294 0.2118 G 2181 0.801 901 0.8206 1280 0.7882 UCSF hCV2637554 0.2892 T 3039 0.702 766 0.6755 2273 0.7108 CCF VSR hCV2637554 0.2957 T 1866 0.689 725 0.6664 1141 0.7043 UCSF hCV26478797 0.2608 G 3236 0.746 872 0.7663 2364 0.7392 CCF VSR hCV26478797 0.2774 G 1997 0.735 822 0.7527 1175 0.7226 UCSF hCV26881276 0.3243 A 2905 0.67 744 0.6549 2161 0.6757 CCF VSR hCV26881276 0.3344 A 1767 0.647 682 0.62 1085 0.6656 UCSF hCV27077072 0.336 C 2911 0.671 785 0.6898 2126 0.664 CCF VSR hCV27077072 0.3471 C 1817 0.666 754 0.6855 1063 0.6529 UCSF hCV27473671 0.285 T 3072 0.708 781 0.6863 2291 0.715 CCF VSR hCV27473671 0.2549 T 1986 0.729 776 0.7055 1210 0.7451 UCSF hCV27494483 0.0481 C 4114 0.948 1066 0.9367 3048 0.9519 CCF VSR hCV27494483 0.0394 C 2599 0.953 1037 0.9427 1562 0.9606 UCSF hCV27504565 0.2683 C 3201 0.738 861 0.7566 2340 0.7317 CCF VSR hCV27504565 0.2337 C 2138 0.783 889 0.8067 1249 0.7663 UCSF hCV27511436 0.1665 T 3627 0.841 973 0.8611 2654 0.8335 CCF VSR hCV27511436 0.1847 T 2256 0.826 927 0.8427 1329 0.8153 UCSF hCV2769503 0.3339 A 2845 0.656 712 0.6257 2133 0.6661 CCF VSR hCV2769503 0.3086 A 1795 0.668 679 0.6334 1116 0.6914 UCSF hCV27892569 0.2299 T 3302 0.764 847 0.7456 2455 0.7701 CCF VSR hCV27892569 0.221 T 2096 0.77 834 0.7568 1262 0.779 UCSF hCV28036404 0.2057 T 3463 0.798 918 0.8095 2545 0.7943 CCF VSR hCV28036404 0.2021 T 2209 0.812 910 0.8333 1299 0.7979 UCSF hCV2851380 0.1096 G 3890 0.896 1037 0.9129 2853 0.8904 CCF VSR hCV2851380 0.1271 G 2408 0.883 987 0.8973 1421 0.8729 UCSF hCV29401764 0.3299 C 2934 0.677 791 0.6951 2143 0.6701 CCF VSR hCV29401764 0.3538 C 1807 0.664 755 0.6914 1052 0.6462 UCSF hCV29537898 0.0854 C 3941 0.909 1016 0.8944 2925 0.9146 CCF VSR hCV29537898 0.0713 C 2496 0.92 986 0.9079 1510 0.9287 UCSF hCV29539757 0.312 C 3027 0.698 824 0.7254 2203 0.688 CCF VSR hCV29539757 0.3391 C 1856 0.681 780 0.7104 1076 0.6609 UCSF hCV302629 0.2775 A 3089 0.712 777 0.684 2312 0.7225 CCF VSR hCV302629 0.2737 A 1947 0.719 769 0.7068 1178 0.7263 UCSF hCV30308202 0.2183 G 3419 0.789 919 0.8076 2500 0.7817 CCF VSR hCV30308202 0.2144 G 2173 0.798 894 0.8172 1279 0.7856 UCSF hCV3054550 0.1411 C 3701 0.852 949 0.8339 2752 0.8589 CCF VSR hCV3054550 0.1503 C 2298 0.841 913 0.8285 1385 0.8497 UCSF hCV3082219 0.1115 G 3835 0.884 990 0.8699 2845 0.8885 CCF VSR hCV3082219 0.1138 G 2364 0.873 923 0.853 1441 0.8862 UCSF hCV31137507 0.2612 G 3177 0.732 810 0.7118 2367 0.7388 CCF VSR hCV31137507 0.2604 G 1983 0.728 779 0.7108 1204 0.7396 UCSF hCV31227848 0.0347 C 4168 0.96 1077 0.9464 3091 0.9653 CCF VSR hCV31227848 0.0344 C 2608 0.956 1034 0.9417 1574 0.9656 UCSF hCV31573621 0.2896 T 3119 0.718 843 0.7408 2276 0.7104 CCF VSR hCV31573621 0.2869 T 1947 0.725 796 0.7425 1151 0.7131 UCSF hCV31705214 0.2188 A 3358 0.773 855 0.7513 2503 0.7812 CCF VSR hCV31705214 0.2025 A 2134 0.782 834 0.7582 1300 0.7975 UCSF hCV32160712 0.1631 A 3595 0.829 917 0.8058 2678 0.8369 CCF VSR hCV32160712 0.1489 A 2276 0.841 899 0.8248 1377 0.8511 UCSF hCV435733 0.3009 C 2992 0.69 755 0.6634 2237 0.6991 CCF VSR hCV435733 0.2912 C 1907 0.7 753 0.6858 1154 0.7088 UCSF hCV454333 0.1408 C 3748 0.864 997 0.8776 2751 0.8592 CCF VSR hCV454333 0.1328 C 2390 0.881 992 0.9002 1398 0.8672 UCSF hCV540056 0.0409 C 4177 0.962 1106 0.9719 3071 0.9591 CCF VSR hCV540056 0.0394 C 2634 0.967 1072 0.9763 1562 0.9606 UCSF hCV7917138 0.1893 A 3474 0.802 883 0.7759 2591 0.8107 CCF VSR hCV7917138 0.189 A 2178 0.802 861 0.7885 1317 0.811 UCSF hCV8147903 0.233 G 3369 0.776 913 0.8023 2456 0.767 CCF VSR hCV8147903 0.2232 G 2139 0.788 876 0.8037 1263 0.7768 UCSF hCV8754449 0.2653 C 3212 0.74 861 0.7566 2351 0.7347 CCF VSR hCV8754449 0.2386 C 2116 0.777 878 0.8011 1238 0.7614 UCSF hCV8820007 0.2467 T 3283 0.757 871 0.7667 2412 0.7533 CCF VSR hCV8820007 0.2577 T 2063 0.76 862 0.7865 1201 0.7423 UCSF hCV8942032 0.1347 G 3728 0.859 959 0.8427 2769 0.8653 CCF VSR hCV8942032 0.1233 G 2360 0.866 931 0.8495 1429 0.8767
TABLE-US-00018 TABLE 19B ALL ALL Case Case Control Control ALL Study Marker rs Genot cnt frq cnt frq cnt frq Genot cnt ALL frq UCSFCCF hCV1053082 rs544115 T T 98 0.0452 17 0.0299 81 0.0507 T C 688 0.3173 VSR hCV1053082 rs544115 T T 52 0.0382 16 0.0292 36 0.0442 T C 396 0.2907 UCSFCCF hCV1116757 rs3794971 C C 85 0.0392 24 0.0422 61 0.0381 C T 674 0.3107 VSR hCV1116757 rs3794971 C C 41 0.0306 13 0.024 28 0.0351 C T 372 0.2778 UCSFCCF hCV11425801 rs3805953 C C 499 0.2298 143 0.2513 356 0.2222 C T 1070 0.4929 VSR hCV11425801 rs3805953 C C 319 0.2347 140 0.2559 179 0.2204 C T 682 0.5018 UCSFCCF hCV11425842 rs10948059 T T 486 0.2242 111 0.1954 375 0.2344 T C 1076 0.4963 VSR hCV11425842 rs10948059 T T 283 0.2078 104 0.1898 179 0.2199 T C 692 0.5081 UCSFCCF hCV11548152 rs11580249 T T 52 0.024 15 0.0264 37 0.0232 T G 603 0.2783 VSR hCV11548152 rs11580249 T T 34 0.0249 17 0.0309 17 0.0209 T G 345 0.2527 UCSFCCF hCV11738775 rs6754561 C C 279 0.1286 57 0.1002 222 0.1388 C T 1058 0.4878 VSR hCV11738775 rs6754561 C C 201 0.1477 65 0.1186 136 0.1673 C T 623 0.4578 UCSFCCF hCV11758801 rs11841997 G G 4 0.0018 2 0.0035 2 0.0012 G C 123 0.0567 VSR hCV11758801 rs11841997 G G 2 0.0015 2 0.0036 0 0 G C 83 0.0608 UCSFCCF hCV11861255 rs529407 G G 144 0.0664 27 0.0475 117 0.0731 G A 750 0.3456 VSR hCV11861255 rs529407 G G 95 0.0706 30 0.0554 65 0.0809 G A 484 0.3599 UCSFCCF hCV12071939 rs1950943 T T 94 0.0433 15 0.0264 79 0.0494 T G 741 0.3416 VSR hCV12071939 rs1950943 T T 61 0.0448 25 0.0455 36 0.0443 T G 410 0.3008 UCSFCCF hCV1209800 rs35067690 T T 4 0.0018 0 0 4 0.0025 T G 199 0.0917 VSR hCV1209800 rs35067690 T T 4 0.0029 0 0 4 0.0049 T G 103 0.0754 UCSFCCF hCV1262973 rs229653 A A 29 0.0134 11 0.0193 18 0.0112 A G 324 0.1493 VSR hCV1262973 rs229653 A A 16 0.0118 5 0.0093 11 0.0135 A G 245 0.1812 UCSFCCF hCV1348610 rs3739636 A A 474 0.2187 135 0.2377 339 0.212 A G 1065 0.4912 VSR hCV1348610 rs3739636 A A 301 0.2566 137 0.2566 164 0.2037 A G 621 0.4638 UCSFCCF hCV1408483 rs17070848 T T 56 0.0246 14 0.0246 42 0.0262 T C 607 0.2799 VSR hCV1408483 rs17070848 T T 50 0.0401 22 0.0401 28 0.0344 T C 426 0.3128 UCSFCCF hCV1452085 rs12223005 A A 28 0.0053 3 0.0053 25 0.0156 A C 412 0.1899 VSR hCV1452085 rs12223005 A A 17 0.0127 7 0.0127 10 0.0123 A C 245 0.1794 UCSFCCF hCV15851766 rs2229995 A A 0 0 0 0 0 0 A G 87 0.0402 VSR hCV15851766 rs2229995 A A 0 0 0 0 0 0 A G 59 0.044 UCSFCCF hCV15857769 rs2924914 T T 212 0.0977 65 0.1142 147 0.0919 T C 890 0.4183 VSR hCV15857769 rs2924914 T T 106 0.0778 53 0.0965 53 0.0651 T C 574 0.4098 UCSFCCF hCV15879601 rs2275769 T T 13 0.006 2 0.0035 11 0.0069 T C 307 0.116 VSR hCV15879601 rs2275769 T T 8 0.0059 0 0 8 0.0098 T C 155 0.1075 UCSFCCF hCV16134786 rs2857595 A A 72 0.0332 22 0.0387 50 0.0312 A G 630 0.3204 VSR hCV16134786 rs2857595 A A 53 0.0388 22 0.04 31 0.038 A G 404 0.3327 UCSFCCF hCV1619596 rs1048621 A A 186 0.0858 54 0.0949 132 0.0826 A G 826 0.4025 VSR hCV1619596 rs1048621 A A 83 0.0609 37 0.0673 46 0.0565 A G 509 0.4055 UCSFCCF hCV16336 rs362277 T T 31 0.0143 7 0.0123 24 0.015 T C 407 0.1634 VSR hCV16336 rs362277 T T 15 0.011 2 0.0036 13 0.016 T C 264 0.1697 UCSFCCF hCV1723718 rs12481805 A A 199 0.0918 61 0.1072 138 0.0863 A G 938 0.4482 VSR hCV1723718 rs12481805 A A 123 0.0902 53 0.0965 70 0.086 A G 533 0.4189 UCSFCCF hCV1958451 rs2985822 T T 135 0.623 30 0.0527 105 0.0657 T G 803 0.3445 VSR hCV1958451 rs2985822 T T 90 0.0662 27 0.0495 63 0.0775 T G 496 0.3553 UCSFCCF hCV2121658 rs1187332 A A 23 0.0106 6 0.0106 17 0.0106 A G 488 0.1905 VSR hCV2121658 rs1187332 A A 18 0.0133 3 0.0056 15 0.0185 A G 295 0.2096 UCSFCCF hCV2358247 rs415989 G G 14 0.0065 2 0.0035 12 0.0075 G A 262 0.1208 VSR hCV2358247 rs415989 G G 5 0.0037 5 0.0091 0 0 G A 140 0.1025 UCSFCCF hCV2390937 rs739719 A A 12 0.0055 2 0.0035 10 0.0062 A C 294 0.1355 VSR hCV2390937 rs739719 A A 3 0.0022 1 0.0018 2 0.0025 A C 179 0.1311 UCSFCCF hCV25473186 rs2880415 C C 488 0.2248 135 0.2373 353 0.2203 C T 1068 0.4919 VSR hCV25473186 rs2880415 C C 246 0.1806 109 0.1993 137 0.1681 C T 689 0.5059 UCSFCCF hCV25596936 rs6967117 T T 13 0.006 2 0.0035 11 0.0069 T C 282 0.1299 VSR hCV25596936 rs6967117 T T 15 0.011 7 0.0127 8 0.0098 T C 211 0.1548 UCSFCCF hCV25615822 NONE T T 1 0.0005 1 0.0018 0 0 T C 112 0.0516 VSR hCV25615822 NONE T T 2 0.0015 1 0.0018 1 0.0012 T C 109 0.0799 UCSFCCF hCV25983294 rs3739709 A A 75 0.0346 19 0.0335 56 0.035 A G 671 0.3092 VSR hCV25983294 rs3739709 A A 64 0.047 23 0.0419 41 0.0505 A G 413 0.3035 UCSFCCF hCV2637554 rs3205421 C C 190 0.0877 64 0.1129 126 0.0788 C T 913 0.4215 VSR hCV2637554 rs3205421 C C 139 0.1027 63 0.1158 76 0.0938 C T 564 0.4165 UCSFCCF hCV26478797 rs2015018 A A 122 0.0563 31 0.0545 91 0.0569 A G 856 0.3948 VSR hCV26478797 rs2015018 A A 95 0.0699 28 0.0513 67 0.0824 A G 531 0.3907 UCSFCCF hCV26881276 rs2344829 G G 250 0.1154 66 0.1162 184 0.1151 G A 929 0.4287 VSR hCV26881276 rs2344829 G G 183 0.1341 86 0.1564 97 0.119 G A 597 0.4374 UCSFCCF hCV27077072 rs8060368 T T 237 0.1092 60 0.1054 177 0.1106 T C 955 0.4401 VSR hCV27077072 rs8060368 T T 152 0.1114 54 0.0982 98 0.1204 T C 607 0.445 UCSFCCF hCV27473671 rs3750465 C C 183 0.0843 54 0.0949 129 0.0805 C T 904 0.4164 VSR hCV27473671 rs3750465 C C 103 0.0756 51 0.0927 52 0.064 C T 532 0.3906 UCSFCCF hCV27494483 rs3748742 T T 12 0.005 4 0.007 8 0.005 T C 202 0.0931 VSR hCV27494483 rs3748742 T T 3 0.0022 2 0.0036 1 0.0012 T C 121 0.0888 UCSFCCF hCV27504565 rs3219489 G G 138 0.0637 39 0.0685 99 0.0619 G C 859 0.3962 VSR hCV27504565 rs3219489 G G 67 0.049 13 0.0236 54 0.0663 G C 460 0.3367 UCSFCCF hCV27511436 rs3750145 C C 55 0.0255 5 0.0088 50 0.0314 C T 577 0.2375 VSR hCV27511436 rs3750145 C C 47 0.0344 16 0.0291 31 0.038 C T 380 0.2784 UCSFCCF hCV2769503 rs4787956 G G 253 0.1166 74 0.1301 179 0.1118 G A 989 0.4558 VSR hCV2769503 rs4787956 G G 146 0.1087 65 0.1213 81 0.1004 G A 599 0.446 UCSFCCF hCV27892569 rs4903741 C C 113 0.0523 35 0.0616 78 0.0489 C T 796 0.3682 VSR hCV27892569 rs4903741 C C 88 0.0647 34 0.0617 54 0.0667 C T 450 0.3306 UCSFCCF hCV28036404 rs4812768 A A 99 0.0456 17 0.03 82 0.0512 A T 677 0.3121 VSR hCV28036404 rs4812768 A A 39 0.0287 13 0.0238 26 0.0319 A T 433 0.3184 UCSFCCF hCV2851380 rs12445805 C C 32 0.0147 4 0.007 28 0.0175 C G 386 0.1779 VSR hCV2851380 rs12445805 C C 21 0.0154 7 0.0127 14 0.0172 C G 278 0.2038 UCSFCCF hCV29401764 rs7793552 T T 223 0.1029 62 0.109 161 0.1007 T C 956 0.441 VSR hCV29401764 rs7793552 T T 159 0.1169 58 0.1062 101 0.1241 T C 595 0.4375 UCSFCCF hCV29537898 rs6073804 T T 23 0.0106 10 0.0176 13 0.0081 T C 347 0.1601 VSR hCV29537898 rs6073804 T T 6 0.0044 5 0.0092 1 0.0012 T C 204 0.1504 UCSFCCF hCV29538757 rs10110659 A A 192 0.0885 49 0.0863 143 0.0893 A C 927 0.4274 VSR hCV29538757 rs10110659 A A 136 0.0998 46 0.0838 90 0.1106 A C 598 0.4387 UCSFCCF hCV302629 rs9284183 G G 185 0.0853 68 0.1197 117 0.0731 G A 877 0.4045 VSR hCV302629 rs9284183 G G 111 0.0819 55 0.1011 56 0.0691 G A 541 0.3993 UCSFCCF hCV30308202 rs9482985 C C 101 0.0466 17 0.0299 84 0.0525 C G 715 0.3298 VSR hCV30308202 rs9482985 C C 66 0.0485 25 0.0457 41 0.0504 C G 417 0.3064 UCSFCCF hCV3054550 rs1559599 T T 50 0.023 17 0.0299 33 0.0206 T C 541 0.2492 VSR hCV3054550 rs1559599 T T 36 0.0264 14 0.0254 22 0.027 T C 362 0.265 UCSFCCF hCV3082219 rs1884833 A A 27 0.0124 7 0.0123 20 0.0125 A G 451 0.2078 VSR hCV3082219 rs1884833 A A 21 0.0155 11 0.0203 10 0.0123 A G 302 0.223 UCSFCCF hCV31137507 rs7660668 C C 162 0.0746 47 0.0826 115 0.0718 C G 841 0.3874 VSR hCV31137507 rs7660668 C C 101 0.0742 46 0.0839 55 0.0676 C G 539 0.3957 UCSFCCF hCV31227848 rs11809423 T T 4 0.0018 1 0.0018 3 0.0019 T C 164 0.0756 VSR hCV31227848 rs11809423 T T 2 0.0015 1 0.0018 1 0.0012 T C 116 0.085 UCSFCCF hCV31573621 rs11079818 C C 164 0.0755 36 0.0633 128 0.0799 C T 895 0.4123 VSR hCV31573621 rs11079818 C C 100 0.0745 30 0.056 70 0.0867 C T 539 0.4013 UCSFCCF hCV31705214 rs12804599 T T 116 0.0534 41 0.0721 75 0.0468 T A 752 0.3464 VSR hCV31705214 rs12804599 T T 71 0.052 31 0.0564 40 0.0491 T A 454 0.3326 UCSFCCF hCV32160712 rs11079160 T T 57 0.0263 17 0.0299 40 0.025 T A 629 0.29 VSR hCV32160712 rs11079160 T T 37 0.0273 20 0.0367 17 0.021 T A 358 0.2644 UCSFCCF hCV435733 rs10276935 G G 226 0.1042 65 0.1142 161 0.1006 G C 894 0.4122 VSR hCV435733 rs10276935 G G 132 0.0968 46 0.0838 86 0.1057 G C 555 0.4072 UCSFCCF hCV454333 rs10916581 T T 42 0.0194 6 0.0106 36 0.0225 T C 506 0.2333 VSR hCV454333 rs10916581 T T 25 0.0184 5 0.0091 20 0.0248 T C 274 0.2019 UCSFCCF hCV540056 rs346802 T T 2 0.0009 1 0.0018 1 0.0006 T C 159 0.0733 VSR hCV540056 rs346802 T T 0 0 0 0 0 0 T C 90 0.0661 UCSFCCF hCV7917138 rs9822460 G G 94 0.0434 29 0.051 65 0.0407 G A 672 0.3101 VSR hCV7917138 rs9822460 G G 53 0.039 29 0.0531 24 0.0296 G A 432 0.3181 UCSFCCF hCV8147903 rs680014 A A 118 0.0544 25 0.0439 93 0.0581 A G 735 0.3387 VSR hCV8147903 rs680014 A A 66 0.0486 21 0.0385 45 0.0554 A G 445 0.3277 UCSFCCF hCV8754449 rs781226 T T 137 0.0632 37 0.065 100 0.0625 T C 852 0.3928 VSR hCV8754449 rs781226 T T 73 0.0536 15 0.0274 58 0.0713 T C 460 0.338 UCSFCCF hCV8820007 rs938390 A A 143 0.0659 29 0.0511 114 0.0712 A T 769 0.3545 VSR hCV8820007 rs938390 A A 94 0.0693 28 0.0511 66 0.0816 A T 463 0.3412 UCSFCCF hCV8942032 rs1264352 C C 46 0.0212 14 0.0246 32 0.02 C G 518 0.2388 VSR hCV8942032 rs1264352 C C 34 0.0249 16 0.0292 18 0.0221 C G 298 0.2186 Case Case Control Control ALL ALL Case Case Control Control Study Marker cnt frq cnt frq Genot cnt frq cnt frq cnt frq UCSFCCF hCV1053082 182 0.3199 506 0.3164 C C 1382 0.6375 370 0.6503 1012 0.6329 VSR hCV1053082 145 0.2646 251 0.3084 C C 914 0.6711 387 0.7062 527 0.6474 UCSFCCF hCV1116757 158 0.2777 516 0.3225 T T 1410 0.6501 387 0.6801 1023 0.6394 VSR hCV1116757 138 0.2546 234 0.2936 T T 926 0.6916 391 0.7214 535 0.6713 UCSFCCF hCV11425801 284 0.4991 786 0.4906 T T 602 0.2773 142 0.2496 460 0.2871 VSR hCV11425801 274 0.5009 408 0.5025 T T 358 0.2634 133 0.2431 225 0.2771 UCSFCCF hCV11425842 291 0.5123 785 0.4906 C C 606 0.2795 166 0.2923 440 0.275 VSR hCV11425842 277 0.5055 415 0.5098 C C 387 0.2841 167 0.3047 220 0.2703 UCSFCCF hCV11548152 180 0.3163 423 0.2647 G G 1512 0.6977 374 0.6573 1138 0.7121 VSR hCV11548152 150 0.2727 195 0.2393 G G 986 0.7223 383 0.6964 603 0.7399 UCSFCCF hCV11738775 280 0.4921 778 0.4862 T T 832 0.3836 232 0.4077 600 0.375 VSR hCV11738775 257 0.469 366 0.4502 T T 537 0.3946 226 0.4124 311 0.3825 UCSFCCF hCV11758801 40 0.0704 83 0.0518 C C 2042 0.9414 526 0.9261 1516 0.9469 VSR hCV11758801 40 0.0727 43 0.0528 C C 1280 0.9377 508 0.9236 772 0.9472 UCSFCCF hCV11861255 206 0.362 544 0.3398 A A 1276 0.588 336 0.5905 940 0.5871 VSR hCV11861255 185 0.3413 299 0.3724 A A 766 0.5695 327 0.6033 439 0.5467 UCSFCCF hCV12071939 191 0.3357 550 0.3438 G G 1334 0.615 363 0.638 971 0.6069 VSR hCV12071939 143 0.26 267 0.3284 G G 892 0.6544 382 0.6945 510 0.6273 UCSFCCF hCV1209800 38 0.0669 161 0.1005 G G 1967 0.9065 530 0.9331 1437 0.897 VSR hCV1209800 34 0.0617 69 0.0847 G G 1259 0.9217 517 0.9383 742 0.9104 UCSFCCF hCV1262973 92 0.1617 232 0.1449 G G 1817 0.8373 466 0.819 1351 0.8438 VSR hCV1262973 117 0.2175 128 0.1572 G G 1091 0.807 416 0.7732 675 0.8292 UCSFCCF hCV1348610 289 0.5088 776 0.4853 G G 628 0.2898 144 0.2535 484 0.3027 VSR hCV1348610 238 0.4457 383 0.4758 G G 417 0.3114 159 0.2978 258 0.3205 UCSFCCF hCV1408483 181 0.3181 426 0.2662 C C 1506 0.6943 374 0.6573 1132 0.7075 VSR hCV1408483 188 0.3431 238 0.2924 C C 886 0.6505 338 0.6168 548 0.6732 UCSFCCF hCV1452085 105 0.1845 307 0.1918 C C 1730 0.7972 461 0.8102 1269 0.7926 VSR hCV1452085 84 0.1525 161 0.1975 C C 1104 0.8082 460 0.8348 644 0.7902 UCSFCCF hCV15851766 14 0.0246 73 0.0457 G G 2079 0.9597 554 0.9754 1525 0.9543 VSR hCV15851766 15 0.0279 44 0.0549 G G 1281 0.956 523 0.9721 758 0.9451 UCSFCCF hCV15857769 238 0.4183 652 0.4075 C C 1067 0.4919 266 0.4675 801 0.5006 VSR hCV15857769 225 0.4098 349 0.4287 C C 683 0.5011 271 0.4936 412 0.5061 UCSFCCF hCV15879601 66 0.116 241 0.1504 C C 1851 0.8526 501 0.8805 1350 0.8427 VSR hCV15879601 59 0.1075 96 0.1181 C C 1199 0.8803 490 0.8925 709 0.8721 UCSFCCF hCV16134786 182 0.3204 448 0.28 G G 1466 0.6762 364 0.6408 1102 0.6888 VSR hCV16134786 183 0.3327 221 0.2712 G G 908 0.6652 345 0.6273 563 0.6908 UCSFCCF hCV1619596 229 0.4025 597 0.3736 G G 1155 0.533 286 0.5026 869 0.5438 VSR hCV1619596 223 0.4055 286 0.3514 G G 772 0.566 290 0.5273 482 0.5921 UCSFCCF hCV16336 93 0.1634 314 0.196 C C 1733 0.7982 469 0.8243 1264 0.789 VSR hCV16336 93 0.1697 171 0.2101 C C 1083 0.7952 453 0.8266 630 0.774 UCSFCCF hCV1723718 255 0.4482 683 0.4271 G G 1031 0.4756 253 0.4446 778 0.4866 VSR hCV1723718 230 0.4189 303 0.3722 G G 707 0.5187 266 0.4845 441 0.5418 UCSFCCF hCV1958451 196 0.3445 607 0.3796 G G 1230 0.5673 343 0.6028 887 0.5547 VSR hCV1958451 194 0.3553 302 0.3715 G G 773 0.5688 325 0.5952 448 0.551 UCSFCCF hCV2121658 108 0.1905 380 0.2375 G G 1656 0.7642 453 0.7989 1203 0.7519 VSR hCV2121658 113 0.2096 182 0.2244 G G 1037 0.7681 423 0.7848 614 0.7571 UCSFCCF hCV2358247 84 0.1479 178 0.1112 A A 1892 0.8727 482 0.8486 1410 0.8812 VSR hCV2358247 67 0.1216 73 0.0896 A A 1221 0.8939 479 0.8693 742 0.9104 UCSFCCF hCV2390937 66 0.116 228 0.1424 C C 1864 0.859 501 0.8805 1363 0.8513 VSR hCV2390937 58 0.1055 121 0.1485 C C 1183 0.8667 491 0.8927 692 0.8491 UCSFCCF hCV25473186 296 0.5202 772 0.4819 T T 615 0.2833 138 0.2425 477 0.2978 VSR hCV25473186 291 0.532 398 0.4883 T T 427 0.3135 147 0.2687 280 0.3436 UCSFCCF hCV25596936 88 0.1547 194 0.1211 C C 1876 0.8641 479 0.8418 1397 0.872 VSR hCV25596936 104 0.1891 107 0.1316 C C 1137 0.8342 439 0.7982 698 0.8585 UCSFCCF hCV25615822 33 0.0581 79 0.0493 C C 2056 0.9479 534 0.9401 1522 0.9507 VSR hCV25615822 54 0.098 55 0.0676 C C 1254 0.9187 496 0.9002 758 0.9312 UCSFCCF hCV25983294 152 0.2676 519 0.324 G G 1424 0.6562 397 0.6989 1027 0.6411 VSR hCV25983294 151 0.275 262 0.3227 G G 884 0.6495 375 0.6831 509 0.6268 UCSFCCF hCV2637554 240 0.4233 673 0.4209 T T 1063 0.4908 263 0.4638 800 0.5003 VSR hCV2637554 237 0.4357 327 0.4037 T T 651 0.4808 244 0.4485 407 0.5025 UCSFCCF hCV26478797 204 0.3585 652 0.4078 G G 1190 0.5489 334 0.587 856 0.5353 VSR hCV26478797 214 0.3919 317 0.3899 G G 733 0.5394 304 0.5568 429 0.5277 UCSFCCF hCV26881276 260 0.4577 669 0.4184 A A 988 0.4559 242 0.4261 746 0.4665 VSR hCV26881276 246 0.4473 351 0.4307 A A 585 0.4286 218 0.3964 367 0.4503 UCSFCCF hCV27077072 233 0.4095 722 0.451 C C 978 0.4507 276 0.4851 702 0.4385 VSR hCV27077072 238 0.4327 369 0.4533 C C 605 0.4435 258 0.4691 347 0.4263 UCSFCCF hCV27473671 249 0.4376 655 0.4089 T T 1084 0.4993 266 0.4675 818 0.5106 VSR hCV27473671 222 0.4036 310 0.3818 T T 727 0.5338 277 0.5036 450 0.5542 UCSFCCF hCV27494483 64 0.1125 138 0.0862 C C 1956 0.9014 501 0.8805 1455 0.9088 VSR hCV27494483 59 0.1073 62 0.0763 C C 1239 0.909 489 0.8891 750 0.9225 UCSFCCF hCV27504565 199 0.3497 660 0.4128 C C 1171 0.5401 331 0.5817 840 0.5253 VSR hCV27504565 187 0.3394 273 0.335 C C 839 0.6142 351 0.637 4888 0.5988 UCSFCCF hCV27511436 147 0.2602 430 0.2701 T T 1525 0.707 413 0.731 1112 0.6985 VSR hCV27511436 141 0.2564 239 0.2933 T T 938 0.6872 393 0.7145 545 0.6687 UCSFCCF hCV2769503 278 0.4886 711 0.4441 A A 928 0.4276 217 0.3814 711 0.4441 VSR hCV2769503 263 0.4907 336 0.4164 A A 598 0.4453 208 0.3881 390 0.4833 UCSFCCF hCV27892569 219 0.3856 577 0.362 T T 1253 0.5796 314 0.5528 939 0.5891 VSR hCV27892569 200 0.363 250 0.3086 T T 823 0.6047 317 0.5753 506 0.6247 UCSFCCF hCV28036404 182 0.321 495 0.309 T T 1393 0.6422 368 0.649 1025 0.6398 VSR hCV28036404 156 0.2857 277 0.3403 T T 888 0.6529 377 0.6905 511 0.6278 UCSFCCF hCV2851380 91 0.1602 295 0.1841 G G 1752 0.8074 473 0.8327 1279 0.7984 VSR hCV2851380 99 0.18 179 0.2199 G G 1065 0.7808 444 0.8073 621 0.7629 UCSFCCF hCV29401764 223 0.3919 733 0.4584 C C 989 0.4562 284 0.4991 705 0.4406 VSR hCV29401764 221 0.4048 374 0.4595 C C 606 0.4456 267 0.489 339 0.4165 UCSFCCF hCV29537898 100 0.1761 247 0.1545 C C 1797 0.8293 458 0.8063 1339 0.8374 VSR hCV29537898 90 0.1657 114 0.1402 C C 1146 0.8451 448 0.825 698 0.8585 UCSFCCF hCV29538757 214 0.3768 713 0.4453 C C 1050 0.4841 305 0.537 745 0.4653 VSR hCV29538757 226 0.4117 372 0.457 C C 629 0.4615 277 0.5046 352 0.5324 UCSFCCF hCV302629 223 0.3926 654 0.4088 A A 1106 0.5101 277 0.4877 829 0.5181 VSR hCV302629 209 0.3842 332 0.4094 A A 703 0.5188 280 0.5147 423 0.5216 UCSFCCF hCV30308202 185 0.3251 530 0.3315 G G 1352 0.6236 367 0.645 985 0.616 VSR hCV30308202 150 0.2742 267 0.328 G G 878 0.6451 372 0.6801 506 0.6216 UCSFCCF hCV3054550 155 0.2724 386 0.2409 C C 1580 0.7278 397 0.6977 1183 0.7385 VSR hCV3054550 161 0.2922 201 0.2466 C C 968 0.7086 376 0.6824 592 0.7264 UCSFCCF hCV3082219 134 0.2355 317 0.198 G G 1692 0.7797 428 0.7522 1264 0.7895 VSR hCV3082219 137 0.2532 165 0.203 G G 1031 0.7614 393 0.7264 638 0.7847 UCSFCCF hCV31137507 234 0.4112 607 0.3789 G G 1168 0.538 288 0.5062 880 0.5493 VSR hCV31137507 225 0.4106 314 0.3857 G G 722 0.5301 277 0.5055 445 0.5467 UCSFCCF hCV31227848 59 0.1037 105 0.0656 C C 2002 0.9226 509 0.8946 1493 0.9325 VSR hCV31227848 62 0.1129 54 0.0663 C C 1246 0.9135 486 0.8852 760 0.9325 UCSFCCF hCV31573621 223 0.3919 672 0.4195 T T 1112 0.5122 310 0.5448 802 0.5006 VSR hCV31573621 216 0.403 323 0.4002 T T 704 0.5242 290 0.541 414 0.513 UCSFCCF hCV31705214 201 0.3533 551 0.3439 A A 1303 0.6002 327 0.5747 976 0.6092 VSR hCV31705214 204 0.3709 250 0.3067 A A 840 0.6154 315 0.5727 525 0.6442 UCSFCCF hCV32160712 187 0.3286 442 0.2762 A A 1483 0.6837 365 0.6415 1118 0.6988 VSR hCV32160712 151 0.2771 207 0.2559 A A 959 0.7083 374 0.6862 585 0.7231 UCSFCCF hCV435733 253 0.4446 641 0.4006 C C 1049 0.4836 251 0.4411 798 0.4988 VSR hCV435733 253 0.4608 302 0.371 C C 676 0.496 250 0.4554 426 0.5233 UCSFCCF hCV454333 127 0.2236 379 0.2367 C C 1621 0.7473 435 0.7658 1186 0.7408 VSR hCV454333 100 0.1815 174 0.2159 C C 1058 0.7797 446 0.8094 612 0.7593 UCSFCCF hCV540056 30 0.0527 129 0.0806 C C 2009 0.9258 538 0.9455 1471 0.9188 VSR hCV540056 26 0.0474 64 0.0787 C C 1272 0.9339 523 0.9526 749 0.9213 UCSFCCF hCV7917138 197 0.3462 475 0.2972 A A 1401 0.6465 343 0.6028 1058 0.6621 VSR hCV7917138 173 0.3168 259 0.319 A A 873 0.6429 344 0.63 529 0.6515 UCSFCCF hCV8147903 175 0.3076 560 0.3498 G G 1317 0.6069 369 0.6485 948 0.5921 VSR hCV8147903 172 0.3156 273 0.3358 G G 847 0.6237 352 0.6459 495 0.6089 UCSFCCF hCV8754449 203 0.3568 649 0.4056 C C 1180 0.544 329 0.5782 851 0.5319 VSR hCV8754449 188 0.3431 272 0.3346 C C 828 0.6084 345 0.6296 483 0.5941 UCSFCCF hCV8820007 207 0.3644 562 0.351 T T 1257 0.5795 332 0.5845 925 0.5778 VSR hCV8820007 178 0.3248 285 0.3523 T T 800 0.5895 342 0.6241 458 0.5661 UCSFCCF hCV8942032 151 0.2654 367 0.2294 G G 1605 0.74 404 0.71 1201 0.7506 VSR hCV8942032 133 0.2427 165 0.2025 G G 1031 0.7564 399 0.7281 632 0.7755
