RECOMBINANT NUCLEIC ACID MOLECULE AND APPLICATION THEREOF IN PREPARATION OF CIRCULAR RNA
20250270544 ยท 2025-08-28
Inventors
Cpc classification
C12N15/79
CHEMISTRY; METALLURGY
A61K48/0058
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
C12N15/67
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N2830/42
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present disclosure relates to a recombinant nucleic acid molecule and an application thereof in preparation of a circular RNA, and in particular, to a recombinant nucleic acid molecule for preparing a circular RNA, a recombinant expression vector, a circular RNA, a composition, a method for preparing a circular RNA, a method for expressing a target polypeptide in a cell, a method for screening a target coding region sequence, a system for screening a target coding region sequence, and a method for screening a ribozyme recognition site sequence. The recombinant nucleic acid molecule provided by the present disclosure provides a Clean PIE system with a novel structure for preparing a circRNA in vitro, which can avoid introducing additional exon sequences into the circular RNA, improve the sequence accuracy of circular RNA molecules, reduce changes in a secondary structure of the circular RNA, and further reduce the immunogenicity of the circular RNA, and has a good application prospects in the fields of nucleic acid vaccines, expression of therapeutic proteins, gene therapy, and the like.
Claims
1. A circular RNA, comprises elements arranged in the following order in the 5 to 3 direction: a translation initiation element, a coding element for encoding at least one target polypeptide; and a translational regulatory element, wherein, the translational regulatory element is a polyN sequence.
2. The circular RNA of claim 1, wherein the polyN sequence is a polyA sequence or a polyAC sequence, and the sequence of polyAC as show in SEQ NO.1
3. The circular RNA of claim 2, wherein the length of the polyA sequence or the polyAC sequence is 19-190nt, preferably 57-190nt, and more preferably 114 nt.
4. The circular RNA of claim 1, wherein the coding element of the circular RNA comprises a coding region 1, and at least one in the group consisting of (i) to (ii): (i) at least one coding region 2, and (ii) at least one coding region 3; each coding region encodes any type of target polypeptide independently of one another; preferably, any two adjacent coding regions are linked by a linker; or wherein the coding element of the circular RNA comprises the coding region 1 and at least one coding region 4, and the 5 end of any coding region is ligated to a translation initiation element; or wherein the insertion element is ligated to the 5 end of any translation initiation element.
5. A composition comprising the circular RNA of claim 1.
6. The composition of claim 5, further comprises one or more pharmaceutically acceptable carriers.
7. The composition of claim 6, wherein the pharmaceutically acceptable carrier is selected from a lipid, a polymer or a lipid polymer complex.
8. A method for expressing a target polypeptide in a cell, wherein the method comprises the step of delivering the circular RNA of claim 1 into the cell.
9. A method for preventing or treating diseases, wherein the method comprises administering the circular RNA of claim 1 to a subject.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
DETAILED DESCRIPTION
Definitions
[0198] When used in conjunction with the terms comprising, including or containing in the claims and/or the specification, the word a or an may refer to one, but it may also refer to one or more, at least one, and one or more than one.
[0199] As used in the claims and the specification, the words comprising, having, including or containing are inclusive or open-ended, and do not exclude additional elements or method steps that are not cited.
[0200] Throughout this application, the term about is intended to refer to a value that includes standard deviations of errors of a device or method used to measure this value.
[0201] Although the term or as used in this disclosure may be defined just as alternatives and and/or, the term or in the claims refers to and/or, unless expressly defined only as alternatives or alternatives that are mutually exclusive.
[0202] The terms polypeptide, peptide, and protein as used herein are interchangeable and are amino acid polymers of any length. The polymer, linear or branched, may contain modified amino acids, and may be separated by non-amino acids. The term also includes amino acid polymers that have been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other operation, such as conjugation with labeling components.
[0203] As used herein, the PIE system, also known as permuted introns and exons, is a method for ligating to form a circular RNA by a self-splicing system of Group I intron.
[0204] As used herein, the Group I intron has a self-splicing system for circularization in the presence of GTP and Mg.sup.2+.
[0205] Group I introns are a class of huge ribozymes capable of self-splicing, which are widely found in many species, mainly being involved in catalytic excision of precursors of mRNA, tRNA and rRNA. The core secondary structure thereof typically includes nine pairing regions (P1-P9) and corresponding loop regions (L1-L9) (
[0206] As used herein, an internal guide sequence typically refers to the nucleotide sequence of a fragment of Group I intron that is mutually paired with a corresponding exon sequence by Watson-Crick pairing or wobble pairing, generally in a P1 stem in a Group I intron.
[0207] As used herein, a ribozyme is intended to refer to RNA with catalytic activity. In some embodiments, a ribozyme recognition site herein refers to a polynucleotide sequence that may be recognized by the ribozyme and an internal broken of a phosphodiester bond can by occurred when RNA forms a ribozyme molecule with catalytic function.
[0208] As used herein, the term circular nucleic acid molecule refers to a nucleic acid molecule with a closed loop. In some embodiments, the circular nucleic acid molecule is a circular RNA molecule. More specifically, the circular nucleic acid molecule is a circular mRNA molecule.
[0209] As used herein, the term linear RNA refers to a circular RNA precursor capable of forming a circular RNA through a circularization reaction, which is typically formed by transcription of a linear DNA molecule (for example, vectors containing recombinant nucleic acid molecules, and the like).
[0210] As used herein, the term IRES, also known as internal ribosome entry site, is a translation control sequence, generally located at the 5 end of a gene of interest, and enables translation of RNA in a cap-independent manner. The transcribed IRES may directly bind to a ribosome subunit, such that a start codon of mRNA is properly oriented in the ribosome for translation. The IRES sequence is usually located in the 5 UTR of mRNA (immediately upstream of the start codon). The IRES functionally replaces the need for various protein factors that interact with a translation mechanism of eukaryotes.
[0211] As used herein, the term translation initiation element refers to any sequence element that may recruit ribosomes and initiate a translation process of RNA molecules. Illustratively, translation initiation elements include an IRES element, an m6A-modified sequence, or an initiation sequence for rolling circle translation, and the like.
[0212] The terms coding region, protein coding region, and open reading frame (ORF) may be used interchangeably herein. A coding region starts with a start codon, with consecutive nucleotide sequences with protein-encoding potency. In some embodiments, the coding region ends with a stop codon. In other embodiments, the coding region may not contain the stop codon.
[0213] The term coding element herein is formed in a circular RNA prepared by using a Clean PIE system (e.g., a recombinant nucleic acid molecule, a recombinant expression vector, or the like) of the present disclosure, and is used to encode at least one target polypeptide. Therefore, the coding element contains at least one coding region. Illustratively, coding elements contain 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more coding regions (including any integer value between any two numbers above). Moreover, a ribozyme recognition site is provided inside any one or more coding regions.
[0214] The ribozyme recognition site herein consists of a ribozyme recognition site I and a ribozyme recognition site II. It should be noted that the ribozyme recognition site is arranged within a coding region contained in the coding element. Accordingly, the ribozyme recognition site I and ribozyme recognition site II are only formed within the coding region contained in the coding element. Alternatively, the ribozyme recognition site consists of a ribozyme recognition site III and a ribozyme recognition site IV. It should be noted that the ribozyme recognition site is arranged within a coding region contained in the coding element. Accordingly, the ribozyme recognition site III and ribozyme recognition site IV are only formed inside the coding region contained in the coding element.
[0215] The nucleotide sequence of the truncated fragment I of the coding element and the
[0216] nucleotide sequence of the truncated fragment II of the coding element of the present disclosure are formed by truncation of the coding element sequence, with the former one corresponding to a partial sequence close to the 5 direction in the coding element sequence and the latter one corresponding to a remaining partial sequence close to the 3 direction in the coding element sequence. Moreover, the ribozyme recognition site I and ribozyme recognition site II are located inside any coding region contained in the coding element.
[0217] Alternatively, the nucleotide sequence of the truncated fragment III of the coding element and the nucleotide sequence of the truncated fragment IV of the coding element herein are formed by truncation of the coding element sequence, with the former one corresponding to a partial sequence close to the 5 direction in the coding element sequence and the latter one corresponding to a remaining partial sequence close to the 3 direction in the coding element sequence. Moreover, the ribozyme recognition site III and ribozyme recognition site IV are located inside any coding region contained in the coding element.
[0218] Furthermore, in the case that two or more coding regions are contained in the coding element, the two adjacent coding regions may be linked by a linker or a translation initiation element. Accordingly, a linker linking to adjacent coding region sequences, or a translation initiation element linking to adjacent coding region sequence, is further contained inside at least one of the truncated fragments of coding element.
[0219] Illustratively, the coding element consists of one coding region 1 that contains a ribozyme recognition site. Accordingly, the truncated fragment I of the coding element is a truncated fragment I of the coding region 1, and the truncated fragment II of the coding element is a truncated fragment II of coding region 1. Alternatively, the truncated fragment III of the coding element is a truncated fragment III of the coding region 1, and the truncated fragment IV of the coding element is a truncated fragment IV of the coding region 1.
[0220] Illustratively, the coding element includes a coding region 1 and a coding region 2 sequentially arranged in the 5 to 3 direction, and a ribozyme recognition site is provided inside the coding region 1. The coding region 1 is truncated to obtain a truncated fragment I of the coding element and a truncated fragment II of the coding element, or to obtain a truncated fragment III of the coding element and a truncated fragment IV of the coding element. Wherein, the truncated fragment I of the coding element is a truncated fragment I of the coding region 1, and the truncated fragment II of the coding element includes a truncated fragment II of the coding region 1, and the coding region 2. Alternatively, the truncated fragment III of the coding element is a truncated fragment III of the coding region 1, and the truncated fragment IV of the coding element includes a truncated fragment IV of the coding region 1, and the coding region 2.
[0221] In some alternative embodiments, the truncated fragment II of the coding element further includes a linker located between the truncated fragment II of the coding region 1, and the coding region 2. Alternatively, the truncated fragment IV of the coding element further includes a linker located between truncated fragment IV of the coding region 1 and coding region 2.
[0222] Illustratively, the coding element includes a coding region 3 and a coding region 1 sequentially arranged in the 5 to 3 direction, and a ribozyme recognition site is provided inside the coding region 1. The coding region 1 is truncated to obtain a truncated fragment I of the coding element and a truncated fragment II of the coding element, or to obtain a truncated fragment III of the coding element and a truncated fragment IV of the coding element. The truncated fragment I of the coding element includes the coding region 3 and a truncated fragment I of the coding region 1, and the truncated fragment II of the coding element is a truncated fragment II of the coding region 1. Alternatively, the truncated fragment III of the coding element includes the coding region 3 and a truncated fragment III of the coding region 1, and the truncated fragment IV of the coding element is a truncated fragment IV of the coding region 1.
[0223] In some alternative embodiments, the truncated fragment of the coding element further includes a linker located between the coding region 3 and the truncated fragment I of the coding region 1. Alternatively, the truncated fragment III of the coding element further includes a linker located between the coding region 3 and the truncated fragment III of the coding region 1.
[0224] As an example, the coding element includes a coding region 3, a coding region 1 and a coding region 2 sequentially arranged in the 5 to 3 direction, and a ribozyme recognition site is provided inside the coding region 1. The coding region 1 is truncated to obtain a truncated fragment I of the coding element and a truncated fragment II of the coding element, or to obtain a truncated fragment III of the coding element and a truncated fragment IV of the coding element. The truncated fragment I of the coding element includes the coding region 3 and a truncated fragment I of the coding region 1, and the truncated fragment II of the coding element includes a truncated fragment II of the coding region 1 and the coding region 2. Alternatively, the truncated fragment III of the coding element includes the coding region 3 and a truncated fragment III of the coding region 1, and the truncated fragment IV of the coding element includes a truncated fragment IV of coding region 1, and the coding region 2.
[0225] In some alternative embodiments, the truncated fragment I of the coding element further includes a linker located between the coding region 3 and the truncated fragment I of the coding region 1. Alternatively, the truncated fragment III of the coding element further includes a linker located between the coding region 3 and the truncated fragment III of the coding region 1. In some alternative embodiments, the truncated fragment II of the coding element further includes a linker located between the truncated fragment II of the coding region 1, and the coding region 2. Alternatively, the truncated fragment IV of the coding element further includes a linker located between the truncated fragment IV of the coding region 1 and the coding region 2.
[0226] Illustratively, the coding element includes a coding region 1, a translation initiation element and a coding region 4 sequentially arranged in the 5 to 3 direction, and a ribozyme recognition site is provided inside the coding region 1. The coding region 1 is truncated to obtain a truncated fragment I of the coding element and a truncated fragment II of the coding element, or to obtain a truncated fragment III of the coding element and a truncated fragment IV of the coding element. The truncated fragment I of the coding element includes a truncated fragment I of the coding region 1, and the truncated fragment II of the coding element includes a truncated fragment II of the coding region 1, the translation initiation element, and the coding region 4. The truncated fragment III of the coding element includes a truncated fragment III of the coding region 1, and the truncated fragment IV of the coding element includes a truncated fragment IV of the coding region 1, the translation initiation element, and the coding region 4.
[0227] Illustratively, the coding element includes a coding region 4, a translation initiation element and a coding region 1 sequentially arranged in the 5 to 3 direction, and a ribozyme recognition site is provided inside the coding region 1. The coding region 1 is truncated to obtain a truncated fragment I of the coding element and a truncated fragment II of the coding element, or to obtain a truncated fragment III of the coding element and a truncated fragment IV of the coding element. The truncated fragment I of the coding element includes the coding region 4, the translation initiation element and a truncated fragment I of the coding region 1, and the truncated fragment II of the coding element is a truncated fragment II of the coding region 1. The truncated fragment III of the coding element includes the coding region 4, the translation initiation element and a truncated fragment III of the coding region 1, and the truncated fragment IV of the coding element is a truncated fragment IV of the coding region 1.
[0228] It should be noted that the number of the coding regions 2, 3 or 4 may be one, or two or more, which is not exhaustive herein.
[0229] The term expression includes any step involving production of polypeptides, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0230] The term antibody, as used herein in the broadest sense thereof, refers to a protein containing antigen-binding sites, encompassing natural antibodies and artificial antibodies with various structures, including but not limited to polyclonal, monoclonal, monospecific, multispecific, nonspecific, humanized, single-stranded, chimeric, synthetic, recombinant, hybrid, mutated, and grafted antibodies. The term antibody further includes an antibody fragment, such as Fab, F(ab).sub.2, FV, scFv, Fd, dAb and another antibody fragment that retains antigen-binding capacity. In general, such fragment may include an antigen-binding fragment.
[0231] As used herein, the term hybridization refers to a process in which a base on one nucleic acid chain is combined with a complementary base on another nucleic acid chain by base-pairing. The hybridization reaction may be selective, allowing for selection of a specific target sequence even at low concentrations from a sample. The stringency of hybridization conditions (such as highly stringent, moderately stringent, and stringent conditions) may be adjusted by, for example, a concentration of a salt or formamide in a pre-hybridized solution and a hybridized solution, or a hybridization temperature, and the like. As an example, the stringency may be increased by decreasing the salt concentration, increasing the formamide concentration, or increasing the hybridization temperature. Generally, the stringent conditions include hybridization in at least about 0% to at least about 15% v/v formamide and at least about 1 M to at least about 2 M salt at a temperature of about 25 C. to about 42 C., and washing in at least about 1 M to at least about 2 M salt. The moderately stringent conditions include hybridization in at least about 16% to at least about 30% v/v formamide and at least about 0.5 M to at least about 0.9 M salt at a temperature of about 25 C. to about 65 C., and washing in at least about 0.5 M to at least about 0.9 M salt. The highly stringent conditions include hybridization in at least about 31% to at least about 50% v/v formamide and at least about 0.01 M to at least about 0.15 M salt at a temperature of at least about 65 C., and washing in at least about 0.01 M to at least about 0.15 M salt. The formamide is optional in these hybridization conditions. Other suitable hybridization buffers and conditions are well known to those skilled in the art and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Press, Plainview, N.Y. (1989); and Ausubel et al., Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons (1999).
[0232] The term pharmaceutically acceptable carrier used in the context herein refers to auxiliary materials widely used in the field of pharmaceutical production. The carriers are used mainly to provide a pharmaceutical composition with use safety, stable properties and/or specific functions, and also to provide a method that allows active ingredients of a drug to be dissolved at a desired rate after being administered to a subject, or promotes effective absorption of the active ingredients in a subject administrated with the drug. A pharmaceutically acceptable carrier may be an inert filler, or a functional ingredient that provides a function for a pharmaceutical composition (such as stabilizing overall pH value of the composition or preventing degradation of active ingredients in the composition). Non-limiting examples of the pharmaceutically acceptable carriers include, but are not limited to, an adhesive, a suspending agent, an emulsifier, a diluent (or a filler), a granulating agent, a tackifier, a disintegrating agent, a lubricant, an anti-adhesion agent, a glidant, a wetting agent, a gelling agent, an absorption retarder, a dissolution inhibitor, an enhancer, an adsorbent, a buffer, a chelating agent, a preservative, a coloring agent, a flavoring agent, a sweetener, and the like.
[0233] As used herein, the term complementary or hybridized is intended to refer to a polynucleotide and oligonucleotide related to a base-pairing rule (interchangeable terms and refers to a nucleotide sequence). For example, the sequence CAGT is complementary to the sequence GTCA. The complementation or hybridization may be partial or complete.
[0234] A partial complementation or hybridization means that one or more nucleic acid bases are mispaired according to a base-pairing rule, and a total or complete complementation or hybridization between nucleic acids means that each nucleic acid base is paired with another base by base-pairing. The degree of complementarity or hybridization of a nucleic acid chain has an important influence on hybridization efficiency and intensity of such nucleic acid chain.
[0235] This is particularly important in an amplification reaction and a detection method depending on binding between nucleic acids.
[0236] The term recombinant nucleic acid molecule refers to a polynucleotide with sequences that are not ligated together in nature. The recombinant polynucleotide may be contained in a suitable vector, through which the recombinant polynucleotide may be delivered to a suitable host cell. Then the polynucleotide is expressed in the recombinant host cell to produce, for example, a recombinant polypeptide, a recombinant protein, a fusion protein, or the like.
[0237] The term recombinant expression vector refers to a DNA structure that expresses, for example, a polynucleotide encoding a desired polypeptide. The recombinant expression vector may include, for example, i) a genetic element set involved in regulating gene expression, such as a promoter and an enhancer; ii) a structure or coding sequence for transcribing into mRNA and translating into a protein; and iii) a transcription subunit for appropriate transcription and translation of initiation and termination sequences. The recombinant expression vector is constructed in any suitable way. The nature of the vector is not critical, and any vector may be used, including a plasmid, a virus, a phage, and a transposon. A possible vector used for the present disclosure includes, but is not limited to, a chromosomal, a non-chromosomal and a synthetic DNA sequence, such as a viral plasmid, a bacterial plasmid, a phage DNA, a yeast plasmid, and a vector derived from combination of a plasmid and a phage DNA, and a DNA from a virus such as lentivirus, retrovirus, vaccinia, adenovirus, fowlpox, baculovirus, SV40 and pseudorabies.