TABLE-US-00019 TABLE 19C HW (Control) allelicAsc allelicAsc allelicAsc DomGenotAsc DomGenotAsc RecGenotAsc RecGenotAsc AddGenotAsc AddGenotAsc OR.Hom. Study Marker rs pExact chi2 pAsym pExact chi2 pAsym chi2 pAsym chi2 pAsym OR.Hom 95CI.L UCSF hCV1053082 rs544115 9.57E−02 1.8813 1.70E−01 1.84E−01 0.5478 4.59E−01 4.1986 4.05E−02 1.8401 1.75E−01 0.574 0.3358 CCF VSR hCV1053082 rs544115 3.79E−01 5.9535 1.47E−02 1.54E−02 5.1272 2.36E−02 2.0145 1.56E−01 5.7805 1.62E−02 0.6052 0.331 UCSF hCV1116757 rs3794971 7.54E−01 1.8049 1.79E−01 1.91E−01 3.0663 7.99E−02 0.1832 6.69E−01 1.7897 1.81E−01 1.04 0.6394 CCF VSR hCV1116757 rs3794971 7.21E−01 4.3026 0.0381 0.0407 3.8015 0.0512 1.3504 0.2450 4.246 0.0393 0.6353 0.3249 UCSF hCV11425801 rs3805953 5.81E−01 3.7417 5.31E−02 5.74E−02 2.959 8.54E−02 2.008 1.56E−01 3.6971 5.45E−02 1.3012 0.993 CCF VSR hCV11425801 rs3805953 8.33E−01 3.1552 7.57E−02 7.83E−02 1.9414 1.64E−01 2.2927 1.30E−01 3.1695 7.50E−02 1.3231 0.9724 UCSF hCV11425842 rs10948059 5.15E−01 2.6567 1.03E−01 1.04E−01 0.6196 4.31E−01 3.6571 5.58E−02 2.6452 1.04E−01 0.7846 0.5948 CCF VSR hCV11425842 rs10948059 5.74E−01 2.7491 9.73E−02 9.99E−02 1.9136 1.67E−01 1.8051 1.79E−01 2.8113 9.36E−02 0.7654 0.5589 UCSF hCV11548152 rs11580249 8.49E−01 5.1795 2.29E−02 2.49E−02 5.9849 1.44E−02 0.1844 6.68E−01 5.2806 2.16E−02 1.2336 0.6694 CCF VSR hCV11548152 rs11580249 7.72E−01 3.669 5.54E−02 5.68E−02 3.1002 7.83E−02 1.3657 2.43E−01 3.6121 5.74E−02 1.5744 0.7942 UCSF hCV11738775 rs6754561 2.44E−01 4.5652 3.26E−02 3.52E−02 1.902 1.68E−01 5.5721 1.82E−02 4.7722 2.89E−02 0.664 0.4783 CCF VSR hCV11738775 rs6754561 1.22E−01 4.301 3.81E−02 3.97E−02 1.223 2.69E−01 6.1599 1.31E−02 4.1958 4.05E−02 0.6577 0.4674 UCSF hCV11758801 rs11841997 3.28E−01 3.8274 5.04E−02 5.52E−02 3.307 6.90E−02 1.1756 2.78E−01 3.7093 5.41E−02 2.8821 0.405 CCF VSR hCV11758801 rs11841997 1.00E+00 3.9487 4.69E−02 5.84E−02 3.133 7.67E−02 2.968 8.49E−02 3.892 4.85E−02 UCSF hCV11861255 rs529407 2.74E−03 0.9704 3.25E−01 3.32E−01 0.0198 8.87E−01 4.4502 3.49E−02 0.9239 3.36E−01 0.6456 0.4172 CCF VSR hCV11861255 rs529407 1.76E−01 5.8243 1.58E−02 1.62E−02 4.2314 3.97E−02 3.2296 7.23E−02 5.5905 1.81E−02 0.6196 0.3928 UCSF hCV12071939 rs1950943 9.42E−01 3.6497 5.61E−02 5.84E−02 1.7131 1.91E−01 5.3616 2.06E−02 3.7053 5.42E−02 0.5079 0.2887 CCF VSR hCV12071939 rs1950943 9.15E−01 4.558 3.28E−02 3.42E−02 6.5586 1.04E−02 0.0106 9.15E−01 4.3724 3.65E−02 0.9271 0.5472 UCSF hCV1209800 rs35067690 1.00E+00 6.8747 8.74E−03 9.31E−03 6.4426 1.11E−02 1.4208 2.33E−01 6.9406 8.43E−03 0 CCF VSR hCV1209800 rs35067690 9.86E−02 4.5292 3.33E−02 3.77E−02 3.5355 6.01E−02 2.7122 9.96E−02 4.3855 3.62E−02 0 UCSF hCV1262973 rs229653 3.31E−02 2.8401 9.19E−02 9.99E−02 1.9058 1.67E−01 2.0833 1.49E−01 2.6543 1.03E−01 1.7717 0.8307 CCF VSR hCV1262973 rs229653 9.20E−02 4.7235 2.98E−02 3.25E−02 6.5217 1.07E−02 0.4932 4.82E−01 4.6556 3.10E−02 0.7375 0.2545 UCSF hCV1348610 rs3739636 3.92E−01 4.7184 2.98E−02 3.18E−02 4.9229 2.65E−02 1.6159 2.04E−01 4.6621 3.08E−02 1.3385 1.019 CCF VSR hCV1348610 rs3739636 3.18E−01 3.6947 5.46E−02 5.73E−02 0.7744 3.79E−01 5.1413 2.34E−02 3.4678 6.26E−02 1.3555 1.0033 UCSF hCV1408483 rs17070848 7.80E−01 3.5792 5.85E−02 6.33E−02 4.9851 2.56E−02 0.0452 8.31E−01 3.6225 5.70E−02 1.0089 0.5449 CCF VSR hCV1408483 rs17070848 7.23E−01 4.0633 4.38E−02 4.77E−02 4.5874 3.22E−02 0.306 5.80E−01 4.0784 4.34E−02 1.2739 0.7171 UCSF hCV1452085 rs12223005 2.06E−01 1.6991 1.92E−01 2.01E−01 0.8011 3.71E−01 3.5259 6.04E−02 1.6769 1.95E−01 0.3303 0.0993 CCF VSR hCV1452085 rs12223005 1.00E+00 3.5065 6.11E−02 6.21E−02 4.2302 3.97E−02 0.005 9.36E−01 3.431 6.40E−02 0.98 0.3703 UCSF hCV15851766 rs2229995 1.00E+00 4.7105 3.00E−02 3.54E−02 4.8091 2.83E−02 4.8091 2.83E−02 CCF VSR hCV15851766 rs2229995 1.00E+00 5.444 1.96E−02 2.19E−02 5.5693 1.83E−02 5.5693 1.83E−02 UCSF hCV15857769 rs2924914 4.01E−01 3.0613 8.02E−02 8.41E−02 1.8442 1.74E−01 2.3797 1.23E−01 2.9769 8.45E−02 1.3315 0.9638 CCF VSR hCV15857769 rs2924914 8.13E−02 1.5429 2.14E−01 2.27E−01 0.2055 6.50E−01 4.5155 3.36E−02 1.5844 2.08E−01 1.5203 1.0085 UCSF hCV15879601 rs2275769 8.69E−01 5.0195 2.51E−02 2.73E−02 4.7726 2.89E−02 0.7923 3.73E−01 5.012 2.52E−02 0.4899 0.1082 CCF VSR hCV15879601 rs2275769 4.68E−02 2.5557 1.10E−01 1.26E−01 1.3012 2.54E−01 5.4341 1.97E−02 2.4744 1.16E−01 0 UCSF hCV16134786 rs2857595 5.97E−01 4.3847 3.63E−02 3.81E−02 4.3936 3.61E−02 0.7309 3.93E−01 4.3449 3.71E−02 1.3321 0.7957 CCF VSR hCV16134786 rs2857595 1.14E−01 4.6354 3.13E−02 3.54E−02 5.9503 1.47E−02 0.0339 8.53E−01 4.5185 3.35E−02 1.1581 0.6598 UCSF hCV1619596 rs1048621 4.21E−02 2.9988 8.33E−02 8.94E−02 2.857 9.10E−02 0.809 3.68E−01 2.8638 9.06E−02 1.243 0.8815 CCF VSR hCV1619596 rs1048621 6.94E−01 5.0407 2.48E−02 2.67E−02 5.6219 1.77E−02 0.6652 4.15E−01 5.0508 2.46E−02 1.3369 0.8468 UCSF hCV16336 rs362277 3.82E−01 3.1329 7.67E−02 8.47E−02 3.2376 7.20E−02 0.2141 6.44E−01 3.0502 8.07E−02 0.7861 0.3365 CCF VSR hCV16336 rs362277 7.41E−01 7.1876 7.34E−03 8.10E−03 5.5815 1.82E−02 4.5646 3.26E−02 7.2354 7.15E−03 0.214 0.048 UCSF hCV1723718 rs12481805 5.13E−01 3.8839 4.88E−02 5.19E−02 2.9562 8.56E−02 2.1993 1.38E−01 3.9421 4.71E−02 1.3593 0.9742 CCF VSR hCV1723718 rs12481805 9.24E−02 3.6917 5.47E−02 5.72E−02 4.3047 3.80E−02 0.444 5.05E−01 3.5428 5.98E−02 1.2553 0.8516 UCSF hCV1958451 rs2985822 9.48E−01 4.1971 4.05E−02 4.14E−02 3.9539 4.68E−02 1.2038 2.73E−01 4.174 4.10E−02 0.7389 0.4833 CCF VSR hCV1958451 rs2985822 2.40E−01 4.5604 3.27E−02 3.35E−02 2.6009 1.07E−01 4.153 4.16E−02 4.4562 3.48E−02 0.5908 0.3682 UCSF hCV2121658 rs1187332 3.41E−02 4.3002 3.81E−02 4.02E−02 5.1465 2.33E−02 0.0001 9.61E−01 4.49 3.41E−02 0.9373 0.3672 CCF VSR hCV2121658 rs1187332 7.57E−01 2.4843 1.15E−01 1.20E−01 1.3947 2.38E−01 4.1148 4.25E−02 2.5241 1.12E−01 0.2903 0.0835 UCSF hCV2358247 rs415989 3.03E−02 2.7624 9.65E−02 9.75E−02 4.0243 4.48E−02 1.0344 3.09E−01 2.6772 1.02E−01 0.4876 0.1087 CCF VSR hCV2358247 rs415989 4.00E−01 7.9749 4.74E−03 6.00E−03 5.853 1.56E−02 7.4228 6.44E−03 7.8768 5.01E−03 UCSF hCV2390937 rs739719 8.61E−01 3.1417 7.63E−02 8.49E−02 2.9448 8.62E−02 0.5694 4.50E−01 3.1343 7.67E−02 0.5441 0.1188 CCF VSR hCV2390937 rs739719 2.18E−01 5.0969 2.40E−02 2.44E−02 5.414 2.00E−02 0.0605 8.05E−01 5.2977 2.14E−02 0.7047 0.0637 UCSF hCV25473186 rs2880415 2.28E−01 4.3841 3.63E−02 3.81E−02 6.3063 1.20E−02 0.6889 4.07E−01 4.3289 3.75E−02 1.3219 1.0048 CCF VSR hCV25473186 rs2880415 8.85E−01 7.4863 6.22E−03 6.51E−03 8.5136 3.52E−03 2.1489 1.43E−01 7.7174 5.47E−03 1.5155 1.0992 UCSF hCV25596936 rs6967117 1.59E−01 2.2975 1.30E−01 1.39E−01 3.2629 7.09E−02 0.7923 3.73E−01 2.2646 1.32E−01 0.5303 0.1171 CCF VSR hCV25596936 rs6967117 1.24E−01 8.1435 4.32E−03 4.78E−03 8.6432 3.28E−03 0.2513 6.16E−01 7.8335 5.13E−03 1.3912 0.501 UCSF hCV25615822 NONE 6.23E−01 1.2345 2.67E−01 2.80E−01 0.9387 3.33E−01 2.82 9.31E−02 1.2457 2.64E−01 CCF VSR hCV25615822 NONE 1.00E+00 4.1369 4.20E−02 4.98E−02 4.2329 3.96E−02 0.0772 7.81E−01 4.1629 4.13E−02 1.5282 0.0954 UCSF hCV25983294 rs3739709 3.85E−01 4.819 2.81E−02 3.07E−02 6.2248 1.26E−02 0.0285 8.65E−01 4.8577 2.75E−02 0.8777 0.515 CCF VSR hCV25983294 rs3739709 3.44E−01 4.3198 3.77E−02 3.98E−02 4.5466 3.30E−02 0.5404 4.62E−01 4.1249 4.23E−02 0.7614 0.4492 UCSF hCV2637554 rs3205421 3.62E−01 4.974 2.57E−02 2.85E−02 2.2274 1.36E−01 6.0734 1.37E−02 5.0067 2.52E−02 1.5451 1.1091 CCF VSR hCV2637554 rs3205421 3.99E−01 4.3776 3.64E−02 3.80E−02 3.793 5.15E−02 1.707 1.91E−01 4.2587 3.90E−02 1.3827 0.9553 UCSF hCV26478797 rs2015018 2.31E−02 3.2424 7.18E−02 7.43E−02 4.5232 3.34E−02 0.0466 8.29E−01 3.3871 6.57E−02 0.8731 0.5698 CCF VSR hCV26478797 rs2015018 4.32E−01 3.0398 8.12E−02 8.40E−02 1.1134 2.91E−01 4.8681 2.74E−02 3.047 8.09E−02 0.5897 0.3705 UCSF hCV26881276 rs2344829 7.67E−02 1.6418 2.00E−01 2.12E−01 2.7694 9.61E−02 0.0052 9.35E−01 1.5938 2.07E−01 1.1057 0.8058 CCF VSR hCV26881276 rs2344829 3.46E−01 5.9931 1.44E−02 1.60E−02 3.9019 4.82E−02 3.9451 4.70E−02 5.7504 1.65E−02 1.4926 1.0675 UCSF hCV27077072 rs8060368 6.95E−01 2.5397 1.11E−01 1.14E−01 3.68 5.51E−02 0.1126 7.37E−01 2.5305 1.12E−01 0.8622 0.6234 CCF VSR hCV27077072 rs8060368 1.00E+00 3.1185 7.74E−02 8.22E−02 2.4362 1.19E−01 1.6353 2.01E−01 3.0097 7.74E−02 0.7411 0.5123 UCSF hCV27473671 rs3750465 9.51E−01 3.3546 6.70E−02 6.87E−02 3.1234 7.72E−02 1.1247 2.89E−01 3.3751 6.62E−02 1.2873 0.9103 CCF VSR hCV27473671 rs3750465 9.27E−01 5.2115 2.24E−02 2.50E−02 3.367 6.65E−02 3.8604 4.94E−02 5.1535 2.32E−02 1.5933 1.0529 UCSF hCV27494483 rs3748743 2.72E−02 3.9163 4.78E−02 5.21E−02 3.7863 5.17E−02 0.3155 5.74E−01 3.7048 5.43E−02 1.4521 0.4354 CCF VSR hCV27494483 rs3748743 1.00E+00 4.7395 2.95E−02 3.30E−02 4.4302 3.53E−02 0.865 3.52E−01 4.7363 2.95E−02 3.0675 0.2774 UCSF hCV27504565 rs3219489 4.17E−02 2.6893 1.01E−01 1.07E−01 5.3732 2.04E−02 0.3093 5.78E−01 2.7588 9.67E−02 0.9997 0.6757 CCF VSR hCV27504565 rs3219489 6.37E−02 6.3249 1.19E−02 1.22E−02 2.0298 1.54E−01 12.829 3.41E−04 6.2596 1.24E−02 0.3347 0.1799 UCSF hCV27511436 rs3750145 2.79E−01 4.7174 2.99E−02 2.96E−02 2.1238 1.45E−01 8.5394 3.48E−03 4.7125 2.99E−02 0.2692 0.1066 CCF VSR hCV27511436 rs3750145 4.85E−01 3.434 6.39E−02 7.13E−02 3.2092 7.32E−02 0.7905 3.74E−01 3.3344 6.78E−02 0.7158 0.3861 UCSF hCV2769503 rs4787956 9.55E−01 6.0949 1.36E−02 1.50E−02 6.7483 9.38E−03 1.3572 2.44E−01 6.1512 1.31E−02 1.3545 0.9929 CCF VSR hCV2769503 rs4787956 5.09E−01 9.7933 1.75E−03 1.95E−03 11.821 5.86E−04 1.4515 2.28E−01 9.8523 1.70E−03 1.5046 1.0422 UCSF hCV27892569 rs4903741 3.97E−01 2.7801 9.54E−02 9.57E−02 2.2605 1.33E−01 1.3606 2.43E−01 2.8366 9.21E−02 1.3419 0.8828 CCF VSR hCV27892569 rs4903741 4.12E−03 1.8263 1.77E−01 1.79E−01 3.3443 6.74E−02 0.1334 7.15E−01 1.7125 1.91E−01 1.005 0.6399 UCSF hCV28036404 rs4812768 3.21E−02 1.2024 2.73E−01 2.82E−01 0.1544 6.94E−01 4.3224 3.76E−02 1.1665 2.80E−01 0.5774 0.3379 CCF VSR hCV28036404 rs4812768 1.28E−01 5.3749 2.04E−02 2.13E−02 5.6716 1.72E−02 0.7758 3.78E−01 5.6186 1.78E−02 0.6777 0.3437 UCSF hCV2851380 rs12445805 2.89E−02 4.529 3.33E−02 3.60E−02 3.185 7.43E−02 3.1432 7.62E−02 4.3423 3.72E−02 0.3863 0.1348 CCF VSR hCV2851380 rs12445805 7.53E−01 3.7815 5.18E−02 5.25E−02 3.776 5.20E−02 0.433 5.11E−01 3.7227 5.37E−02 0.6993 0.28 UCSF hCV29401764 rs7793552 1.57E−01 2.3924 1.22E−01 1.30E−01 5.7341 1.66E−02 0.3114 5.77E−01 2.411 1.20E−01 0.956 0.6916 CCF VSR hCV29401764 rs7793552 9.39E−01 5.9882 1.44E−02 1.46E−02 6.9627 8.32E−03 1.0087 3.15E−01 5.8764 1.53E−02 0.7291 0.5084 UCSF CCF hCV29537898 rs6073804 6.31E−01 4.1761 4.10E−02 4.70E−02 2.8557 9.10E−02 3.5835 5.84E−02 4.0584 4.40E−02 2.2489 0.9794 VSR hCV29537898 rs6073804 1.14E−01 3.821 5.06E−02 5.96E−02 2.7919 9.47E−02 4.704 3.01E−02 3.9237 4.76E−02 7.7902 0.9071 UCSF hCV29539757 rs10110659 1.46E−01 5.5454 1.85E−02 1.97E−02 8.6151 3.33E−03 0.0484 8.25E−01 5.6203 1.78E−02 0.837 0.5894 CCF VSR hCV29539757 rs10110659 6.39E−01 7.379 6.60E−03 7.33E−03 6.8624 8.80E−03 2.6171 1.06E−01 7.4502 6.34E−03 0.6495 0.4404 UCSF hCV302629 rs9284183 4.55E−01 6.072 1.37E−02 1.46E−02 1.5552 2.12E−01 11.66 6.39E−04 5.9952 1.43E−02 1.7394 1.2525 CCF VSR hCV302629 rs9284183 4.28E−01 1.2194 2.69E−01 2.76E−01 0.0616 8.04E−01 4.4477 3.49E−02 1.2037 2.73E−01 1.4837 0.993 UCSF hCV30308202 rs9482985 2.71E−01 3.3551 6.70E−02 6.92E−02 1.5017 2.20E−01 4.8497 2.76E−02 3.3181 6.85E−02 0.5432 0.3182 CCF VSR hCV30308202 rs9482985 4.66E−01 4.0472 4.42E−02 4.58E−02 4.8822 2.71E−02 0.1543 6.94E−01 3.8598 4.95E−02 0.8294 0.4955 UCSF hCV3054550 rs1559599 8.36E−01 4.1733 4.11E−02 4.60E−02 3.5169 6.07E−02 1.6062 2.05E−01 4.1327 4.21E−02 1.5351 0.8458 CCF VSR hCV3054550 rs1559599 3.36E−01 2.2114 1.37E−01 1.50E−01 3.0804 7.92E−02 0.0322 8.57E−01 2.193 1.39E−01 1.0019 0.5064 UCSF hCV3082219 rs1884833 1.00E+00 2.8129 9.35E−02 9.54E−02 3.4024 6.51E−02 0.0012 9.55E−01 2.8432 9.18E−02 1.0336 0.434 CCF VSR hCV3082219 rs1884833 1.00E+00 6.4474 1.11E−02 1.33E−02 6.0815 1.37E−02 1.3727 2.41E−01 6.4841 1.09E−02 1.7858 0.7515 UCSF hCV31137507 rs7660668 4.76E−01 3.1157 7.75E−02 7.98E−02 3.147 7.61E−02 0.7113 3.99E−01 3.0745 7.95E−02 1.2488 0.8674 CCF VSR hCV31137507 rs7660668 1.00E+00 2.7419 9.77E−02 1.04E−01 2.2328 1.35E−01 1.279 2.58E−01 2.7397 9.79E−02 1.3436 0.8834 UCSF hCV31227848 rs11809423 4.36E−01 7.9108 4.91E−03 6.04E−03 8.4827 3.59E−03 0.0031 9.45E−01 7.8545 5.07E−03 0.9777 0.1015 CCF VSR hCV31227848 rs11809423 1.00E+00 8.9352 2.80E−03 3.13E−03 9.2748 2.32E−03 0.0792 7.78E−01 9.0359 2.65E−03 1.5638 0.0976 UCSF hCV31573621 rs11079818 4.66E−01 3.8384 5.01E−02 5.05E−02 3.2818 7.01E−02 1.663 1.97E−01 3.9118 4.79E−02 0.7276 0.4915 CCF VSR hCV31573621 rs11079818 5.47E−01 2.7923 9.47E−02 1.03E−01 1.0148 3.14E−01 4.4251 3.54E−02 2.8097 9.37E−02 0.6118 0.3888 UCSF hCV31705214 rs12804599 8.84E−01 4.2814 3.85E−02 3.94E−02 2.0882 1.48E−01 5.2885 2.15E−02 4.2313 3.97E−02 1.6316 1.0929 CCF VSR hCV31705214 rs12804599 1.58E−01 5.9636 1.46E−02 1.60E−02 7.0819 7.79E−03 0.3533 5.52E−01 5.8152 1.59E−02 1.2917 0.7918 UCSF hCV32160712 rs11079160 7.14E−01 5.7112 1.69E−02 1.94E−02 6.367 1.16E−02 0.3901 5.32E−01 5.8369 1.57E−02 1.3018 0.7291 CCF VSR hCV32160712 rs11079160 8.90E−01 3.3547 6.70E−02 6.90E−02 2.1431 1.43E−01 3.0135 8.26E−02 3.3083 6.89E−02 1.8402 0.9516 UCSF hCV435733 rs10276935 5.73E−02 4.9763 2.57E−02 2.77E−02 5.5811 1.82E−02 0.833 3.61E−01 4.7987 2.85E−02 1.2836 0.9311 CCF VSR hCV435733 rs10276935 4.96E−03 1.658 1.98E−01 2.02E−01 6.059 1.38E−02 1.7917 1.81E−01 1.6077 2.05E−01 0.9114 0.6167 UCSF hCV454333 rs10916581 4.08E−01 2.4396 1.18E−01 1.31E−01 1.3942 2.38E−01 3.1385 7.65E−02 2.4218 1.20E−01 0.4544 0.1901 CCF VSR hCV454333 rs10916581 9.04E−02 6.7538 9.35E−03 9.52E−03 4.7879 2.87E−02 4.4834 3.42E−02 6.4961 1.08E−02 0.343 0.1278 UCSF hCV540056 rs346802 5.17E−01 3.8011 5.12E−02 5.63E−02 4.3627 3.67E−02 0.5851 4.44E−01 3.8532 4.97E−02 2.7342 0.1707 CCF VSR hCV540056 rs346802 6.30E−01 5.0445 2.47E−02 2.84E−02 5.223 2.23E−02 5.223 2.23E−02 UCSF hCV7917138 rs9822460 2.21E−01 6.3815 1.15E−02 1.21E−02 6.4489 1.11E−02 1.0708 3.01E−01 6.2249 1.26E−02 1.3762 0.8737 CCF VSR hCV7917138 rs9822460 3.02E−01 2.0808 1.49E−01 1.55E−01 0.6537 4.19E−01 4.8306 2.80E−02 2.0835 1.49E−01 1.8582 1.0639 UCSF hCV8147903 rs680014 4.01E−01 6.0117 1.42E−02 1.45E−02 5.5927 1.80E−02 1.6351 2.01E−01 5.8658 1.54E−02 0.6906 0.437 CCF VSR hCV8147903 rs680014 3.63E−01 2.8258 9.28E−02 9.42E−02 1.9048 1.68E−01 1.996 1.58E−01 2.7684 9.61E−02 0.6562 0.3841 UCSF hCV8754449 rs781226 1.09E−01 2.0954 1.48E−01 1.56E−01 3.6323 5.67E−02 0.0453 8.31E−01 2.1424 1.43E−01 0.9571 0.6428 CCF VSR hCV8754449 rs781226 2.62E−02 5.9675 1.46E−02 1.46E−02 1.7282 1.89E−01 12.467 4.14E−04 5.8303 1.58E−02 0.3621 0.2018 UCSF hCV8820007 rs938390 2.66E−02 0.8237 3.64E−01 3.76E−01 0.0782 7.79E−01 2.764 9.64E−02 0.7944 3.73E−01 0.7088 0.4627 CCF VSR hCV8820007 rs938390 2.72E−02 7.008 8.11E−03 8.99E−03 4.5349 3.32E−02 4.7099 3.00E−02 6.5843 1.03E−02 0.5681 0.3573 UCSF hCV8942032 rs1264352 5.20E−01 3.55 5.95E−02 6.61E−02 3.5971 5.79E−02 0.4287 5.13E−01 3.5083 6.11E−02 1.3006 0.6871 CCF VSR hCV8942032 rs1264352 7.41E−02 4.1819 4.09E−02 4.49E−02 3.9886 4.58E−02 0.6813 4.09E−01 3.947 4.70E−02 1.408 0.7097 OR.Hom. OR.Het. OR.Het. G G Statistic Study Marker 95CI.U OR.Het 95CI.L 95CI.U Statistic pAsym OR std.ln (OR) OR99CI.L OR99CI.U OR95CI.L OR95CI.U UCSF hCV1053082 0.9814 0.9838 0.7998 1.2101 4.5688 1.02E−01 0.8873 0.0872 0.7088 1.1108 0.7479 1.0527 CCF VSR hCV1053082 1.1065 0.7867 0.617 1.003 5.8263 5.43E−02 0.7782 0.103 0.5969 1.0145 0.636 0.9521 UCSF hCV1116757 1.6918 0.8094 0.654 1.0017 3.9968 1.36E−01 0.8876 0.0888 0.7061 1.1157 0.7458 1.0563 CCF VSR hCV1116757 1.2422 0.8069 0.63 1.0336 4.2673 1.18E−01 0.8016 0.1068 0.6088 1.0553 0.6502 0.9881 UCSF hCV11425801 1.7051 1.1705 0.9281 1.4761 3.7602 1.53E−01 1.1429 0.0691 0.9566 1.3654 0.9982 1.3085 CCF VSR hCV11425801 1.8004 1.1361 0.873 1.4785 3.1782 2.04E−01 1.1491 0.0783 0.9393 1.4059 0.9857 1.3397 UCSF hCV11425842 1.035 0.9826 0.7858 1.2287 3.7537 1.53E−01 0.8932 0.0693 0.7471 1.0678 0.7797 1.0232 CCF VSR hCV11425842 1.0482 0.8793 0.6833 1.1315 2.8121 2.45E−01 0.878 0.0785 0.7173 1.0747 0.7528 1.024 UCSF hCV11548152 2.273 1.2948 1.0496 1.5973 5.8774 5.29E−02 1.2289 0.0907 0.9729 1.5522 1.0288 1.4679 CCF VSR hCV11548152 3.1213 1.2111 0.9447 1.5526 3.5834 1.67E−01 1.2289 0.1077 0.9311 1.622 0.995 1.5179 UCSF hCV11738775 0.9219 0.9308 0.759 1.1414 6.296 4.29E−02 0.8572 0.0722 0.7118 1.0323 0.7442 0.9874 CCF VSR hCV11738775 0.9255 0.9663 0.7646 1.2211 6.3672 4.14E−02 0.8453 0.0811 0.686 1.0416 0.7211 0.9909 UCSF hCV11758801 20.513 1.389 0.9403 2.0517 3.3582 1.87E−01 1.4427 0.1883 0.8882 2.3432 0.9974 2.0867 CCF VSR hCV11758801 1.4137 0.906 2.2057 1.5378 0.2181 0.8769 2.6969 1.0029 2.3579 UCSF hCV11861255 0.9991 1.0594 0.8647 1.2979 5.0497 8.01E−02 0.9226 0.0817 0.7474 1.1389 0.786 1.083 CCF VSR hCV11861255 0.9773 0.8306 0.6583 1.0482 5.7533 5.63E−02 0.8012 0.0919 0.6322 1.0153 0.669 0.9594 UCSF hCV12071939 0.8937 0.9289 0.7575 1.1392 6.4 4.08E−02 0.8483 0.0862 0.6794 1.0592 0.7164 1.0044 CCF VSR hCV12071939 1.5708 0.715 0.561 0.9113 7.4172 2.45E−02 0.8078 0.1001 0.6243 1.0453 0.664 0.9829 UCSF hCV1209800 0.6399 0.4432 0.9239 0.6215 0.183 0.388 0.9957 0.4342 0.8896 CCF VSR hCV1209800 0.7072 0.462 1.0826 0.6421 0.2097 0.3741 1.012 0.4257 0.9685 UCSF hCV1262973 3.7788 1.1497 0.8834 1.4962 2.9516 2.29E−01 1.2188 0.1176 0.9004 1.6498 0.968 1.5346 CCF VSR hCV1262973 2.1377 1.4832 1.1222 1.9602 7.9944 1.84E−02 1.3186 0.1276 0.9493 1.8315 1.0269 1.6932 UCSF hCV1348610 1.7582 1.2518 0.9947 1.5753 5.2978 7.07E−02 1.162 0.0692 0.9724 1.3886 1.0147 1.3307 CCF VSR hCV1348610 1.8313 1.0083 0.7811 1.3017 5.0887 7.85E−02 1.1644 0.0792 0.9495 1.4278 0.997 1.3598 UCSF hCV1408483 1.8681 1.286 1.0429 1.5858 5.472 6.48E−02 1.1866 0.0905 0.9398 1.4982 0.9937 1.417 CCF VSR hCV1408483 2.263 1.2807 1.0131 1.619 4.5423 1.03E−01 1.2184 0.0981 0.9464 1.5685 1.0053 1.4766 UCSF hCV1452085 1.0993 0.9415 0.7362 1.2039 4.3881 1.11E−01 0.8613 0.1146 0.6411 1.1571 0.688 1.0783 CCF VSR hCV1452085 2.5937 0.7304 0.5467 0.9759 4.5378 1.03E−01 0.7814 0.132 0.5562 1.0978 0.6033 1.0121 UCSF hCV15851766 0.5279 0.2956 0.9429 0.5338 0.2938 0.2504 1.1379 0.3001 0.9495 CCF VSR hCV15851766 0.4941 0.2721 0.8972 0.5012 0.3016 0.2305 1.0901 0.2775 0.9053 UCSF hCV15857769 1.8396 1.0992 0.8971 1.3468 3.1352 2.09E−01 1.1387 0.0743 0.9404 1.3788 0.9845 1.3172 CCF VSR hCV15857769 2.2918 0.9801 0.781 1.23 4.4526 1.08E−01 1.1125 0.0859 0.8918 1.388 0.9402 1.3165 UCSF hCV15879601 2.2181 0.7379 0.5516 0.9872 5.1115 7.76E−02 0.7329 0.1392 0.5121 1.0489 0.558 0.9628 CCF VSR hCV15879601 0.8893 0.6304 1.2545 0.7676 0.1658 0.5008 1.1767 0.5546 1.0624 UCSF hCV16134786 2.23 1.2299 0.9978 1.5159 4.4069 1.10E−01 1.2019 0.0879 0.9584 1.5073 1.0117 1.4278 CCF VSR hCV16134786 2.0327 1.3513 1.0658 1.7133 6.1591 4.60E−02 1.2376 0.0991 0.9587 1.5977 1.0191 1.5031 UCSF hCV1619596 1.7527 1.1655 0.9517 1.4273 2.9745 2.26E−01 1.141 0.0762 0.9377 1.3884 0.9827 1.3248 CCF VSR hCV1619596 2.1107 1.2959 1.032 1.6274 5.6095 6.05E−02 1.2231 0.0898 0.9706 1.5413 1.0258 1.4584 UCSF hCV16336 1.8365 0.7982 0.6189 1.0296 3.2722 1.95E−01 0.8148 0.1159 0.6045 1.0982 0.6492 1.0226 CCF VSR hCV16336 0.9528 0.7564 0.5717 1.0007 9.0123 1.10E−02 0.7053 0.1307 0.5037 0.9876 0.5459 0.9113 UCSF hCV1723718 1.8965 1.1481 0.9381 1.4051 3.9209 1.41E−01 1.1566 0.0739 0.9562 1.399 1.0007 1.3368 CCF VSR hCV1723718 1.8502 1.2585 1.0007 1.5826 4.2931 1.17E−01 1.1795 0.086 0.9452 1.4719 0.9966 1.396 UCSF hCV1958451 1.1295 0.835 0.6812 1.0236 4.2666 1.18E−01 0.8459 0.0818 0.6853 1.0442 0.7206 0.9929 CCF VSR hCV1958451 0.948 0.8855 0.7035 1.1145 5.3527 6.88E−02 0.8225 0.0916 0.6496 1.0413 0.6873 0.9842 UCSF hCV2121658 2.3922 0.7548 0.594 0.959 5.3775 6.80E−02 0.7964 0.11 0.5999 1.0572 0.642 0.9879 CCF VSR hCV2121658 1.009 0.9012 0.6911 1.1752 5.1433 7.64E−02 0.8253 0.122 0.6028 1.1299 0.6498 1.0481 UCSF hCV2358247 2.1862 1.3805 1.0441 1.8253 5.9832 5.02E−02 1.2462 0.1327 0.8855 1.754 0.9609 1.6163 CCF VSR hCV2358247 1.4217 1.0009 2.0194 1.6023 0.1682 1.0388 2.4713 1.1522 2.2281 UCSF hCV2390937 2.4919 0.7875 0.5878 1.0551 3.1758 2.04E−01 0.7807 0.14 0.5444 1.1196 0.5934 1.0272 CCF VSR hCV2390937 7.7934 0.6756 0.4839 0.9432 5.0842 7.87E−02 0.6946 0.1622 0.4575 1.0547 0.5055 0.9545 UCSF hCV25473186 1.7391 1.3253 1.0508 1.6714 6.4292 4.02E−02 1.1555 0.0691 0.9672 1.3806 1.0092 1.3231 CCF VSR hCV25473186 2.0894 1.3927 1.0842 1.789 8.9051 1.16E−02 1.2404 0.0788 1.0126 1.5194 1.0629 1.4475 UCSF hCV25596936 2.401 1.3229 1.0074 1.7373 4.7012 9.53E−02 1.2167 0.1296 0.8714 1.6988 0.9438 1.5685 CCF VSR hCV25596936 3.8636 1.5454 1.1505 2.0759 8.4034 1.50E−02 1.4683 0.1352 1.0364 2.0802 1.1264 1.914 UCSF hCV25615822 1.1906 0.7838 1.8085 1.2567 0.2061 0.7391 2.1366 0.8391 1.882 CCF VSR hCV25615822 24.49 1.5004 1.0137 2.2209 3.6716 1.59E−01 1.4756 0.1923 0.8991 2.4217 1.0121 2.1512 UCSF hCV25983294 1.4958 0.7576 0.6112 0.9391 6.5483 3.78E−02 0.819 0.0911 0.6477 1.0355 0.6851 0.979 CCF VSR hCV25983294 1.2907 0.7823 0.615 0.9951 4.5596 1.02E−01 0.8136 0.0994 0.6298 1.0509 0.6696 0.9885 UCSF hCV2637554 2.1524 1.0848 0.8856 1.3286 6.3881 4.10E−02 1.1805 0.0745 0.9745 1.4301 1.0202 1.366 CCF VSR hCV2637554 2.0013 1.2089 0.96 1.5224 4.2815 1.18E−01 1.1927 0.0843 0.96 1.4817 1.0111 1.4068 UCSF hCV26478797 1.3378 0.8019 0.6554 0.9812 4.6697 9.68E−02 0.8647 0.0808 0.7022 1.0647 0.738 1.013 CCF VSR hCV26478797 0.9388 0.9527 0.759 1.1958 5.2035 7.41E−02 0.8558 0.0894 0.6798 1.0773 0.7182 1.0196 UCSF hCV26881276 1.5173 1.198 0.9771 1.4689 3.0209 2.21E−01 1.098 0.073 0.9099 1.325 0.9517 1.2667 CCF VSR hCV26881276 2.087 1.1799 0.9339 1.4906 5.8097 5.48E−02 1.2202 0.0813 0.9896 1.5046 1.0404 1.4311 UCSF hCV27077072 1.1924 0.8208 0.67 1.0055 3.7499 1.53E−01 0.8885 0.0742 0.7339 1.0756 0.7682 1.0276 CCF VSR hCV27077072 1.072 0.8675 0.6898 1.0909 3.1285 2.09E−01 0.8634 0.0832 0.6968 1.0698 0.7334 1.0163 UCSF hCV27473671 1.8204 1.169 0.9561 1.4294 3.4061 1.82E−01 1.147 0.0749 0.9457 1.3912 0.9904 1.3285 CCF VSR hCV27473671 2.4111 1.1634 0.926 1.4617 5.4661 6.50E−02 1.2203 0.0873 0.9746 1.5279 1.0284 1.448 UCSF hCV27494483 4.843 1.3469 0.9846 1.8425 3.554 1.69E−01 1.3368 0.1471 0.9151 1.9528 1.0019 1.7837 CCF VSR hCV27494483 33.922 1.4595 1.0039 2.122 4.3507 1.14E−01 1.4827 0.1819 0.928 2.3692 1.038 2.118 UCSF hCV27504565 1.4792 0.7652 0.6244 0.9376 7.0162 3.00E−02 0.8774 0.0798 0.7144 1.0776 0.7504 1.0256 CCF VSR hCV27504565 0.6227 0.9523 0.7558 1.2 14.186 8.31E−04 0.7854 0.0962 0.6131 1.0062 0.6505 0.9483 UCSF hCV27511436 0.6798 0.9205 0.7397 1.1455 10.955 4.18E−03 0.808 0.0983 0.6273 1.0408 0.6664 0.9797 CCF VSR hCV27511436 1.3267 0.8181 0.6402 1.0455 3.3771 1.85E−01 0.824 0.1046 0.6294 1.0787 0.6713 1.0114 UCSF hCV2769503 1.8479 1.2811 1.0429 1.5738 6.9114 3.16E−02 1.1938 0.0718 0.9922 1.4364 1.0371 1.3743 CCF VSR hCV2769503 2.1723 1.4676 1.1624 1.853 11.864 2.65E−03 1.2971 0.0832 1.0469 1.607 1.1019 1.5268 UCSF hCV27892569 2.0397 1.135 0.9281 1.3881 2.8209 2.44E−01 1.1428 0.0801 0.9298 1.4046 0.9768 1.337 CCF VSR hCV27892569 1.5785 1.277 1.0116 1.612 4.3397 1.14E−01 1.1328 0.0923 0.8931 1.4367 0.9453 1.3574 UCSF hCV28036404 0.9867 1.0241 0.8322 1.2603 4.7358 9.37E−02 0.9087 0.0873 0.7256 1.138 0.7657 1.0784 CCF VSR hCV28036404 1.3363 0.7634 0.6022 0.9676 5.7808 5.56E−02 0.7897 0.102 0.6072 1.0269 0.6466 0.9644 UCSF hCV2851380 1.1071 0.8341 0.6447 1.0792 5.5293 6.30E−02 0.776 0.1194 0.5705 1.0555 0.614 0.9807 CCF VSR hCV2851380 1.7468 0.7736 0.5881 1.0174 3.8106 1.49E−01 0.7859 0.1241 0.5709 1.0819 0.6163 1.0023 UCSF hCV29401764 1.3214 0.7552 0.6161 0.9257 7.6343 2.20E−02 0.8911 0.0746 0.7354 1.0798 0.7699 1.0313 CCF VSR hCV29401764 1.0456 0.7503 0.5955 0.9452 6.9627 3.08E−02 0.8152 0.0835 0.6574 1.0109 0.6921 0.9603 UCSF CCF hCV29537898 5.1638 1.1836 0.9169 1.528 4.7982 9.08E−02 1.2655 0.1154 0.94 1.7036 1.0093 1.5867 VSR hCV29537898 66.901 1.23 0.9105 1.6616 6.3117 4.26E−02 1.3202 0.1425 0.9147 1.9055 0.9986 1.7455 UCSF hCV29539757 1.1886 0.7331 0.5986 0.8979 9.1106 1.05E−02 0.835 0.0766 0.6854 1.0172 0.7185 0.9703 CCF VSR hCV29539757 0.9579 0.772 0.6145 0.97 7.5953 2.24E−02 0.7947 0.0847 0.639 0.9884 0.6732 0.9381 UCSF hCV302629 2.4155 1.0205 0.8322 1.2514 10.938 4.22E−03 1.203 0.075 0.9915 1.4595 1.0384 1.3936 CCF VSR hCV302629 2.2169 0.951 0.7559 1.1966 4.5406 1.03E−01 1.1006 0.0868 0.8801 1.3764 0.9284 1.3047 UCSF hCV30308202 0.9273 0.9368 0.7625 1.151 5.6664 5.88E−02 0.8535 0.0865 0.683 1.0666 0.7204 1.0113 CCF VSR hCV30308202 1.3882 0.7642 0.6007 0.9721 4.9764 8.31E−02 0.8199 0.0988 0.6356 1.0575 0.6755 0.9951 UCSF hCV3054550 2.7861 1.1966 0.9619 1.4885 4.0552 1.32E−01 1.2126 0.0944 0.9507 1.5465 1.0076 1.4592 CCF VSR hCV3054550 1.9825 1.2611 0.9878 1.6101 3.4557 1.78E−01 1.1702 0.1058 0.8911 1.5368 0.9511 1.4399 UCSF hCV3082219 2.4615 1.2484 0.9921 1.5709 3.4741 1.76E−01 1.1914 0.1045 0.9102 1.5593 0.9707 1.4621 CCF VSR hCV3082219 4.2435 1.3479 1.0403 1.7465 6.3282 4.23E−02 1.3418 0.1161 0.995 1.8094 1.0688 1.6846 UCSF hCV31137507 1.798 1.1779 0.9633 1.4403 3.228 1.99E−01 1.1451 0.0768 0.9396 1.3957 0.9851 1.3312 CCF VSR hCV31137507 2.0436 1.1512 0.9168 1.4454 2.724 2.56E−01 1.1555 0.0873 0.9227 1.447 0.9737 1.3713 UCSF hCV31227848 9.4209 1.6482 1.1797 2.3027 7.5344 2.31E−02 1.5772 0.1633 1.0357 2.4017 1.1453 2.172 CCF VSR hCV31227848 25.061 1.7955 1.2252 2.6312 8.0196 1.81E−02 1.7397 0.1873 1.0738 2.8185 1.2051 2.5114 UCSF hCV31573621 1.0772 0.8585 0.7027 1.0489 3.9481 1.39E−01 0.8583 0.0781 0.7019 1.0494 0.7365 1.0001 CCF VSR hCV31573621 0.9627 0.9547 0.7597 1.1997 4.7176 9.45E−02 0.862 0.0889 0.6855 1.0839 0.7241 1.0261 UCSF hCV31705214 2.436 1.0888 0.8875 1.3357 5.6238 6.01E−02 1.1819 0.0808 0.9598 1.4553 1.0087 1.3847 CCF VSR hCV31705214 2.1071 1.36 1.0787 1.7147 7.0676 2.92E−02 1.2564 0.0936 0.9873 1.5989 1.0459 1.5094 UCSF hCV32160712 2.3242 1.2959 1.0527 1.5953 6.2375 4.42E−02 1.2364 0.0889 0.9833 1.5546 1.0387 1.4718 CCF VSR hCV32160712 3.5585 1.141 0.8916 1.4602 4.0086 1.35E−01 1.2139 0.1059 0.924 1.5948 0.9863 1.4941 UCSF hCV435733 1.7695 1.2548 1.0241 1.5376 5.6002 6.08E−02 1.1784 0.0736 0.9748 1.4245 1.02 1.3613 CCF VSR hCV435733 1.347 1.4275 1.1357 1.7943 11.119 3.85E−03 1.1155 0.0849 0.8964 1.388 0.9445 1.3173 UCSF hCV454333 1.086 0.9136 0.7266 1.1488 4.1171 1.28E−01 0.8504 0.1038 0.6509 1.1111 0.6938 1.0423 CCF VSR hCV454333 0.921 0.7886 0.5993 1.0378 7.7331 2.09E−02 0.7244 0.1244 0.5257 0.9981 0.5676 0.9245 UCSF hCV540056 43.792 0.6359 0.4223 0.9575 4.7627 9.24E−02 0.6783 0.2003 0.4049 1.1362 0.4581 1.0044 CCF VSR hCV540056 0.5818 0.3639 0.9302 0.5919 0.2359 0.3224 1.0869 0.3728 0.9399 UCSF hCV7917138 2.1676 1.2793 1.0412 1.5718 6.4455 3.98E−02 1.2368 0.0842 0.9956 1.5364 1.0486 1.4587 CCF VSR hCV7917138 3.2454 1.0272 0.8116 1.3 4.742 9.34E−02 1.1509 0.0975 0.8953 1.4796 0.9507 1.3933 UCSF hCV8147903 1.0914 0.8028 0.6521 0.9885 6.0203 4.93E−02 0.8113 0.0854 0.6512 1.0109 0.6863 0.9591 CCF VSR hCV8147903 1.1213 0.886 0.7007 1.1204 3.0613 2.16E−01 0.85 0.0968 0.6625 1.0905 0.7032 1.0275 UCSF hCV8754449 1.425 0.8091 0.6607 0.9907 4.2677 1.18E−01 0.8909 0.0798 0.7253 1.0943 0.7618 1.0418 CCF VSR hCV8754449 0.6495 0.9676 0.7676 1.2199 13.591 1.12E−03 0.7922 0.0955 0.6195 1.013 0.6571 0.9552 UCSF hCV8820007 1.0857 1.0262 0.8379 1.2569 2.9617 2.27E−01 0.9289 0.0813 0.7535 1.1452 0.7922 1.0893 CCF VSR hCV8820007 0.9033 0.8364 0.662 1.0567 7.1036 2.87E−02 0.7818 0.0931 0.6152 0.9937 0.6515 0.9383 UCSF hCV8942032 2.4618 1.2231 0.9811 1.5249 3.5479 1.70E−01 1.1992 0.0965 0.9353 1.5375 0.9925 1.4488 CCF VSR hCV8942032 2.7931 1.2768 0.9839 1.6567 3.9974 1.36E−01 1.26 0.1132 0.9414 1.6865 1.0093 1.5729