[0238] The term host cell refers to a cell into which an exogenous polynucleotide has been introduced, including progenies of such cells. The host cell includes a transformant and a transformed cell, including a primary transformed cell and a progeny derived therefrom. The host cell may be any type of cell system used to generate an antibody of the present disclosure, including an eukaryotic cell, such as a mammalian cell, an insect cell, and a yeast cell, and a prokaryotic cell, such as a Escherichia coli cell. The host cell includes a cultured cell, and also includes a cell in a transgenic animal, a transgenic plant or a cultured plant tissue or an animal tissue. The term recombinant host cell covers a host cell that is different from a parent cell after introduction of a recombinant nucleic acid molecule, a recombinant expression vector and a circular RNA, and the recombinant host cell is specifically produced by transformation. The host cells of the present disclosure may be a prokaryotic cell or an eukaryotic cell, as long as it may be used to introduce a recombinant nucleic acid molecule, a recombinant expression vector, a circular RNAs, and the like of the present disclosure.
[0239] As used herein, the term individual, patient or subject includes a mammal. The mammal includes, but is not limited to, a domestic animal (for example, cattle, sheep, cats, dogs, and horses), a primate (for example, human and non-human primates, such as monkeys), a rabbit, and a rodent (for example, mice and rats).
[0240] As used herein, the terms transformation, transfection and transduction have the meaning commonly understood by those skilled in the art, that is, a process introducing exogenous DNA into a host. The transformation, transfection and transduction methods include any method for introducing a nucleic acid into a cell, including but not limited to, electroporation, calcium phosphate (CaPO.sub.4) precipitation, calcium chloride (CaCl.sub.2) precipitation, microinjection, polyethylene glycol (PEG)-based method, DEAE-dextran-based method, cationic liposome-based method, and lithium acetate-DMOS-based method.
[0241] As used herein, the treatment refers to alleviation of symptoms of a disease by contact (e.g., administration) of a circular RNA, a circularization precursor RNA, a composition, and the like of the present disclosure to a subject suffering from such disease, as compared to the scenario without such contact, and does not necessarily mean that the symptoms of the disease must be completely suppressed. Suffering from a disease means that some symptoms of disease occurred in a body.
[0242] As used herein, the prevention refers to alleviation of symptoms of a disease by contact (e.g., administration) of a circular RNA, a circularization precursor RNA, a composition, and the like of the present disclosure to a subject before suffering from such disease, as compared to the scenario without such contact, and does not necessarily mean that the symptoms of the disease must be completely suppressed.
[0243] As used herein, the term effective amount refers to such an amount or a dose of a recombinant nucleic acid molecule, a recombinant expression vector, a circularization precursor RNA, a circular RNA, a vaccine, or a composition of the present disclosure, that produces an expected effect in a patient in need of treatment or prevention after being administered in a single dose or in multiple doses. The effective amount may be easily determined by an attending physician as a skilled person in the art by considering the following factors: for example, species such as mammals; size, age and general health thereof; a related specific disease; a degree or severity of the disease; a response of an individual; a specific antibody administered; an administration mode; bioavailability characteristics of the administrated preparation; a selected dosage regimen; and an application of any concomitant therapy.
[0244] As used herein, the term individual, patient or subject includes a mammal. The mammal includes, but is not limited to, a domestic animal (for example, cattle, sheep, cats, dogs, and horses), a primate (for example, human and non-human primates, such as monkeys), a rabbit, and a rodent (for example, mice and rats).
[0245] Unless defined otherwise or clearly indicated in the context, all technical and scientific terms used herein have the same meaning as those commonly understood by a person of ordinary skill in the art to which the present disclosure belongs.
Clean PIE System
A process in which a classic PIE system is ligated to form a circular RNA is shown in
[0246] However, using a classic PIE system may lead to presence of additional exon sequences of E1 and E2 in the circular RNA, and reduced sequence accuracy of the circular RNAs, resulting in an increase of natural immunogenicity of the circular RNA, and susceptibility to degradation in cells.
[0247] To solve the problems above, the present disclosure provides a Clean PIE system with a novel structure, which may be used to prepare a circular RNA through self-splicing of the PIE system without changing a protein expression sequence, exhibiting high circularization efficiency. In addition, there is no need to introduce additional E1 and E2 sequences into the circularized circular RNA, which not only simplifies the structure of the circular RNA and reduces various potential safety hazards, but also improves the sequence accuracy of the circular RNA, reduces natural immunogenicity of the circular RNA, and improves stability thereof in cells, thus making it suitable for clinical application fields, such as serving as a gene therapy vector, an expressing therapeutic protein, serving as a nucleic acid vaccine and the like, showing broad application prospects.
[0248] The Clean PIE system of the present disclosure includes, but is not limited to, a DNA construct used to prepare a circular RNA, a recombinant expression vector containing the DNA construct, a circularization precursor RNA molecule obtained by in vitro transcription by using the recombinant expression vector, and the like.
[0249] In some embodiments, the present disclosure provides a recombinant nucleic acid molecule for preparing a circular RNA. Illustratively, the recombinant nucleic acid molecule may be the above-mentioned DNA construct for preparing a circular RNA, a circularization precursor RNA molecule, and the like. In some embodiments, the structure of the recombinant nucleic acid molecule, as shown in
[0250] The 3 end of the truncated fragment I of the coding element includes a ribozyme recognition site I that consists of a first predetermined number of nucleotides located at the 3 end of the truncated fragment I of the coding element; the 5 end of the truncated fragment II of the coding element contains a ribozyme recognition site II that consists of a second predetermined number of nucleotides located at the 5 end of the truncated fragment II of the coding element.
[0251] The nucleotide sequence of the truncated fragment I of the coding element and the nucleotide sequence of the truncated fragment II of the coding element are used to form a coding element sequence encoding at least one target polypeptide in the 5 to 3 direction. The nucleotide sequence of the truncated fragment I of the coding element corresponds to a partial sequence close to the 5 direction in the coding element sequence, and the nucleotide sequence of the truncated fragment II of the coding element corresponds to a remaining partial sequence close to the 3 direction in the coding element sequence.
[0252] It should be noted that the coding element is formed in the circular RNA prepared from the recombinant nucleic acid molecule. In addition, the coding element includes one or two or more coding regions encoding a target polypeptide. In the presence of two or more coding regions in the coding element, the coding element may also includes a linker located between two adjacent coding regions, a translation initiation element between two adjacent coding regions, or other types of sequences desired.
[0253] The nucleotide sequence of the intron fragment I and the nucleotide sequence of the intron fragment II are used to form an intron sequence in the 5 to 3 direction. The nucleotide sequence of the intron fragment I includes a partial sequence close to the 5 direction in the intron sequence, and the nucleotide sequence of the intron fragment II includes a remaining sequence close to the 3 direction in the intron sequence.
[0254] In other words, the nucleotide sequence of the truncated fragment I of the coding element and the nucleotide sequence of the truncated fragment II of the coding element may be ligated to form a coding element sequence encoding at least one target polypeptide, and the nucleotide sequence of the intron fragment I and the nucleotide sequence of the intron fragment II may be ligated to form an intron sequence. In preparing the circular RNAs by the recombinant nucleic acid molecule with the above structure, cleavage occurs at a linking position between a ribozyme recognition site I and the intron fragment I, releasing the intron fragment I. After that, cleavage occurs at a linking position of a ribozyme recognition site II and the intron fragment II, releasing the intron fragment II. The 3 end of truncated fragment I of the coding element is ligated to the 5 end of truncated fragment II of coding element to form a circular molecule. In the present disclosure, without changing the target polypeptide sequence encoded by the coding element and introducing additional E1 and E2 sequences, the circular
[0255] RNA encoding the target protein is obtained by self-splicing, with a high sequence accuracy, stability, and low immunogenicity.
[0256] In other embodiments, a recombinant nucleic acid molecule, as shown in
[0257] The 3 end of the truncated fragment III of the coding element includes a ribozyme recognition site IV that consists of a second predetermined number of nucleotides located at the 3 end of the truncated fragment III of coding element. The 5 end of the truncated fragment IV of the coding element contains a ribozyme recognition site III that consists of a first predetermined number of nucleotides located at the 5 end of the truncated fragment IV of the coding element.
[0258] The nucleotide sequence of the truncated fragment III of the coding element and the nucleotide sequence of the truncated fragment IV of the coding element are used to form a coding element sequence encoding at least one target polypeptide in the 5 to 3 direction. The nucleotide sequence of the truncated fragment III of the coding element corresponds to a partial sequence close to the 5 direction in the coding element sequence, and the nucleotide sequence of the truncated fragment IV of the coding element corresponds to a remaining partial sequence close to the 3 direction in the coding element sequence. The sequence of the intron fragment III is a reverse sequence or a reverse complementary sequence of the nucleotide sequence of the intron fragment I, and the sequence of intron fragment IV is a reverse sequence or a reverse complementary sequence of the nucleotide sequence of the intron fragment II. The sequence of the ribozyme recognition site III is a reverse sequence of the nucleotide sequence of the ribozyme recognition site I, and the sequence of the ribozyme recognition site IV is a reverse sequence of the nucleotide sequence of the ribozyme recognition site II.
[0259] As discovered by the present disclosure, the reverse sequence or reverse complementary sequence of intron sequence may also construct the Clean PIE system. In the present disclosure, the reverse sequence or reverse complementary sequence of a 5 portion of the intron is used as the intron fragment III, and the reverse sequence or reverse complementary sequence of a 3 portion of the intron is used as the intron fragment IV. The intron fragment III is ligated to the 5 end of the truncated fragment IV of the coding element, corresponding to the intron fragment III, the first predetermined number of nucleotides at the 5 end of truncated fragment IV of the coding element constitute the ribozyme recognition site III, and the sequence of the ribozyme recognition site III is a reverse sequence or reverse complementary sequence of the nucleotide sequence of the ribozyme recognition site I. The intron fragment IV is ligated to the 3 end of truncated fragment III of the coding element, corresponding to the intron fragment IV, the second predetermined number of nucleotides at the 3 end of truncated fragment III of the coding element constitute the ribozyme recognition site IV, and the sequence of the ribozyme recognition site IV is a reverse sequence or reverse complementary sequence of the nucleotide sequence of the ribozyme recognition site II.
[0260] In preparation of a circular RNA in vitro by the recombinant nucleic acid molecule containing the above elements, cleavage successively occurs at the ribozyme recognition site III and the ribozyme recognition site IV, releasing the intron fragment III and the intron fragment IV, and the 3 end of the truncated fragment III of coding element is ligated to the 5 end of the truncated fragment IV of the coding element to form the circular RNA molecule. As the ribozyme recognition site III and the ribozyme recognition site IV are provided inside the truncated fragments of the coding element, no additional E1 and E2 sequences are introduced into the circular RNA after in vitro circularization, providing advantages of accurate sequence, simple structure, low immunogenicity, and the like, enabling large-scale in vitro production with the application advantages in the fields of nucleic acid vaccines, expression of therapeutic proteins, clinical immunotherapy, and the like.
Translation Initiation Element
[0261] In the present disclosure, a translation initiation element may be any type of element that is able to initiate translation of a target polypeptide. In some embodiments, the translation initiation element is an element containing any one or more of the following sequences: an IRES sequence, a 5UTR sequence, a Kozak sequence, a sequence with m.sup.6A modification (N (6) methyladenosine modification), and a complementary sequence of ribosome 18S rRNA. In other embodiments, the translation initiation element may be any other type of cap-independent translation elements.
[0262] In some embodiments, the translation initiation element is an IRES element derived from those including, but not limited to, viruses, mammals, fruit flies, and the like. In some alternative embodiments, the IRES element is derived from a virus. Illustratively, the IRES element contains an IRES sequence derived from a small RNA virus. Furthermore, the IRES element includes, but is not limited to, an IRES sequence derived from Echovirus, Human poliovirus, Human Enterovirus, Coxsackievirus, Human rhinovirus, Canine picornavirus, Turdivirus 3, Hepatovirus, Passerivirus, Picornaviridae, Tremovirus A, Feline kobuvirus, Murine kobuvirus, Kobuvirus sewage Kathmandu, Ferret kobuvirus, Marmot kobuvirus, Human parechovirus, Chicken picornavirus, Falcon picornavirus, Feline picornavirus, French Guiana picornavirus, and the like.
[0263] In some alternative embodiments, the recombinant nucleic acid molecule provided by the present disclosure consists of elements arranged in the following order in the 5 to 3 direction: an intron fragment II, a truncated fragment II of a coding element, a translation initiation element, a truncated fragment I of a coding element, and an intron fragment I. In other alternative embodiments, the recombinant nucleic acid molecule may also include any other one or more of the above elements, such as a transcriptional regulatory element for regulating transcription level, a translational regulatory element for regulating translation level, a purification element for purifying circular RNA, and the like.
[0264] In some alternative embodiments, the recombinant nucleic acid molecule provided by the present disclosure consists of elements arranged in the following order in the 5 to 3 direction: an intron fragment III, a truncated fragment IV of a coding element, a translation initiation element, a truncated fragment III of a coding element, and an intron fragment IV. In other alternative embodiments, the recombinant nucleic acid molecule may also include any other one or more of the above elements, such as a transcriptional regulatory element for regulating transcription level, a translational regulatory element for regulating translation level, a purification element for purifying circular RNA, and the like.
Intron Fragment
[0265] An intron fragment in the present disclosure is derived from Group I intron with ribozyme activity of self-splicing reaction and is widely found in various species. Illustratively, Group I introns include, but are not limited to, phage T4 td gene, Anabaena tRNA.sup.Leu, TpaCOX2, and Ptu, and the like.
[0266] In some embodiments, an intron fragment I and an intron fragment II are derived from the Group I intron, and contain a partial sequence close to the 5 direction and another partial sequence close to the 3 direction, respectively, both of which constitute the Group I intron. A ribozyme recognition site I is derived from an exon sequence (Exon 1, E1) ligated to the 5 end of the Group I intron, and a ribozyme recognition site II is derived from an exon sequence
[0267] (Exon 2, E2) ligated to the 3 end of Group I intron. The intron fragment I is ligated to the ribozyme recognition site I, and the intron fragment II is ligated to the ribozyme recognition site II, thus forming a PIE system capable of self-splicing.
[0268] In other embodiments, an intron fragment III and an intron fragment IV are derived from the Group I intron, and contain a reverse sequence of the partial sequence close to the 5 direction and a reverse sequence of another partial sequence close to the 3 direction, respectively, both of which constitute the Group I intron. A ribozyme recognition site III is derived from a reverse sequence of the exon sequence (Exon 1, E1) ligated to the 5 end of the Group I intron, and a ribozyme recognition site IV is derived from a reverse sequence of the exon sequence (Exon 2, E2) ligated to the 3 end of the Group I intron. The intron fragment III is ligated to the ribozyme recognition site III, and the intron fragment IV is ligated to the ribozyme recognition site IV, thus forming a PIE system capable of self-splicing.
[0269] In some alternative embodiments, the ribozyme recognition site I consists of 3 to 100 nucleotides, preferably 3 to 50 nucleotides, and more preferably 3 to10 nucleotides. That is, the first predetermined number of nucleotides located at the 3 end of truncated fragment I of the coding element is 3 to 100 nucleotides, preferably 3 to 50 nucleotides, and more preferably 3 to 10 nucleotides. Illustratively, the first predetermined number is 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, and any integer value between any two of them.
[0270] In some alternative embodiments, the ribozyme recognition site II consists of 1 to 100 nucleotides, preferably 1 to 50 nucleotides, and more preferably 1 to10 nucleotides. That is, the second predetermined number of nucleotides located at the 5 end of truncated fragment II of the coding element is 1 to 100 nucleotides, preferably 1 to 50 nucleotides, and more preferably 1 to 10 nucleotides. Illustratively, the first predetermined number is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, and any integer value between any two of them.
[0271] In some alternative embodiments, the ribozyme recognition site III consists of 3 to 100 nucleotides, preferably 3 to 50 nucleotides, and more preferably 3 to10 nucleotides. That is, the first predetermined number of nucleotides located at the 5 end of truncated fragment IV of the coding element is 3 to 100 nucleotides, preferably 3 to 50 nucleotides, and more preferably 3 to 10 nucleotides. Illustratively, the first predetermined number is 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, and any integer value between any two of them.
[0272] In some alternative embodiments, the ribozyme recognition site IV consists of 1 to 100 nucleotides, preferably 1 to 50 nucleotides, more preferably 1 to10 nucleotides. That is, the second predetermined number of nucleotides located at the 3 end of truncated fragment III of coding element is 1 to 100 nucleotides, preferably 1 to 50 nucleotides, and more preferably 1 to 10 nucleotides. Illustratively, the first predetermined number is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, and any integer value between any two of them.
[0273] In some preferred embodiments, a sum of the first predetermined number and the second predetermined number is not equal to 3y, where y>1 and y is an integer. That is, the sum of the first predetermined number and the second predetermined number is not equal to an integer multiple of 3. When the sum is not a value of an integer multiple of 3, increased freedom of arranging a ribozyme recognition site in the coding fragment may be obtained, resulting in effective circularization for the circular RNA.
[0274] In some alternative embodiments, the Group I intron is a T4 td intron derived from a T4 phage td gene, with a secondary structure shown in
[0275] It should be noted that the ribozyme recognition site with a few base mutations may also be used for in vitro circularization of a circular RNA, under conditions that keep the bases at the circularization position unchanged. Illustratively, the present disclosure has found that the ribozyme recognition site and ligated intron fragments thereof may remain the circularization activity, in the presence of one or more of the following mutations in 5-TTGGGTCT-3: base T to C mutation at position 2, base G to A mutation at position 3, and base T to A mutation at position 8.
[0276] In some alternative embodiments, the nucleotide sequence of the intron fragment I derived from the T4 td intron is shown in SEQ ID NO: 7, or is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to that shown in SEQ ID NO: 7.
[0277] In some alternative embodiments, the nucleotide sequence of the intron fragment II derived from the T4 td intron is shown in SEQ ID NO: 6, or is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to that shown in SEQ ID NO: 6.
[0278] In some alternative embodiments, the Group I intron is a TpaCOX2 intron, which is an intron sequence of a cytochrome xoidase cox2 gene of a T. papilionaceus mitochondria, with a secondary structure as shown in
[0279] In some alternative embodiments, the Group I intron is a Ptu intron, with a secondary structure shown in
[0280] It should be noted that the sequences of the ribozyme recognition sites and the intron fragments are not limited in the present disclosure, as long as they are derived from the Group I introns, efficient for circularization, and may be used to prepare a circular RNA in vitro.
Recombinant Nucleic Acid Molecule Containing Insertion Element
[0281] In some embodiments, a recombinant nucleic acid molecule includes an insertion element, which may be used to regulate transcription of the recombinant nucleic acid molecule, regulate translation of a circular RNA, enable specific expression of a circular RNA between different tissues, or purify a circular RNA, and the like. Illustratively, as shown
[0282] In some embodiments, the insertion element is at least one selected from the group consisting of (i) to (iii): (i) a transcriptional regulatory element, (ii) a translational regulatory element, and (iii) a purification element. Illustratively, the insertion element includes one of or a combination of any two or more of the following sequences: an untranslated region (UTR) sequence, a polyN sequence, an aptamer sequence, a riboswitch sequence, and a transcriptional regulator-binding sequence. In the polyN sequence, N is selected from at least one of A, T, G, and C.
[0283] In some alternative embodiments, the translational regulatory element includes an untranslated region sequence, which may serve to regulate stability, immunogenicity, and efficiency of the circular RNA in expressing the target polypeptide, and the like. The untranslated region sequence is not specifically limited in the present disclosure, which may be selected from any type of sequences known in the art having the properties of regulating the circular RNA transcription, translation, intracellular stability, immunogenicity, and the like. Furthermore, the untranslated region sequence is also not limited to the 5UTR sequence or the 3UTR sequence.