TABLE-US-00020 TABLE 20 GENO- hCV # rs # Gene OUTCOME ADJUST MODE TYPE hCV1958451 rs2985822 MIER1 EO_STK AGE MALE GEN GT DIAB HTN hCV1958451 rs2985822 MIER1 EO_STK AGE MALE DOM GT or GG DIAB HTN hCV1958451 rs2985822 MIER1 EO_STK GEN GT hCV1958451 rs2985822 MIER1 EO_STK AGE MALE GEN GG DIAB HTN hCV1958451 rs2985822 MIER1 LACUNAR_ GEN GT STK hCV27494483 rs3748743 SLC22A15 CE_STK GEN TC hCV27494483 rs3748743 SLC22A15 CE_STK DOM TC or TT hCV27494483 rs3748743 SLC22A15 CE_STK ADD T hCV27494483 rs3748743 SLC22A15 ISCHEMIC_ DOM TC or TT STK hCV27494483 rs3748743 SLC22A15 ISCHEMIC_ ADD T STK hCV27494483 rs3748743 SLC22A15 ISCHEMIC_ GEN TC STK hCV27504565 rs3219489 MUTYH ATHERO_ AGE MALE GEN CG STK DIAB HTN hCV27504565 rs3219489 MUTYH ATHERO_ AGE MALE DOM CG or CC STK DIAB HTN hCV27504565 rs3219489 MUTYH ATHERO_ AGE MALE GEN CC STK DIAB HTN hCV27504565 rs3219489 MUTYH ATHERO_ GEN CG STK hCV27504565 rs3219489 MUTYH ATHERO_ DOM CG or CC STK hCV27504565 rs3219489 MUTYH ATHERO_ GEN CC STK hCV27504565 rs3219489 MUTYH ISCHEMIC_ GEN CG STK hCV27504565 rs3219489 MUTYH NOHD_STK GEN CG hCV27504565 rs3219489 MUTYH NOHD_STK AGE MALE GEN CG DIAB HTN hCV27504565 rs3219489 MUTYH NONCE_ AGE MALE GEN CG STK DIAB HTN hCV27504565 rs3219489 MUTYH NONCE_ GEN CG STK hCV27504565 rs3219489 MUTYH RECURRENT_ AGE MALE GEN CG STK DIAB HTN hCV27504565 rs3219489 MUTYH RECURRENT_ AGE MALE DOM CG or CC STK DIAB HTN hCV8754449 rs781226 TESK2 ATHERO_ AGE MALE GEN CT STK DIAB HTN hCV8754449 rs781226 TESK2 ATHERO_ AGE MALE DOM CT or CC STK DIAB HTN hCV8754449 rs781226 TESK2 ATHERO_ GEN CT STK hCV8754449 rs781226 TESK2 ATHERO_ DOM CT or CC STK hCV8754449 rs781226 TESK2 ATHERO_ GEN CC STK hCV8754449 rs781226 TESK2 ATHERO_ AGE MALE GEN CC STK DIAB HTN hCV8754449 rs781226 TESK2 RECURRENT_ AGE MALE GEN CT STK DIAB HTN hCV8754449 rs781226 TESK2 RECURRENT_ AGE MALE DOM CT or CC STK DIAB HTN hCV2091644 rs1010 VAMP8 CE_STK REC CC hCV8820007 rs938390 ATHERO GEN TA STK hCV8820007 rs938390 ISCHEMIC_ GEN TA STK hCV8820007 rs938390 ISCHEMIC_ AGE MALE GEN TA STK DIAB HTN hCV8820007 rs938390 NOHD_STK GEN TA hCV8820007 rs938390 NOHD_STK AGE MALE GEN TA DIAB HTN hCV8820007 rs938390 NOHD_STK AGE MALE DOM TA or TT DIAB HTN hCV8820007 rs938390 NOHD_STK DOM TA or TT hCV11354788 rs12644625 LOC729065 ATHERO_ AGE MALE ADD T STK DIAB HTN hCV11354788 rs12644625 LOC729065 ATHERO_ AGE MALE DOM TC or TT STK DIAB HTN hCV11354788 rs12644625 LOC729065 ATHERO_ AGE MALE GEN TC STK DIAB HTN hCV11354788 rs12644625 LOC729065 ATHERO_ DOM TC or TT STK hCV11354788 rs12644625 LOC729065 ATHERO_ GEN TC STK hCV11354788 rs12644625 LOC729065 ATHERO_ ADD T STK hCV11354788 rs12644625 LOC729065 CE_STK ADD T hCV11354788 rs12644625 LOC729065 CE_STK DOM TC or TT hCV11354788 rs12644625 LOC729065 CE_STK AGE MALE ADD T DIAB HTN hCV11354788 rs12644625 LOC729065 CE_STK AGE MALE DOM TC or TT DIAB HTN hCV11354788 rs12644625 LOC729065 CE_STK GEN TC hCV11354788 rs12644625 LOC729065 CE_STK AGE MALE GEN TC DIAB HTN hCV11354788 rs12644625 LOC729065 CE_STK GEN TT hCV11354788 rs12644625 LOC729065 CE_STK REC TT hCV11354788 rs12644625 LOC729065 CE_STK AGE MALE GEN TT DIAB HTN hCV11354788 rs12644625 LOC729065 EO_STK AGE MALE ADD T DIAB HTN hCV11354788 rs12644625 LOC729065 EO_STK DOM TC or TT hCV11354788 rs12644625 LOC729065 EO_STK ADD T hCV11354788 rs12644625 LOC729065 EO_STK AGE MALE DOM TC or TT DIAB HTN hCV11354788 rs12644625 LOC729065 EO_STK GEN TC hCV11354788 rs12644625 LOC729065 EO_STK AGE MALE GEN TC DIAB HTN hCV11354788 rs12644625 LOC729065 ISCHEMIC_ DOM TC or TT STK hCV11354788 rs12644625 LOC729065 ISCHEMIC_ ADD T STK hCV11354788 rs12644625 LOC729065 ISCHEMIC_ GEN TC STK hCV11354788 rs12644625 LOC729065 ISCHEMIC_ AGE MALE ADD T STK DIAB HTN hCV11354788 rs12644625 LOC729065 ISCHEMIC_ AGE MALE DOM TC or TT STK DIAB HTN hCV11354788 rs12644625 LOC729065 ISCHEMIC_ AGE MALE GEN TC STK DIAB HTN hCV11354788 rs12644625 LOC729065 NOHD_STK ADD T hCV11354788 rs12644625 LOC729065 NOHD_STK DOM TC or TT hCV11354788 rs12644625 LOC729065 NOHD_STK GEN TC hCV11354788 rs12644625 LOC729065 NOHD_STK AGE MALE ADD T DIAB HTN hCV11354788 rs12644625 LOC729065 NOHD_STK AGE MALE DOM TC or TT DIAB HTN hCV11354788 rs12644625 LOC729065 NOHD_STK AGE MALE GEN TC DIAB HTN hCV11354788 rs12644625 LOC729065 NONCE_ GEN TC STK hCV11354788 rs12644625 LOC729065 NONCE_ DOM TC or TT STK hCV11354788 rs12644625 LOC729065 NONCE_ AGE MALE DOM TC or TT STK DIAB HTN hCV11354788 rs12644625 LOC729065 RECURRENT_ AGE MALE GEN TC STK DIAB HTN hCV11354788 rs12644625 LOC729065 RECURRENT_ AGE MALE DOM TC or TT STK DIAB HTN hCV11354788 rs12644625 LOC729065 RECURRENT_ AGE MALE ADD T STK DIAB HTN hCV11354788 rs12644625 LOC729065 RECURRENT_ DOM TC or TT STK hCV11354788 rs12644625 LOC729065 RECURRENT_ GEN TC STK hCV11354788 rs12644625 LOC729065 RECURRENT_ ADD T STK hCV16158671 rs2200733 ATHERO_ AGE MALE ADD T STK DIAB HTN hCV16158671 rs2200733 ATHERO_ AGE MALE DOM TC or TT STK DIAB HTN hCV16158671 rs2200733 ATHERO_ DOM TC or TT STK hCV16158671 rs2200733 ATHERO_ ADD T STK hCV16158671 rs2200733 ATHERO_ GEN TC STK hCV16158671 rs2200733 ATHERO_ AGE MALE GEN TC STK DIAB HTN hCV16158671 rs2200733 CE_STK ADD T hCV16158671 rs2200733 CE_STK DOM TC or TT hCV16158671 rs2200733 CE_STK GEN TC hCV16158671 rs2200733 CE_STK AGE MALE ADD T DIAB HTN hCV16158671 rs2200733 CE_STK AGE MALE DOM TC or TT DIAB HTN hCV16158671 rs2200733 CE_STK AGE MALE GEN TC DIAB HTN hCV16158671 rs2200733 CE_STK GEN TT hCV16158671 rs2200733 CE_STK REC TT hCV16158671 rs2200733 CE_STK AGE MALE GEN TT DIAB HTN hCV16158671 rs2200733 EO_STK DOM TC or TT hCV16158671 rs2200733 EO_STK ADD T hCV16158671 rs2200733 EO_STK AGE MALE ADD T DIAB HTN hCV16158671 rs2200733 EO_STK GEN TC hCV16158671 rs2200733 EO_STK AGE MALE DOM TC or TT DIAB HTN hCV16158671 rs2200733 EO_STK AGE MALE GEN TC DIAB HTN hCV16158671 rs2200733 ISCHEMIC_ DOM TC or TT STK hCV16158671 rs2200733 ISCHEMIC_ ADD T STK hCV16158671 rs2200733 ISCHEMIC_ GEN TC STK hCV16158671 rs2200733 ISCHEMIC_ AGE MALE ADD T STK DIAB HTN hCV16158671 rs2200733 ISCHEMIC_ AGE MALE DOM TC or TT STK DIAB HTN hCV16158671 rs2200733 ISCHEMIC_ AGE MALE GEN TC STK DIAB HTN hCV16158671 rs2200733 NOHD_STK ADD T hCV16158671 rs2200733 NOHD_STK DOM TC or TT hCV16158671 rs2200733 NOHD_STK GEN TC hCV16158671 rs2200733 NOHD_STK AGE MALE ADD T DIAB HTN hCV16158671 rs2200733 NOHD_STK AGE MALE DOM TC or TT DIAB HTN hCV16158671 rs2200733 NOHD_STK AGE MALE GEN TC DIAB HTN hCV16158671 rs2200733 NOHD_STK AGE MALE GEN TT DIAB HTN hCV16158671 rs2200733 NONCE_ DOM TC or TT STK hCV16158671 rs2200733 NONCE_ GEN TC STK hCV16158671 rs2200733 NONCE_ ADD T STK hCV16158671 rs2200733 NONCE_ AGE MALE ADD T STK DIAB HTN hCV16158671 rs2200733 NONCE_ AGE MALE DOM TC or TT STK DIAB HTN hCV16158671 rs2200733 RECURRENT_ AGE MALE GEN TC STK DIAB HTN hCV16158671 rs2200733 RECURRENT_ AGE MALE DOM TC or TT STK DIAB HTN hCV16158671 rs2200733 RECURRENT_ AGE MALE ADD T STK DIAB HTN hCV16158671 rs2200733 RECURRENT_ DOM TC or TT STK hCV16158671 rs2200733 RECURRENT_ GEN TC STK hCV16158671 rs2200733 RECURRENT_ ADD T STK hCV16336 rs362277 HD ATHERO_ REC CC STK hCV16336 rs362277 HD ATHERO_ ADD C STK hCV16336 rs362277 HD ATHERO_ AGE MALE REC CC STK DIAB HTN hCV16336 rs362277 HD CE_STK ADD C hCV16336 rs362277 HD CE_STK REC CC hCV16336 rs362277 HD CE_STK AGE MALE ADD C DIAB HTN hCV16336 rs362277 HD CE_STK AGE MALE REC CC DIAB HTN hCV16336 rs362277 HD CE_STK GEN CC hCV16336 rs362277 HD EO_STK AGE MALE REC CC DIAB HTN hCV16336 rs362277 HD EO_STK AGE MALE ADD C DIAB HTN hCV16336 rs362277 HD EO_STK REC CC hCV16336 rs362277 HD EO_STK ADD C hCV16336 rs362277 HD ISCHEMIC_ ADD C STK hCV16336 rs362277 HD ISCHEMIC_ REC CC STK hCV16336 rs362277 HD ISCHEMIC_ AGE MALE ADD C STK DIAB HTN hCV16336 rs362277 HD ISCHEMIC_ AGE MALE REC CC STK DIAB HTN hCV16336 rs362277 HD NOHD_STK ADD C hCV16336 rs362277 HD NOHD_STK REC CC hCV16336 rs362277 HD NONCE_ REC CC STK hCV16336 rs362277 HD NONCE_ ADD C STK hCV16336 rs362277 HD NONCE_ AGE MALE REC CC STK DIAB HTN hCV16336 rs362277 HD NONCE_ AGE MALE ADD C STK DIAB HTN hCV26478797 rs2015018 CHSY-2 CE_STK REC GG hCV11425801 rs3805953 PEX6 ATHERO_ AGE MALE GEN CT STK DIAB HTN hCV11425801 rs3805953 PEX6 ATHERO_ AGE MALE DOM CT or CC STK DIAB HTN hCV11425801 rs3805953 PEX6 ATHERO_ GEN CT STK hCV11425801 rs3805953 PEX6 ATHERO_ DOM CT or CC STK hCV11425801 rs3805953 PEX6 ATHERO_ ADD C STK hCV11425801 rs3805953 PEX6 ATHERO_ GEN CC STK hCV11425801 rs3805953 PEX6 ATHERO_ AGE MALE ADD C STK DIAB HTN hCV11425801 rs3805953 PEX6 EO_STK GEN CT hCV11425801 rs3805953 PEX6 EO_STK AGE MALE GEN CT DIAB HTN hCV11425801 rs3805953 PEX6 EO_STK DOM CT or CC hCV11425801 rs3805953 PEX6 EO_STK AGE MALE DOM CT or CC DIAB HTN hCV11425801 rs3805953 PEX6 ISCHEMIC_ AGE MALE GEN CT STK DIAB HTN hCV11425801 rs3805953 PEX6 ISCHEMIC_ AGE MALE DOM CT or CC STK DIAB HTN hCV11425801 rs3805953 PEX6 ISCHEMIC_ GEN CT STK hCV11425801 rs3805953 PEX6 ISCHEMIC_ DOM CT or CC STK hCV11425801 rs3805953 PEX6 ISCHEMIC_ ADD C STK hCV11425801 rs3805953 PEX6 LACUNAR_ AGE MALE GEN CT STK DIAB HTN hCV11425801 rs3805953 PEX6 LACUNAR_ AGE MALE DOM CT or CC STK DIAB HTN hCV11425801 rs3805953 PEX6 LACUNAR_ GEN CT STK hCV11425801 rs3805953 PEX6 NOHD_STK AGE MALE GEN CT DIAB HTN hCV11425801 rs3805953 PEX6 NOHD_STK AGE MALE DOM CT or CC DIAB HTN hCV11425801 rs3805953 PEX6 NOHD_STK DOM CT or CC hCV11425801 rs3805953 PEX6 NOHD_STK GEN CT hCV11425801 rs3805953 PEX6 NOHD_STK ADD C hCV11425801 rs3805953 PEX6 NOHD_STK GEN CC hCV11425801 rs3805953 PEX6 NONCE_ AGE MALE DOM CT or CC STK DIAB HTN hCV11425801 rs3805953 PEX6 NONCE_ GEN CT STK hCV11425801 rs3805953 PEX6 NONCE_ DOM CT or CC STK hCV11425801 rs3805953 PEX6 NONCE_ ADD C STK hCV11425801 rs3805953 PEX6 NONCE_ GEN CC STK hCV11425801 rs3805953 PEX6 RECURRENT_ AGE MALE GEN CT STK DIAB HTN hCV11425801 rs3805953 PEX6 RECURRENT_ GEN CT STK hCV11425842 rs10948059 GNMT ATHERO_ AGE MALE DOM CT or CC STK DIAB HTN hCV11425842 rs10948059 GNMT ATHERO_ AGE MALE GEN CT STK DIAB HTN hCV11425842 rs10948059 GNMT ATHERO_ DOM CT or CC STK hCV11425842 rs10948059 GNMT ATHERO_ AGE MALE GEN CC STK DIAB HTN hCV11425842 rs10948059 GNMT ATHERO_ GEN CT STK hCV11425842 rs10948059 GNMT EO_STK GEN CT hCV11425842 rs10948059 GNMT EO_STK DOM CT or CC hCV11425842 rs10948059 GNMT EO_STK AGE MALE GEN CT DIAB HTN hCV11425842 rs10948059 GNMT EO_STK AGE MALE DOM CT or CC DIAB HTN hCV11425842 rs10948059 GNMT EO_STK GEN CC hCV11425842 rs10948059 GNMT ISCHEMIC_ AGE MALE GEN CT STK DIAB HTN hCV11425842 rs10948059 GNMT ISCHEMIC_ AGE MALE DOM CT or CC STK DIAB HTN hCV11425842 rs10948059 GNMT NONCE_ AGE MALE GEN CT STK DIAB HTN hCV11425842 rs10948059 GNMT NONCE_ AGE MALE DOM CT or CC STK DIAB HTN hCV1209800 rs35067690 CLIC5 CE_STK REC GG hCV1209800 rs35067690 CLIC5 CE STK ADD G hCV16134786 rs2857595 EO_STK ADD A hCV16134786 rs2857595 EO_STK GEN AA hCV16134786 rs2857595 EO_STK REC AA hCV16134786 rs2857595 EO_STK DOM AG or AA hCV16134786 rs2857595 LACUNAR_ GEN AA STK hCV16134786 rs2857595 LACUNAR_ REC AA STK hCV16134786 rs2857595 LACUNAR_ ADD A STK hCV16134786 rs2857595 NONCE_ ADD A STK hCV16134786 rs2857595 NONCE_ GEN AA STK hCV25651109 rs35690712 SLC39A7 ISCHEMIC_ GEN GG STK hCV25651109 rs35690712 SLC39A7 ISCHEMIC_ DOM GC or GG STK hCV25651109 rs35690712 SLC39A7 ISCHEMIC_ GEN GC STK hCV25651109 rs35690712 SLC39A7 NOHD_STK GEN GC hCV25651109 rs35690712 SLC39A7 NOHD_STK DOM GC or GG hCV25651109 rs35690712 SLC39A7 NOHD_STK GEN GG hCV30308202 rs9482985 LAMA2 RECURRENT_ ADD G STK hCV30308202 rs9482985 LAMA2 RECURRENT_ AGE MALE GEN GG STK DIAB HTN hCV30308202 rs9482985 LAMA2 RECURRENT_ AGE MALE DOM GC or GG STK DIAB HTN hCV30308202 rs9482985 LAMA2 RECURRENT_ REC GG STK hCV30308202 rs9482985 LAMA2 RECURRENT_ AGE MALE GEN GC STK DIAB HTN hCV30308202 rs9482985 LAMA2 RECURRENT_ GEN GG STK hCV3082219 rs1884833 RFXDC1 EO_STK ADD A hCV3082219 rs1884833 RFXDC1 LACUNAR_ ADD A STK hCV3082219 rs1884833 RFXDC1 LACUNAR_ DOM AG or AA STK hCV3082219 rs1884833 RFXDC1 LACUNAR_ GEN AG STK hCV3082219 rs1884833 RFXDC1 NONCE_ ADD A STK hCV3082219 rs1884833 RFXDC1 NONCE_ DOM AG or AA STK hCV3082219 rs1884833 RFXDC1 NONCE_ GEN AG STK hCV8942032 rs1264352 DDR1 EO_STK DOM CG or CC hCV8942032 rs1264352 DDR1 EO_STK GEN CG hCV8942032 rs1264352 DDR1 EO_STK ADD C hCV8942032 rs1264352 DDR1 EO_STK AGE MALE GEN CG DIAB HTN hCV8942032 rs1264352 DDR1 EO_STK AGE MALE DOM CG or CC DIAB HTN hCV8942032 rs1264352 DDR1 EO_STK AGE MALE ADD C DIAB HTN hCV8942032 rs1264352 DDR1 ISCHEMIC_ AGE MALE GEN CG STK DIAB HTN hCV8942032 rs1264352 DDR1 ISCHEMIC_ AGE MALE DOM CG or CC STK DIAB HTN hCV8942032 rs1264352 DDR1 ISCHEMIC_ AGE MALE ADD C STK DIAB HTN hCV8942032 rs1264352 DDR1 ISCHEMIC_ GEN CG STK hCV8942032 rs1264352 DDR1 ISCHEMIC_ DOM CG or CC STK hCV8942032 rs1264352 DDR1 LACUNAR_ AGE MALE DOM CG or CC STK DIAB HTN hCV8942032 rs1264352 DDR1 LACUNAR_ AGE MALE ADD C STK DIAB HTN hCV8942032 rs1264352 DDR1 LACUNAR_ AGE MALE GEN CG STK DIAB HTN hCV8942032 rs1264352 DDR1 LACUNAR_ DOM CG or CC STK hCV8942032 rs1264352 DDR1 LACUNAR_ ADD C STK hCV8942032 rs1264352 DDR1 LACUNAR_ GEN CG STK hCV8942032 rs1264352 DDR1 NOHD_STK AGE MALE GEN CG DIAB HTN hCV8942032 rs1264352 DDR1 NOHD_STK AGE MALE DOM CG or CC DIAB HTN hCV8942032 rs1264352 DDR1 NOHD_STK GEN CG hCV8942032 rs1264352 DDR1 NONCE_ AGE MALE GEN CG STK DIAB HTN hCV8942032 rs1264352 DDR1 NONCE_ AGE MALE DOM CG or CC STK DIAB HTN hCV8942032 rs1264352 DDR1 NONCE_ GEN CG STK hCV8942032 rs1264352 DDR1 NONCE_ AGE MALE ADD C STK DIAB HTN hCV8942032 rs1264352 DDR1 NONCE_ DOM CG or CC STK hCV8942032 rs1264352 DDR1 RECURRENT_ AGE MALE DOM CG or CC STK DIAB HTN hCV8942032 rs1264352 DDR1 RECURRENT_ AGE MALE GEN CG STK DIAB HTN hCV8942032 rs1264352 DDR1 RECURRENT_ AGE MALE ADD C STK DIAB HTN hCV8942032 rs1264352 DDR1 RECURRENT_ GEN CG STK hCV8942032 rs1264352 DDR1 RECURRENT_ DOM CG or CC STK hCV8942032 rs1264352 DDR1 RECURRENT_ ADD C STK hCV25596936 rs6967117 EPHA1 ATHERO_ GEN TC STK hCV25596936 rs6967117 EPHA1 ATHERO_ DOM TC or TT STK hCV25596936 rs6967117 EPHA1 ISCHEMIC_ GEN TC STK hCV25596936 rs6967117 EPHA1 LACUNAR_ GEN TC STK hCV25596936 rs6967117 EPHA1 NOHD_STK GEN TC hCV25596936 rs6967117 EPHA1 NONCE_ GEN TC STK hCV25596936 rs6967117 EPHA1 NONCE_ DOM TC or TT STK hCV25596936 rs6967117 EPHA1 NONCE_ ADD T STK hCV27511436 rs3750145 FZD1 ATHERO_ GEN TC STK hCV27511436 rs3750145 FZD1 ATHERO_ AGE MALE GEN TC STK DIAB HTN hCV27511436 rs3750145 FZD1 ATHERO_ DOM TC or TT STK hCV27511436 rs3750145 FZD1 ATHERO_ GEN TT STK hCV27511436 rs3750145 FZD1 ATHERO_ AGE MALE DOM TC or TT STK DIAB HTN hCV27511436 rs3750145 FZD1 ATHERO_ AGE MALE GEN TT STK DIAB HTN hCV27511436 rs3750145 FZD1 CE STK GEN TC hCV27511436 rs3750145 FZD1 CE STK AGE MALE GEN TC DIAB HTN hCV27511436 rs3750145 FZD1 CE_STK AGE MALE DOM TC or TT DIAB HTN hCV27511436 rs3750145 FZD1 CE STK AGE MALE GEN TT DIAB HTN hCV27511436 rs3750145 FZD1 CE STK DOM TC or TT hCV27511436 rs3750145 FZD1 EO_STK GEN TC hCV27511436 rs3750145 FZD1 EO_STK DOM TC or TT hCV27511436 rs3750145 FZD1 EO_STK AGE MALE GEN TC DIAB HTN hCV27511436 rs3750145 FZD1 EO_STK GEN TT hCV27511436 rs3750145 FZD1 EO_STK AGE MALE DOM TC or TT DIAB HTN hCV27511436 rs3750145 FZD1 EO_STK AGE MALE GEN TT DIAB HTN hCV27511436 rs3750145 FZD1 ISCHEMIC_ AGE MALE GEN TC STK DIAB HTN hCV27511436 rs3750145 FZD1 ISCHEMIC_ DOM TC or TT STK hCV27511436 rs3750145 FZD1 ISCHEMIC_ AGE MALE DOM TC or TT STK DIAB HTN hCV27511436 rs3750145 FZD1 ISCHEMIC_ AGE MALE GEN TT STK DIAB HTN hCV27511436 rs3750145 FZD1 ISCHEMIC_ GEN TT STK hCV27511436 rs3750145 FZD1 LACUNAR_ AGE MALE GEN TC STK DIAB HTN hCV27511436 rs3750145 FZD1 LACUNAR_ GEN TC STK hCV27511436 rs3750145 FZD1 LACUNAR_ AGE MALE DOM TC or TT STK DIAB HTN hCV27511436 rs3750145 FZD1 LACUNAR_ AGE MALE GEN TT STK DIAB HTN hCV27511436 rs3750145 FZD1 LACUNAR_ DOM TC or TT STK hCV27511436 rs3750145 FZD1 LACUNAR_ GEN TT STK hCV27511436 rs3750145 FZD1 NOHD_STK GEN TC hCV27511436 rs3750145 FZD1 NOHD_STK AGE MALE GEN TC DIAB HTN hCV27511436 rs3750145 FZD1 NOHD_STK DOM TC or TT hCV27511436 rs3750145 FZD1 NOHD_STK AGE MALE DOM TC or TT DIAB HTN hCV27511436 rs3750145 FZD1 NOHD_STK AGE MALE GEN TT DIAB HTN hCV27511436 rs3750145 FZD1 NOHD_STK GEN TT hCV27511436 rs3750145 FZD1 NONCE_ AGE MALE GEN TC STK DIAB HTN hCV27511436 rs3750145 FZD1 NONCE_ DOM TC or TT STK hCV27511436 rs3750145 FZD1 NONCE_ GEN TT STK hCV27511436 rs3750145 FZD1 NONCE_ AGE MALE DOM TC or TT STK DIAB HTN hCV27511436 rs3750145 FZD1 NONCE_ AGE MALE GEN TT STK DIAB HTN hCV29401764 rs7793552 LOC646588 ATHERO_ AGE MALE GEN CT STK DIAB HTN hCV15857769 rs2924914 ATHERO_ ADD T STK hCV15857769 rs2924914 ATHERO_ DOM TC or TT STK hCV15857769 rs2924914 ATHERO_ GEN TC STK hCV15857769 rs2924914 ATHERO_ AGE MALE GEN TT STK DIAB HTN hCV15857769 rs2924914 ATHERO_ GEN TT STK hCV15857769 rs2924914 CE_STK GEN TC hCV15857769 rs2924914 CE_STK DOM TC or TT hCV15857769 rs2924914 ISCHEMIC_ GEN TC STK hCV15857769 rs2924914 ISCHEMIC_ DOM TC or TT STK hCV15857769 rs2924914 ISCHEMIC_ ADD T STK hCV15857769 rs2924914 NOHD_STK GEN TC hCV15857769 rs2924914 NOHD_STK DOM TC or TT hCV15857769 rs2924914 NONCE_ DOM TC or TT STK hCV15857769 rs2924914 NONCE_ GEN TC STK hCV15857769 rs2924914 NONCE_ ADD T STK hCV15857769 rs2924914 RECURRENT_ GEN TC STK hCV15857769 rs2924914 RECURRENT_ DOM TC or TT STK hCV15857769 rs2924914 RECURRENT_ AGE MALE GEN TC STK DIAB HTN hCV15857769 rs2924914 RECURRENT_ AGE MALE DOM TC or TT STK DIAB HTN hCV15857769 rs2924914 RECURRENT_ ADD T STK hCV29539757 rs10110659 KCNQ3 NONCE_ GEN CA STK hCV1348610 rs3739636 C9orf46 ISCHEMIC_ AGE MALE GEN AG STK DIAB HTN hCV1348610 rs3739636 C9orf46 ISCHEMIC_ AGE MALE DOM AG or AA STK DIAB HTN hCV1348610 rs3739636 C9orf46 NOHD_STK AGE MALE GEN AG DIAB HTN hCV1348610 rs3739636 C9orf46 NONCE_ AGE MALE GEN AG STK DIAB HTN hCV26505812 rs10757274 C9P21 ATHERO_ AGE MALE REC GG STK DIAB HTN hCV26505812 rs10757274 C9P21 NONCE_ AGE MALE REC GG STK DIAB HTN hCV2169762 rs1804689 HPS1 CE_STK GEN TG hCV2169762 rs1804689 HPS1 CE_STK DOM TG or TT hCV2169762 rs1804689 HPS1 CE_STK ADD T hCV2169762 rs1804689 HPS1 CE_STK AGE MALE DOM TG or TT DIAB HTN hCV2169762 rs1804689 HPS1 CE_STK AGE MALE GEN TG DIAB HTN hCV2169762 rs1804689 HPS1 CE_STK AGE MALE ADD T DIAB HTN hCV2169762 rs1804689 HPS1 EO_STK AGE MALE REC TT DIAB HTN hCV2169762 rs1804689 HPS1 ISCHEMIC_ AGE MALE ADD T STK DIAB HTN hCV2169762 rs1804689 HPS1 ISCHEMIC_ DOM TG or TT STK hCV2169762 rs1804689 HPS1 ISCHEMIC_ AGE MALE DOM TG or TT STK DIAB HTN hCV2169762 rs1804689 HPS1 ISCHEMIC_ GEN TG STK hCV2169762 rs1804689 HPS1 ISCHEMIC_ AGE MALE GEN TT STK DIAB HTN hCV2169762 rs1804689 HPS1 ISCHEMIC_ ADD T STK hCV2169762 rs1804689 HPS1 ISCHEMIC_ AGE MALE GEN TG STK DIAB HTN hCV2169762 rs1804689 HPS1 ISCHEMIC_ AGE MALE REC TT STK DIAB HTN hCV2169762 rs1804689 HPS1 LACUNAR_ AGE MALE DOM TG or TT STK DIAB HTN hCV2169762 rs1804689 HPS1 NOHD_STK DOM TG or TT hCV2169762 rs1804689 HPS1 NOHD_STK GEN TG hCV2169762 rs1804689 HPS1 NOHD_STK ADD T hCV2169762 rs1804689 HPS1 NOHD_STK AGE MALE ADD T DIAB HTN hCV2169762 rs1804689 HPS1 NOHD_STK AGE MALE DOM TG or TT DIAB HTN hCV2169762 rs1804689 HPS1 NOHD_STK AGE MALE GEN TG DIAB HTN hCV2169762 rs1804689 HPS1 NOHD_STK AGE MALE GEN TT DIAB HTN hCV2169762 rs1804689 HPS1 NOHD_STK GEN TT hCV2169762 rs1804689 HPS1 NONCE_ AGE MALE GEN TT STK DIAB HTN hCV2169762 rs1804689 HPS1 NONCE_ AGE MALE ADD T STK DIAB HTN hCV2169762 rs1804689 HPS1 NONCE_ AGE MALE REC TT STK DIAB HTN hCV27830265 rs12762303 ALOX5 ATHERO_ GEN GG STK hCV27830265 rs12762303 ALOX5 ATHERO_ REC GG STK hCV27830265 rs12762303 ALOX5 ATHERO_ AGE MALE ADD G STK DIAB HTN hCV27830265 rs12762303 ALOX5 ATHERO_ ADD G STK hCV27830265 rs12762303 ALOX5 ATHERO_ AGE MALE GEN GG STK DIAB HTN hCV27830265 rs12762303 ALOX5 ATHERO_ AGE MALE REC GG STK DIAB HTN hCV27830265 rs12762303 ALOX5 ATHERO_ AGE MALE DOM GA or GG STK DIAB HTN hCV27830265 rs12762303 ALOX5 EO_STK AGE MALE ADD G DIAB HTN hCV27830265 rs12762303 ALOX5 EO_STK AGE MALE DOM GA or GG DIAB HTN hCV27830265 rs12762303 ALOX5 EO_STK AGE MALE GEN GA DIAB HTN hCV27830265 rs12762303 ALOX5 ISCHEMIC_ GEN GG STK hCV27830265 rs12762303 ALOX5 ISCHEMIC_ REC GG STK hCV27830265 rs12762303 ALOX5 ISCHEMIC_ AGE MALE ADD G STK DIAB HTN hCV27830265 rs12762303 ALOX5 ISCHEMIC_ AGE MALE GEN GG STK DIAB HTN hCV27830265 rs12762303 ALOX5 ISCHEMIC_ AGE MALE REC GG STK DIAB HTN hCV27830265 rs12762303 ALOX5 ISCHEMIC_ ADD G STK hCV27830265 rs12762303 ALOX5 LACUNAR_ AGE MALE ADD G STK DIAB HTN hCV27830265 rs12762303 ALOX5 LACUNAR_ AGE MALE DOM GA or GG STK DIAB HTN hCV27830265 rs12762303 ALOX5 NOHD_STK GEN GG hCV27830265 rs12762303 ALOX5 NOHD_STK REC GG hCV27830265 rs12762303 ALOX5 NOHD_STK AGE MALE ADD G DIAB HTN hCV27830265 rs12762303 ALOX5 NONCE_ AGE MALE ADD G STK DIAB HTN hCV27830265 rs12762303 ALOX5 NONCE_ GEN GG STK