[0284] In some alternative embodiments, the untranslated region sequence contains one or more (for example, 1, 2, 3, 4, 5, 6, and 7) miRNA recognition sequences. The addition of one or more miRNA recognition sequences may provide specific expression of a circular RNA in different tissues and cells, providing targeted delivery of a circular RNA molecule.
[0285] In some alternative embodiments, the translational regulatory element contains a polyN sequence, where N may be at least one of A, T, G, and C. The addition of the translation regulatory element containing the polyN sequence may improve efficiency of target polypeptide expression of the circular RNA, immunogenicity, and stability of the circular RNA, or purify the circular RNA. The length of polyN sequence, as well as the selected N type and the manner of composition in the polyN sequence, is not specifically limited in the present disclosure, as long as they facilitate the improvement of the properties of the circular RNA. Illustratively, polyN sequences are polyA sequence, polyAC sequence, and the like.
[0286] In some alternative embodiments, the translational regulatory element contains a riboswitch sequence. The riboswitch sequence is a class of untranslated sequences capable of regulating the transcription and translation of RNA. The riboswitch sequence in the present disclosure may affect expression of the circular RNA, including but not limited to transcription termination, inhibition of translation initiation, mRNA self-cleavage, and changes of splicing pathway in eukaryotes. In addition, the riboswitch sequence may also control the expression of circular RNA by triggering binding or removing of molecules. Illustratively, riboswitch sequences are cobalamin riboswitch (also called B12-element), FMN riboswitch (also called RFN element), glmS riboswitch, SAM riboswitch, SAH riboswitch, tetrahydrofolate riboswitch, Moco riboswitch, and the like, and the type and sequence of riboswitch sequence are not limited in the present disclosure, as long as they can realize regulation of the transcriptional and translational levels of circular RNAs expressing target polypeptides.
[0287] In some alternative embodiments, the translational regulatory element contains an aptamer sequence. In the present disclosure, the aptamer sequence may be used to regulate transcription and translation of circular RNAs, or to purify and prepare a circular RNA in vitro. In an exemplary embodiment, the aptamer sequence is the sequence as shown in SEQ ID NO: 37, or is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to that shown in SEQ ID NO: 37.
Recombinant Nucleic Acid Molecule Containing Homology Arm
[0288] In some embodiments, a recombinant nucleic acid molecule contains a homology arm. Specifically, the homology arm includes a 5 homology arm located at the 5 end of the recombinant nucleic acid molecule and a 3 homology arm located at the 3 end of the recombinant nucleic acid molecule, and the nucleic acid sequence of the 5 homology arm hybridizes with the nucleotide sequence of the 3 homology arm.
[0289] In some embodiments, in the recombinant nucleic acid molecule, the 5 homology arm is ligated to the 5 end of an intron fragment II, and the 3 homology arm is ligated to the 3 end of an intron fragment I, as shown in
[0290] In some embodiments, in the recombinant nucleic acid molecule, the 5 homology arm is ligated to the 5 end of the intron fragment III, and the 3 homology arm is ligated to the 3 end of the intron fragment IV, as shown in
[0291] In some embodiments of the present disclosure, by comparing the effects on in vitro circularization of the circular RNA when the homology arm is added or not added. it is discovered in the present disclosure that effective circularization rate may still be remained for the recombinant nucleic acid molecule without the homology arm added, as compared to recombinant nucleic acid molecule with the homology arm added. Therefore, in order to further simplify structure of the recombinant nucleic acid molecule, in some embodiments, the 5 homology arm and the 3 homology arm are not contained in the recombinant nucleic acid molecule. This is because within the frame of the present disclosure, the circularization site (ribozyme recognition site) always separates the coding gene into two parts, for which typically no complicated secondary structure exists in the coding region. Such benign sequence separates a promoter element from a self-splicing intron sequence, thus forming a unique secondary structure, which is more conducive to correct folding and approaching of the intron sequences. As a result, an effective circularization may be achieved without the homology arm within the frame of the present disclosure.
Target Polypeptide
[0292] The type of target polypeptide is not limited in the present disclosure, which may be a human-derived protein or a non-human protein. Illustratively, a target polypeptide include, but are not limited to, an antigen, an antibody, an antigen-binding fragment, a fluorescent protein, a protein with therapeutic activity against diseases, and a protein with gene-editing activity.
[0293] The term antibody, as used herein in the broadest sense thereof, refers to a protein containing an antigen-binding site, which encompasses natural antibodies and artificial antibodies with various structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (for example, bispecific antibodies), single-stranded antibodies, complete antibodies, and antibody fragments.
[0294] The term antigen-binding fragment herein is a portion or a fragment of a intact or complete antibody with fewer amino acid residues than the intact or complete antibody, and is is capable of binding to an antigen or competing with the intact antibody (that is, the intact antibody from which the antigen-binding fragment is derived) for binding the antigen. An antigen-binding fragment of an antibody may be produced by recombinant DNA technology or by enzymatic or chemical cleavage of an intact antibody. The antigen-binding fragment includes, but is not limited to, Fv, Fab, Fab, Fab-SH, F(ab).sub.2, a diabody, a linear antibody, a single chain antibody (e.g., ScFv), a single domain antibody, a bivalent or bispecific antibody or a fragment thereof; Camelidae antibody (a heavy chain antibody); and a bispecific antibody or polyspecific antibody formed by antibody fragments.
[0295] In the present disclosure, a protein with therapeutic activity against diseases may include, but is not limited to, an enzyme replacement protein, a protein for supplementation, a protein vaccine, an antigen (e.g. a tumor antigen, a virus, bacteria), a hormone, a cytokine, an antibody, an immunotherapy (e.g., a cancer), a cell reprogramming/transdifferentiation factor, a transcription factor, a chimeric antigen receptor, a transposase or nuclease, an immune effector (e.g., having effects on susceptibility to immune response/signal), a regulated death effector protein (e.g., an inducer of apoptosis or necrosis), an insoluble inhibitor of a tumor (e.g., a cancer protein inhibitor), an epigenetic modifier, an epigenetic enzyme, a transcription factor, a DNA or protein-modifying enzyme, a DNA intercalator, an efflux pump inhibitor, a nuclear receptor activator or inhibitor, a proteasome inhibitor, an enzyme competition inhibitor, a protein synthesis effector or inhibitor, a nuclease, a protein fragment or domain, a ligand or receptor, and the CRISPR system or a component thereof, and the like.
Coding Element for Forming One or More Coding Regions
[0296] In some embodiments, the recombinant nucleic acid molecule is used for preparing a circular RNA containing a coding element, where the coding element in the circular RNA includes a coding region 1, optionally (a) at least one coding region 2, and optionally (b) at least one coding region 3.
[0297] In the present disclosure, a truncated fragment I of the coding element and a truncated fragment II of the coding element in the recombinant nucleic acid molecule form the coding region 1, optionally (a) the at least one coding region 2, and optionally (b) the at least one coding region 3. Illustratively, in some embodiments, the truncated fragment I of the coding element and the truncated fragment II of the coding element form the coding region 1, as shown in
[0298] In other embodiments, the truncated fragment I of the coding element and the truncated fragment II of the coding element in the recombinant nucleic acid molecule are used to form a coding region 1 and at least one coding region 2. The circular RNA prepared by the recombinant nucleic acid molecule may provide tandem expression of at least two target polypeptides. Illustratively, the recombinant nucleic acid molecule contains elements arranged in the following order: (i) an intron fragment II, a truncated fragment II of the coding region 1, the at least one coding region 2, a translation initiation element, a truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0299] In some alternative embodiments, the coding regions 2 has a quantity of one, and the recombinant nucleic acid molecule contains elements arranged in the following order: an intron fragment II, a truncated fragment II of the coding region 1, the coding region 2, a translation initiation element, a truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0300] In some alternative embodiments, the coding regions 2 has a quantity of at least two, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment II, a truncated fragment II of the coding region 1, the at least two coding regions 2, a translation initiation element, a truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0301] In some preferred embodiments, the recombinant nucleic acid molecule further includes a linker located between the truncated fragment II of the coding region 1 and the coding region 2, and/or a linker located between any two adjacent coding regions 2. Such linkers are used to separate the coding region 2 from the coding region 1, and separate any two adjacent coding regions 2 from each other, allowing the circular RNA prepared by the recombinant nucleic acid molecule to express two or more target polypeptides.
[0302] In other embodiments, the truncated fragment I of the coding element and the truncated fragment II of the coding element in the recombinant nucleic acid molecule are used to form a coding region 1 and at least one coding region 3. The circular RNA prepared by the recombinant nucleic acid molecule may provide tandem expression of at least two target polypeptides. Illustratively, the recombinant nucleic acid molecule includes elements arranged in the following order: (ii) an intron fragment II, a truncated fragment II of the coding region 1, a translation initiation element, the at least one coding region 3, a truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0303] In some alternative embodiments, the coding regions 3 has a quantity of one, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment II, a truncated fragment II of the coding region 1, a translation initiation element, the coding region 3, a truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0304] In some alternative embodiments, the coding regions 3 has a quantity of at least two, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment II, a truncated fragment II of the coding region 1, a translation initiation element, the at least two coding regions 3, a truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0305] In some preferred embodiments, the recombinant nucleic acid molecule further includes a linker located between the truncated fragment I of the coding region 1 and the coding region 3, and/or a linker located between any two adjacent coding regions 3. Such linkers are used to separate the coding region 3 from the coding region 1, and separate any two adjacent coding regions 3 from each other, allowing the circular RNA prepared by the recombinant nucleic acid molecule to express two or more target polypeptides.
[0306] In other embodiments, the truncated fragment I of the coding element and the truncated fragment II of the coding element in the recombinant nucleic acid molecule are used to form a coding region 1, at least one coding region 2, and at least one coding region 3. The circular RNA prepared by the recombinant nucleic acid molecule may provide tandem expression of at least three target polypeptides. Illustratively, the recombinant nucleic acid molecule includes elements arranged in the following order: (iii) an intron fragment II, a truncated fragment II of the coding region 1, the at least one coding region 2, a translation initiation element, the at least one coding region 3, a truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0307] In some alternative embodiments, the coding region 2 and the coding region 3 has a quantity of one respectively, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment II, a truncated fragment II of the coding region 1, the coding region 2, a translation initiation element, the coding region 3, a truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0308] In some alternative embodiments, the coding region 2 has a quantity of at least two, and the coding region 3 has a quantity of at least two. The recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment II, a truncated fragment II of the coding region 1, the at least two coding regions 2, a translation initiation element, the at least two coding regions 3, a truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0309] In some preferred embodiments, the recombinant nucleic acid molecule further includes a linker located between the truncated fragment II of the coding region 1 and the coding region 2, a linker located between the truncated fragment I of the coding region 1 and the coding region 3, a linker located between any two adjacent coding regions 2, and/or a linker located between any two adjacent coding regions 3. Such linkers are used to separate the coding region 2 from the coding region 1, the coding region 3 from the coding region 1, any two adjacent coding regions 2 from each other, and any two adjacent coding regions 3 from each other, allowing the circular RNA prepared by the recombinant nucleic acid molecule to express three or more target polypeptides.
[0310] In some embodiments, a truncated fragment III of the coding element and a truncated fragment IV of the coding element are used to form a coding region 1. Accordingly, the truncated fragment III of the coding element is the truncated fragment III of the coding region 1, and the truncated fragment IV of the coding element is the truncated fragment IV of the coding region 1, as shown in
[0311] In other embodiments, the truncated fragment III of the coding element and the truncated fragment IV of the coding element in the recombinant nucleic acid molecule are used to form a coding region 1 and at least one coding region 2. The circular RNA prepared by the recombinant nucleic acid molecule may provide tandem expression of at least two target polypeptides. Illustratively, the recombinant nucleic acid molecule includes elements arranged in the following order: (v) an intron fragment III, the truncated fragment IV of the coding region 1, the at least one coding region 2, a translation initiation element, the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0312] In some alternative embodiments, the coding fragment 2 has a quantity of one, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment III, the truncated fragment IV of the coding region 1, the coding region 2, a translation initiation element, the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0313] In some alternative embodiments, the coding region 2 has a quantity of at least two, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment III, the truncated fragment IV of the coding region 1, the at least two coding regions 2, a translation initiation element, the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0314] In some preferred embodiments, the recombinant nucleic acid molecule further includes a linker located between the truncated fragment IV of the coding region 1, and the coding region 2, and/or a linker located between any two adjacent coding regions 2. Such linkers are used to separate the coding region 2 from the coding region 1, and any two adjacent coding v from each other, allowing the circular RNA prepared by the recombinant nucleic acid molecule to express two or more target polypeptides.
[0315] In other embodiments, the truncated fragment III of the coding element and the truncated fragment IV of the coding element in the recombinant nucleic acid molecule are used to form a coding region 1 and at least one coding region 3. The circular RNA prepared by the recombinant nucleic acid molecule may provide tandem expression of at least two target polypeptides. Illustratively, the recombinant nucleic acid molecule includes elements arranged in the following order: (vi) an intron fragment III, the truncated fragment IV of the coding region 1, a translation initiation element, the at least one coding region 3, the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0316] In some alternative embodiments, the coding region 3 has a quantity of one, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment III, the truncated fragment IV of the coding region 1, a translation initiation element, the coding region 3, the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0317] In some alternative embodiments, the coding region 3 has a quantity of at least two, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment III, the truncated fragment IV of the coding region 1, a translation initiation element, the at least two coding regions 3, the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0318] In some preferred embodiments, the recombinant nucleic acid molecule further includes a linker located between the truncated fragment III of the coding region 1 and the coding region 3, and/or a linker located between any two adjacent coding regions 3. Such linkers are used to separate the coding region 3 from the coding region 1, and any two adjacent coding regions 3 from each other, allowing the circular RNA prepared by the recombinant nucleic acid molecule to express two or more target polypeptides.
[0319] In other embodiments, the truncated fragment III of the coding element and the truncated fragment IV of the coding element in the recombinant nucleic acid molecule are used to form a coding region 1, at least one coding region 2, and at least one coding region 3. The circular RNA prepared by the recombinant nucleic acid molecule may provide tandem expression of at least three target polypeptides. Illustratively, the recombinant nucleic acid molecule includes elements arranged in the following order: (vii) an intron fragment III, the truncated fragment IV of the coding region 1, the at least one coding region 2, a translation initiation element, the at least one coding region 3, the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0320] In some alternative embodiments, the coding region 2 has a quantity of one, and the coding region 3 has a quantity of one. The recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment III, the truncated fragment IV of the coding region 1, the coding region 2, a translation initiation element, the coding region 3, the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0321] In some alternative embodiments, the coding regions 2 has a quantity of at least two, and the coding region 3 has a quantity of at least two. The recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment III, the truncated fragment IV of the coding region 1, the at least two coding regions 2, a translation initiation element, the at least two coding regions 3 , the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0322] In some preferred embodiments, the recombinant nucleic acid molecule further includes a linker located between the truncated fragment IV of the coding region 1, and the coding region 2, a linker located between the truncated fragment III of the coding region 1 and the coding region 3, a linker located between any two adjacent coding regions 2, and/or a linker located between any two adjacent coding regions 3. Such linkers are used to separate the coding region 2 from the coding region 1, the coding region 3 from the coding region 1, any two adjacent coding regions 2 from each other, and any two adjacent coding regions 3 from each other, enabling the circular RNA prepared by the recombinant nucleic acid molecule to express two or more target polypeptides.
[0323] In the present disclosure, the linker may be a polynucleotide encoding 2A peptide, or another type of polynucleotide encoding a linker peptide for spacing target polypeptides, where the 2A peptide is a short peptide (about 18 to 25 amino acids in length) derived from a virus, commonly known as a self-splicing peptide, enabling a strand of transcript to produce a variety of proteins. Illustratively, 2A peptides are P2A, T2A, E2A, F2A, and the like.
[0324] In the present disclosure, the coding region 1, each coding region 2 and each coding region 3 encode any type of target polypeptide independently of one another. The target polypeptides encoded by the coding region 1 and any one coding region 2 may be the same or different, the target polypeptide encoded by the coding region 1 and any one coding region 3 may be the same or different, the target polypeptide encoded by any two coding regions 2 may be the same or different, the target polypeptide encoded by any two coding regions 3 may be the same or different, and the target polypeptide encoded by any one coding region 2 and any one coding region 3 may be the same or different.
[0325] In the present disclosure, the coding regions located at different positions are distinguished by numbering the coding regions (for example, coding region 1, coding region 2, coding region 3, and the like). Illustratively, the coding region 1 represents a coding region containing a ribozyme recognition site; the coding region 2 represents a coding region between the truncated fragment II of the coding region 1 and the translation initiation element, or the coding region 2 represents a coding region between the truncated fragment IV of the coding region 1 and the translation initiation element; the code region 3 represents a coding region between the truncated fragment I of the coding region 1 and the translation initiation element, or the coding region 2 represents a coding region between the truncated fragment III of the coding region 1 and the translation initiation element.
Recombinant Nucleic Acid Molecule Including at Least Two Translation Initiation Elements
[0326] In some embodiments, the recombinant nucleic acid molecule is used for preparing a circular RNA containing a coding element; where the coding element in the circular RNA contains a coding region 1, at least one coding region 4, and a translation initiation element located between any two adjacent coding regions.
[0327] In some embodiments, a truncated fragment I of the coding element and a truncated fragment II of the coding element in the recombinant nucleic acid molecule form the coding region 1, the at least one coding region 4, and the translation initiation element located between any two adjacent coding regions. The 3 end of the truncated fragment I of the coding element contains a ribozyme recognition site I that consists of a first predetermined number of nucleotides located at the 3 end of the truncated fragment I of the coding region 1; and the 5 end of the truncated fragment II of the coding element contains a ribozyme recognition site II that consists of a second predetermined number of nucleotides located at the 5 end of the truncated fragment II of the coding region 1. In the circular RNA prepared by the recombinant nucleic acid molecule in vitro, each coding region corresponds to one translation initiation element, allowing for tandem expression of at least two target polypeptides.
[0328] In some alternative embodiments, the coding region 4 has a quantity of one, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment II, the truncated fragment II of the coding region 1, a translation initiation element, the coding region 4, a translation initiation element, the truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0329] In some alternative embodiments, the coding region 4 has a quantity of two, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment II, the truncated fragment II of the coding region 1, a translation initiation element, the coding region 4, a translation initiation element, the coding region 4, a translation initiation element, the truncated fragment I of the coding region 1, and an intron fragment I, as shown in
[0330] In some alternative embodiments, as shown in
[0331] In some other embodiments, the truncated fragment III of the coding element and the truncated fragment IV of the coding element in the recombinant nucleic acid molecule are used to form a coding region 1, at least one coding region 4, and a translation initiation element located between any two adjacent coding regions. The 3 end of the truncated fragment III of the coding region 1 contains a ribozyme recognition site IV that consists of a first predetermined number of nucleotides located at the 3 end of the truncated fragment III of the coding region 1; and the 5 end of the truncated fragment IV of the coding region 1 contains a ribozyme recognition site III that consists of a second predetermined number of nucleotides located at the 5 end of the truncated fragment IV of the coding region 1. In the circular RNA prepared by the recombinant nucleic acid molecule in vitro, each coding region corresponds to one translation initiation element, allowing for tandem expression of at least two target polypeptides.