hCV27830265 rs12762303 ALOX5 NONCE_ ADD G STK hCV27830265 rs12762303 ALOX5 NONCE_ REC GG STK hCV27830265 rs12762303 ALOX5 NONCE_ AGE MALE DOM GA or GG STK DIAB HTN hCV27830265 rs12762303 ALOX5 NONCE_ AGE MALE GEN GA STK DIAB HTN hCV27830265 rs12762303 ALOX5 NONCE_ DOM GA or GG STK hCV27830265 rs12762303 ALOX5 NONCE_ AGE MALE GEN GG STK DIAB HTN hCV27830265 rs12762303 ALOX5 RECURRENT_ REC GG STK hCV27830265 rs12762303 ALOX5 RECURRENT_ GEN GG STK hCV27830265 rs12762303 ALOX5 RECURRENT_ AGE MALE REC GG STK DIAB HTN hCV27830265 rs12762303 ALOX5 RECURRENT_ AGE MALE GEN GG STK DIAB HTN hCV1053082 rs544115 NEU3 ATHERO_ AGE MALE DOM CT or CC STK DIAB HTN hCV1053082 rs544115 NEU3 ATHERO_ AGE MALE GEN CC STK DIAB HTN hCV1053082 rs544115 NEU3 ATHERO_ AGE MALE GEN CT STK DIAB HTN hCV1053082 rs544115 NEU3 CE_STK AGE MALE GEN CC DIAB HTN hCV1053082 rs544115 NEU3 CE_STK AGE MALE DOM CT or CC DIAB HTN hCV1053082 rs544115 NEU3 CE_STK ADD C hCV1053082 rs544115 NEU3 CE_STK AGE MALE GEN CT DIAB HTN hCV1053082 rs544115 NEU3 CE_STK REC CC hCV1053082 rs544115 NEU3 EO_STK DOM CT or CC hCV1053082 rs544115 NEU3 EO_STK GEN CC hCV1053082 rs544115 NEU3 EO_STK GEN CT hCV1053082 rs544115 NEU3 EO_STK AGE MALE ADD C DIAB HTN hCV1053082 rs544115 NEU3 EO_STK AGE MALE GEN CC DIAB HTN hCV1053082 rs544115 NEU3 EO_STK AGE MALE REC CC DIAB HTN hCV1053082 rs544115 NEU3 ISCHEMIC_ AGE MALE DOM CT or CC STK DIAB HTN hCV1053082 rs544115 NEU3 ISCHEMIC_ AGE MALE GEN CC STK DIAB HTN hCV1053082 rs544115 NEU3 ISCHEMIC_ AGE MALE GEN CT STK DIAB HTN hCV1053082 rs544115 NEU3 ISCHEMIC_ GEN CC STK hCV1053082 rs544115 NEU3 ISCHEMIC_ DOM CT or CC STK hCV1053082 rs544115 NEU3 ISCHEMIC_ GEN CT STK hCV1053082 rs544115 NEU3 ISCHEMIC_ ADD C STK hCV1053082 rs544115 NEU3 NOHD_STK AGE MALE DOM CT or CC DIAB HTN hCV1053082 rs544115 NEU3 NOHD_STK AGE MALE GEN CT DIAB HTN hCV1053082 rs544115 NEU3 NOHD_STK AGE MALE GEN CC DIAB HTN hCV1053082 rs544115 NEU3 NOHD_STK GEN CC hCV1053082 rs544115 NEU3 NOHD_STK DOM CT or CC hCV1053082 rs544115 NEU3 NOHD_STK GEN CT hCV1053082 rs544115 NEU3 NONCE_ AGE MALE DOM CT or CC STK DIAB HTN hCV1053082 rs544115 NEU3 NONCE_ AGE MALE GEN CT STK DIAB HTN hCV1053082 rs544115 NEU3 NONCE_ AGE MALE GEN CC STK DIAB HTN hCV1053082 rs544115 NEU3 NONCE_ DOM CT or CC STK hCV1053082 rs544115 NEU3 NONCE_ GEN CC STK hCV1053082 rs544115 NEU3 NONCE_ GEN CT STK hCV1452085 rs12223005 TRIM22 ISCHEMIC_ AGE MALE GEN CA STK DIAB HTN hCV1452085 rs12223005 TRIM22 LACUNAR_ AGE MALE GEN CA STK DIAB HTN hCV1452085 rs12223005 TRIM22 NOHD_STK AGE MALE GEN CA DIAB HTN hCV1452085 rs12223005 TRIM22 NOHD_STK AGE MALE DOM CA or CC DIAB HTN hCV1452085 rs12223005 TRIM22 NOHD_STK AGE MALE GEN CC DIAB HTN hCV1452085 rs12223005 TRIM22 NONCE_ AGE MALE GEN CA STK DIAB HTN hCV1452085 rs12223005 TRIM22 RECURRENT_ AGE MALE GEN CA STK DIAB HTN hCV302629 rs9284183 UBAC2 EO_STK GEN GA hCV11474611 rs3814843 CALM1 ATHERO_ GEN GT STK hCV11474611 rs3814843 CALM1 CE_STK AGE MALE GEN GG DIAB HTN hCV11474611 rs3814843 CALM1 CE_STK AGE MALE REC GG DIAB HTN hCV1262973 rs229653 PLEKHG3 CE_STK GEN AG hCV27892569 rs4903741 NRXN3 CE_STK GEN CC hCV27892569 rs4903741 NRXN3 CE_STK REC CC hCV27892569 rs4903741 NRXN3 CE_STK ADD C hCV27892569 rs4903741 NRXN3 NOHD_STK ADD C hCV27077072 rs8060368 RECURRENT_ ADD C STK hCV27077072 rs8060368 RECURRENT_ REC CC STK hCV27077072 rs8060368 RECURRENT_ AGE MALE GEN CC STK DIAB HTN hCV32160712 rs11079160 CE_STK GEN TT hCV32160712 rs11079160 CE_STK REC TT hCV32160712 rs11079160 CE_STK ADD T hCV32160712 rs11079160 EO_STK AGE MALE REC TT DIAB HTN hCV32160712 rs11079160 EO_STK AGE MALE GEN TT DIAB HTN hCV32160712 rs11079160 ISCHEMIC_ GEN TT STK hCV32160712 rs11079160 ISCHEMIC_ REC TT STK hCV1619596 rs1048621 SDCBP2 CE_STK AGE MALE GEN AG DIAB HTN hCV1619596 rs1048621 SDCBP2 CE_STK AGE MALE DOM AG or AA DIAB HTN hCV1619596 rs1048621 SDCBP2 CE_STK ADD A hCV1619596 rs1048621 SDCBP2 EO_STK DOM AG or AA hCV1619596 rs1048621 SDCBP2 EO_STK GEN AG hCV1619596 rs1048621 SDCBP2 EO_STK ADD A hCV1619596 rs1048621 SDCBP2 EO_STK AGE MALE DOM AG or AA DIAB HTN hCV1619596 rs1048621 SDCBP2 EO_STK AGE MALE GEN AG DIAB HTN hCV1619596 rs1048621 SDCBP2 ISCHEMIC_ AGE MALE GEN AG STK DIAB HTN hCV1619596 rs1048621 SDCBP2 ISCHEMIC_ AGE MALE DOM AG or AA STK DIAB HTN hCV1619596 rs1048621 SDCBP2 ISCHEMIC_ ADD A STK hCV2358247 rs415989 WFDC3 RECURRENT_ DOM GA or GG STK hCV2358247 rs415989 WFDC3 RECURRENT_ GEN GA STK hCV2358247 rs415989 WFDC3 RECURRENT_ ADD G STK hCV29537898 rs6073804 NOHD_STK GEN TC hCV29537898 rs6073804 NOHD_STK DOM TC or TT hCV29537898 rs6073804 RECURRENT_ DOM TC or TT STK hCV29537898 rs6073804 RECURRENT_ ADD T STK hCV29537898 rs6073804 RECURRENT_ GEN TC STK hCV1723718 rs12481805 UMODL1 EO_STK AGE MALE REC AA DIAB HTN hCV1723718 rs12481805 UMODL1 LACUNAR_ REC AA STK hCV1723718 rs12481805 UMODL1 LACUNAR_ GEN AA STK ProbChi 95% 95% Sq (2- Odds Lower Upper sided p- PVALUE_ hCV # Ratio CL CL value) 2DF hCV1958451 1.753 0.99 3.106 0.0543 0.15583 hCV1958451 1.676 0.974 2.884 0.0623 . hCV1958451 1.565 0.952 2.573 0.0775 0.15311 hCV1958451 1.628 0.935 2.835 0.0852 0.15583 hCV1958451 1.932 0.987 3.781 0.0546 0.06739 hCV27494483 1.575 1.084 2.287 0.0171 0.05794 hCV27494483 1.564 1.081 2.263 0.0176 . hCV27494483 1.522 1.065 2.175 0.0211 . hCV27494483 1.307 0.967 1.765 0.0814 . hCV27494483 1.291 0.966 1.725 0.0847 . hCV27494483 1.306 0.963 1.771 0.0859 0.21896 hCV27504565 2.619 1.242 5.524 0.0115 0.04076 hCV27504565 2.434 1.184 5.002 0.0155 . hCV27504565 2.336 1.127 4.841 0.0225 0.04076 hCV27504565 1.922 1.077 3.43 0.027 0.08635 hCV27504565 1.858 1.06 3.256 0.0306 . hCV27504565 1.821 1.032 3.212 0.0385 0.08635 hCV27504565 1.416 0.957 2.095 0.0819 0.13029 hCV27504565 1.527 0.985 2.369 0.0585 0.11469 hCV27504565 1.706 0.952 3.055 0.0725 0.18169 hCV27504565 1.811 0.973 3.371 0.061 0.10231 hCV27504565 1.487 0.943 2.346 0.0877 0.12763 hCV27504565 2.79 0.968 8.046 0.0575 0.15677 hCV27504565 2.47 0.893 6.833 0.0817 . hCV8754449 2.155 1.043 4.452 0.0381 0.11587 hCV8754449 2.021 1.004 4.065 0.0486 . hCV8754449 1.768 1.002 3.119 0.049 0.1425 hCV8754449 1.724 0.995 2.986 0.0521 . hCV8754449 1.698 0.974 2.96 0.0619 0.1425 hCV8754449 1.949 0.96 3.955 0.0647 0.11587 hCV8754449 2.615 0.909 7.524 0.0747 0.20413 hCV8754449 2.421 0.876 6.693 0.0883 . hCV2091644 1.275 0.956 1.699 0.0984 . hCV8820007 1.597 0.953 2.678 0.0757 0.18574 hCV8820007 1.387 0.953 2.02 0.0876 0.11797 hCV8820007 1.511 0.927 2.463 0.0975 0.21063 hCV8820007 1.624 1.065 2.478 0.0243 0.01745 hCV8820007 1.751 1.027 2.984 0.0396 0.07825 hCV8820007 1.543 0.929 2.564 0.094 . hCV8820007 1.404 0.937 2.102 0.0998 . hCV11354788 1.379 1.016 1.871 0.0394 . hCV11354788 1.419 1.012 1.99 0.0423 . hCV11354788 1.397 0.987 1.977 0.0592 0.11826 hCV11354788 1.274 0.99 1.639 0.0597 . hCV11354788 1.275 0.984 1.653 0.066 0.16972 hCV11354788 1.231 0.982 1.542 0.0711 . hCV11354788 1.501 1.205 1.869 0.0003 . hCV11354788 1.56 1.216 2.002 0.0005 . hCV11354788 1.633 1.215 2.196 0.0011 . hCV11354788 1.712 1.227 2.39 0.0016 . hCV11354788 1.51 1.166 1.956 0.0018 0.00137 hCV11354788 1.652 1.17 2.332 0.0043 0.00498 hCV11354788 2.198 1.061 4.556 0.0341 0.00137 hCV11354788 1.996 0.966 4.125 0.0619 . hCV11354788 2.533 0.921 6.962 0.0716 0.00498 hCV11354788 1.432 1.068 1.922 0.0165 . hCV11354788 1.413 1.06 1.883 0.0184 . hCV11354788 1.365 1.053 1.768 0.0186 . hCV11354788 1.466 1.057 2.032 0.0217 . hCV11354788 1.396 1.038 1.876 0.0273 0.05898 hCV11354788 1.423 1.017 1.991 0.0396 0.0564 hCV11354788 1.356 1.113 1.652 0.0025 . hCV11354788 1.309 1.097 1.563 0.0029 . hCV11354788 1.346 1.099 1.65 0.0041 0.0099 hCV11354788 1.367 1.077 1.735 0.0102 . hCV11354788 1.404 1.077 1.831 0.0122 . hCV11354788 1.376 1.047 1.809 0.022 0.03661 hCV11354788 1.31 1.083 1.585 0.0053 . hCV11354788 1.345 1.086 1.666 0.0065 . hCV11354788 1.321 1.059 1.647 0.0135 0.02034 hCV11354788 1.354 1.052 1.743 0.0188 . hCV11354788 1.375 1.036 1.825 0.0275 . hCV11354788 1.332 0.995 1.784 0.0544 0.06231 hCV11354788 1.248 0.99 1.573 0.0613 0.17362 hCV11354788 1.233 0.984 1.545 0.0692 . hCV11354788 1.295 0.953 1.758 0.0982 . hCV11354788 2.096 1.252 3.509 0.0049 0.01709 hCV11354788 1.962 1.187 3.243 0.0086 . hCV11354788 1.701 1.072 2.7 0.0241 . hCV11354788 1.383 0.979 1.955 0.066 . hCV11354788 1.382 0.968 1.973 0.075 0.1844 hCV11354788 1.321 0.972 1.796 0.0752 . hCV16158671 1.415 1.045 1.915 0.0248 . hCV16158671 1.442 1.028 2.023 0.0339 . hCV16158671 1.304 1.013 1.679 0.039 . hCV16158671 1.257 1.005 1.573 0.0456 . hCV16158671 1.302 1.003 1.69 0.047 0.11865 hCV16158671 1.397 0.986 1.98 0.06 0.07966 hCV16158671 1.509 1.213 1.879 0.0002 . hCV16158671 1.585 1.235 2.035 0.0003 . hCV16158671 1.543 1.191 1.999 0.001 0.00106 hCV16158671 1.631 1.216 2.189 0.0011 . hCV16158671 1.733 1.241 2.42 0.0012 . hCV16158671 1.684 1.192 2.381 0.0032 0.00458 hCV16158671 2.083 1.015 4.275 0.0454 0.00106 hCV16158671 1.883 0.92 3.853 0.0832 . hCV16158671 2.319 0.869 6.191 0.093 0.00458 hCV16158671 1.426 1.069 1.901 0.0156 . hCV16158671 1.364 1.055 1.763 0.0178 . hCV16158671 1.409 1.052 1.887 0.0215 . hCV16158671 1.415 1.051 1.905 0.022 0.05284 hCV16158671 1.448 1.044 2.008 0.0267 . hCV16158671 1.409 1.006 1.975 0.0461 0.07117 hCV16158671 1.376 1.13 1.677 0.0015 . hCV16158671 1.324 1.11 1.579 0.0018 . hCV16158671 1.365 1.113 1.674 0.0028 0.00631 hCV16158671 1.375 1.085 1.742 0.0083 . hCV16158671 1.413 1.083 1.843 0.0109 . hCV16158671 1.378 1.047 1.813 0.0222 0.03074 hCV16158671 1.327 1.099 1.603 0.0032 . hCV16158671 1.366 1.103 1.691 0.0042 . hCV16158671 1.337 1.072 1.668 0.0101 0.01299 hCV16158671 1.366 1.063 1.754 0.0147 . hCV16158671 1.384 1.042 1.838 0.0247 . hCV16158671 1.33 0.992 1.783 0.0569 0.04871 hCV16158671 2.103 0.891 4.961 0.0896 0.04871 hCV16158671 1.251 0.998 1.568 0.0518 . hCV16158671 1.259 0.998 1.588 0.0525 0.14733 hCV16158671 1.206 0.985 1.475 0.0696 . hCV16158671 1.274 0.967 1.679 0.0852 . hCV16158671 1.297 0.954 1.761 0.0967 . hCV16158671 2.087 1.24 3.512 0.0056 0.01904 hCV16158671 1.943 1.171 3.225 0.0102 . hCV16158671 1.671 1.053 2.652 0.0294 . hCV16158671 1.375 0.971 1.948 0.0728 . hCV16158671 1.38 0.964 1.975 0.0786 0.19939 hCV16158671 1.307 0.961 1.776 0.0879 . hCV16336 1.377 1.032 1.837 0.0298 . hCV16336 1.315 1.013 1.707 0.0399 . hCV16336 1.39 0.96 2.013 0.0812 . hCV16336 1.523 1.147 2.022 0.0036 . hCV16336 1.525 1.126 2.066 0.0065 . hCV16336 1.49 1.033 2.148 0.0328 . hCV16336 1.52 1.028 2.247 0.036 . hCV16336 3.625 0.825 15.926 0.0881 0.01511 hCV16336 1.659 1.156 2.381 0.0061 . hCV16336 1.559 1.11 2.188 0.0103 . hCV16336 1.389 1.014 1.904 0.0407 . hCV16336 1.355 1.01 1.819 0.0427 . hCV16336 1.379 1.127 1.686 0.0018 . hCV16336 1.41 1.131 1.758 0.0023 . hCV16336 1.377 1.052 1.803 0.0198 . hCV16336 1.417 1.056 1.901 0.0203 . hCV16336 1.227 0.99 1.521 0.0619 . hCV16336 1.248 0.986 1.581 0.0658 . hCV16336 1.345 1.046 1.73 0.0211 . hCV16336 1.3 1.035 1.633 0.0244 . hCV16336 1.39 0.999 1.935 0.0508 . hCV16336 1.346 0.997 1.816 0.0521 . hCV26478797 1.205 0.965 1.505 0.099 . hCV11425801 1.99 1.402 2.824 0.0001 0.0005 hCV11425801 1.726 1.251 2.38 0.0009 . hCV11425801 1.539 1.183 2.002 0.0013 0.00531 hCV11425801 1.481 1.159 1.892 0.0017 . hCV11425801 1.179 1.019 1.363 0.0271 . hCV11425801 1.385 1.028 1.865 0.0323 0.00531 hCV11425801 1.18 0.974 1.429 0.0913 . hCV11425801 1.639 1.226 2.192 0.0009 0.00345 hCV11425801 1.718 1.229 2.4 0.0015 0.00399 hCV11425801 1.484 1.135 1.939 0.0038 . hCV11425801 1.483 1.092 2.015 0.0116 . hCV11425801 1.617 1.235 2.116 0.0005 0.00176 hCV11425801 1.453 1.135 1.86 0.003 . hCV11425801 1.321 1.082 1.612 0.0062 0.02335 hCV11425801 1.276 1.062 1.534 0.0094 . hCV11425801 1.104 0.985 1.236 0.0889 . hCV11425801 1.826 1.186 2.811 0.0063 0.01078 hCV11425801 1.51 1.014 2.25 0.0427 . hCV11425801 1.368 0.973 1.923 0.0715 0.11508 hCV11425801 1.641 1.229 2.19 0.0008 0.00304 hCV11425801 1.472 1.13 1.916 0.0041 . hCV11425801 1.276 1.043 1.559 0.0176 . hCV11425801 1.295 1.041 1.61 0.0201 0.05622 hCV11425801 1.12 0.991 1.266 0.07 . hCV11425801 1.244 0.973 1.591 0.0821 0.05622 hCV11425801 1.689 1.268 2.251 0.0003 . hCV11425801 1.48 1.176 1.862 0.0008 0.00363 hCV11425801 1.393 1.125 1.725 0.0023 . hCV11425801 1.126 0.989 1.282 0.0732 . hCV11425801 1.249 0.96 1.625 0.0971 0.00363 hCV11425801 1.636 0.988 2.71 0.0556 0.12066 hCV11425801 1.368 0.951 1.967 0.091 0.22257 hCV11425842 1.483 1.042 2.111 0.0286 . hCV11425842 1.508 1.036 2.195 0.032 0.08825 hCV11425842 1.281 0.979 1.676 0.0707 . hCV11425842 1.445 0.961 2.172 0.077 0.08825 hCV11425842 1.292 0.972 1.717 0.0777 0.19224 hCV11425842 1.44 1.056 1.965 0.0214 0.06697 hCV11425842 1.4 1.047 1.871 0.0232 . hCV11425842 1.497 1.048 2.138 0.0267 0.08575 hCV11425842 1.418 1.016 1.978 0.0399 . hCV11425842 1.338 0.953 1.878 0.0927 0.06697 hCV11425842 1.334 0.998 1.785 0.0518 0.1427 hCV11425842 1.309 0.997 1.719 0.0525 . hCV11425842 1.435 1.028 2.005 0.0341 0.10566 hCV11425842 1.379 1.008 1.886 0.0444 . hCV1209800 1.54 0.995 2.384 0.0529 . hCV1209800 1.497 0.985 2.277 0.059 . hCV16134786 1.287 1.044 1.587 0.018 . hCV16134786 1.967 1.08 3.581 0.0269 0.0477 hCV16134786 1.845 1.02 3.336 0.0428 . hCV16134786 1.283 0.999 1.65 0.0513 . hCV16134786 2.149 1.196 3.86 0.0105 0.0372 hCV16134786 2.114 1.189 3.76 0.0108 . hCV16134786 1.243 0.98 1.578 0.073 . hCV16134786 1.158 0.984 1.363 0.0777 . hCV16134786 1.501 0.953 2.365 0.0799 0.16516 hCV25651109 8.255 1.015 67.158 0.0484 0.13989 hCV25651109 8.232 1.012 66.954 0.0487 . hCV25651109 7.978 0.963 66.101 0.0542 0.13989 hCV25651109 6.169 0.743 51.25 0.0921 0.2415 hCV25651109 5.892 0.724 47.938 0.0973 . hCV25651109 5.866 0.721 47.736 0.0981 0.2415 hCV30308202 1.354 1.016 1.803 0.0384 . hCV30308202 3.706 1.016 13.521 0.0473 0.12903 hCV30308202 3.537 0.978 12.795 0.0542 . hCV30308202 1.349 0.975 1.868 0.0712 . hCV30308202 3.204 0.854 12.028 0.0845 0.12903 hCV30308202 2.419 0.856 6.839 0.0956 0.11116 hCV3082219 1.273 0.982 1.65 0.0681 . hCV3082219 1.399 1.049 1.867 0.0225 . hCV3082219 1.424 1.035 1.959 0.03 . hCV3082219 1.391 1.003 1.93 0.0483 0.07365 hCV3082219 1.213 0.991 1.485 0.0608 . hCV3082219 1.227 0.984 1.529 0.0688 . hCV3082219 1.214 0.969 1.52 0.0917 0.17242 hCV8942032 1.484 1.127 1.954 0.0049 . hCV8942032 1.488 1.12 1.978 0.0062 0.01912 hCV8942032 1.394 1.092 1.78 0.0077 . hCV8942032 1.513 1.09 2.101 0.0134 0.04543 hCV8942032 1.486 1.083 2.038 0.0142 . hCV8942032 1.37 1.037 1.81 0.0265 . hCV8942032 1.383 1.056 1.811 0.0183 0.061 hCV8942032 1.341 1.035 1.737 0.0262 . hCV8942032 1.241 0.991 1.554 0.0604 . hCV8942032 1.208 0.988 1.476 0.0658 0.17422 hCV8942032 1.178 0.972 1.428 0.0949 . hCV8942032 1.803 1.207 2.694 0.004 . hCV8942032 1.64 1.165 2.307 0.0046 . hCV8942032 1.77 1.166 2.689 0.0074 0.01502 hCV8942032 1.418 1.036 1.942 0.0294 . hCV8942032 1.328 1.023 1.725 0.0333 . hCV8942032 1.405 1.01 1.954 0.0435 0.09148 hCV8942032 1.358 1.021 1.807 0.0355 0.09951 hCV8942032 1.309 0.994 1.723 0.0554 . hCV8942032 1.218 0.98 1.513 0.0749 0.10394 hCV8942032 1.419 1.047 1.923 0.0242 0.07825 hCV8942032 1.377 1.027 1.845 0.0323 . hCV8942032 1.244 0.992 1.559 0.0585 0.1603 hCV8942032 1.269 0.983 1.637 0.0672 . hCV8942032 1.211 0.975 1.504 0.0833 . hCV8942032 1.953 1.219 3.129 0.0054 . hCV8942032 1.965 1.206 3.201 0.0067 0.02072 hCV8942032 1.728 1.15 2.594 0.0084 . hCV8942032 1.415 1.001 2.001 0.0494 0.14433 hCV8942032 1.384 0.992 1.931 0.0561 . hCV8942032 1.269 0.959 1.68 0.0956 . hCV25596936 1.432 1.071 1.913 0.0153 0.03518 hCV25596936 1.345 1.017 1.779 0.038 . hCV25596936 1.263 0.997 1.601 0.0533 0.04107 hCV25596936 1.433 0.981 2.092 0.0627 0.15123 hCV25596936 1.302 1.01 1.679 0.0419 0.06504 hCV25596936 1.438 1.108 1.865 0.0063 0.01473 hCV25596936 1.352 1.052 1.736 0.0183 . hCV25596936 1.224 0.981 1.526 0.0731 . hCV27511436 2.706 1.389 5.271 0.0034 0.00764 hCV27511436 2.877 1.272 6.508 0.0111 0.03448 hCV27511436 2.231 1.18 4.22 0.0136 . hCV27511436 2.105 1.11 3.993 0.0227 0.00764 hCV27511436 2.397 1.108 5.184 0.0263 . hCV27511436 2.271 1.046 4.93 0.0381 0.03448 hCV27511436 2.392 1.294 4.422 0.0054 0.00015 hCV27511436 3.084 1.383 6.875 0.0059 0.00609 hCV27511436 2.257 1.055 4.828 0.0359 . hCV27511436 2.025 0.943 4.352 0.0705 0.00609 hCV27511436 1.647 0.917 2.958 0.0946 . hCV27511436 5.062 2.211 11.593 0.0001 0.00053 hCV27511436 4.226 1.901 9.394 0.0004 . hCV27511436 4.83 1.964 11.882 0.0006 0.00223 hCV27511436 3.983 1.786 8.882 0.0007 0.00053 hCV27511436 3.916 1.653 9.279 0.0019 . hCV27511436 3.668 1.542 8.725 0.0033 0.00223 hCV27511436 3.449 1.798 6.618 0.0002 0.00063 hCV27511436 2.217 1.397 3.521 0.0007 . hCV27511436 2.78 1.498 5.158 0.0012 . hCV27511436 2.59 1.392 4.82 0.0027 0.00063 hCV27511436 2.033 1.277 3.236 0.0028 0.00001 hCV27511436 12.63 2.356 67.742 0.0031 0.00773 hCV27511436 8.049 1.905 34.008 0.0046 0.00667 hCV27511436 9.88 1.896 51.473 0.0065 . hCV27511436 9.1 1.743 47.499 0.0088 0.00773 hCV27511436 6.318 1.528 26.128 0.0109 . hCV27511436 5.858 1.413 24.288 0.0148 0.00667 hCV27511436 2.83 1.661 4.824 0.0001 0.00002 hCV27511436 3.231 1.612 6.479 0.001 0.00243 hCV27511436 2.088 1.258 3.467 0.0044 . hCV27511436 2.586 1.334 5.012 0.0049 . hCV27511436 2.4 1.235 4.665 0.0098 0.00243 hCV27511436 1.891 1.135 3.149 0.0144 0.00002 hCV27511436 3.955 1.807 8.657 0.0006 0.00244 hCV27511436 2.827 1.555 5.142 0.0007 . hCV27511436 2.657 1.457 4.843 0.0014 0.00023 hCV27511436 3.312 1.571 6.985 0.0017 . hCV27511436 3.137 1.483 6.636 0.0028 0.00244 hCV29401764 1.633 0.952 2.798 0.0746 0.17293 hCV15857769 1.187 1.011 1.394 0.0361 . hCV15857769 1.255 1.011 1.557 0.0391 . hCV15857769 1.23 0.979 1.545 0.0756 0.1026 hCV15857769 1.532 0.946 2.48 0.0827 0.21882 hCV15857769 1.36 0.947 1.952 0.096 0.1026 hCV15857769 1.295 1.029 1.63 0.0275 0.0333 hCV15857769 1.209 0.97 1.507 0.0919 . hCV15857769 1.252 1.05 1.493 0.0124 0.04329 hCV15857769 1.219 1.031 1.441 0.0203 . hCV15857769 1.117 0.983 1.27 0.0904 . hCV15857769 1.263 1.043 1.53 0.0167 0.05587 hCV15857769 1.228 1.024 1.474 0.0271 . hCV15857769 1.226 1.013 1.483 0.0365 . hCV15857769 1.224 1.001 1.497 0.0489 0.11225 hCV15857769 1.149 0.996 1.327 0.057 . hCV15857769 1.788 1.299 2.463 0.0004 0.00102 hCV15857769 1.641 1.203 2.238 0.0018 . hCV15857769 1.733 1.112 2.701 0.0151 0.04261 hCV15857769 1.596 1.042 2.443 0.0315 . hCV15857769 1.259 1.003 1.58 0.0471 . hCV29539757 1.401 0.977 2.009 0.0671 0.0978 hCV1348610 1.307 1.014 1.685 0.0389 0.11763 hCV1348610 1.262 0.993 1.602 0.0567 . hCV1348610 1.285 0.981 1.683 0.0688 0.15881 hCV1348610 1.283 0.96 1.714 0.0923 0.22581 hCV26505812 1.363 0.956 1.943 0.0866 . hCV26505812 1.32 0.959 1.818 0.0886 . hCV2169762 1.479 1.172 1.866 0.001 0.00436 hCV2169762 1.422 1.139 1.774 0.0018 . hCV2169762 1.216 1.033 1.433 0.0189 . hCV2169762 1.401 1.046 1.876 0.0237 . hCV2169762 1.41 1.038 1.916 0.0281 0.07665 hCV2169762 1.25 1.003 1.559 0.0473 . hCV2169762 1.493 0.946 2.357 0.0852 . hCV2169762 1.246 1.052 1.476 0.0108 . hCV2169762 1.233 1.043 1.456 0.014 . hCV2169762 1.31 1.046 1.641 0.0187 . hCV2169762 1.236 1.035 1.476 0.0192 0.04864 hCV2169762 1.536 1.045 2.259 0.0291 0.03859 hCV2169762 1.148 1.014 1.301 0.0296 . hCV2169762 1.258 0.991 1.597 0.0589 0.03859 hCV2169762 1.382 0.955 2 0.0861 . hCV2169762 1.362 0.949 1.955 0.0934 . hCV2169762 1.35 1.125 1.619 0.0012 . hCV2169762 1.354 1.116 1.642 0.0021 0.00545 hCV2169762 1.218 1.064 1.395 0.0042 . hCV2169762 1.281 1.069 1.534 0.0073 . hCV2169762 1.386 1.089 1.763 0.0079 . hCV2169762 1.347 1.044 1.737 0.0221 0.02354 hCV2169762 1.553 1.031 2.34 0.035 0.02354 hCV2169762 1.335 0.985 1.809 0.063 0.00545 hCV2169762 1.497 0.971 2.308 0.0677 0.17878 hCV2169762 1.188 0.981 1.438 0.0774 . hCV2169762 1.422 0.939 2.153 0.0966 . hCV27830265 2.437 1.292 4.596 0.0059 0.01855 hCV27830265 2.354 1.254 4.421 0.0077 . hCV27830265 1.051 0.0204 1.38 1.812 . hCV27830265 1.256 1.027 1.535 0.0262 . hCV27830265 2.705 1.09 6.711 0.0318 0.04449 hCV27830265 2.508 1.018 6.179 0.0456 . hCV27830265 1.356 0.997 1.845 0.0522 . hCV27830265 1.294 0.988 1.697 0.0616 . hCV27830265 1.322 0.979 1.786 0.0687 . hCV27830265 1.302 0.956 1.772 0.0938 0.17365 hCV27830265 1.909 1.098 3.32 0.0219 0.06853 hCV27830265 1.88 1.084 3.26 0.0246 . hCV27830265 1.231 0.99 1.53 0.0618 . hCV27830265 2.011 0.94 4.304 0.0719 0.12112 hCV27830265 1.923 0.902 4.099 0.0903 . hCV27830265 1.146 0.977 1.344 0.0941 . hCV27830265 1.391 0.982 1.972 0.0632 . hCV27830265 1.408 0.958 2.069 0.082 . hCV27830265 1.889 1.048 3.404 0.0342 0.10105 hCV27830265 1.859 1.035 3.339 0.0381 . hCV27830265 1.246 0.988 1.571 0.0637 . hCV27830265 1.376 1.074 1.761 0.0114 . hCV27830265 2.132 1.172 3.878 0.0132 0.02459 hCV27830265 1.248 1.042 1.493 0.0158 . hCV27830265 2.037 1.124 3.693 0.019 . hCV27830265 1.386 1.051 1.83 0.021 . hCV27830265 1.335 1.004 1.775 0.0472 0.03807 hCV27830265 1.221 0.996 1.497 0.0553 . hCV27830265 2.187 0.939 5.093 0.0697 0.03807 hCV27830265 3.032 1.42 6.474 0.0042 . hCV27830265 2.907 1.354 6.243 0.0062 0.01156 hCV27830265 4.128 1.238 13.766 0.021 . hCV27830265 4.048 1.205 13.592 0.0237 0.06695 hCV1053082 2.424 1.101 5.338 0.028 . hCV1053082 2.412 1.089 5.342 0.03 0.08891 hCV1053082 2.452 1.079 5.571 0.0322 0.08891 hCV1053082 2.519 1.057 6.004 0.0372 0.11133 hCV1053082 2.464 1.039 5.844 0.0406 . hCV1053082 1.228 1.001 1.508 0.0494 . hCV1053082 2.339 0.958 5.715 0.0622 0.11133 hCV1053082 1.233 0.972 1.564 0.084 . hCV1053082 2.443 1.139 5.24 0.0218 . hCV1053082 2.453 1.139 5.282 0.0219 0.07158 hCV1053082 2.419 1.101 5.313 0.0278 0.07158 hCV1053082 1.306 1.002 1.703 0.0483 . hCV1053082 2.182 0.894 5.324 0.0865 0.11774 hCV1053082 1.297 0.959 1.752 0.0909 . hCV1053082 2.441 1.274 4.675 0.0071 . hCV1053082 2.438 1.267 4.689 0.0076 0.02673 hCV1053082 2.449 1.249 4.801 0.0091 0.02673 hCV1053082 1.695 1.052 2.732 0.0302 0.08337 hCV1053082 1.658 1.032 2.664 0.0365 . hCV1053082 1.577 0.965 2.576 0.0691 0.08337 hCV1053082 1.152 0.989 1.343 0.0698 . hCV1053082 2.225 1.109 4.465 0.0244 . hCV1053082 2.282 1.109 4.692 0.025 0.07672 hCV1053082 2.202 1.092 4.438 0.0274 0.07672 hCV1053082 1.715 1.006 2.924 0.0475 0.13875 hCV1053082 1.695 0.998 2.88 0.0509 . hCV1053082 1.651 0.955 2.855 0.0727 0.13875 hCV1053082 2.388 1.164 4.897 0.0175 . hCV1053082 2.451 1.164 5.163 0.0183 0.05761 hCV1053082 2.36 1.145 4.866 0.02 0.05761 hCV1053082 1.684 0.963 2.945 0.0673 . hCV1053082 1.69 0.963 2.966 0.0674 0.18668 hCV1053082 1.672 0.939 2.977 0.0808 0.18668 hCV1452085 2.844 0.95 8.517 0.0617 0.07446 hCV1452085 8.604 0.863 85.766 0.0666 0.00063 hCV1452085 4.953 1.405 17.456 0.0128 0.01831 hCV1452085 3.875 1.132 13.267 0.031 . hCV1452085 3.687 1.075 12.65 0.038 0.01831 hCV1452085 2.892 0.881 9.491 0.0798 0.03384 hCV1452085 12.05 0.995 145.92 0.0505 0.02942 hCV302629 1.268 0.982 1.638 0.0684 0.16605 hCV11474611 1.408 0.962 2.061 0.0785 0.15447 hCV11474611 7.206 0.691 75.167 0.0988 0.25264 hCV11474611 7.176 0.688 74.834 0.0995 . hCV1262973 1.33 0.99 1.789 0.0586 0.03312 hCV27892569 1.569 1.022 2.409 0.0394 0.11153 hCV27892569 1.514 0.996 2.303 0.0525 . hCV27892569 1.184 0.993 1.412 0.06 . hCV27892569 1.139 0.982 1.32 0.0847 . hCV27077072 1.253 0.99 1.587 0.0605 . hCV27077072 1.308 0.967 1.77 0.0816 . hCV27077072 1.952 0.901 4.23 0.0899 0.22584 hCV32160712 1.93 1.061 3.512 0.0313 0.0843 hCV32160712 1.872 1.034 3.391 0.0385 . hCV32160712 1.213 0.988 1.489 0.0648 . hCV32160712 2.382 1.026 5.532 0.0435 . hCV32160712 2.361 1.011 5.513 0.047 0.12823 hCV32160712 1.563 0.953 2.565 0.0772 0.1756 hCV32160712 1.529 0.935 2.502 0.0907 . hCV1619596 1.412 1.038 1.92 0.0281 0.08963 hCV1619596 1.362 1.017 1.823 0.0382 . hCV1619596 1.168 0.982 1.389 0.0794 . hCV1619596 1.314 1.03 1.677 0.0281 . hCV1619596 1.33 1.029 1.719 0.0292 0.08594 hCV1619596 1.205 0.993 1.461 0.0586 . hCV1619596 1.295 0.979 1.713 0.0699 . hCV1619596 1.298 0.967 1.741 0.0822 0.1932 hCV1619596 1.271 1.001 1.612 0.0486 0.14298 hCV1619596 1.239 0.989 1.554 0.0629 . hCV1619596 1.125 0.985 1.284 0.0826 . hCV2358247 1.521 0.989 2.34 0.0561 . hCV2358247 1.527 0.987 2.363 0.0574 0.16029 hCV2358247 1.468 0.978 2.204 0.0636 . hCV29537898 1.303 1.011 1.679 0.0406 0.06312 hCV29537898 1.258 0.98 1.614 0.0712 . hCV29537898 1.866 1.288 2.703 0.001 . hCV29537898 1.749 1.25 2.448 0.0011 . hCV29537898 1.848 1.264 2.701 0.0015 0.00417 hCV1723718 1.543 0.928 2.565 0.0944 . hCV1723718 1.773 1.119 2.809 0.0147 . hCV1723718 1.632 1.011 2.633 0.045 0.02572