[0332] In some alternative embodiments, the coding region 4 has a quantity of one, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment III, the truncated fragment IV of the coding region 1, a translation initiation element, the coding region 4, a translation initiation element, the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0333] In some alternative embodiments, the coding region 4 has a quantity of two, and the recombinant nucleic acid molecule includes elements arranged in the following order: an intron fragment III, the truncated fragment IV of the coding region 1, a translation initiation element, the coding region 4, a translation initiation element, the coding region 4, a translation initiation element, the truncated fragment III of the coding region 1, and an intron fragment IV, as shown in
[0334] In some alternative embodiments, as shown in
[0335] In the present disclosure, the coding region 1 and each coding region 4 encode any type of target polypeptide independently of one another. The target polypeptides encoded by the coding region 1 and any one coding region 4 may be the same or different, and the target polypeptides encoded by any coding region 4 may be the same or different.
[0336] In the circular RNA prepared by the recombinant nucleic acid molecule above, the 5 end of each coding region is correspondingly ligated to one translation initiation element, and the coding region 1 and the at least one coding region 4 are ligated in tandem by a plurality of translation initiation elements, allowing for expression of at least two target polypeptides.
[0337] In the present disclosure, the coding regions located at different positions are distinguished by numbering the coding regions (for example, coding region 1, coding region 4, etc.). Illustratively, the coding region 1 represents a coding region containing a ribozyme recognition site; the code region 4 represents a coding region between the truncated fragment I of the coding region 1 and the truncated fragment II of the coding region 2, or the coding region 4 represents a coding region between the truncated fragment III of the coding region 1 and the truncated fragment IV of the coding region 2.
Recombinant Expression Vector Containing Recombinant Nucleic Acid Molecule
[0338] In some embodiments, the recombinant nucleic acid molecule serves as a portion of a recombinant expression vector for preparing a circular RNA. The circular RNAs expressing a target polypeptide may be prepared in a process of transcription and circularization in vitro.
[0339] In other embodiments, the recombinant nucleic acid molecule may serve as a circularization precursor RNA molecule, or a part thereof obtained after linearization and transcription of the recombinant expression vector. That is, only circularization of the recombinant nucleic acid molecule is needed to obtain the circular RNA expressing a target polypeptide.
[0340] In some embodiments, the steps of preparing a circular RNA in vitro include:
[0341] transcribing the recombinant nucleic acid molecule according to any one item described above or the recombinant expression vector described above to form a circularization precursor nucleic acid molecule; and
[0342] circularizing the circularization precursor nucleic acid to obtain the circular RNA.
[0343] In some alternative embodiments, the method further includes a step of purifying the circular RNA.
Circular RNA
[0344] In some embodiments, the circular RNA of the present disclosure is prepared by using a Clean PIE system provided by the present disclosure, and includes elements arranged in the following order in the 5 to 3 direction: a translation initiation element, and a coding element for encoding at least one target polypeptide.
[0345] Compared with the circular RNA prepared by a classic PIE system shown in
[0346] In some embodiments, the coding element of the circular RNA includes a coding region 1 and at least one in the group consisting of (i) to (ii): (i) at least one coding region 2, and (ii) at least one coding region 3. Each coding region encodes any type of target polypeptide independently of one another, and the circular RNA may encode one or more target polypeptides in tandem. Illustratively, the circular RNA expresses 1, 2, 3, 4, 5, 10, 15, 20, 25, or another number of target polypeptides.
[0347] As a preferred embodiment, two adjacent coding regions are linked by a linker, which is used to encode a linker peptide to separate target polypeptides encoded by the adjacent coding regions, enabling the same circular RNA to encode two or more target polypeptides.
[0348] In some alternative embodiments, the circular RNA contains a translation initiation element, a coding region 1, a coding region 2, and a linker located between the coding region 1 and the coding region 2 in the 5 to 3 direction, as shown in
[0349] In some alternative embodiments, the coding region 2 may have a quantity of two or more. Illustratively, the circular RNA contains a translation initiation element, a coding region 1, two coding regions 2 (for convenience of description, designated as a first coding region 2 and a second coding region 2 in the 5 to 3 direction), a linker located between the coding region 1 and the first coding region 2, and a linker located between the first coding region 2 and the second coding region 2 in the 5 to 3 direction, as shown in
[0350] In some alternative embodiments, the circular RNA contains a translation initiation element, a coding region 3, a coding region 1, and a linker located between the coding region 1 and the coding region 3 in the 5 to 3 direction, as shown in
[0351] In some alternative embodiments, the coding region 3 may have a quantity of two or more. Illustratively, the circular RNA contains a translation initiation element, two coding regions 3 (for convenience of description, designated as a first coding region 3 and a second coding region 3 in the 5 to 3 direction), a coding region 1, a linker located between the coding region 1 and the second coding region 3, and a linker located between the first coding region 3 and the second coding region 3 in the 5 to 3 direction, as shown in
[0352] In some alternative embodiments, the circular RNA contains both a coding region 2 and a coding region 3. Illustratively, the circular RNA contains a translation initiation element, a coding regions 3, a coding region 1, a coding region 2, a linker located between the coding region 1 and the coding region 3, and a linker located between coding region 1 and coding region 2 in the 5 to 3 direction, as shown in
[0353] In the present disclosure, the coding region 1, each coding region 2 and each coding region 3 encode any type of target polypeptide independently of one another. The target polypeptide encoded by the coding region 1 and any one coding region 2 may be the same or different, the target polypeptide encoded by the coding region 1 and any one coding region 3 may be the same or different, the target polypeptide encoded by any two coding regions 2 may be the same or different, the target polypeptide encoded by any two coding regions 3 may be the same or different, and the target polypeptide encoded by any one coding region 2 and any one coding region 3 may be the same or different.
[0354] In some embodiments, the coding regions of the circular RNA includes one coding region 1 and at least one coding region 4, and the 5 end of any one coding region is ligated to a translation initiation element. Illustratively, the coding region 4 has a quantity of 1, 2, 3, 4, 5, 10, 15, 20, 25, and the like. The transcription of different coding regions is initiated by using a translation initiation element ligated to the 5 end of each coding region, enabling the same circular RNA to encode two or more target polypeptides.
[0355] In some alternative embodiments, the coding region 4 has a quantity of one, and the circular RNA contains a translation initiation element, a coding region 1, a translation initiation element, and a coding region 4 in the 5 to 3 direction, as shown in
[0356] In some alternative embodiments, the coding region 4 may have a quantity of at least two. Illustratively, the circular RNA contains a translation initiation element, a coding region 1, a translation initiation element, at least two coding regions 4, and a translation initiation element located between the at least two coding regions 4 in the 5 to 3 direction, as shown in
[0357] In the present disclosure, the coding region 1 and each coding region 4 encode any type of target polypeptide independently of one another. The target polypeptide encoded by the coding region 1 and any one coding region 4 may be the same or different, and the target polypeptide encoded by any two coding regions 4 may be the same or different.
[0358] In some alternative embodiments, the circular RNA contains an insertion element. The insertion element is ligated to the 5 end of any translation initiation element.
Methods for Screening Target Coding Region Sequence Containing Ribozyme Recognition Site
[0359] In some embodiments, the present disclosure provides a method for screening a target coding region sequence containing a ribozyme recognition site, including the following steps:
[0360] S1, extracting m amino acid units from the target polypeptide containing q amino acids in the N-terminal-to-C-terminal direction, with each of amino acid units containing n amino acids; where at least one repeated amino acid is contained between any two adjacent amino acid units, n is an integer and n2, m is an integer and m1.
[0361] Specifically, in the N-terminal-to-C-terminal direction, the extracted m amino acid units are sequentially designated as amino acid units R.sub.1 to R.sub.M. A quantity of the amino acids in each amino acid unit from R.sub.1 to R.sub.M is n, and at least one identical amino acid is contained between any two adjacent amino acid units, with a quantity of amino acid units is any integer from 1 to (n-1). As a preferred embodiment, the quantity of repeated amino acids between any two adjacent amino acid units is n-1.
[0362] Illustratively, the target polypeptide sequentially consists of AA.sub.1 to AA.sub.q amino acids in the N-terminal-to-C-terminal direction. When extracting the amino acids from the target polypeptide, a total number of n amino acids (AA.sub.1 included) are extracted as an amino acid unit R.sub.1, with AA.sub.1 as a start amino acid.
[0363] Furthermore, when extracting the amino acid unit R.sub.2, a start position for extracting the amino acid unit R.sub.2may be any position from positions [2] to [n] in the amino acid unit R.sub.1. For example, when n is 2, a start amino acid of the amino acid unit R.sub.2 is the amino acid at the position [2] in the amino acid unit R.sub.1. When n is 3, the start amino acid of the amino acid unit R.sub.2 is the amino acid at the position [2] or [3] in the amino acid unit R.sub.1 (AA.sub.2 or AA.sub.3). When n is 4, the start amino acid of the amino acid unit R.sub.2 is the amino acid at the position [2], [3] or [4] in the amino acid unit R.sub.1 (AA.sub.2, AA.sub.3 or AA.sub.4). Analogy may be made with the increase of n, which is not exhaustive herein.
[0364] As a preferred embodiment, the start amino acid of the amino acid unit R.sub.2 is the amino acid at the position [2] in the amino acid unit R.sub.1. For example, when n is any integer of 2 or more, a start amino acid of the amino acid unit R.sub.2 is always AA.sub.2.
[0365] Furthermore, when extracting the amino acid unit R.sub.3, a start position for extracting the amino acid unit R.sub.3 may be any position from position [2] to [n] in the amino acid unit R.sub.2. For example, when n is 2, a start amino acid of the amino acid unit R.sub.3 is the amino acid at the position [2] in the amino acid unit R.sub.2. When n is 3, the start amino acid of the amino acid unit R.sub.3 is the amino acid at the position [2] or [3] in the amino acid unit R.sub.2. When n is 4, the start amino acid of the amino acid unit R.sub.3 is the amino acid at the position [2], [3] or [4] in the amino acid unit R.sub.2. Analogy may be made with the increase of n, which is not exhaustive herein.