TABLE-US-00021 TABLE 21 ProbChi 95% 95% Sq (2- GENO- Odds Lower Upper sided p- PVALUE_ hCV # rs # Gene OUTCOME ADJUST MODE TYPE Ratio CL CL value) 2DF hCV11548152 rs11580249 EO_STK AGE GEN TG 1.231 0.899 1.686 0.1947 0.43131 MALE DIAB HTN hCV1958451 rs2985822 MIER1 EO_STK DOM GT or 1.409 0.879 2.258 0.1545 — GG hCV1958451 rs2985822 MIER1 ISCHEMIC_STK GEN GT 1.279 0.909 1.8 0.1576 0.08689 hCV1958451 rs2985822 MIER1 LACUNAR_STK DOM GT or 1.638 0.857 3.131 0.1351 — GG hCV1958451 rs2985822 MIER1 LACUNAR_STK AGE GEN GT 1.734 0.753 3.995 0.196 0.39776 MALE DIAB HTN hCV1958451 rs2985822 MIER1 NOHD_STK GEN GT 1.284 0.887 1.859 0.1849 0.03579 hCV1958451 rs2985822 MIER1 NONCE_STK GEN GT 1.361 0.915 2.024 0.1281 0.13834 hCV27494483 rs3748743 SLC22A15 CE_STK AGE GEN TC 1.433 0.867 2.366 0.1602 0.27105 MALE DIAB HTN hCV27504565 rs3219489 MUTYH ISCHEMIC_STK DOM CG or 1.305 0.896 1.901 0.1656 — CC hCV27504565 rs3219489 MUTYH NOHD_STK GEN CC 1.339 0.872 2.055 0.1821 0.11469 hCV27504565 rs3219489 MUTYH NOHD_STK DOM CG or 1.407 0.922 2.146 0.1129 — CC hCV27504565 rs3219489 MUTYH NOHD_STK AGE GEN CC 1.519 0.859 2.683 0.1503 0.18169 MALE DIAB HTN hCV27504565 rs3219489 MUTYH NOHD_STK AGE DOM CG or 1.587 0.906 2.782 0.1066 — MALE CC DIAB HTN hCV27504565 rs3219489 MUTYH NONCE_STK DOM CG or 1.351 0.871 2.095 0.1786 — CC hCV27504565 rs3219489 MUTYH NONCE_STK AGE DOM CG or 1.593 0.877 2.895 0.1265 — MALE CC DIAB HTN hCV27504565 rs3219489 MUTYH RECURRENT_STK AGE GEN CC 2.313 0.826 6.477 0.1106 0.15677 MALE DIAB HTN hCV31227848 rs11809423 HIVEP3 ATHERO_STK GEN TC 1.404 0.927 2.128 0.1094 0.06604 hCV31227848 rs11809423 HIVEP3 NOHD_STK GEN TC 1.284 0.889 1.853 0.1822 0.0563 hCV31227848 rs11809423 HIVEP3 NONCE_STK GEN TC 1.327 0.908 1.939 0.1434 0.12332 hCV454333 rs10916581 NVL RECURRENT_STK GEN CT 5.03 0.664 38.1 0.1179 0.09083 hCV454333 rs10916581 NVL RECURRENT_STK GEN CC 3.778 0.504 28.32 0.1959 0.09083 hCV454333 rs10916581 NVL RECURRENT_STK DOM CT or 4.101 0.548 30.66 0.1692 — CC hCV8754449 rs781226 TESK2 NOHD_STK GEN CT 1.375 0.894 2.114 0.1474 0.25013 hCV8754449 rs781226 TESK2 NOHD_STK AGE GEN CT 1.508 0.856 2.656 0.1552 0.34108 MALE DIAB HTN hCV8754449 rs781226 TESK2 NONCE_STK AGE GEN CT 1.536 0.841 2.803 0.1625 0.25117 MALE DIAB HTN hCV8754449 rs781226 TESK2 RECURRENT_STK AGE GEN CC 2.321 0.83 6.495 0.1087 0.20413 MALE DIAB HTN hCV2091644 rs1010 VAMP8 CE_STK GEN CC 1.287 0.933 1.776 0.1236 0.25285 hCV2091644 rs1010 VAMP8 CE_STK ADD C 1.114 0.952 1.305 0.1788 — hCV2091644 rs1010 VAMP8 EO_STK AGE GEN CT 1.238 0.912 1.682 0.1714 0.34826 MALE DIAB HTN hCV2091644 rs1010 VAMP8 ISCHEMIC_STK GEN CC 1.189 0.927 1.524 0.1731 0.28614 hCV2091644 rs1010 VAMP8 ISCHEMIC_STK REC CC 1.198 0.957 1.499 0.115 — hCV2091644 rs1010 VAMP8 RECURRENT_STK AGE GEN CT 1.385 0.865 2.216 0.1753 0.3581 MALE DIAB HTN hCV7425232 rs3900940 MYH15 EO_STK AGE DOM CT or 1.208 0.913 1.596 0.1853 — MALE CC DIAB HTN hCV8820007 rs938390 ATHERO_STK GEN TT 1.428 0.865 2.359 0.1639 0.18574 hCV8820007 rs938390 ATHERO_STK DOM TA or 1.486 0.906 2.437 0.1171 — TT hCV8820007 rs938390 ATHERO_STK AGE GEN TA 1.603 0.846 3.038 0.1475 0.28036 MALE DIAB HTN hCV8820007 rs938390 CE_STK GEN TA 1.389 0.846 2.282 0.194 0.14033 hCV8820007 rs938390 EO_STK GEN TA 1.523 0.889 2.609 0.1254 0.30388 hCV8820007 rs938390 EO_STK DOM TA or 1.432 0.862 2.379 0.1661 — TT hCV8820007 rs938390 EO_STK AGE GEN TA 1.659 0.904 3.046 0.1025 0.25362 MALE DIAB HTN hCV8820007 rs938390 EO_STK AGE GEN TT 1.463 0.818 2.616 0.1998 0.25362 MALE DIAB HTN hCV8820007 rs938390 EO_STK AGE DOM TA or 1.525 0.861 2.704 0.1482 — MALE TT DIAB HTN hCV8820007 rs938390 ISCHEMIC_STK AGE DOM TA or 1.382 0.871 2.194 0.1698 — MALE TT DIAB HTN hCV8820007 rs938390 NOHD_STK AGE GEN TT 1.434 0.856 2.403 0.1711 0.07825 MALE DIAB HTN hCV8820007 rs938390 NONCE_STK GEN TA 1.386 0.897 2.142 0.1412 0.28065 hCV8820007 rs938390 NONCE_STK AGE GEN TA 1.555 0.891 2.713 0.1203 0.27256 MALE DIAB HTN hCV8820007 rs938390 NONCE_STK AGE DOM TA or 1.431 0.845 2.423 0.1829 — MALE TT DIAB HTN hCV8820007 rs938390 RECURRENT_STK GEN TA 1.702 0.812 3.567 0.1592 0.19862 hCV11354788 rs12644625 LOC729065 CE_STK AGE REC TT 2.249 0.823 6.145 0.1141 — MALE DIAB HTN hCV11354788 rs12644625 LOC729065 EO_STK AGE GEN TT 2.129 0.727 6.236 0.1683 0.0564 MALE DIAB HTN hCV11354788 rs12644625 LOC729065 ISCHEMIC_STK AGE GEN TT 1.8 0.759 4.269 0.1821 0.03661 MALE DIAB HTN hCV11354788 rs12644625 LOC729065 NOHD_STK GEN TT 1.651 0.849 3.213 0.1397 0.02034 hCV11354788 rs12644625 LOC729065 NOHD_STK REC TT 1.552 0.799 3.015 0.1942 — hCV11354788 rs12644625 LOC729065 NOHD_STK AGE GEN TT 1.985 0.81 4.86 0.1337 0.06231 MALE DIAB HTN hCV11354788 rs12644625 LOC729065 NOHD_STK AGE REC TT 1.86 0.761 4.543 0.1733 — MALE DIAB HTN hCV11354788 rs12644625 LOC729065 NONCE_STK ADD T 1.186 0.967 1.454 0.1013 — hCV11354788 rs12644625 LOC729065 NONCE_STK AGE GEN TC 1.288 0.941 1.763 0.1139 0.25236 MALE DIAB HTN hCV11354788 rs12644625 LOC729065 NONCE_STK AGE ADD T 1.261 0.955 1.666 0.102 — MALE DIAB HTN hCV15854171 rs2231137 ABCG2 CE_STK ADD C 1.357 0.865 2.129 0.184 — hCV16158671 rs2200733 ATHERO_STK AGE GEN TT 2.133 0.724 6.287 0.1696 0.07966 MALE DIAB HTN hCV16158671 rs2200733 CE_STK AGE REC TT 2.054 0.774 5.452 0.1483 — MALE DIAB HTN hCV16158671 rs2200733 EO_STK AGE GEN TT 1.982 0.7 5.614 0.1976 0.07117 MALE DIAB HTN hCV16158671 rs2200733 ISCHEMIC_STK GEN TT 1.506 0.815 2.783 0.1916 0.00631 hCV16158671 rs2200733 ISCHEMIC_STK AGE GEN TT 1.874 0.819 4.292 0.1372 0.03074 MALE DIAB HTN hCV16158671 rs2200733 ISCHEMIC_STK AGE REC TT 1.743 0.763 3.982 0.1873 — MALE DIAB HTN hCV16158671 rs2200733 NOHD_STK GEN TT 1.705 0.898 3.238 0.1031 0.01299 hCV16158671 rs2200733 NOHD_STK REC TT 1.599 0.844 3.032 0.1501 — hCV16158671 rs2200733 NOHD_STK AGE REC TT 1.973 0.839 4.643 0.1195 — MALE DIAB HTN hCV16158671 rs2200733 NONCE_STK AGE GEN TC 1.275 0.93 1.747 0.1316 0.22725 MALE DIAB HTN hCV16336 rs362277 HD ATHERO_STK AGE ADD C 1.321 0.946 1.844 0.102 — MALE DIAB HTN hCV16336 rs362277 HD CE_STK DOM CT or 3.411 0.777 14.97 0.104 — CC hCV16336 rs362277 HD ISCHEMIC_STK GEN CC 1.847 0.825 4.133 0.1354 0.00758 hCV16336 rs362277 HD ISCHEMIC_STK DOM CT or 1.751 0.783 3.914 0.1725 — CC hCV16336 rs362277 HD LACUNAR_STK AGE ADD C 1.368 0.892 2.097 0.1507 — MALE DIAB HTN hCV16336 rs362277 HD LACUNAR_STK AGE REC CC 1.389 0.873 2.211 0.1656 — MALE DIAB HTN hCV31137507 rs7660668 CLOCK LACUNAR_STK GEN CG 1.274 0.945 1.716 0.112 0.22027 hCV31137507 rs7660668 CLOCK LACUNAR_STK DOM CG or 1.21 0.909 1.612 0.1921 — CC hCV26478797 rs2015018 CHSY-2 CE_STK ADD G 1.134 0.951 1.352 0.1602 — hCV26478797 rs2015018 CHSY-2 CE_STK AGE REC GG 1.233 0.921 1.649 0.1593 — MALE DIAB HTN hCV26478797 rs2015018 CHSY-2 NOHD_STK REC GG 1.132 0.944 1.358 0.1816 — hCV26478797 rs2015018 CHSY-2 RECURRENT_STK GEN GA 1.613 0.804 3.238 0.1787 0.30867 hCV26478797 rs2015018 CHSY-2 RECURRENT_STK GEN GG 1.712 0.86 3.407 0.1255 0.30867 hCV26478797 rs2015018 CHSY-2 RECURRENT_STK DOM GA or 1.668 0.85 3.272 0.137 — GG hCV11425801 rs3805953 PEX6 ATHERO_STK AGE GEN CC 1.372 0.929 2.025 0.1116 0.0005 MALE DIAB HTN hCV11425801 rs3805953 PEX6 CE_STK AGE GEN CT 1.287 0.913 1.812 0.1493 0.35182 MALE DIAB HTN hCV11425801 rs3805953 PEX6 EO_STK GEN CC 1.254 0.903 1.739 0.1764 0.00345 hCV11425801 rs3805953 PEX6 EO_STK ADD C 1.133 0.961 1.335 0.1372 hCV11425801 rs3805953 PEX6 ISCHEMIC_STK GEN CC 1.202 0.958 1.508 0.1123 0.02335 hCV11425801 rs3805953 PEX6 ISCHEMIC_STK AGE ADD C 1.116 0.959 1.3 0.1556 — MALE DIAB HTN hCV11425801 rs3805953 PEX6 LACUNAR_STK DOM CT or 1.235 0.897 1.7 0.1959 — CC hCV11425801 rs3805953 PEX6 NOHD_STK AGE GEN CC 1.236 0.896 1.706 0.1968 0.00304 MALE DIAB HTN hCV11425801 rs3805953 PEX6 NOHD_STK AGE ADD C 1.124 0.958 1.32 0.1525 — MALE DIAB HTN hCV11425801 rs3805953 PEX6 NONCE_STK AGE GEN CC 1.276 0.898 1.813 0.1732 0.00005 MALE DIAB HTN hCV11425801 rs3805953 PEX6 NONCE_STK AGE ADD C 1.147 0.963 1.365 0.1237 — MALE DIAB HTN hCV11425801 rs3805953 PEX6 RECURRENT_STK DOM CT or 1.28 0.912 1.798 0.1535 — CC hCV11425801 rs3805953 PEX6 RECURRENT_STK AGE DOM CT or 1.403 0.885 2.225 0.1498 — MALE CC DIAB HTN hCV11425842 rs10948059 GNMT ATHERO_STK GEN CC 1.263 0.927 1.722 0.1392 0.19224 hCV11425842 rs10948059 GNMT ATHERO_STK ADD C 1.109 0.953 1.29 0.1815 — hCV11425842 rs10948059 GNMT ATHERO_STK AGE ADD C 1.178 0.964 1.439 0.1101 — MALE DIAB HTN hCV11425842 rs10948059 GNMT CE_STK AGE DOM CT or 1.272 0.898 1.8 0.1751 — MALE CC DIAB HTN hCV11425842 rs10948059 GNMT EO_STK ADD C 1.141 0.964 1.352 0.126 — hCV11425842 rs10948059 GNMT EO_STK AGE GEN CC 1.302 0.883 1.92 0.1827 0.08575 MALE DIAB HTN hCV11425842 rs10948059 GNMT ISCHEMIC_STK AGE GEN CC 1.27 0.925 1.743 0.1389 0.1427 MALE DIAB HTN hCV11425842 rs10948059 GNMT ISCHEMIC_STK AGE ADD C 1.113 0.951 1.303 0.1836 — MALE DIAB HTN hCV11425842 rs10948059 GNMT NOHD_STK AGE GEN CT 1.279 0.938 1.745 0.1197 0.26094 MALE DIAB HTN hCV11425842 rs10948059 GNMT NOHD_STK AGE GEN CC 1.266 0.905 1.772 0.1686 0.26094 MALE DIAB HTN hCV11425842 rs10948059 GNMT NOHD_STK AGE DOM CT or 1.274 0.953 1.703 0.1015 — MALE CC DIAB HTN hCV11425842 rs10948059 GNMT NONCE_STK GEN CT 1.195 0.932 1.531 0.1595 0.35697 hCV11425842 rs10948059 GNMT NONCE_STK DOM CT or 1.184 0.938 1.495 0.1556 — CC hCV11425842 rs10948059 GNMT NONCE_STK AGE GEN CC 1.294 0.9 1.861 0.1646 0.10566 MALE DIAB HTN hCV16134786 rs2857595 EO_STK GEN AG 1.207 0.929 1.568 0.1593 0.0477 hCV16134786 rs2857595 EO_STK AGE ADD A 1.185 0.934 1.504 0.1629 — MALE DIAB HTN hCV16134786 rs2857595 ISCHEMIC_STK GEN AA 1.406 0.933 2.119 0.103 0.26366 hCV16134786 rs2857595 ISCHEMIC_STK REC AA 1.392 0.928 2.088 0.1098 — hCV16134786 rs2857595 ISCHEMIC_STK AGE ADD A 1.154 0.949 1.402 0.1516 — MALE DIAB HTN hCV16134786 rs2857595 LACUNAR_STK AGE GEN AA 1.77 0.809 3.873 0.153 0.27205 MALE DIAB HTN hCV16134786 rs2857595 LACUNAR_STK AGE ADD A 1.272 0.943 1.717 0.1157 — MALE DIAB HTN hCV16134786 rs2857595 LACUNAR_STK AGE DOM AG or 1.287 0.889 1.863 0.182 — MALE AA DIAB HTN hCV16134786 rs2857595 NONCE_STK DOM AG or 1.151 0.947 1.399 0.1584 — AA hCV16134786 rs2857595 NONCE_STK REC AA 1.448 0.924 2.268 0.1062 — hCV25651109 rs35690712 SLC39A7 EO_STK GEN GC 5.189 0.556 48.4 0.1484 0.34485 hCV25651109 rs35690712 SLC39A7 EO_STK GEN GG 4.668 0.52 41.92 0.1689 0.34485 hCV25651109 rs35690712 SLC39A7 EO_STK DOM GC or 4.709 0.525 42.28 0.1664 — GG hCV25651109 rs35690712 SLC39A7 ISCHEMIC_STK AGE GEN GC 4.69 0.505 43.57 0.1742 0.39506 MALE DIAB HTN hCV25651109 rs35690712 SLC39A7 ISCHEMIC_STK AGE GEN GG 4.372 0.486 39.35 0.1882 0.39506 MALE DIAB HTN hCV25651109 rs35690712 SLC39A7 ISCHEMIC_STK AGE DOM GC or 4.398 0.489 39.56 0.1864 — MALE GG DIAB HTN hCV25651109 rs35690712 SLC39A7 NONCE_STK GEN GC 4.525 0.542 37.77 0.1632 0.26183 hCV25651109 rs35690712 SLC39A7 NONCE_STK GEN GG 5.073 0.623 41.3 0.129 0.26183 hCV25651109 rs35690712 SLC39A7 NONCE_STK ADD G 1.239 0.895 1.713 0.1962 — hCV25651109 rs35690712 SLC39A7 NONCE_STK DOM GC or 5.026 0.618 40.91 0.1312 — GG hCV30308202 rs9482985 LAMA2 CE_STK ADD G 1.168 0.958 1.423 0.1237 — hCV30308202 rs9482985 LAMA2 CE_STK REC GG 1.179 0.936 1.484 0.1621 — hCV30308202 rs9482985 LAMA2 CE_STK AGE GEN GC 1.724 0.779 3.815 0.1792 0.26508 MALE DIAB HTN hCV30308202 rs9482985 LAMA2 CE_STK AGE GEN GG 1.878 0.867 4.07 0.1103 0.26508 MALE DIAB HTN hCV30308202 rs9482985 LAMA2 CE_STK AGE ADD G 1.19 0.92 1.54 0.1851 — MALE DIAB HTN hCV30308202 rs9482985 LAMA2 CE_STK AGE DOM GC or 1.825 0.848 3.929 0.124 — MALE GG DIAB HTN hCV30308202 rs9482985 LAMA2 RECURRENT_STK DOM GC or 2.236 0.795 6.289 0.1272 — GG hCV30308202 rs9482985 LAMA2 RECURRENT_STK AGE ADD G 1.379 0.94 2.022 0.1002 — MALE DIAB HTN hCV3082219 rs1884833 RFXDC1 EO_STK GEN AG 1.217 0.909 1.628 0.1874 0.16147 hCV3082219 rs1884833 RFXDC1 EO_STK GEN AA 2.194 0.766 6.286 0.1434 0.16147 hCV3082219 rs1884833 RFXDC1 EO_STK DOM AG or 1.262 0.949 1.677 0.1091 — AA hCV3082219 rs1884833 RFXDC1 EO_STK REC AA 2.096 0.733 5.993 0.1672 — hCV3082219 rs1884833 RFXDC1 LACUNAR_STK GEN AA 2.024 0.703 5.824 0.1911 0.07365 hCV3082219 rs1884833 RFXDC1 LACUNAR_STK AGE GEN AA 2.876 0.735 11.26 0.1292 0.25425 MALE DIAB HTN hCV3082219 rs1884833 RFXDC1 LACUNAR_STK AGE ADD A 1.288 0.89 1.865 0.18 — MALE DIAB HTN hCV3082219 rs1884833 RFXDC1 LACUNAR_STK AGE REC AA 2.755 0.706 10.75 0.1444 — MALE DIAB HTN hCV3082219 rs1884833 RFXDC1 NOHD_STK GEN AA 1.762 0.835 3.717 0.137 0.20951 hCV3082219 rs1884833 RFXDC1 NOHD_STK ADD A 1.171 0.965 1.421 0.11 — hCV3082219 rs1884833 RFXDC1 NOHD_STK DOM AG or 1.158 0.935 1.432 0.1783 — AA hCV3082219 rs1884833 RFXDC1 NOHD_STK REC AA 1.715 0.814 3.612 0.1557 — hCV3082219 rs1884833 RFXDC1 NOHD_STK AGE GEN AA 1.98 0.711 5.513 0.1912 0.41847 MALE DIAB HTN hCV3082219 rs1884833 RFXDC1 NOHD_STK AGE REC AA 1.961 0.706 5.45 0.1964 — MALE DIAB HTN hCV8942032 rs1264352 DDR1 ATHERO_STK AGE GEN CG 1.315 0.937 1.846 0.1128 0.23534 MALE DIAB HTN hCV8942032 rs1264352 DDR1 ATHERO_STK AGE DOM CG or 1.257 0.906 1.744 0.1707 — MALE CC DIAB HTN hCV8942032 rs1264352 DDR1 CE_STK AGE GEN CG 1.299 0.916 1.842 0.1424 0.29178 MALE DIAB HTN hCV8942032 rs1264352 DDR1 CE_STK AGE ADD C 1.251 0.938 1.669 0.1269 — MALE DIAB HTN hCV8942032 rs1264352 DDR1 CE_STK AGE DOM CG or 1.307 0.935 1.826 0.1175 — MALE CC DIAB HTN hCV8942032 rs1264352 DDR1 ISCHEMIC_STK ADD C 1.119 0.948 1.321 0.1832 — hCV8942032 rs1264352 DDR1 LACUNAR_STK AGE GEN CC 2.104 0.743 5.961 0.1614 0.01502 MALE DIAB HTN hCV8942032 rs1264352 DDR1 NOHD_STK DOM CG or 1.16 0.942 1.43 0.163 — CC hCV8942032 rs1264352 DDR1 NOHD_STK AGE ADD C 1.211 0.951 1.541 0.1206 — MALE DIAB HTN hCV8942032 rs1264352 DDR1 NONCE_STK ADD C 1.142 0.948 1.375 0.1628 — hCV25596936 rs6967117 EPHA1 ATHERO_STK ADD T 1.215 0.95 1.552 0.1207 — hCV25596936 rs6967117 EPHA1 ISCHEMIC_STK DOM TC or 1.181 0.941 1.482 0.1522 — TT hCV25596936 rs6967117 EPHA1 LACUNAR_STK DOM TC or 1.352 0.937 1.951 0.1065 — TT hCV25596936 rs6967117 EPHA1 NOHD_STK DOM TC or 1.226 0.961 1.566 0.1014 — TT hCV29401764 rs7793552 LOC646588 ATHERO_STK AGE DOM CT or 1.501 0.896 2.513 0.123 — MALE CC DIAB HTN hCV15857769 rs2924914 ATHERO_STK AGE ADD T 1.193 0.963 1.479 0.1061 — MALE DIAB HTN hCV15857769 rs2924914 ATHERO_STK AGE REC TT 1.456 0.92 2.305 0.1089 — MALE DIAB HTN hCV15857769 rs2924914 NOHD_STK ADD T 1.12 0.975 1.287 0.1103 — hCV15857769 rs2924914 RECURRENT_STK AGE ADD T 1.255 0.909 1.731 0.167 — MALE DIAB HTN hCV29539757 rs10110659 KCNQ3 ATHERO_STK GEN CA 1.362 0.902 2.058 0.1417 0.31708 hCV29539757 rs10110659 KCNQ3 ATHERO_STK DOM CA or 1.297 0.875 1.925 0.1957 — CC hCV29539757 rs10110659 KCNQ3 LACUNAR_STK GEN CA 1.453 0.843 2.504 0.1789 0.08401 hCV29539757 rs10110659 KCNQ3 NONCE_STK DOM CA or 1.283 0.909 1.81 0.1572 — CC hCV1348610 rs3739636 C9orf46 ATHERO_STK AGE GEN AG 1.304 0.945 1.799 0.1062 0.25491 MALE DIAB HTN hCV1348610 rs3739636 C9orf46 ATHERO_STK AGE DOM AG or 1.242 0.918 1.682 0.1605 — MALE AA DIAB HTN hCV1348610 rs3739636 C9orf46 CE_STK AGE GEN AG 1.24 0.895 1.719 0.1962 0.39368 MALE DIAB HTN hCV1348610 rs3739636 C9orf46 CE_STK AGE DOM AG or 1.238 0.911 1.682 0.1722 — MALE AA DIAB HTN hCV1348610 rs3739636 C9orf46 NOHD_STK AGE DOM AG or 1.217 0.944 1.569 0.1306 — MALE AA DIAB HTN hCV1348610 rs3739636 C9orf46 NONCE_STK AGE DOM AG or 1.226 0.933 1.61 0.144 — MALE AA DIAB HTN hCV1754669 rs2383206 C9P21 ATHERO_STK AGE REC GG 1.277 0.913 1.784 0.1528 — MALE DIAB HTN hCV1754669 rs2383206 C9P21 NONCE_STK AGE REC GG 1.227 0.906 1.662 0.187 — MALE DIAB HTN hCV26505812 rs10757274 C9P21 ISCHEMIC_STK AGE REC GG 1.207 0.912 1.599 0.1887 — MALE DIAB HTN hCV26505812 rs10757274 C9P21 NOHD_STK AGE REC GG 1.238 0.918 1.669 0.1611 — MALE DIAB HTN hCV26505812 rs10757274 C9P21 NONCE_STK AGE GEN GG 1.297 0.893 1.884 0.1714 0.23096 MALE DIAB HTN hCV15752716 rs2296436 HPS1 CE_STK ADD T 1.242 0.914 1.686 0.1656 — hCV15752716 rs2296436 HPS1 CE_STK REC TT 1.284 0.928 1.778 0.1311 — hCV2169762 rs1804689 HPS1 ATHERO_STK GEN TT 1.293 0.914 1.829 0.1461 0.33606 hCV2169762 rs1804689 HPS1 ATHERO_STK REC TT 1.282 0.92 1.787 0.1422 — hCV2169762 rs1804689 HPS1 ATHERO_STK AGE GEN TT 1.446 0.902 2.316 0.1255 0.27749 MALE DIAB HTN hCV2169762 rs1804689 HPS1 ATHERO_STK AGE REC TT 1.447 0.92 2.276 0.1093 — MALE DIAB HTN hCV2169762 rs1804689 HPS1 EO_STK AGE GEN TT 1.49 0.926 2.397 0.1003 0.2272 MALE DIAB HTN hCV2169762 rs1804689 HPS1 ISCHEMIC_STK GEN TT 1.22 0.921 1.617 0.1658 0.04864 hCV2169762 rs1804689 HPS1 LACUNAR_STK GEN TG 1.273 0.941 1.721 0.1172 0.29125 hCV2169762 rs1804689 HPS1 LACUNAR_STK DOM TG or 1.235 0.927 1.644 0.1491 — TT hCV2169762 rs1804689 HPS1 LACUNAR_STK AGE GEN TG 1.345 0.919 1.97 0.1275 0.23974 MALE DIAB HTN hCV2169762 rs1804689 HPS1 LACUNAR_STK AGE ADD T 1.246 0.953 1.63 0.1085 — MALE DIAB HTN hCV2169762 rs1804689 HPS1 NOHD_STK AGE REC TT 1.351 0.914 1.999 0.1317 — MALE DIAB HTN hCV2169762 rs1804689 HPS1 NONCE_STK GEN TT 1.229 0.897 1.683 0.1999 0.37015 hCV2169762 rs1804689 HPS1 NONCE_STK ADD T 1.106 0.961 1.272 0.1591 — hCV2169762 rs1804689 HPS1 NONCE_STK AGE DOM TG or 1.193 0.923 1.541 0.1783 — MALE TT DIAB HTN hCV27830265 rs12762303 ALOX5 ATHERO_STK DOM GA or 1.204 0.956 1.515 0.1143 — GG hCV27830265 rs12762303 ALOX5 ATHERO_STK AGE GEN GA 1.275 0.928 1.752 0.1331 0.04449 MALE DIAB HTN hCV27830265 rs12762303 ALOX5 CE_STK GEN GG 1.591 0.788 3.212 0.1954 0.27948 hCV27830265 rs12762303 ALOX5 CE_STK REC GG 1.637 0.813 3.293 0.1673 — hCV27830265 rs12762303 ALOX5 CE_STK AGE REC GG 1.967 0.73 5.302 0.1811 — MALE DIAB HTN hCV27830265 rs12762303 ALOX5 EO_STK GEN GG 1.724 0.758 3.92 0.1937 0.27237 hCV27830265 rs12762303 ALOX5 EO_STK ADD G 1.201 0.951 1.517 0.1236 — hCV27830265 rs12762303 ALOX5 EO_STK DOM GA or 1.194 0.919 1.551 0.1835 — GG hCV27830265 rs12762303 ALOX5 ISCHEMIC_STK AGE DOM GA or 1.211 0.948 1.547 0.1246 — MALE GG DIAB HTN hCV27830265 rs12762303 ALOX5 LACUNAR_STK GEN GA 1.242 0.911 1.692 0.1704 0.30411 hCV27830265 rs12762303 ALOX5 LACUNAR_STK ADD G 1.237 0.944 1.621 0.1228 — hCV27830265 rs12762303 ALOX5 LACUNAR_STK DOM GA or 1.258 0.93 1.701 0.1365 — GG hCV27830265 rs12762303 ALOX5 LACUNAR_STK AGE GEN GA 1.371 0.924 2.032 0.1169 0.17426 MALE DIAB HTN hCV27830265 rs12762303 ALOX5 NOHD_STK ADD G 1.146 0.963 1.364 0.1236 — hCV27830265 rs12762303 ALOX5 NOHD_STK AGE GEN GA 1.204 0.92 1.575 0.1757 0.16102 MALE DIAB HTN hCV27830265 rs12762303 ALOX5 NOHD_STK AGE GEN GG 1.82 0.823 4.024 0.1389 0.16102 MALE DIAB HTN hCV27830265 rs12762303 ALOX5 NOHD_STK AGE DOM GA or 1.244 0.958 1.615 0.1015 — MALE GG DIAB HTN hCV27830265 rs12762303 ALOX5 NOHD_STK AGE REC GG 1.722 0.783 3.787 0.1768 — MALE DIAB HTN hCV27830265 rs12762303 ALOX5 NONCE_STK GEN GA 1.16 0.94 1.432 0.166 0.02459 hCV27830265 rs12762303 ALOX5 NONCE_STK AGE REC GG 1.999 0.864 4.627 0.1056 — MALE DIAB HTN hCV1053082 rs544115 NEU3 ATHERO_STK GEN CC 1.629 0.864 3.07 0.1313 0.29853 hCV1053082 rs544115 NEU3 ATHERO_STK ADD C 1.139 0.935 1.387 0.1971 — hCV1053082 rs544115 NEU3 ATHERO_STK DOM CT or 1.597 0.851 2.997 0.1454 — CC hCV1053082 rs544115 NEU3 CE_STK GEN CC 1.702 0.885 3.27 0.1107 0.13598 hCV1053082 rs544115 NEU3 CE_STK DOM CT or 1.618 0.845 3.097 0.1466 — CC hCV1053082 rs544115 NEU3 CE_STK AGE ADD C 1.237 0.945 1.619 0.1224 — MALE DIAB HTN hCV1053082 rs544115 NEU3 EO_STK ADD C 1.172 0.933 1.471 0.172 — hCV1053082 rs544115 NEU3 EO_STK AGE DOM CT or 2.054 0.846 4.982 0.1115 — MALE CC DIAB HTN hCV1053082 rs544115 NEU3 ISCHEMIC_STK REC CC 1.125 0.942 1.344 0.1924 — hCV1053082 rs544115 NEU3 ISCHEMIC_STK AGE ADD C 1.164 0.943 1.436 0.1567 — MALE DIAB HTN hCV1053082 rs544115 NEU3 LACUNAR_STK GEN CT 2.025 0.775 5.292 0.1499 0.33773 hCV1053082 rs544115 NEU3 LACUNAR_STK DOM CT or 1.895 0.742 4.839 0.1815 — CC hCV1053082 rs544115 NEU3 LACUNAR_STK AGE GEN CT 2.148 0.723 6.38 0.1685 0.38668 MALE DIAB HTN hCV1053082 rs544115 NEU3 LACUNAR_STK AGE DOM CT or 2.036 0.708 5.851 0.1868 — MALE CC DIAB HTN hCV1053082 rs544115 NEU3 NOHD_STK ADD C 1.128 0.954 1.333 0.1577 — hCV1452085 rs12223005 TRIM22 CE_STK GEN CA 3.193 0.705 14.47 0.1321 0.27397 hCV1452085 rs12223005 TRIM22 CE_STK GEN CC 2.843 0.638 12.66 0.1703 0.27397 hCV1452085 rs12223005 TRIM22 CE_STK DOM CA or 2.902 0.652 12.91 0.1619 — CC hCV1452085 rs12223005 TRIM22 CE_STK AGE GEN CA 4.133 0.74 23.07 0.1058 0.25417 MALE DIAB HTN hCV1452085 rs12223005 TRIM22 CE_STK AGE GEN CC 3.631 0.67 19.68 0.1347 0.25417 MALE DIAB HTN hCV1452085 rs12223005 TRIM22 CE_STK AGE DOM CA or 3.711 0.686 20.07 0.1279 — MALE CC DIAB HTN hCV1452085 rs12223005 TRIM22 EO_STK GEN CA 2.362 0.762 7.322 0.1364 0.26957 hCV1452085 rs12223005 TRIM22 EO_STK DOM CA or 2.075 0.691 6.232 0.1935 — CC hCV1452085 rs12223005 TRIM22 ISCHEMIC_STK GEN CA 1.97 0.824 4.714 0.1275 0.08218 hCV1452085 rs12223005 TRIM22 ISCHEMIC_STK AGE GEN CC 2.207 0.757 6.44 0.1472 0.07446 MALE DIAB HTN hCV1452085 rs12223005 TRIM22 ISCHEMIC_STK AGE DOM CA or 2.31 0.793 6.727 0.1247 — MALE CC DIAB HTN hCV1452085 rs12223005 TRIM22 LACUNAR_STK GEN CA 4.431 0.568 34.58 0.1556 0.00441 hCV1452085 rs12223005 TRIM22 LACUNAR_STK AGE DOM CA or 4.519 0.471 43.37 0.1911 — MALE CC DIAB HTN hCV1452085 rs12223005 TRIM22 NOHD_STK GEN CA 2.418 0.843 6.932 0.1004 0.16487 hCV1452085 rs12223005 TRIM22 NOHD_STK GEN CC 2.082 0.739 5.866 0.1655 0.16487 hCV1452085 rs12223005 TRIM22 NOHD_STK DOM CA or 2.138 0.759 6.02 0.1502 — CC hCV1452085 rs12223005 TRIM22 RECURRENT_STK AGE GEN CC 6.513 0.564 75.15 0.1332 0.02942 MALE DIAB HTN hCV1452085 rs12223005 TRIM22 RECURRENT_STK AGE DOM CA or 7.075 0.618 80.97 0.1157 — MALE CC DIAB HTN hCV302629 rs9284183 UBAC2 EO_STK DOM GA or 1.217 0.954 1.553 0.1137 — GG hCV302629 rs9284183 UBAC2 EO_STK AGE GEN GA 1.219 0.91 1.633 0.1853 0.37831 MALE DIAB HTN hCV302629 rs9284183 UBAC2 EO_STK AGE ADD G 1.156 0.927 1.442 0.1987 — MALE DIAB HTN hCV302629 rs9284183 UBAC2 EO_STK AGE DOM GA or 1.219 0.923 1.611 0.1632 — MALE GG DIAB HTN hCV11474611 rs3814843 CALM1 ATHERO_STK DOM GT or 1.345 0.925 1.956 0.1207 — GG hCV11474611 rs3814843 CALM1 ISCHEMIC_STK GEN GT 1.282 0.939 1.748 0.1173 0.13174 hCV11474611 rs3814843 CALM1 ISCHEMIC_STK DOM GT or 1.222 0.902 1.656 0.1959 — GG hCV11474611 rs3814843 CALM1 NOHD_STK GEN GT 1.32 0.946 1.842 0.1021 0.1136 hCV11474611 rs3814843 CALM1 NOHD_STK DOM GT or 1.251 0.902 1.735 0.1789 — GG hCV11474611 rs3814843 CALM1 NONCE_STK GEN GT 1.328 0.939 1.877 0.1082 0.1417 hCV11474611 rs3814843 CALM1 NONCE_STK DOM GT or 1.261 0.898 1.772 0.1806 — GG hCV11474611 rs3814843 CALM1 RECURRENT_STK GEN GT 1.526 0.916 2.544 0.1047 0.2681 hCV11474611 rs3814843 CALM1 RECURRENT_STK DOM GT or 1.429 0.86 2.374 0.168 — GG hCV1262973 rs229653 PLEKHG3 ISCHEMIC_STK GEN AG 1.186 0.939 1.499 0.1523 0.00405 hCV1262973 rs229653 PLEKHG3 RECURRENT_STK GEN AG 1.33 0.893 1.982 0.1605 0.3735 hCV27892569 rs4903741 NRXN3 CE_STK DOM CT or 1.171 0.936 1.466 0.1674 — CC hCV27892569 rs4903741 NRXN3 LACUNAR_STK GEN CT 1.273 0.943 1.719 0.1153 0.28645 hCV27892569 rs4903741 NRXN3 LACUNAR_STK DOM CT or 1.241 0.93 1.656 0.143 — CC hCV27892569 rs4903741 NRXN3 NOHD_STK GEN CC 1.333 0.917 1.939 0.1323 0.22016 hCV27892569 rs4903741 NRXN3 NOHD_STK DOM CT or 1.153 0.958 1.388 0.1327 — CC hCV27892569 rs4903741 NRXN3 NOHD_STK REC CC 1.278 0.885 1.845 0.191 — hCV27077072 rs8060368 RECURRENT_STK GEN CC 1.564 0.889 2.75 0.1205 0.17139 hCV27077072 rs8060368 RECURRENT_STK AGE ADD C 1.308 0.947 1.806 0.1032 — MALE DIAB HTN hCV27077072 rs8060368 RECURRENT_STK AGE DOM CT or 1.798 0.854 3.786 0.1226 — MALE CC DIAB HTN hCV2769503 rs4787956 CE_STK GEN GA 1.171 0.924 1.484 0.1909 0.3088 hCV2769503 rs4787956 CE_STK ADD G 1.131 0.961 1.331 0.1373 — hCV2769503 rs4787956 CE_STK DOM GA or 1.187 0.948 1.485 0.1354 — GG hCV2769503 rs4787956 RECURRENT_STK GEN GA 1.27 0.919 1.753 0.1471 0.27579 hCV31573621 rs11079818 SKAP1 ATHERO_STK REC TT 1.165 0.939 1.445 0.1653 — hCV31573621 rs11079818 SKAP1 LACUNAR_STK AGE GEN TC 1.614 0.78 3.341 0.1973 0.13048 MALE DIAB HTN hCV32160712 rs11079160 CE_STK DOM TA or 1.181 0.928 1.501 0.1761 — TT hCV32160712 rs11079160 CE_STK AGE GEN TT 1.93 0.872 4.27 0.1047 0.26509 MALE DIAB HTN hCV32160712 rs11079160 CE_STK AGE REC TT 1.896 0.862 4.17 0.1116 — MALE DIAB HTN hCV32160712 rs11079160 EO_STK GEN TT 1.734 0.829 3.629 0.144 0.19059 hCV32160712 rs11079160 EO_STK REC TT 1.8 0.864 3.751 0.1167 — hCV32160712 rs11079160 ISCHEMIC_STK ADD T 1.137 0.972 1.33 0.1085 — hCV32160712 rs11079160 ISCHEMIC_STK AGE GEN TT 1.675 0.848 3.308 0.1373 0.31696 MALE DIAB HTN hCV32160712 rs11079160 ISCHEMIC_STK AGE REC TT 1.646 0.837 3.237 0.1488 — MALE DIAB HTN hCV32160712 rs11079160 NOHD_STK GEN TT 1.509 0.886 2.57 0.1303 0.30893 hCV32160712 rs11079160 NOHD_STK REC TT 1.49 0.878 2.531 0.1396 — hCV32160712 rs11079160 RECURRENT_STK GEN TT 1.887 0.865 4.117 0.1107 0.28017 hCV32160712 rs11079160 RECURRENT_STK REC TT 1.87 0.863 4.056 0.1128 — hCV32160712 rs11079160 RECURRENT_STK AGE GEN TT 2.044 0.706 5.92 0.1878 0.41924 MALE DIAB HTN hCV32160712 rs11079160 RECURRENT_STK AGE REC TT 2.029 0.706 5.827 0.1887 — MALE DIAB HTN hCV1408483 rs17070848 BCL2 ATHERO_STK GEN TT 1.514 0.894 2.564 0.1231 0.29337 hCV1408483 rs17070848 BCL2 ATHERO_STK REC TT 1.487 0.882 2.505 0.1364 — hCV1619596 rs1048621 SDCBP2 CE_STK GEN AG 1.176 0.932 1.483 0.1731 0.21433 hCV1619596 rs1048621 SDCBP2 CE_STK GEN AA 1.35 0.888 2.055 0.1607 0.21433 hCV1619596 rs1048621 SDCBP2 CE_STK DOM AG or 1.203 0.964 1.501 0.1025 — AA hCV1619596 rs1048621 SDCBP2 CE_STK AGE ADD A 1.204 0.959 1.51 0.109 — MALE DIAB HTN hCV1619596 rs1048621 SDCBP2 EO_STK AGE ADD A 1.202 0.965 1.497 0.101 — MALE DIAB HTN hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK GEN AG 1.127 0.945 1.344 0.1838 0.22154 hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK GEN AA 1.261 0.909 1.748 0.1644 0.22154 hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK DOM AG or 1.148 0.97 1.357 0.1079 — AA hCV1619596 rs1048621 SDCBP2 ISCHEMIC_STK AGE ADD A 1.139 0.954 1.36 0.1508 — MALE DIAB HTN hCV1619596 rs1048621 SDCBP2 NOHD_STK GEN AA 1.267 0.89 1.804 0.1884 0.27789 hCV1619596 rs1048621 SDCBP2 NOHD_STK ADD A 1.125 0.974 1.299 0.1095 — hCV1619596 rs1048621 SDCBP2 NOHD_STK DOM AG or 1.146 0.955 1.375 0.1442 — AA hCV1619596 rs1048621 SDCBP2 NOHD_STK AGE GEN AG 1.217 0.944 1.569 0.1302 0.29766 MALE DIAB HTN hCV1619596 rs1048621 SDCBP2 NOHD_STK AGE ADD A 1.14 0.944 1.376 0.1722 — MALE DIAB HTN hCV1619596 rs1048621 SDCBP2 NOHD_STK AGE DOM AG or 1.21 0.951 1.541 0.1208 — MALE AA DIAB HTN hCV1619596 rs1048621 SDCBP2 RECURRENT_STK GEN AG 1.23 0.896 1.689 0.1998 0.42372 hCV1619596 rs1048621 SDCBP2 RECURRENT_STK DOM AG or 1.224 0.904 1.658 0.1917 — AA hCV1619596 rs1048621 SDCBP2 RECURRENT_STK AGE GEN AG 1.334 0.86 2.07 0.1987 0.41241 MALE DIAB HTN hCV29537898 rs6073804 NOHD_STK ADD T 1.194 0.943 1.511 0.1415 — hCV29537898 rs6073804 RECURRENT_STK AGE GEN TT 5.809 0.6 56.26 0.1288 0.23964 MALE DIAB HTN hCV29537898 rs6073804 RECURRENT_STK AGE REC TT 5.608 0.578 54.4 0.1369 — MALE DIAB HTN hCV1723718 rs12481805 UMODL1 EO_STK REC AA 1.45 0.917 2.293 0.1118 — hCV1723718 rs12481805 UMODL1 ISCHEMIC_STK REC AA 1.254 0.922 1.706 0.1498 — hCV1723718 rs12481805 UMODL1 LACUNAR_STK AGE REC AA 1.545 0.838 2.848 0.1633 — MALE DIAB HTN hCV1723718 rs12481805 UMODL1 NOHD_STK REC AA 1.316 0.947 1.829 0.1019 — hCV1723718 rs12481805 UMODL1 NONCE_STK REC AA 1.33 0.945 1.872 0.1017 — hCV1723718 rs12481805 UMODL1 RECURRENT_STK AGE GEN AG 1.349 0.867 2.098 0.185 0.37072 MALE DIAB HTN hCV1723718 rs12481805 UMODL1 RECURRENT_STK AGE ADD A 1.239 0.897 1.711 0.1934 — MALE DIAB HTN hCV1723718 rs12481805 UMODL1 RECURRENT_STK AGE DOM AG or 1.352 0.889 2.056 0.159 — MALE AA DIAB HTN
TABLE-US-00022 TABLE 22 Gene GENO Risk hCV # rs # Symbol ENDPT MODE STRATA ADJUST TYPE Genotype hCV16336 rs362277 HD ENDPT4F1 GEN ALL STATIN TC CC hCV16336 rs362277 HD ENDPT4F1 DOM ALL STATIN TC + TT CC hCV16336 rs362277 HD ENDPT4F1 ADD ALL STATIN T CC hCV32160712 rs11079160 ENDPT4F1 GEN ALL STATIN TT TT hCV32160712 rs11079160 ENDPT4F1 REC ALL STATIN TT TT hCV32160712 rs11079160 ENDPT4F1 ADD ALL STATIN T TT hCV16134786 rs2857595 ENDPT4F1 REC ALL AA AA hCV1619596 rs1048621 SDCBP2 ENDPT4F1 GEN ALL AA AG or AA hCV1619596 rs1048621 SDCBP2 ENDPT4F1 REC ALL AA AG or AA hCV32160712 rs11079160 ENDPT4F1 GEN ALL TT TT hCV32160712 rs11079160 ENDPT4F1 DOM ALL TA + TT TT hCV32160712 rs11079160 ENDPT4F1 REC ALL TT TT hCV32160712 rs11079160 ENDPT4F1 ADD ALL T TT 95% 95% Lower Upper CL for CL for P- 2DF P- hCV # rs # EVENTS TOTAL HR HR HR VALUE VALUE hCV16336 rs362277 21 491 0.7 0.444 1.115 0.1341 0.3256 hCV16336 rs362277 23 526 0.72 0.462 1.12 0.1447 — hCV16336 rs362277 — — 0.76 0.507 1.14 0.1848 — hCV32160712 rs11079160 8 83 1.88 0.914 3.853 0.0866 0.221 hCV32160712 rs11079160 8 83 1.82 0.895 3.714 0.0981 — hCV32160712 rs11079160 — — 1.21 0.918 1.604 0.1746 — hCV16134786 rs2857595 5 45 1.92 0.778 4.735 0.1569 — hCV1619596 rs1048621 12 115 1.69 0.894 3.195 0.1065 0.1552 hCV1619596 rs1048621 12 115 1.78 0.97 3.274 0.0627 — hCV32160712 rs11079160 6 37 3.09 1.33 7.19 0.0088 0.0281 hCV32160712 rs11079160 34 428 1.41 0.917 2.164 0.1172 — hCV32160712 rs11079160 6 37 2.87 1.253 6.585 0.0126 — hCV32160712 rs11079160 — — 1.48 1.037 2.12 0.0308 —
TABLE-US-00023 TABLE 23 95% 95% Lower Upper Gene GENO- Risk Risk CL for CL for hCV # rs # Symbol ENDPT TIMEVAR MODE TYPE Allele Genotype STATIN EVENTS TOTAL HR HR HR P-VALUE PVAL_INTX hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GG G GA or GG Pravastatin 0 23 0 0 — 0.9967 0.15026 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GG G GA or GG Placebo 2 42 ref — — — 0.15026 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GA G GA or GG Pravastatin 13 376 0.47 0.239 0.906 0.0243 0.15026 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GA G GA or GG Placebo 26 351 ref — — — 0.15026 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN AA G GA or GG Pravastatin 54 1005 0.84 0.584 1.212 0.3548 0.15026 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN AA G GA or GG Placebo 62 980 ref — — — 0.15026 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 DOM GA + GG G GA or GG Pravastatin 13 399 0.46 0.236 0.88 0.0192 0.10233 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 DOM GA + GG G GA or GG Placebo 28 393 ref — — — 0.10233 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 REC GA + AA G GA or GG Pravastatin 67 1381 0.73 0.531 1.002 0.0514 0.24445 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 REC GA + AA G GA or GG Placebo 88 1331 ref — — — 0.24445 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GG G GA or GG Pravastatin 0 23 0 0 — 0.9967 0.15067 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GG G GA or GG Placebo 2 42 ref — — — 0.15067 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GA G GA or GG Pravastatin 13 375 0.47 0.24 0.911 0.0254 0.15067 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN GA G GA or GG Placebo 26 352 ref — — — 0.15067 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 GEN AA G GA or GG Pravastatin 54 1002 0.85 0.587 1.218 0.3671 0.15067 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO EP4F1 GEN AA G GA or GG Placebo 62 981 ref — — — 0.15067 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 DOM GA + GG G GA or GG Pravastatin 13 398 0.46 0.237 0.884 0.02 0.10281 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 DOM GA + GG G GA or GG Placebo 28 394 ref — — — 0.10281 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 REC GA + AA G GA or GG Pravastatin 67 1377 0.73 0.533 1.007 0.0549 0.24354 hCV27830265 rs12762303 ALOX5 ENDPT4F1 TIMETO_EP4F1 REC GA + AA G GA or GG Placebo 88 1333 ref — — — 0.24354 hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN CC C CG or CC Pravastatin 1 36 0.86 0.054 13.71 0.9134 0.18029 hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN CC C CG or CC Placebo 1 31 ref — — — 0.18029 hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN CG C CG or CC Pravastatin 9 356 0.39 0.179 0.844 0.0169 0.18029 hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN CG C CG or CC Placebo 22 347 ref — — — 0.18029 hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN GG C CG or CC Pravastatin 57 1011 0.84 0.592 1.201 0.3442 0.18029 hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 GEN GG C CG or CC Placebo 67 997 ref — — — 0.18029 hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 DOM CG + CC C CG or CC Pravastatin 10 392 0.41 0.195 0.859 0.0182 0.07391 hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 DOM CG + CC C CG or CC Placebo 23 378 ref — — — 0.07391 hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 REC CG + GG C CG or CC Pravastatin 66 1367 0.73 0.527 0.997 0.0479 0.92551 hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 REC CG + GG C CG or CC Placebo 89 1344 ref — — — 0.92551 hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA AA Pravastatin 2 71 0.23 0.044 1.189 0.0794 0.27061 hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA AA Placebo 5 45 ref — — — 0.27061 hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL AG AA Pravastatin 14 403 0.67 0.342 1.293 0.2295 0.27061 hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL AG AA Placebo 23 442 ref — — — 0.27061 hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL GG AA Pravastatin 51 928 0.8 0.553 1.164 0.2463 0.27061 hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 GEN ALL GG AA Placebo 61 887 ref — — — 0.27061 hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 DOM ALL AG + AA AA Pravastatin 16 474 0.58 0.313 1.068 0.0803 0.35911 hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 DOM ALL AG + AA AA Placebo 28 487 ref — — — 0.35911 hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 REC ALL AG + GG AA Pravastatin 65 1331 0.77 0.559 1.068 0.1182 0.12065 hCV16134786 rs2857595 ENDPT4F1 TIMETO_EP4F1 REC ALL AG + GG AA Placebo 84 1329 ref — — — 0.12065 hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA AG or AA Pravastatin 2 108 0.16 0.037 0.734 0.018 0.05456 hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA AG or AA Placebo 12 115 ref — — — 0.05456 hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL AG AG or AA Pravastatin 29 572 0.89 0.538 1.471 0.6494 0.05456 hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL AG AG or AA Placebo 32 559 ref — — — 0.05456 hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL GG AG or AA Pravastatin 36 719 0.77 0.498 1.197 0.2473 0.05456 hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 GEN ALL GG AG or AA Placebo 45 696 ref — — — 0.05456 hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 DOM ALL AG + AA AG or AA Pravastatin 31 680 0.69 0.438 1.098 0.1188 0.74301 hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 DOM ALL AG + AA AG or AA Placebo 44 674 ref — — — 0.74301 hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 REC ALL AG + GG AG or AA Pravastatin 65 1291 0.82 0.59 1.142 0.2405 0.01754 hCV1619596 rs1048621 SDCBP2 ENDPT4F1 TIMETO_EP4F1 REC ALL AG + GG AG or AA Placebo 77 1255 ref — — — 0.01754 hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL TT TT Pravastatin 2 46 0.24 0.048 1.193 0.0812 0.22268 hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL TT TT Placebo 6 37 ref — — — 0.22268 hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL TA TT Pravastatin 17 382 0.62 0.339 1.132 0.1194 0.22268 hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL TA TT Placebo 28 391 ref — — — 0.22268 hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA TT Pravastatin 48 972 0.86 0.582 1.267 0.4421 0.22268 hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 GEN ALL AA TT Placebo 54 942 ref — — — 0.22268 hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 DOM ALL TA + TT TT Pravastatin 19 428 0.55 0.315 0.967 0.0379 0.20087 hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 DOM ALL TA + TT TT Placebo 34 428 ref — — — 0.20087 hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 REC ALL TA + AA TT Pravastatin 65 1354 0.78 0.562 1.077 0.1301 0.13978 hCV32160712 rs11079160 ENDPT4F1 TIMETO_EP4F1 REC ALL TA + AA TT Placebo 82 1333 ref — — — 0.13978
TABLE-US-00024 TABLE 24 Gene/ GENO- hCV # rs # Chrom ENDPT MODE ADJUST TYPE EVENTS hCV1305848 rs6016200 ENDPT4F1 GEN STATIN AA 0 hCV1305848 rs6016200 ENDPT4F1 GEN STATIN AG 41 hCV1305848 rs6016200 ENDPT4F1 GEN STATIN GG 115 hCV1305848 rs6016200 ENDPT4F1 DOM STATIN AG + AA 41 hCV1305848 rs6016200 ENDPT4F1 DOM STATIN GG 115 hCV1305848 rs6016200 ENDPT4F1 REC STATIN AA 0 hCV1305848 rs6016200 ENDPT4F1 REC STATIN AG + GG 156 hCV1305848 rs6016200 ENDPT4F1 ADD STATIN A — hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN STATIN AA 39 hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN STATIN AG 89 hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN STATIN GG 28 hCV1746715 rs4750628 C10orf38 ENDPT4F1 DOM STATIN AG + AA 128 hCV1746715 rs4750628 C10orf38 ENDPT4F1 DOM STATIN GG 28 hCV1746715 rs4750628 C10orf38 ENDPT4F1 REC STATIN AA 39 hCV1746715 rs4750628 C10orf38 ENDPT4F1 REC STATIN AG + GG 117 hCV1746715 rs4750628 C10orf38 ENDPT4F1 ADD STATIN A — hCV29881864 rs10514542 ENDPT4F1 GEN STATIN CC 20 hCV29881864 rs10514542 ENDPT4F1 GEN STATIN CG 61 hCV29881864 rs10514542 ENDPT4F1 GEN STATIN GG 75 hCV29881864 rs10514542 ENDPT4F1 DOM STATIN CG + CC 81 hCV29881864 rs10514542 ENDPT4F1 DOM STATIN GG 75 hCV29881864 rs10514542 ENDPT4F1 REC STATIN CC 20 hCV29881864 rs10514542 ENDPT4F1 REC STATIN CG + GG 136 hCV29881864 rs10514542 ENDPT4F1 ADD STATIN C — hDV70959216 rs17482753 ENDPT4F1 GEN STATIN TT 0 hDV70959216 rs17482753 ENDPT4F1 GEN STATIN TG 20 hDV70959216 rs17482753 ENDPT4F1 GEN STATIN GG 136 hDV70959216 rs17482753 ENDPT4F1 DOM STATIN TG + TT 20 hDV70959216 rs17482753 ENDPT4F1 DOM STATIN GG 136 hDV70959216 rs17482753 ENDPT4F1 REC STATIN TT 0 hDV70959216 rs17482753 ENDPT4F1 REC STATIN TG + GG 156 hDV70959216 rs17482753 ENDPT4F1 ADD STATIN T — hCV1305848 rs6016200 ENDPT4F1 GEN AA 0 hCV1305848 rs6016200 ENDPT4F1 GEN AG 22 hCV1305848 rs6016200 ENDPT4F1 GEN GG 67 hCV1305848 rs6016200 ENDPT4F1 DOM AG + AA 22 hCV1305848 rs6016200 ENDPT4F1 DOM GG 67 hCV1305848 rs6016200 ENDPT4F1 REC AA 0 hCV1305848 rs6016200 ENDPT4F1 REC AG + GG 89 hCV1305848 rs6016200 ENDPT4F1 ADD A — hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN AA 21 hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN AG 52 hCV1746715 rs4750628 C10orf38 ENDPT4F1 GEN GG 16 hCV1746715 rs4750628 C10orf38 ENDPT4F1 DOM AG + AA 73 hCV1746715 rs4750628 C10orf38 ENDPT4F1 DOM GG 16 hCV1746715 rs4750628 C10orf38 ENDPT4F1 REC AA 21 hCV1746715 rs4750628 C10orf38 ENDPT4F1 REC AG + GG 68 hCV1746715 rs4750628 C10orf38 ENDPT4F1 ADD A — hCV29881864 rs10514542 ENDPT4F1 GEN CC 14 hCV29881864 rs10514542 ENDPT4F1 GEN CG 35 hCV29881864 rs10514542 ENDPT4F1 GEN GG 40 hCV29881864 rs10514542 ENDPT4F1 DOM CG + CC 49 hCV29881864 rs10514542 ENDPT4F1 DOM GG 40 hCV29881864 rs10514542 ENDPT4F1 REC CC 14 hCV29881864 rs10514542 ENDPT4F1 REC CG + GG 75 hCV29881864 rs10514542 ENDPT4F1 ADD C — 95% 95% Lower Upper CL for CL for P- 2DF P- hCV # rs # TOTAL HR HR HR VALUE VALUE hCV1305848 rs6016200 86 0 0 1.63E+248 0.9648 0.2079 hCV1305848 rs6016200 875 0.72 0.507 1.035 0.0764 0.2079 hCV1305848 rs6016200 1806 ref — — — 0.2079 hCV1305848 rs6016200 961 0.66 0.46 0.938 0.0209 — hCV1305848 rs6016200 1806 ref — — — — hCV1305848 rs6016200 86 0 0 9.16E+246 0.9649 — hCV1305848 rs6016200 2681 ref — — — — hCV1305848 rs6016200 — 0.63 0.451 0.876 0.0061 — hCV1746715 rs4750628 701 1.47 0.906 2.392 0.1187 0.0324 hCV1746715 rs4750628 1340 1.76 1.151 2.691 0.0091 0.0324 hCV1746715 rs4750628 726 ref — — — 0.0324 hCV1746715 rs4750628 2041 1.66 1.103 2.5 0.015 — hCV1746715 rs4750628 726 ref — — — — hCV1746715 rs4750628 701 0.99 0.688 1.42 0.9495 — hCV1746715 rs4750628 2066 ref — — — — hCV1746715 rs4750628 — 1.18 0.947 1.465 0.1424 — hCV29881864 rs10514542 224 1.76 1.072 2.875 0.0253 0.0767 hCV29881864 rs10514542 1102 1.06 0.756 1.486 0.7354 0.0767 hCV29881864 rs10514542 1450 ref — — — 0.0767 hCV29881864 rs10514542 1326 1.18 0.858 1.609 0.3138 — hCV29881864 rs10514542 1450 ref — — — — hCV29881864 rs10514542 224 1.71 1.07 2.736 0.0249 — hCV29881864 rs10514542 2552 ref — — — — hCV29881864 rs10514542 — 1.24 0.975 1.564 0.08 — hDV70959216 rs17482753 21 0 0 — 0.974 0.2331 hDV70959216 rs17482753 495 0.66 0.416 1.063 0.088 0.2331 hDV70959216 rs17482753 2252 ref — — — 0.2331 hDV70959216 rs17482753 516 0.64 0.399 1.019 0.0599 — hDV70959216 rs17482753 2252 ref — — — — hDV70959216 rs17482753 21 0 0 — 0.974 — hDV70959216 rs17482753 2747 ref — — — — hDV70959216 rs17482753 — 0.63 0.398 0.991 0.0458 — hCV1305848 rs6016200 44 0 0 — 0.9823 0.3016 hCV1305848 rs6016200 426 0.68 0.422 1.107 0.1216 0.3016 hCV1305848 rs6016200 898 ref — — — 0.3016 hCV1305848 rs6016200 470 0.62 0.381 0.997 0.0487 — hCV1305848 rs6016200 898 ref — — — — hCV1305848 rs6016200 44 0 0 — 0.9823 — hCV1305848 rs6016200 1324 ref — — — — hCV1305848 rs6016200 — 0.59 0.379 0.929 0.0226 — hCV1746715 rs4750628 349 1.34 0.699 2.568 0.3775 0.1054 hCV1746715 rs4750628 665 1.79 1.021 3.132 0.0421 0.1054 hCV1746715 rs4750628 355 ref — — — 0.1054 hCV1746715 rs4750628 1014 1.63 0.95 2.802 0.0763 — hCV1746715 rs4750628 355 ref — — — — hCV1746715 rs4750628 349 0.89 0.545 1.449 0.6359 — hCV1746715 rs4750628 1020 ref — — — — hCV1746715 rs4750628 — 1.13 0.844 1.501 0.4216 — hCV29881864 rs10514542 115 2.28 1.238 4.187 0.0081 0.0236 hCV29881864 rs10514542 565 1.06 0.675 1.673 0.7927 0.0236 hCV29881864 rs10514542 694 ref — — — 0.0236 hCV29881864 rs10514542 680 1.25 0.826 1.903 0.2888 — hCV29881864 rs10514542 694 ref — — — — hCV29881864 rs10514542 115 2.21 1.25 3.921 0.0064 — hCV29881864 rs10514542 1259 ref — — — — hCV29881864 rs10514542 — 1.38 1.009 1.878 0.0438 —
TABLE-US-00025 TABLE 25 Gene GENO- Risk hCV # rs # Symbol ENDPT TIMEVAR MODE TYPE Allele STATIN hDV77718013 ENDPT4F1 TIMETO_EP4F1 REC TC + CC Pravastatin hCV3216551 rs562338 ENDPT4F1 TIMETO_EP4F1 GEN GG Pravastatin hCV2862873 rs780094 GCKR ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin hCV9296529 rs4358307 ENDPT4F1 TIMETO_EP4F1 GEN GA Pravastatin hCV29480044 rs10516433 TSPAN5 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin hCV29480044 rs10516433 TSPAN5 ENDPT4F1 TIMETO_EP4F1 REC TC + CC Pravastatin hCV30454150 rs10516434 TSPAN5 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin hCV30454150 rs10516434 TSPAN5 ENDPT4F1 TIMETO_EP4F1 REC TC + CC Pravastatin hCV8942032 rs1264352 DDR1 ENDPT4F1 TIMETO_EP4F1 DOM CG + CC C Pravastatin hCV9473891 rs1555173 ENDPT4F1 TIMETO_EP4F1 REC CT + TT Pravastatin hCV2442143 rs12544854 ASAH1 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin hCV2442143 rs12544854 ASAH1 ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin hCV2442143 rs12544854 ASAH1 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin hCV2442143 rs12544854 ASAH1 ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin hCV1463226 rs10890 FXN ENDPT4F1 TIMETO_EP4F1 GEN TT Pravastatin hCV1463226 rs10890 FXN ENDPT4F1 TIMETO_EP4F1 GEN CC Pravastatin hCV2741051 rs2230806 ABCA1 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin hCV2741051 rs2230806 ABCA1 ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin hCV2741051 rs2230806 ABCA1 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin hCV2741051 rs2230806 ABCA1 ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin hCV2959482 rs3890182 ABCA1 ENDPT4F1 TIMETO_EP4F1 GEN AG Pravastatin hCV2959482 rs3890182 ABCA1 ENDPT4F1 TIMETO_EP4F1 DOM AG + AA Pravastatin hCV22275299 rs28927680 BUD13 ENDPT4F1 TIMETO_EP4F1 GEN GC Pravastatin hCV29566897 rs10507755 ENDPT4F1 TIMETO_EP4F1 REC CT + TT Pravastatin hCV8757333 rs1800588 LIPC ENDPT4F1 TIMETO_EP4F1 DOM TC + TT Pravastatin hCV16164743 rs2928932 ENDPT4F1 TIMETO_EP4F1 GEN CC Pravastatin hCV16164743 rs2928932 ENDPT4F1 TIMETO_EP4F1 GEN AA Pravastatin hCV9324316 rs9305020 ENDPT4F1 TIMETO_EP4F1 GEN TT Pravastatin hCV9324316 rs9305020 ENDPT4F1 TIMETO_EP4F1 REC CT + TT Pravastatin hCV1846459 rs4803759 ENDPT4F1 TIMETO_EP4F1 GEN TC Pravastatin hCV1846459 rs4803759 ENDPT4F1 TIMETO_EP4F1 GEN CC Pravastatin hCV1846459 rs4803759 ENDPT4F1 TIMETO_EP4F1 REC TC + CC Pravastatin hCV26682080 rs4420638 ENDPT4F1 TIMETO_EP4F1 GEN GG Pravastatin hCV26682080 rs4420638 ENDPT4F1 TIMETO_EP4F1 GEN GA Pravastatin hCV26682080 rs4420638 ENDPT4F1 TIMETO_EP4F1 DOM GA + GG Pravastatin 95% 95% Lower Upper CL for CL for P- PVAL_ hCV # rs # EVENTS TOTAL HR HR HR VALUE INTX hDV77718013 66 1359 0.74 0.539 1.022 0.0673 0.0556 hCV3216551 rs562338 40 932 0.59 0.401 0.877 0.0089 0.04137 hCV2862873 rs780094 41 887 0.6 0.403 0.881 0.0095 0.09031 hCV9296529 rs4358307 25 624 0.5 0.307 0.807 0.0047 0.08098 hCV29480044 rs10516433 16 454 0.46 0.255 0.832 0.0101 0.03925 hCV29480044 rs10516433 61 1309 0.67 0.487 0.934 0.0178 0.04698 hCV30454150 rs10516434 16 451 0.46 0.255 0.832 0.0102 0.04149 hCV30454150 rs10516434 61 1310 0.67 0.486 0.931 0.017 0.04884 hCV8942032 rs1264352 10 392 0.41 0.195 0.859 0.0182 0.07391 hCV9473891 rs1555173 67 1363 0.75 0.547 1.035 0.0801 0.07415 hCV2442143 rs12544854 29 713 0.55 0.35 0.877 0.0118 0.02918 hCV2442143 rs12544854 43 1070 0.57 0.391 0.836 0.004 0.00824 hCV2442143 rs12544854 29 704 0.57 0.36 0.905 0.0172 0.04882 hCV2442143 rs12544854 42 1059 0.56 0.384 0.825 0.0033 0.01402 hCV1463226 rs10890 9 303 0.41 0.188 0.885 0.0233 0.02602 hCV1463226 rs10890 16 416 0.48 0.266 0.874 0.0162 0.02602 hCV2741051 rs2230806 16 597 0.47 0.258 0.856 0.0136 0.09085 hCV2741051 rs2230806 20 709 0.47 0.272 0.801 0.0056 0.03067 hCV2741051 rs2230806 17 603 0.5 0.275 0.892 0.0192 0.06908 hCV2741051 rs2230806 20 711 0.47 0.273 0.802 0.0057 0.02439 hCV2959482 rs3890182 8 302 0.34 0.152 0.767 0.0093 0.06769 hCV2959482 rs3890182 8 320 0.34 0.151 0.753 0.0081 0.02862 hCV22275299 rs28927680 2 175 0.2 0.042 0.908 0.0372 0.0983 hCV29566897 rs10507755 67 1350 0.76 0.552 1.049 0.0957 0.02347 hCV8757333 rs1800588 21 567 0.49 0.286 0.824 0.0074 0.05012 hCV16164743 rs2928932 6 190 0.31 0.124 0.797 0.0148 0.03514 hCV16164743 rs2928932 23 555 0.6 0.355 1.004 0.052 0.03514 hCV9324316 rs9305020 48 963 0.7 0.482 1.016 0.0604 0.05765 hCV9324316 rs9305020 67 1352 0.76 0.554 1.05 0.0968 0.02527 hCV1846459 rs4803759 25 565 0.62 0.378 1.023 0.0613 0.05544 hCV1846459 rs4803759 31 707 0.66 0.415 1.036 0.0707 0.05544 hCV1846459 rs4803759 56 1272 0.64 0.457 0.895 0.0092 0.01624 hCV26682080 rs4420638 2 58 0.25 0.05 1.217 0.0855 0.07632 hCV26682080 rs4420638 15 383 0.5 0.268 0.919 0.0259 0.07632 hCV26682080 rs4420638 17 441 0.45 0.255 0.804 0.0068 0.04158
TABLE-US-00026 TABLE 26 95% 95% Lower Upper GENO- CL for CL for P- hCV # rs # Gene MODE STRATA ADJUST TYPE EVENTS TOTAL HR HR HR VALUE hCV11474611 rs3814843 CALM1 GEN ALL STATIN GG 1 3 7.54 1.055 53.886 0.0441 hCV11474611 rs3814843 CALM1 GEN ALL STATIN GT 14 224 1.17 0.676 2.038 0.5698 hCV11474611 rs3814843 CALM1 GEN ALL STATIN TT 128 2392 ref — — — hCV11474611 rs3814843 CALM1 REC ALL STATIN GG 1 3 7.43 1.041 53.062 0.0455 hCV11474611 rs3814843 CALM1 REC ALL STATIN GT + TT 142 2616 ref — — — hCV11474611 rs3814843 CALM1 GEN ALL GG 1 3 6.64 0.919 47.944 0.0606 hCV11474611 rs3814843 CALM1 GEN ALL GT 6 104 0.95 0.413 2.188 0.9051 hCV11474611 rs3814843 CALM1 GEN ALL TT 70 1183 ref — — — hCV11474611 rs3814843 CALM1 REC ALL GG 1 3 6.67 0.924 48.09 0.0599 hCV11474611 rs3814843 CALM1 REC ALL GT + TT 76 1287 ref — — — hCV2930693 rs13183672 FSTL4 REC ALL STATIN AA 96 1498 1.51 1.07 2.14 0.0191 hCV2930693 rs13183672 FSTL4 REC ALL STATIN AC + CC 48 1122 ref — — — hCV2930693 rs13183672 FSTL4 ADD ALL STATIN A — — 1.29 0.965 1.719 0.0859 hCV2930693 rs13183672 FSTL4 REC ALL AA 52 729 1.61 0.998 2.59 0.0512 hCV2930693 rs13183672 FSTL4 REC ALL AC + CC 25 560 ref — — — hCV2930693 rs13183672 FSTL4 ADD ALL A — — 1.48 0.982 2.24 0.0609
TABLE-US-00027 TABLE 27 95% 95% Lower Upper GENO- CL for CL for P- PVAL_ hCV # rs Gene MODE TYPE STATIN EVENTS TOTAL HR HR HR VALUE INTX hCV1022614 rs220479 ITGAE GEN CC Pravastatin 52 973 0.89 0.609 1.295 0.5366 0.22592 hCV1022614 rs220479 ITGAE GEN CC Placebo 56 927 ref — — — 0.22592 hCV1022614 rs220479 ITGAE GEN CT Pravastatin 15 408 0.48 0.257 0.887 0.0192 0.22592 hCV1022614 rs220479 ITGAE GEN CT Placebo 30 400 ref — — — 0.22592 hCV1022614 rs220479 ITGAE GEN TT Pravastatin 3 46 0.91 0.203 4.047 0.8969 0.22592 hCV1022614 rs220479 ITGAE GEN TT Placebo 4 56 ref — — — 0.22592 hCV1022614 rs220479 ITGAE DOM CT + CC Pravastatin 67 1381 0.74 0.541 1.024 0.0696 0.79081 hCV1022614 rs220479 ITGAE DOM CT + CC Placebo 86 1327 ref — — — 0.79081 hCV1022614 rs220479 ITGAE REC CT + TT Pravastatin 18 454 0.52 0.294 0.921 0.0248 0.11998 hCV1022614 rs220479 ITGAE REC CT + TT Placebo 34 456 ref — — — 0.11998 hCV11450563 rs2038366 GEN GG Pravastatin 29 539 1.15 0.669 1.975 0.6132 0.17234 hCV11450563 rs2038366 GEN GG Placebo 24 522 ref — — — 0.17234 hCV11450563 rs2038366 GEN GT Pravastatin 28 638 0.61 0.381 0.986 0.0436 0.17234 hCV11450563 rs2038366 GEN GT Placebo 43 602 ref — — — 0.17234 hCV11450563 rs2038366 GEN TT Pravastatin 10 151 1.13 0.472 2.724 0.7789 0.17234 hCV11450563 rs2038366 GEN TT Placebo 10 167 ref — — — 0.17234 hCV11450563 rs2038366 DOM GT + GG Pravastatin 57 1177 0.81 0.567 1.148 0.2334 0.47195 hCV11450563 rs2038366 DOM GT + GG Placebo 67 1124 ref — — — 0.47195 hCV11450563 rs2038366 REC GT + TT Pravastatin 38 789 0.7 0.463 1.064 0.0954 0.15155 hCV11450563 rs2038366 REC GT + TT Placebo 53 769 ref — — — 0.15155 hCV2091644 rs1010 VAMP8 GEN CC Pravastatin 12 271 1.18 0.51 2.73 0.6997 0.48071 hCV2091644 rs1010 VAMP8 GEN CC Placebo 10 258 ref — — — 0.48071 hCV2091644 rs1010 VAMP8 GEN CT Pravastatin 31 686 0.66 0.418 1.045 0.0763 0.48071 hCV2091644 rs1010 VAMP8 GEN CT Placebo 45 666 ref — — — 0.48071 hCV2091644 rs1010 VAMP8 GEN TT Pravastatin 26 455 0.71 0.43 1.186 0.1928 0.48071 hCV2091644 rs1010 VAMP8 GEN TT Placebo 35 448 ref — — — 0.48071 hCV2091644 rs1010 VAMP8 DOM CT + CC Pravastatin 43 957 0.76 0.507 1.126 0.1678 0.87535 hCV2091644 rs1010 VAMP8 DOM CT + CC Placebo 55 924 ref — — — 0.87535 hCV2091644 rs1010 VAMP8 REC CT + TT Pravastatin 57 1141 0.68 0.487 0.961 0.0284 0.23503 hCV2091644 rs1010 VAMP8 REC CT + TT Placebo 80 1114 ref — — — 0.23503 hCV2169762 rs1804689 HPS1 GEN TT Pravastatin 4 107 0.99 0.266 3.694 0.9903 0.34901 hCV2169762 rs1804689 HPS1 GEN TT Placebo 5 131 ref — — — 0.34901 hCV2169762 rs1804689 HPS1 GEN TG Pravastatin 36 652 0.92 0.583 1.468 0.7398 0.34901 hCV2169762 rs1804689 HPS1 GEN TG Placebo 36 600 ref — — — 0.34901 hCV2169762 rs1804689 HPS1 GEN GG Pravastatin 30 668 0.59 0.372 0.924 0.0214 0.34901 hCV2169762 rs1804689 HPS1 GEN GG Placebo 49 651 ref — — — 0.34901 hCV2169762 rs1804689 HPS1 DOM TG + TT Pravastatin 40 759 0.95 0.612 1.461 0.8004 0.13433 hCV2169762 rs1804689 HPS1 DOM TG + TT Placebo 41 731 ref — — — 0.13433 hCV2169762 rs1804689 HPS1 REC TG + GG Pravastatin 66 1320 0.73 0.529 1.006 0.0547 0.65359 hCV2169762 rs1804689 HPS1 REC TG + GG Placebo 85 1251 ref — — — 0.65359 hCV2192261 rs3213646 EXOD1 GEN CC Pravastatin 27 417 1.05 0.613 1.799 0.8592 0.20384 hCV2192261 rs3213646 EXOD1 GEN CC Placebo 26 416 ref — — — 0.20384 hCV2192261 rs3213646 EXOD1 GEN CT Pravastatin 24 691 0.54 0.328 0.898 0.0175 0.20384 hCV2192261 rs3213646 EXOD1 GEN CT Placebo 41 646 ref — — — 0.20384 hCV2192261 rs3213646 EXOD1 GEN TT Pravastatin 13 245 0.64 0.316 1.278 0.2036 0.20384 hCV2192261 rs3213646 EXOD1 GEN TT Placebo 20 243 ref — — — 0.20384 hCV2192261 rs3213646 EXOD1 DOM CT + CC Pravastatin 51 1108 0.73 0.506 1.048 0.0882 0.72432 hCV2192261 rs3213646 EXOD1 DOM CT + CC Placebo 67 1062 ref — — — 0.72432 hCV2192261 rs3213646 EXOD1 REC CT + TT Pravastatin 37 936 0.57 0.379 0.857 0.007 0.07855 hCV2192261 rs3213646 EXOD1 REC CT + TT Placebo 61 889 ref — — — 0.07855 hCV7425232 rs3900940 MYH15 GEN CC Pravastatin 13 160 1.03 0.461 2.296 0.9448 0.57268 hCV7425232 rs3900940 MYH15 GEN CC Placebo 11 142 ref — — — 0.57268 hCV7425232 rs3900940 MYH15 GEN CT Pravastatin 23 561 0.61 0.365 1.022 0.0604 0.57268 hCV7425232 rs3900940 MYH15 GEN CT Placebo 39 583 ref — — — 0.57268 hCV7425232 rs3900940 MYH15 GEN TT Pravastatin 30 620 0.71 0.442 1.146 0.1618 0.57268 hCV7425232 rs3900940 MYH15 GEN TT Placebo 39 573 ref — — — 0.57268 hCV7425232 rs3900940 MYH15 DOM CT + CC Pravastatin 36 721 0.72 0.468 1.102 0.1293 0.97544 hCV7425232 rs3900940 MYH15 DOM CT + CC Placebo 50 725 ref — — — 0.97544 hCV7425232 rs3900940 MYH15 REC CT + TT Pravastatin 53 1181 0.66 0.467 0.939 0.0207 0.33623 hCV7425232 rs3900940 MYH15 REC CT + TT Placebo 78 1156 ref — — — 0.33623 hCV945276 rs89962 KRT4 GEN TT Pravastatin 9 238 0.96 0.392 2.375 0.9381 0.71864 hCV945276 rs89962 KRT4 GEN TT Placebo 10 255 ref — — — 0.71864 hCV945276 rs89962 KRT4 GEN TG Pravastatin 37 674 0.64 0.423 0.979 0.0397 0.71864 hCV945276 rs89962 KRT4 GEN TG Placebo 53 628 ref — — — 0.71864 hCV945276 rs89962 KRT4 GEN GG Pravastatin 17 443 0.65 0.349 1.196 0.1641 0.71864 hCV945276 rs89962 KRT4 GEN GG Placebo 25 426 ref — — — 0.71864 hCV945276 rs89962 KRT4 DOM TG + TT Pravastatin 46 912 0.7 0.48 1.027 0.0683 0.83505 hCV945276 rs89962 KRT4 DOM TG + TT Placebo 63 883 ref — — — 0.83505 hCV945276 rs89962 KRT4 REC TG + GG Pravastatin 54 1117 0.65 0.458 0.916 0.0141 0.42005 hCV945276 rs89962 KRT4 REC TG + GG Placebo 78 1054 ref — — — 0.42005
TABLE-US-00028 TABLE 28 Association of MYH15 (rs3900940/hCV7425232) with stroke endpoint in CARE Study population: CARE study (n = 2913) Endpoint: stroke or TIA (offical CARE endpoint) (“endpt4f1”) Statistical method: Cox model Association of MYH15 SNP (rs3900940/hCV7425232) with stroke endpoint in CARE combined treatment arms Adjusted1 Adjusted2 Adjusted3 Genotype HR 95% CI 2-sided p-value HR 95% CI 2-sided p-value HR 95% CI 2-sided p-value Hom_CC 1.403 0.88-2.23 0.153 1.51 0.94-2.40 0.086 1.49 0.93-2.37 0.094 Het_CT 0.925 0.66-1.30 0.6565 0.89 0.63-1.25 0.49 0.881 0.62-1.24 0.4715 Maj_TT 1 1 1 Rec_CC 1.46 0.94-2.25 0.09 1.6 1.03-2.47 0.0358 1.58 1.02-2.45 0.039 Maj + het 1 1 1 “Adjusted1” = Adjusted for statin use “Adjusted2” = Adjusted for traditional risk factors (TRF), body mass index (BMI), and statin use “Adjusted3” = Adjusted for TRF, BMI, statin use, and CHD (CARE primary endpoint) Conclusions: 1) The MYH15 SNP (rs3900940/hCV7425232) was associated with stroke in CARE. 2) The MYH15 SNP (rs3900940/hCV7425232) was associated with stroke in CARE even after adjusting for CHD. (CHD defined in accordance with CARE original endpoint-fatal CHD/definite non-fatal MI, “endpt1”)
TABLE-US-00029 TABLE 29 Gene Risk GENO_ EVENTS_ TOTAL_ hCV # rs # symbol Allele MODE STRATA PLACEBO PLACEBO PLACEBO hCV2091644 rs1010 VAMP8 C GEN ALL CC 49 521 hCV2091644 rs1010 VAMP8 C GEN hist CC 28 235 hCV2091644 rs1010 VAMP8 C GEN hist CT 58 633 hCV2442143 rs12544854 ASAH1 T GEN no hist CT 48 808 hCV8942032 rs1264352 DDR1 C GEN ALL CC 8 110 hCV2169762 rs1804689 HP51 T GEN no hist GT 38 670 hCV16158671 rs2200733 C4 T GEN ALL CT 37 489 hCV16158671 rs2200733 C4 T GEN no hist CT 19 285 hCV16158671 rs2200733 C4 T GEN hist TT 3 10 hCV27504565 rs3219489 MUTYH C GEN hist CG 35 465 hCV27511436 rs3750145 FZD1 T GEN ALL CC 4 77 hCV27511436 rs3750145 FZD1 T GEN hist CC 1 31 hCV7425232 rs3900940 MYH15 C GEN hist CT 55 528 HR_ LOWER_ UPPER_ P_ EVENTS_ no hCV # PLACEBO PLACEBO PLACEBO PLACEBO ALL event HR_ALL P_ALL hCV2091644 1.50982 1.030611 2.211844 0.0344528 88 951 1.340598 0.051104903 hCV2091644 1.503 0.897908 2.515874 0.1210805 54 428 1.633661 0.014183695 hCV2091644 1.13938 0.733208 1.770572 0.5617921 118 1136 1.344979 0.076364852 hCV2442143 1.31132 0.778332 2.209298 0.3085018 101 1535 1.326084 0.166536479 hCV8942032 1.01239 0.495766 2.067369 0.9730365 22 214 1.368996 0.190221586 hCV2169762 0.99636 0.64971 1.527967 0.9866678 85 1236 1.35397 0.062193717 hCV16158671 1.07497 0.753308 1.533975 0.6902781 80 900 1.197273 0.172251195 hCV16158671 1.2283 0.742471 2.032018 0.4233603 38 517 1.282126 0.189409128 hCV16158671 3.71145 1.175206 11.72124 0.0254095 4 18 2.311594 0.124212946 hCV27504565 0.70803 0.473602 1.0585 0.092402 69 853 0.726379 0.040276813 hCV27511436 0.65977 0.244625 1.779435 0.4113489 6 149 0.503156 0.113669409 hCV27511436 0.32028 0.044599 2.300102 0.2576826 2 64 0.307292 0.120384642 hCV7425232 1.21122 0.833465 1.760195 0.3149935 107 956 1.224954 0.171949776
TABLE-US-00030 TABLE 30 Gene/ Chrom Risk GENO_ EVENTS_ TOTAL_ hCV # rs # symbol Allele MODE STRATA PLACEBO PLACEBO PLACEBO hCV2091644 rs1010 VAMP8 C GEN ALL CC 49 521 hCV2091644 rs1010 VAMP8 C DOM ALL CC + CT 153 1968 hCV2091644 rs1010 VAMP8 C GEN no hist CC 21 286 hCV2091644 rs1010 VAMP8 C GEN hist CC 28 235 hCV26505812 rs10757274 C9p21 G GEN ALL AG 121 1455 hCV26505812 rs10757274 C9p21 G DOM ALL GG + AG 169 2156 hCV26505812 rs10757274 C9p21 G GEN no hist GG 23 364 hCV26505812 rs10757274 C9p21 G GEN no hist AG 52 826 hCV26505812 rs10757274 C9p21 G DOM no hist GG + AG 75 1190 hCV26505812 rs10757274 C9p21 G GEN hist AG 69 629 hCV2442143 rs12544854 ASAH1 T GEN no hist TT 26 393 hCV8942032 rs1264352 DDR1 C GEN no hist CG 37 550 hCV8942032 rs1264352 DDR1 C DOM no hist CC + CG 41 616 hCV16158671 rs2200733 C4 T GEN hist TT 3 10 hCV27504565 rs3219489 MUTYH C GEN hist CG 35 465 hCV27504565 rs3219489 MUTYH C DOM hist GG + CG 41 523 hCV27511436 rs3750145 FZD1 T DOM ALL CC + CT 50 804 hCV27511436 rs3750145 FZD1 T GEN no hist CT 16 414 hCV27511436 rs3750145 FZD1 T DOM no hist CC + CT 19 460 HR_ LOWER_ UPPER_ P_ EVENTS_ no hCV # PLACEBO PLACEBO PLACEBO PLACEBO ALL event HR_ALL P_ALL hCV2091644 1.509818 1.030611 2.211844 0.0344528 88 951 1.340598 0.0511049 hCV2091644 1.242162 0.916407 1.683713 0.1622853 hCV2091644 1.452091 0.820968 2.568392 0.1998539 34 523 1.033962 0.91230651 hCV2091644 1.503005 0.897908 2.515874 0.1210805 54 428 1.633661 0.0141837 hCV26505812 1.464442 1.027673 2.086842 0.0347703 215 2683 1.118574 0.41790129 hCV26505812 1.381146 0.981881 1.942766 0.0636069 hCV26505812 1.507129 0.820845 2.767193 0.1857813 47 674 1.215134 0.39336777 hCV26505812 1.482778 0.876794 2.50758 0.1417039 87 1528 0.992161 1 hCV26505812 1.489002 0.900117 2.463154 0.1210931 hCV26505812 1.372228 0.849193 2.217411 0.196237 128 1155 1.185801 0.35086569 hCV2442143 1.479057 0.825673 2.649487 0.1881955 41 704 1.173733 0.49295851 hCV8942032 1.324522 0.870367 2.015654 0.1895578 61 972 1.10852 0.55960326 hCV8942032 1.305687 0.868558 1.962816 0.1996948 hCV16158671 3.711451 1.175206 11.72124 0.0254095 4 18 2.311594 0.12421295 hCV27504565 0.708031 0.473602 1.0585 0.092402 69 853 0.726379 0.04027681 hCV27504565 0.741641 0.506363 1.08624 0.1247589 hCV27511436 0.80098 0.583058 1.100353 0.1707752 hCV27511436 0.603398 0.351722 1.035162 0.066584 42 805 0.824734 0.33847297 hCV27511436 0.646002 0.390525 1.068608 0.0888378
TABLE-US-00031 TABLE 31 Gene/ Chrom Risk GENO_ EVENTS_ hCV # rs # symbol Allele MODE STRATA RESP STATIN RESP hCV2091644 rs1010 VAMP8 C DOM no hist CC + CT pravastatin 50 hCV2091644 rs1010 VAMP8 C DOM no hist CC + CT placebo 67 hCV29539757 rs10110659 KCNQ3 C REC hist CC + AC pravastatin 106 hCV29539757 rs10110659 KCNQ3 C REC hist CC + AC placebo 100 hCV26505812 rs10757274 C9p21 G GEN ALL GG pravastatin 51 hCV26505812 rs10757274 C9p21 G GEN ALL GG placebo 48 hCV26505812 rs10757274 C9p21 G GEN ALL AG pravastatin 94 hCV26505812 rs10757274 C9p21 G GEN ALL AG placebo 121 hCV26505812 rs10757274 C9p21 G GEN ALL AA pravastatin 56 hCV26505812 rs10757274 C9p21 G GEN ALL AA placebo 41 hCV26505812 rs10757274 C9p21 G DOM ALL GG + AG pravastatin 145 hCV26505812 rs10757274 C9p21 G DOM ALL GG + AG placebo 169 hCV26505812 rs10757274 C9p21 G GEN no hist GG pravastatin 24 hCV26505812 rs10757274 C9p21 G GEN no hist GG placebo 23 hCV26505812 rs10757274 C9p21 G GEN no hist AG pravastatin 35 hCV26505812 rs10757274 C9p21 G GEN no hist AG placebo 52 hCV26505812 rs10757274 C9p21 G GEN no hist AA pravastatin 28 hCV26505812 rs10757274 C9p21 G GEN no hist AA placebo 19 hCV26505812 rs10757274 C9p21 G DOM no hist GG + AG pravastatin 59 hCV26505812 rs10757274 C9p21 G DOM no hist GG + AG placebo 75 hCV2169762 rs1804689 HPS1 T DOM no hist TT + GT pravastatin 57 hCV2169762 rs1804689 HPS1 T DOM no hist TT + GT placebo 47 hCV2169762 rs1804689 HPS1 T REC hist GG + GT pravastatin 109 hCV2169762 rs1804689 HPS1 T REC hist GG + GT placebo 102 no TOTAL_ LOWER_ UPPER_ P_INT_ hCV # event RESP HR_RESP RESP RESP P_RESP RESP hCV2091644 994 1044 0.7860368 0.54496 1.13377 0.19768 0.0837336 hCV2091644 1033 1100 0.0837336 hCV29539757 1087 1193 1.0088023 0.76761 1.32578 0.94987 0.0530448 hCV29539757 1040 1140 0.0530448 hCV26505812 638 689 1.0816406 0.7293 1.60421 0.69635 0.0696553 hCV26505812 653 701 0.0696553 hCV26505812 1349 1443 0.7768621 0.59335 1.01713 0.06629 0.0696553 hCV26505812 1334 1455 0.0696553 hCV26505812 674 730 1.3304985 0.88923 1.99075 0.16486 0.0696553 hCV26505812 680 721 0.0696553 hCV26505812 1987 2132 0.8638087 0.69193 1.07838 0.1959 0.0630809 hCV26505812 1987 2156 0.0630809 hCV26505812 333 357 1.0681052 0.6028 1.89259 0.82141 0.0828923 hCV26505812 341 364 0.0828923 hCV26505812 754 789 0.6977172 0.45454 1.071 0.09971 0.0828923 hCV26505812 774 826 0.0828923 hCV26505812 395 423 1.5704654 0.87695 2.81243 0.12894 0.0828923 hCV26505812 424 443 0.0828923 hCV26505812 1087 1146 0.8131888 0.57817 1.14374 0.23474 0.0573322 hCV26505812 1115 1190 0.0573322 hCV2169762 731 788 1.2655756 0.86016 1.86208 0.23193 0.033 hCV2169762 777 824 0.033 hCV2169762 1063 1172 1.0276801 0.7845 1.34624 0.84289 0.0507564 hCV2169762 1035 1137 0.0507564
TABLE-US-00032 TABLE 32 Gene/ Chrom Risk GENO_ EVENTS_ hCV # rs # symbol Allele MODE STRATA RESP STATIN RESP hCV2091644 rs1010 VAMP8 C GEN no hist CC pravastatin 13 hCV2091644 rs1010 VAMP8 C GEN no hist CC placebo 21 hCV2091644 rs1010 VAMP8 C GEN no hist CT pravastatin 37 hCV2091644 rs1010 VAMP8 C GEN no hist CT placebo 46 hCV2091644 rs1010 VAMP8 C GEN no hist TT pravastatin 36 hCV2091644 rs1010 VAMP8 C GEN no hist TT placebo 27 hCV2091644 rs1010 VAMP8 C DOM no hist CC + CT pravastatin 50 hCV2091644 rs1010 VAMP8 C DOM no hist CC + CT placebo 67 hCV29539757 rs10110659 KCNQ3 C GEN hist AA pravastatin 7 hCV29539757 rs10110659 KCNQ3 C GEN hist AA placebo 16 hCV29539757 rs10110659 KCNQ3 C GEN hist AC pravastatin 44 hCV29539757 rs10110659 KCNQ3 C GEN hist AC placebo 44 hCV29539757 rs10110659 KCNQ3 C GEN hist CC pravastatin 62 hCV29539757 rs10110659 KCNQ3 C GEN hist CC placebo 56 hCV29539757 rs10110659 KCNQ3 C REC hist CC + AC pravastatin 106 hCV29539757 rs10110659 KCNQ3 C REC hist CC + AC placebo 100 hCV26505812 rs10757274 C9p21 G GEN ALL GG pravastatin 51 hCV26505812 rs10757274 C9p21 G GEN ALL GG placebo 48 hCV26505812 rs10757274 C9p21 G GEN ALL AG pravastatin 94 hCV26505812 rs10757274 C9p21 G GEN ALL AG placebo 121 hCV26505812 rs10757274 C9p21 G GEN ALL AA pravastatin 56 hCV26505812 rs10757274 C9p21 G GEN ALL AA placebo 41 hCV26505812 rs10757274 C9p21 G DOM ALL GG + AG pravastatin 145 hCV26505812 rs10757274 C9p21 G DOM ALL GG + AG placebo 169 hCV26505812 rs10757274 C9p21 G GEN no hist GG pravastatin 24 hCV26505812 rs10757274 C9p21 G GEN no hist GG placebo 23 hCV26505812 rs10757274 C9p21 G GEN no hist AG pravastatin 35 hCV26505812 rs10757274 C9p21 G GEN no hist AG placebo 52 hCV26505812 rs10757274 C9p21 G GEN no hist AA pravastatin 28 hCV26505812 rs10757274 C9p21 G GEN no hist AA placebo 19 hCV26505812 rs10757274 C9p21 G DOM no hist GG + AG pravastatin 59 hCV26505812 rs10757274 C9p21 G DOM no hist GG + AG placebo 75 hCV2442143 rs12544854 ASAH1 T REC no hist CC + CT pravastatin 72 hCV2442143 rs12544854 ASAH1 T REC no hist CC + CT placebo 68 hCV2442143 rs12544854 ASAH1 T DOM hist TT + CT pravastatin 88 hCV2442143 rs12544854 ASAH1 T DOM hist TT + CT placebo 82 hCV27830265 rs12762303 ALOX5 G DOM no hist GG + AG pravastatin 25 hCV27830265 rs12762303 ALOX5 G DOM no hist GG + AG placebo 16 hCV2169762 rs1804689 HPS1 T GEN no hist TT pravastatin 10 hCV2169762 rs1804689 HPS1 T GEN no hist TT placebo 9 hCV2169762 rs1804689 HPS1 T GEN no hist GT pravastatin 47 hCV2169762 rs1804689 HPS1 T GEN no hist GT placebo 38 hCV2169762 rs1804689 HPS1 T GEN no hist GG pravastatin 30 hCV2169762 rs1804689 HPS1 T GEN no hist GG placebo 47 hCV2169762 rs1804689 HPS1 T DOM no hist TT + GT pravastatin 57 hCV2169762 rs1804689 HPS1 T DOM no hist TT + GT placebo 47 hCV2169762 rs1804689 HPS1 T GEN hist TT pravastatin 5 hCV2169762 rs1804689 HPS1 T GEN hist TT placebo 12 hCV2169762 rs1804689 HPS1 T GEN hist GT pravastatin 47 hCV2169762 rs1804689 HPS1 T GEN hist GT placebo 46 hCV2169762 rs1804689 HPS1 T GEN hist GG pravastatin 62 hCV2169762 rs1804689 HPS1 T GEN hist GG placebo 56 hCV2169762 rs1804689 HPS1 T REC hist GG + GT pravastatin 109 hCV2169762 rs1804689 HPS1 T REC hist GG + GT placebo 102 hCV1348610 rs3739636 C9orf46 A GEN hist AA pravastatin 24 hCV1348610 rs3739636 C9orf46 A GEN hist AA placebo 19 hCV1348610 rs3739636 C9orf46 A GEN hist AG pravastatin 47 hCV1348610 rs3739636 C9orf46 A GEN hist AG placebo 61 hCV1348610 rs3739636 C9orf46 A GEN hist GG pravastatin 43 hCV1348610 rs3739636 C9orf46 A GEN hist GG placebo 35 hCV1348610 rs3739636 C9orf46 A DOM hist AA + AG pravastatin 71 hCV1348610 rs3739636 C9orf46 A DOM hist AA + AG placebo 80 hCV27511436 rs3750145 FZD1 T GEN no hist CC pravastatin 1 hCV27511436 rs3750145 FZD1 T GEN no hist CC placebo 3 hCV27511436 rs3750145 FZD1 T GEN no hist CT pravastatin 26 hCV27511436 rs3750145 FZD1 T GEN no hist CT placebo 16 hCV27511436 rs3750145 FZD1 T GEN no hist TT pravastatin 60 hCV27511436 rs3750145 FZD1 T GEN no hist TT placebo 75 hCV27511436 rs3750145 FZD1 T DOM no hist CC + CT pravastatin 27 hCV27511436 rs3750145 FZD1 T DOM no hist CC + CT placebo 19 no TOTAL_ LOWER_ UPPER_ P_INT_ hCV # event RESP HR_RESP RESP RESP P_RESP RESP hCV2091644 258 271 0.635895 0.31841 1.26996 0.199563 0.1798335 hCV2091644 265 286 0.1798335 hCV2091644 736 773 0.850356 0.5516 1.31092 0.462931 0.1798335 hCV2091644 768 814 0.1798335 hCV2091644 492 528 1.358113 0.82457 2.2369 0.22925 0.1798335 hCV2091644 510 537 0.1798335 hCV2091644 994 1044 0.786037 0.54496 1.13377 0.197677 0.0837336 hCV2091644 1033 1100 0.0837336 hCV29539757 96 103 0.411487 0.16926 1.00034 0.050088 0.1548877 hCV29539757 92 108 0.1548877 hCV29539757 493 537 0.994615 0.6549 1.51055 0.979793 0.1548877 hCV29539757 481 525 0.1548877 hCV29539757 594 656 1.015618 0.70762 1.45767 0.93301 0.1548877 hCV29539757 559 615 0.1548877 hCV29539757 1087 1193 1.008802 0.76761 1.32578 0.949874 0.0530448 hCV29539757 1040 1140 0.0530448 hCV26505812 638 689 1.081641 0.7293 1.60421 0.696354 0.0696553 hCV26505812 653 701 0.0696553 hCV26505812 1349 1443 0.776862 0.59335 1.01713 0.066291 0.0696553 hCV26505812 1334 1455 0.0696553 hCV26505812 674 730 1.330498 0.88923 1.99075 0.164856 0.0696553 hCV26505812 680 721 0.0696553 hCV26505812 1987 2132 0.863809 0.69193 1.07838 0.195899 0.0630809 hCV26505812 1987 2156 0.0630809 hCV26505812 333 357 1.068105 0.6028 1.89259 0.821407 0.0828923 hCV26505812 341 364 0.0828923 hCV26505812 754 789 0.697717 0.45454 1.071 0.099711 0.0828923 hCV26505812 774 826 0.0828923 hCV26505812 395 423 1.570465 0.87695 2.81243 0.128942 0.0828923 hCV26505812 424 443 0.0828923 hCV26505812 1087 1146 0.813189 0.57817 1.14374 0.234739 0.0573322 hCV26505812 1115 1190 0.0573322 hCV2442143 1146 1218 1.087339 0.78059 1.51463 0.620489 0.1385034 hCV2442143 1175 1243 0.1385034 hCV2442143 865 953 1.043307 0.77225 1.4095 0.78239 0.1787787 hCV2442143 850 932 0.1787787 hCV27830265 474 499 1.479294 0.78982 2.77065 0.22133 0.1332561 hCV27830265 445 461 0.1332561 hCV2169762 127 137 1.27501 0.51771 3.14008 0.597269 0.102835 hCV2169762 145 154 0.102835 hCV2169762 604 651 1.268286 0.82701 1.94501 0.27599 0.102835 hCV2169762 632 670 0.102835 hCV2169762 753 783 0.65902 0.41685 1.04187 0.074354 0.102835 hCV2169762 763 810 0.102835 hCV2169762 731 788 1.265576 0.86016 1.86208 0.231932 0.033 hCV2169762 777 824 0.033 hCV2169762 119 124 0.336546 0.11847 0.95606 0.040922 0.1254774 hCV2169762 99 111 0.1254774 hCV2169762 511 558 0.94255 0.62771 1.4153 0.775439 0.1254774 hCV2169762 480 526 0.1254774 hCV2169762 552 614 1.104484 0.76954 1.58521 0.589855 0.1254774 hCV2169762 555 611 0.1254774 hCV2169762 1063 1172 1.02768 0.7845 1.34624 0.842894 0.0507564 hCV2169762 1035 1137 0.0507564 hCV1348610 226 250 0.986092 0.54 1.80071 0.963642 0.1842815 hCV1348610 186 205 0.1842815 hCV1348610 566 613 0.740596 0.50624 1.08345 0.121846 0.1842815 hCV1348610 545 606 0.1842815 hCV1348610 378 421 1.276897 0.81723 1.99511 0.283036 0.1842815 hCV1348610 392 427 0.1842815 hCV1348610 792 863 0.806434 0.58581 1.11014 0.187096 0.1002517 hCV1348610 731 811 0.1002517 hCV27511436 42 43 0.349207 0.03631 3.35808 0.362284 0.1652143 hCV27511436 43 46 0.1652143 hCV27511436 407 433 1.575251 0.84504 2.93645 0.152693 0.1652143 hCV27511436 398 414 0.1652143 hCV27511436 1035 1095 0.85237 0.60701 1.19691 0.356417 0.1652143 hCV27511436 1099 1174 0.1652143 hCV27511436 449 476 1.387947 0.77175 2.49613 0.273626 0.1600111 hCV27511436 441 460 0.1600111
TABLE-US-00033 TABLE 33 gene/ chrom GENO hCV # rs # symbol ENDPT MODE STRATA ADJUST TYPE hCV1348610 rs3739636 C9orf46 ATHERO GEN WHITE AGEBL GEND01 AG hCV15857769 rs2924914 ATHERO GEN WHITE AGEBL GEND01 TT hCV15857769 rs2924914 ATHERO REC WHITE AGEBL GEND01 TT hCV15857769 rs2924914 ATHERO ADD WHITE AGEBL GEND01 T hCV15857769 rs2924914 ATHERO GEN WHITE AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV15857769 rs2924914 ATHERO REC WHITE AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV15857769 rs2924914 ISCHEM GEN WHITE AGEBL GEND01 TT hCV15857769 rs2924914 ISCHEM REC WHITE AGEBL GEND01 TT hCV15857769 rs2924914 ISCHEM ADD WHITE AGEBL GEND01 T hCV15857769 rs2924914 ISCHEM GEN WHITE AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV15857769 rs2924914 ISCHEM ADD WHITE AGEBL GEND01 T BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV15857769 rs2924914 STROKE GEN WHITE AGEBL GEND01 TT hCV16336 rs362277 HD STROKE ADD WHITE AGEBL GEND01 C hCV30308202 rs9482985 LAMA2 ISCHEM REC WHITE AGEBL GEND01 GG hCV30308202 rs9482985 LAMA2 ISCHEM REC WHITE AGEBL GEND01 GG BMI PRESSM DIABADA HTN LDLADJBL HDL44BL 95% 95% Lower Upper CL for CL for P-VALUE 2DF P- hCV # EVENTS TOTAL HR HR HR 2-sided) VALUE hCV1348610 147 1809 1.28 0.97 1.70 0.087 0.232 hCV15857769 31 310 1.52 1.03 2.26 0.036 0.111 hCV15857769 31 310 1.47 1.01 2.13 0.046 . hCV15857769 . . 1.19 0.99 1.43 0.066 . hCV15857769 30 300 1.46 0.98 2.17 0.067 0.186 hCV15857769 30 300 1.4 0.96 2.06 0.083 . hCV15857769 41 310 1.42 1.01 1.99 0.044 0.127 hCV15857769 41 310 1.36 0.98 1.88 0.064 . hCV15857769 . . 1.16 0.99 1.35 0.060 . hCV15857769 40 300 1.36 0.97 1.93 0.078 0.202 hCV15857769 . . 1.14 0.98 1.34 0.093 . hCV15857769 48 310 1.32 0.96 1.80 0.084 0.220 hCV16336 . . 1.2 0.97 1.49 0.093 . hCV30308202 280 2509 1.21 0.98 1.50 0.080 . hCV30308202 275 2458 1.21 0.98 1.51 0.080 .
TABLE-US-00034 TABLE 34 gene/ chrom GENO hCV # rs # symbol ENDPT MODE STRATA ADJUST TYPE hCV1348610 rs3739636 C9orf46 ATHERO GEN BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 ATHERO ADD BLACK AGEBL GEND01 A BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 ISCHEM GEN BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 ISCHEM ADD BLACK AGEBL GEND01 A BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 STROKE GEN BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 STROKE REC BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 STROKE ADD BLACK AGEBL GEND01 A BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1619596 rs1048621 SDCBP2 ISCHEM GEN BLACK AGEBL GEND01 AA hCV1619596 rs1048621 SDCBP2 ISCHEM REC BLACK AGEBL GEND01 AA hCV1619596 rs1048621 SDCBP2 ISCHEM GEN BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1619596 rs1048621 SDCBP2 ISCHEM REC BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1619596 rs1048621 SDCBP2 STROKE GEN BLACK AGEBL GEND01 AA hCV1619596 rs1048621 SDCBP2 STROKE REC BLACK AGEBL GEND01 AA hCV1619596 rs1048621 SDCBP2 STROKE GEN BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1619596 rs1048621 SDCBP2 STROKE REC BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV16336 rs362277 HD ISCHEM GEN BLACK AGEBL GEND01 CT hCV16336 rs362277 HD ISCHEM GEN BLACK AGEBL GEND01 CT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1723718 rs12481805 UMODL1 ATHERO GEN BLACK AGEBL GEND01 AA hCV1723718 rs12481805 UMODL1 ATHERO REC BLACK AGEBL GEND01 AA hCV1723718 rs12481805 UMODL1 ATHERO GEN BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1723718 rs12481805 UMODL1 ATHERO REC BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1723718 rs12481805 UMODL1 ISCHEM GEN BLACK AGEBL GEND01 AA hCV1723718 rs12481805 UMODL1 ISCHEM REC BLACK AGEBL GEND01 AA hCV1723718 rs12481805 UMODL1 ISCHEM GEN BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1723718 rs12481805 UMODL1 ISCHEM REC BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV25596936 rs6967117 EPHA1 STROKE GEN BLACK AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV25596936 rs6967117 EPHA1 STROKE REC BLACK AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV27077072 rs8060368 ATHERO REC BLACK AGEBL GEND01 CC hCV27077072 rs8060368 ATHERO ADD BLACK AGEBL GEND01 C hCV27077072 rs8060368 ATHERO ADD BLACK AGEBL GEND01 C BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV27077072 rs8060368 ISCHEM ADD BLACK AGEBL GEND01 C hCV8754449 rs781226 TESK2 ATHERO GEN BLACK AGEBL GEND01 CT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV8754449 rs781226 TESK2 ISCHEM GEN BLACK AGEBL GEND01 CT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL 95% 95% Lower Upper CL for CL for P-VALUE 2DF hCV # EVENTS TOTAL HR HR HR (2-sided) P-VALUE hCV1348610 17 151 2.03 0.93 4.40 0.074 0.203 hCV1348610 . . 1.41 0.97 2.06 0.073 . hCV1348610 20 151 1.83 0.91 3.67 0.089 0.214 hCV1348610 . . 1.36 0.96 1.93 0.085 . hCV1348610 25 151 1.75 0.94 3.23 0.076 0.173 hCV1348610 25 151 1.56 0.96 2.54 0.075 . hCV1348610 . . 1.33 0.98 1.82 0.072 . hCV1619596 6 22 2.36 1.00 5.60 0.051 0.150 hCV1619596 6 22 2.28 0.98 5.32 0.055 . hCV1619596 5 20 2.66 1.02 6.90 0.045 0.133 hCV1619596 5 20 2.54 1.00 6.46 0.050 . hCV1619596 7 22 2.15 0.97 4.75 0.059 0.165 hCV1619596 7 22 2.12 0.97 4.61 0.059 . hCV1619596 6 20 2.24 0.95 5.31 0.067 0.185 hCV1619596 6 20 2.2 0.95 5.14 0.068 . hCV16336 43 326 1.68 0.92 3.07 0.094 0.083 hCV16336 41 309 1.95 1.02 3.71 0.043 0.033 hCV1723718 3 8 3.95 1.21 12.91 0.023 0.046 hCV1723718 3 8 4.15 1.28 13.49 0.018 . hCV1723718 3 8 3.4 1.00 11.56 0.051 0.085 hCV1723718 3 8 3.61 1.07 12.22 0.039 . hCV1723718 3 8 3.26 1.01 10.59 0.049 0.073 hCV1723718 3 8 3.46 1.07 11.17 0.038 . hCV1723718 3 8 3.08 0.92 10.32 0.068 0.096 hCV1723718 3 8 3.29 0.99 10.95 0.052 . hCV25596936 1 4 7 0.80 61.25 0.079 0.170 hCV25596936 1 4 6.66 0.77 58.06 0.086 . hCV27077072 48 444 1.78 0.96 3.29 0.066 . hCV27077072 . . 1.82 1.03 3.24 0.041 . hCV27077072 . . 1.64 0.91 2.95 0.097 . hCV27077072 . . 1.56 0.94 2.59 0.087 . hCV8754449 35 297 1.86 0.99 3.46 0.052 0.081 hCV8754449 39 297 1.8 1.01 3.24 0.048 0.085
TABLE-US-00035 TABLE 35 gene/ chrom GENO- hCV # rs # symbol ENDPT MODE STRATA ADJUST TYPE hCV11425801 rs3805953 PEX6 ISCHEM GEN WHITE AGEBL GEND01 CT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV11425801 rs3805953 PEX6 STROKE GEN WHITE AGEBL GEND01 CT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 ATHERO DOM WHITE AGEBL GEND01 AG + AA hCV1348610 rs3739636 C9orf46 ATHERO GEN WHITE AGEBL GEND01 AG BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 ATHERO DOM WHITE AGEBL GEND01 AG + AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV15857769 rs2924914 ATHERO ADD WHITE AGEBL GEND01 T BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV15857769 rs2924914 ISCHEM DOM WHITE AGEBL GEND01 TC + TT hCV15857769 rs2924914 ISCHEM REC WHITE AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV15857769 rs2924914 STROKE REC WHITE AGEBL GEND01 TT hCV15857769 rs2924914 STROKE ADD WHITE AGEBL GEND01 T hCV15857769 rs2924914 STROKE GEN WHITE AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV15857769 rs2924914 STROKE REC WHITE AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV15857769 rs2924914 STROKE ADD WHITE AGEBL GEND01 T BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV16158671 rs2200733 STROKE GEN WHITE AGEBL GEND01 TT hCV16158671 rs2200733 STROKE REC WHITE AGEBL GEND01 TT hCV16158671 rs2200733 STROKE GEN WHITE AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV16158671 rs2200733 STROKE REC WHITE AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV16336 rs362277 HD STROKE GEN WHITE AGEBL GEND01 CC hCV16336 rs362277 HD STROKE DOM WHITE AGEBL GEND01 CT + CC hCV16336 rs362277 HD STROKE REC WHITE AGEBL GEND01 CC hCV16336 rs362277 HD STROKE ADD WHITE AGEBL GEND01 C BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV29401764 rs7793552 LOC646588 ISCHEM REC WHITE AGEBL GEND01 CC hCV30308202 rs9482985 LAMA2 ISCHEM ADD WHITE AGEBL GEND01 G hCV30308202 rs9482985 LAMA2 ISCHEM ADD WHITE AGEBL GEND01 G BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV30308202 rs9482985 LAMA2 STROKE REC WHITE AGEBL GEND01 GG hCV32160712 rs11079160 ATHERO GEN WHITE AGEBL GEND01 TT hCV32160712 rs11079160 ATHERO REC WHITE AGEBL GEND01 TT hCV32160712 rs11079160 ATHERO GEN WHITE AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV32160712 rs11079160 ATHERO REC WHITE AGEBL GEND01 TT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL 95% 95% Lower Upper CL for CL for P-VALUE 2DF P- hCV # EVENTS TOTAL HR HR HR (2-sided) VALUE hCV11425801 206 1814 1.17 0.928 1.48 0.1834 0.1314 hCV11425801 254 1814 1.15 0.933 1.418 0.1894 0.1374 hCV1348610 205 2556 1.25 0.953 1.631 0.108 . hCV1348610 143 1763 1.25 0.938 1.658 0.1286 0.3147 hCV1348610 201 2499 1.22 0.933 1.605 0.1444 . hCV15857769 . . 1.17 0.969 1.403 0.1033 . hCV15857769 187 1704 1.16 0.942 1.422 0.165 . hCV15857769 40 300 1.31 0.942 1.821 0.1092 . hCV15857769 48 310 1.28 0.947 1.723 0.1093 . hCV15857769 . . 1.12 0.974 1.288 0.1112 . hCV15857769 47 300 1.29 0.939 1.766 0.1172 0.2918 hCV15857769 47 300 1.26 0.928 1.702 0.1394 . hCV15857769 . . 1.11 0.96 1.274 0.1632 . hCV16158671 16 90 1.41 0.853 2.323 0.1811 0.4076 hCV16158671 16 90 1.4 0.85 2.306 0.1856 . hCV16158671 16 88 1.48 0.895 2.443 0.1272 0.3047 hCV16336 408 3030 2.2 0.707 6.862 0.1734 0.2057 hCV16336 495 3764 2.14 0.689 6.677 0.188 . hCV16336 408 3030 1.19 0.944 1.49 0.1428 . hCV16336 . . 1.16 0.937 1.44 0.1709 . hCV29401764 199 1792 1.15 0.941 1.395 0.1757 . hCV30308202 . . 1.14 0.946 1.368 0.1694 . hCV30308202 . . 1.14 0.949 1.374 0.1586 . hCV30308202 342 2509 1.14 0.942 1.376 0.1802 . hCV32160712 13 119 1.47 0.835 2.572 0.183 0.3099 hCV32160712 13 119 1.5 0.858 2.617 0.1551 . hCV32160712 13 117 1.49 0.851 2.626 0.1621 0.2277 hCV32160712 13 117 1.54 0.883 2.698 0.1277 .
TABLE-US-00036 TABLE 36 gene/ chrom GENO hCV # rs # symbol ENDPT MODE STRATA ADJUST TYPE hCV11425801 rs3805953 PEX6 ISCHEM GEN BLACK AGEBL GEND01 CT hCV11425801 rs3805953 PEX6 ISCHEM GEN BLACK AGEBL GEND01 CT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV11425801 rs3805953 PEX6 STROKE GEN BLACK AGEBL GEND01 CT hCV11425801 rs3805953 PEX6 STROKE GEN BLACK AGEBL GEND01 CT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV11425842 rs10948059 GNMT ATHERO GEN BLACK AGEBL GEND01 CC BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV11425842 rs10948059 GNMT ATHERO REC BLACK AGEBL GEND01 CC BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV11425842 rs10948059 GNMT ATHERO ADD BLACK AGEBL GEND01 C BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV11425842 rs10948059 GNMT STROKE GEN BLACK AGEBL GEND01 CC BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV11425842 rs10948059 GNMT STROKE ADD BLACK AGEBL GEND01 C BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 ATHERO GEN BLACK AGEBL GEND01 AA hCV1348610 rs3739636 C9orf46 ATHERO DOM BLACK AGEBL GEND01 AG + AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 ATHERO REC BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1348610 rs3739636 C9orf46 ISCHEM REC BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1619596 rs1048621 SDCBP2 ISCHEM ADD BLACK AGEBL GEND01 A hCV1619596 rs1048621 SDCBP2 ISCHEM ADD BLACK AGEBL GEND01 A BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV16336 rs362277 HD ATHERO GEN BLACK AGEBL GEND01 CT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV16336 rs362277 HD ISCHEM DOM BLACK AGEBL GEND01 CT + CC BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV16336 rs362277 HD STROKE GEN BLACK AGEBL GEND01 CT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1723718 rs12481805 UMODL1 STROKE GEN BLACK AGEBL GEND01 AA hCV1723718 rs12481805 UMODL1 STROKE REC BLACK AGEBL GEND01 AA hCV1723718 rs12481805 UMODL1 STROKE GEN BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV1723718 rs12481805 UMODL1 STROKE REC BLACK AGEBL GEND01 AA BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV25596936 rs6967117 EPHA1 STROKE GEN BLACK AGEBL GEND01 TT hCV25596936 rs6967117 EPHA1 STROKE REC BLACK AGEBL GEND01 TT hCV27077072 rs8060368 ATHERO REC BLACK AGEBL GEND01 CC BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV27077072 rs8060368 ISCHEM REC BLACK AGEBL GEND01 CC hCV27077072 rs8060368 ISCHEM ADD BLACK AGEBL GEND01 C BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV29401764 rs7793552 LOC646588 STROKE GEN BLACK AGEBL GEND01 CC hCV29401764 rs7793552 LOC646588 STROKE REC BLACK AGEBL GEND01 CC hCV29401764 rs7793552 LOC646588 STROKE GEN BLACK AGEBL GEND01 CC BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV29401764 rs7793552 LOC646588 STROKE REC BLACK AGEBL GEND01 CC BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV8754449 rs781226 TESK2 ATHERO GEN BLACK AGEBL GEND01 CT hCV8754449 rs781226 TESK2 ATHERO DOM BLACK AGEBL GEND01 CT + CC BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV8754449 rs781226 TESK2 ISCHEM DOM BLACK AGEBL GEND01 CT + CC BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV8754449 rs781226 TESK2 STROKE GEN BLACK AGEBL GEND01 CT BMI PRESSM DIABADA HTN LDLADJBL HDL44BL hCV8942032 rs1264352 DDR1 STROKE GEN BLACK AGEBL GEND01 CG hCV8942032 rs1264352 DDR1 STROKE GEN BLACK AGEBL GEND01 CG BMI PRESSM DIABADA HTN LDLADJBL HDL44BL 95% 95% Lower Upper CL for CL for P-VALUE 2DF P- hCV # EVENTS TOTAL HR HR HR (2-sided) VALUE hCV11425801 25 184 1.4 0.853 2.286 0.1849 0.4151 hCV11425801 24 177 1.47 0.882 2.446 0.1399 0.3364 hCV11425801 30 184 1.35 0.865 2.119 0.1854 0.1546 hCV11425801 29 177 1.39 0.88 2.209 0.1574 0.145 hCV11425842 19 158 1.63 0.789 3.384 0.1864 0.3447 hCV11425842 19 158 1.5 0.857 2.628 0.1557 . hCV11425842 . . 1.29 0.894 1.872 0.1716 . hCV11425842 25 158 1.51 0.822 2.78 0.1837 0.4087 hCV11425842 . . 1.23 0.908 1.664 0.181 . hCV1348610 17 157 1.64 0.769 3.515 0.1995 0.4376 hCV1348610 39 427 1.72 0.865 3.421 0.1223 . hCV1348610 17 151 1.54 0.855 2.786 0.1497 . hCV1348610 20 151 1.57 0.91 2.713 0.1048 . hCV1619596 . . 1.33 0.902 1.954 0.1502 . hCV1619596 . . 1.37 0.904 2.084 0.1373 . hCV16336 34 309 1.61 0.832 3.118 0.1574 0.1458 hCV16336 53 469 1.6 0.853 3 0.1434 . hCV16336 48 309 1.44 0.846 2.456 0.1788 0.1231 hCV1723718 3 8 2.45 0.763 7.88 0.1323 0.1146 hCV1723718 3 8 2.62 0.816 8.39 0.1057 . hCV1723718 3 8 2.28 0.692 7.493 0.1755 0.1501 hCV1723718 3 8 2.44 0.746 8.015 0.1401 . hCV25596936 1 4 4.13 0.551 31.03 0.1676 0.3443 hCV25596936 1 4 4.04 0.539 30.26 0.1741 . hCV27077072 44 423 1.59 0.852 2.96 0.1453 . hCV27077072 53 444 1.48 0.859 2.566 0.1567 . hCV27077072 . . 1.51 0.891 2.567 0.125 . hCV29401764 13 61 1.62 0.855 3.084 0.1382 0.3119 hCV29401764 13 61 1.58 0.873 2.848 0.1313 . hCV29401764 12 57 1.62 0.836 3.15 0.1529 0.3156 hCV29401764 12 57 1.61 0.87 2.981 0.1291 . hCV8754449 36 310 1.49 0.836 2.657 0.1758 0.1929 hCV8754449 43 414 1.61 0.879 2.966 0.1228 . hCV8754449 49 414 1.59 0.899 2.806 0.1107 . hCV8754449 46 297 1.39 0.847 2.289 0.192 0.1777 hCV8942032 38 244 1.34 0.867 2.058 0.1894 0.1396 hCV8942032 36 229 1.43 0.915 2.25 0.1155 0.0872
TABLE-US-00037 TABLE 37 hCV # (C9p21 rs # (C9p21 GENO- SNP) SNP) ADJUST MODE TYPE STATIN EVENTS hCV26505812 rs10757274 unadjusted GEN AA Pravastatin 17 hCV26505812 rs10757274 unadjusted GEN AA Placebo 17 hCV26505812 rs10757274 unadjusted GEN AG Pravastatin 27 hCV26505812 rs10757274 unadjusted GEN AG Placebo 48 hCV26505812 rs10757274 unadjusted GEN GG Pravastatin 23 hCV26505812 rs10757274 unadjusted GEN GG Placebo 25 hCV26505812 rs10757274 unadjusted DOM AG + AA Pravastatin 44 hCV26505812 rs10757274 unadjusted DOM AG + AA Placebo 65 hCV26505812 rs10757274 unadjusted REC AG + GG Pravastatin 50 hCV26505812 rs10757274 unadjusted REC AG + GG Placebo 73 hCV26505812 rs10757274 AGE MALE CURRSMK GEN AA Pravastatin 18 HYPERTEN_1 DIABETES_1 BMI BASE_LDL BASE_HD1 hCV26505812 rs10757274 AGE_MALE CURRSMK GEN AA Placebo 17 HYPERTEN_1 DIABETES_1 BMI BASE_EDL BASE_HD1 hCV26505812 rs10757274 AGE_MALE CURRSMK GEN GA Pravastatin 29 HYPERTEN_1 DIABETES_1 BMI BASE_EDL BASE_HD1 hCV26505812 rs10757274 AGE_MALE CURRSMK GEN GA Placebo 50 HYPERTEN_1 DIABETES_1 BMI BASE_EDL BASE_HD1 hCV26505812 rs10757274 AGE_MALE CURRSMK GEN GG Pravastatin 25 HYPERTEN_1 DIABETES_1 BMI BASE_EDL BASE_HD1 hCV26505812 rs10757274 AGE MALE CURRSMK GEN GG Placebo 26 HYPERTEN_1 DIABETES_1 BMI BASE_EDL BASE_HD1 hCV26505812 rs10757274 AGE MALE CURRSMK REC GA + AA Pravastatin 47 HYPERTEN_1 DIABETES_1 BMI BASE_EDL BASE_HD1 hCV26505812 rs10757274 AGE MALE CURRSMK REC GA + AA Placebo 67 HYPERTEN_1 DIABETES_1 BMI BASE_EDL BASE_HD1 hCV26505812 rs10757274 AGE MALE CURRSMK DOM GA + GG Pravastatin 54 HYPERTEN_1 DIABETES_1 BMI BASE_EDL BASE_HD1 hCV26505812 rs10757274 AGE MALE CURRSMK DOM GA + GG Placebo 76 HYPERTEN_1 DIABETES_1 BMI BASE_EDL BASE_HD1 95% 95% Lower Upper Confidence Confidence Limit for Limit for hCV # (C9p21 Hazard Hazard P- PVAL_IN SNP) TOTAL HR Ratio Ratio VALUE TX hCV26505812 315 0.85 0.433 1.667 0.6359 0.44429 hCV26505812 262 ref . . . 0.44429 hCV26505812 666 0.58 0.361 0.927 0.0229 0.44429 hCV26505812 689 ref . . . 0.44429 hCV26505812 414 0.91 0.515 1.599 0.7377 0.44429 hCV26505812 412 ref . . . 0.44429 hCV26505812 981 0.65 0.446 0.96 0.03 0.34883 hCV26505812 951 ref . . . 0.34883 hCV26505812 1080 0.69 0.484 0.994 0.0463 0.65126 hCV26505812 1101 ref . . . 0.65126 hCV26505812 328 0.92 0.469 1.802 0.8064 0.43653 hCV26505812 272 ref . . . 0.43653 hCV26505812 690 0.61 0.384 0.963 0.0339 0.43653 hCV26505812 727 ref . . . 0.43653 hCV26505812 441 1 0.574 1.732 0.9924 0.43653 hCV26505812 425 ref . . . 0.43653 hCV26505812 1018 0.69 0.476 1.005 0.0533 0.3725 hCV26505812 999 ref . . . 0.3725 hCV26505812 1131 0.73 0.512 1.03 0.0728 0.60059 hCV26505812 1152 ref . . . 0.60059
TABLE-US-00038 TABLE 38 for chromosome 9p21 SNP (rs10757274/hCV26505812): HR_ LOWER_ UPPER_ P_ Risk GENO_ EVENTS_ no TOTAL_ RESP_ RESP_ RESP_ RESP_ ENDPT Allele MODE STRATA RESP STATIN RESP event RESP unadj unadj unadj unadj stroke G GEN ALL GG pravastatin 51 638 689 1.082 0.729 1.604 0.696 stroke G GEN ALL GG placebo 48 653 701 stroke G GEN ALL AG pravastatin 94 1349 1443 0.777 0.593 1.017 0.066 stroke G GEN ALL AG placebo 121 1334 1455 stroke G GEN ALL AA pravastatin 56 674 730 1.330 0.889 1.991 0.165 stroke G GEN ALL AA placebo 41 680 721 stroke G DOM ALL GG + AG pravastatin 145 1987 2132 0.864 0.692 1.078 0.196 stroke G DOM ALL GG + AG placebo 169 1987 2156 stroke G REC ALL AA + AG pravastatin 150 2023 2173 0.919 0.736 1.147 0.455 stroke G REC ALL AA + AG placebo 162 2014 2176 stroke G GEN no hist GG pravastatin 24 333 357 1.068 0.603 1.893 0.821 stroke G GEN no hist GG placebo 23 341 364 stroke G GEN no hist AG pravastatin 35 754 789 0.698 0.455 1.071 0.100 stroke G GEN no hist AG placebo 52 774 826 stroke G GEN no hist AA pravastatin 28 395 423 1.570 0.877 2.812 0.129 stroke G GEN no hist AA placebo 19 424 443 stroke G DOM no hist GG + AG pravastatin 59 1087 1146 0.813 0.578 1.144 0.235 stroke G DOM no hist GG + AG placebo 75 1115 1190 stroke G REC no hist AA + AG pravastatin 63 1149 1212 0.927 0.660 1.302 0.662 stroke G REC no hist AA + AG placebo 71 1198 1269 stroke G GEN hist GG pravastatin 27 305 332 1.098 0.637 1.892 0.736 stroke G GEN hist GG placebo 25 312 337 stroke G GEN hist AG pravastatin 59 595 654 0.816 0.576 1.155 0.251 stroke G GEN hist AG placebo 69 560 629 stroke G GEN hist AA pravastatin 28 279 307 1.093 0.625 1.911 0.755 stroke G GEN hist AA placebo 22 256 278 stroke G DOM hist GG + AG pravastatin 86 900 986 0.892 0.666 1.195 0.444 stroke G DOM hist GG + AG placebo 94 872 966 stroke G REC hist AA + AG pravastatin 87 874 961 0.885 0.660 1.187 0.415 stroke G REC hist AA + AG placebo 91 816 907 P_INT_ P_ P_INT_ GENO_ EVENTS_ TOTAL_ HR_ LOWER_ UPPER_ P_ Risk RESP_ RESP_ RESP_ PLA- PLA- PLA- PLA- PLA- PLA- PLA- ENDPT Allele MODE unadj adj adj CEBO CEBO CEBO CEBO CEBO CEBO CEBO stroke G GEN 0.070 0.602 0.050 GG 48 701 1.20631 0.79513 1.8301 0.37779 stroke G GEN 0.070 0.050 stroke G GEN 0.070 0.053 0.050 AG 121 1455 1.46444 1.02767 2.0868 0.03477 stroke G GEN 0.070 0.050 stroke G GEN 0.070 0.158 0.050 AA 41 721 ref 0 0 0 stroke G GEN 0.070 0.050 stroke G DOM 0.063 0.175 0.055 GG + AG 169 2156 1.38115 0.98188 1.9428 0.06361 stroke G DOM 0.063 0.055 stroke G REC 0.472 0.432 0.398 AA + AG stroke G REC 0.472 0.398 stroke G GEN 0.083 0.824 0.065 GG 23 364 1.50713 0.82085 2.7672 0.18578 stroke G GEN 0.083 0.065 stroke G GEN 0.083 0.077 0.065 AG 52 826 1.48278 0.87679 2.5076 0.1417 stroke G GEN 0.083 0.065 stroke G GEN 0.083 0.108 0.065 AA 19 443 ref 0 0 0 stroke G GEN 0.083 0.065 stroke G DOM 0.057 0.191 0.049 GG + AG 75 1190 1.489 0.90012 2.4632 0.12109 stroke G DOM 0.057 0.049 stroke G REC 0.669 0.636 0.624 AA + AG stroke G REC 0.669 0.624 stroke G GEN 0.535 0.650 0.576 GG 25 337 0.91337 0.51499 1.6199 0.75659 stroke G GEN 0.535 0.576 stroke G GEN 0.535 0.323 0.576 AG 69 629 1.37223 0.84919 2.2174 0.19624 stroke G GEN 0.535 0.576 stroke G GEN 0.535 0.978 0.576 AA 22 278 ref 0 0 0 stroke G GEN 0.535 0.576 stroke G DOM 0.508 0.552 0.576 GG + AG 94 966 1.21007 0.76069 1.9249 0.42078 stroke G DOM 0.508 0.576 stroke G REC 0.500 0.420 0.450 AA + AG stroke G REC 0.500 0.450