[0366] As a preferred embodiment, the start amino acid of the amino acid unit R.sub.3 is the amino acid at the position [2] in the amino acid unit R.sub.2. For example, when n is any integer of 2 or more, the start amino acid of the amino acid unit R.sub.3 is always AA.sub.3.
[0367] Furthermore, the start position for extracting the amino acid unit R.sub.4 may be any position from positions [2] to [n] in the amino acid unit R.sub.3. For example, when n is 2, the start amino acid of the amino acid unit R.sub.4 is the amino acid at a position [2] in the amino acid unit R.sub.3. When n is 3, the start amino acid of the amino acid unit R.sub.4 is the amino acid at the position [2] or [3] in the amino acid unit R.sub.3. When n is 4, the start amino acid of the amino acid unit R.sub.4 is the amino acid at the position [2], [3] or [4] in the amino acid unit R.sub.3. Analogy may be made with the increase of n, which is not exhaustive herein.
[0368] As a preferred embodiment, the start amino acid of the amino acid unit R.sub.4 is the amino acid at the position [2] in the amino acid unit R.sub.3. For example, when n is any integer of 2 or more, the start amino acid of the amino acid unit R.sub.4 is always AA.sub.4.
[0369] The extraction of amino acid units is carried out in the above manner until the amino acid unit R.sub.m is extracted.
[0370] In a preferred embodiment, a target polypeptide sequence consisting of q amino acids is split, with a step of 1 and a window length of n, to obtain m amino acid units, where m =q+1-n, n is an integer and n>2, m is an integer and m1.
[0371] S2, determining m codon sequence sets, where each of the codon sequence sets includes a codon sequence corresponding to each of the amino acid unit.
[0372] Specifically, according to the degeneracy principle of amino acid codons, the codon sequence set corresponding to each amino acid unit is obtained. Codon sequence sets C.sub.1-C.sub.m are obtained corresponding to amino acid units R.sub.1-R.sub.m.
[0373] S3, traversing the m codon sequence sets to obtain a matching value of each codon sequence in each of the codon sequence sets with a target motif.
[0374] Specifically, the target motif contains a ribozyme recognition site sequence that is formed by ligating the nucleotide sequence of a ribozyme recognition site I to the nucleotide sequence of a ribozyme recognition site II, or formed by ligating the nucleotide sequence of a ribozyme recognition site III to the nucleotide sequence of a ribozyme recognition site IV. Illustratively, ribozyme recognition site sequences include, but are not limited to, 5-TTGGGTCT-3, 5-ACGTCTTAACCAA-3, 5-AGGGATCA-3, and the like.
[0375] Furthermore, the target motif also contains x nucleotide(s) ligated to at least one of the 5 end and the 3 end of the ribozyme recognition site sequence, to form a target motif consisting of 3n nucleotides. Each x is an integer 0 independently of one another, and each ligated nucleotide is selected from any type of nucleotide independently of one another. For example, when the ribozyme recognition site sequence is 5-TTGGGTCT-3, the target motif may correspond to at least one selected from the following (a1) to (a6), where X=A, T, C, G:
TABLE-US-00001 (a1) TTGGGTCTX; (a2) XTTGGGTCT; (a3) XTCTGGGTT; (a4) TCTGGGTTX; (a5) XXTTGGGTCTXX; (a6) XXTCTGGGTTXX.
[0376] In some embodiments, the step of traversing m codon sequence sets to obtain a matching value of each codon sequence in each of codon sequence sets with a target motif includes aligning each codon sequence in the codon sequence sets C.sub.1-C.sub.m with the target motif to calculate the matching value of each codon subsequence.
[0377] Furthermore, the target motif contains an effective base pair that corresponds to two bases at a linking position of the ribozyme recognition site I and the ribozyme recognition site II. That is, the effective base pair refers to the two bases used for circularization in the ribozyme recognition site. For example, when the sequence of ribozyme recognition site is 5-TTGGGTCT-3, the effective base pair refers to TC therein. When the sequence of the ribozyme recognition site is 5-ACGTCTTAACCAA-3, the effective base pair refers to TA therein. When the sequence of ribozyme recognition site is 5-AGGGATCA-3, the effective base pair refers to TC therein.
[0378] When aligning each codon sequence with the target motif, it is determined whether bases at positions in the codon sequence corresponding to the effective base pair are effective bases, and if the codon sequence does not contain the effective base pair, then an alignment value of the codon sequence is not outputted.
[0379] If the codon sequence contains the effective base pair, the alignment value between each base in each codon sequence with the corresponding base in the target motif in the 5 to 3 direction is determined.
[0380] The matching value of each codon sequence with the target motif is obtained based on the alignment value of each base in each codon sequence.
[0381] Illustratively, when the target motif may correspond to at least one selected from (a1) to (a6): (a1) TTGGGTCTX; (a2) XTTGGGTCT; (a3) XTCTGGGTT; (a4) TCTGGGTTX; (a5) XXTTGGGTCTXX; (a6) XXTCTGGGTTXX, where X=A, T, C, G. The traversing m codon sequence sets to obtain a matching value of each codon sequence in each of the codon sequence sets with a target motif includes:
[0382] S31: by taking (a1) TTGGGTCTX as the target motif, transversing each codon sequence of the codon sequence sets C.sub.1-C.sub.m to calculate the matching value of each codon sequence with target motif. For a codon sequence, the 6th position therein must be base T, and the 7th position therein must be base C, or the matching value is not outputted. When the codon sequence contains an effective base pair, the bases at positions 1 to 9 are successively aligned, and scores are accumulated according to the alignment results.
[0383] S32: by taking (a2) XTTGGGTCT as the target motif, traversing each codon sequence of the codon sequence sets C.sub.1-C.sub.m to calculate the matching value of each codon sequence with the target motif. For a codon sequence, the 7th position therein must be base T, and the 8th position therein must be base C, or the matching value is not outputted. When the codon sequence contains an effective base pair, the bases at positions 1 to 9 are successively aligned, and scores are accumulated according to the alignment results.
[0384] S33: by taking (a3) XTCTGGGTT as the target motif, traversing each codon sequence of the codon sequence sets C.sub.1-C.sub.m to calculate the matching value of each codon sequence with the target motif. For a codon sequence, the 3th position therein must be base C, and the 4th position therein must be base T, or the matching value is not outputted. When the codon sequence contains an effective base pair, the bases at positions 1 to 9 are successively aligned, and scores are accumulated according to the alignment results.
[0385] S33: by taking (a3) XTCTGGGTT as the target motif, traversing each codon sequence of the codon sequence sets C.sub.1-C.sub.m to calculate the matching value of each codon sequence with the target motif. For a codon sequence, the 3th position therein must be base C, and the 4th position therein must be base T, or the matching value is not outputted. When the codon sequence contains an effective base pair, the bases at positions 1 to 9 are successively aligned, and scores are accumulated according to the alignment results.
[0386] S34: by taking (a4) TCTGGGTTX as the target motif, traversing each codon sequence of the codon sequence sets C.sub.1-C.sub.m to calculate the matching value of each codon sequence with the target motif. For a codon sequence, the 3rd position therein must be base T, and the 2nd position therein must be base C, or the matching value is not outputted. When the codon sequence contains an effective base pair, the bases at positions 1 to 9 are successively aligned, and scores are accumulated according to the alignment results.
[0387] S35: by taking (a5) XXTTGGGTCTXX as the target motif, traversing each codon sequence of the codon sequence sets C.sub.1-C.sub.m to calculate the matching value of each codon sequence with the target motif. For a codon sequence, the 7th position therein must be base T, and the 8th position therein must be base C, or the matching value is not outputted. When the codon sequence contains an effective base pair, the bases at positions 1 to 9 are successively aligned, and scores are accumulated according to the alignment results.
[0388] S36: by taking (a6) XXTCTGGGTTXX as the target motif, traversing each codon sequence of the codon sequence sets C.sub.1-C.sub.m to calculate the matching value of each codon sequence with the target motif. For a codon sequence, the 4th position therein must be base C, and the 5th position therein must be base T, or the matching value is not outputted. When the codon sequence contains an effective base pair, the bases at positions 1 to 9 are successively aligned, and scores are accumulated according to the alignment results.
[0389] In some embodiments, the obtaining a matching value of each codon sequence in each of the codon sequence sets with a target motif further includes: determining whether each codon sequence in each codon sequence set is hybridized with an intron sequence to obtain a complementary value of each codon sequence in each of codon sequence sets.
[0390] Illustratively, by traversing each codon sequence of the codon sequence sets C.sub.1-C.sub.m, based on whether each codon sequence is hybridized with an intron sequence, the complementary value of each codon sequence is obtained; and in combination of the complementary value with the alignment value, a final matching value of each codon sequence is obtained.
[0391] S4, determining the target codon sequence in the codon sequence set based on the matching value, where a position of the target codon sequence corresponding to the coding region sequence is an implantation position of the ribozyme recognition site, and the coding region sequence containing the target codon sequence at the implantation position is the target coding region sequence containing the ribozyme recognition site.
[0392] Specifically, after obtaining the matching value of each codon sequence in each of codon sequence sets with a target motif, the codon sequence with the matching value higher than a first threshold is selected as the target codon sequence. The position of the target codon sequence corresponding to the coding region sequence is the implantation position of ribozyme recognition site. For the target coding region sequence, the nucleotide sequence at the implantation position is the target codon sequence.
[0393] Furthermore, the target codon sequence is truncated at the position of the effective base pair in the target codon sequence, to provide the truncated fragment I of the coding element and the truncated fragment II of the coding element, or provide the truncated fragment III of the coding element and the truncated fragment IV of the coding element, either of which may be applied to the Clean PIE system for circularization.
[0394] In the present disclosure, the first threshold refers to a value that when the matching value between the codon sequence and the target motif is higher than this value, the truncated fragments of the coding element may be applied to the Clean PIE system for effective circularization.
[0395] In the present disclosure, as a limited number of base mutations in the ribozyme recognition site sequence have no impact on effective circularization of the ribozyme recognition site, for the target codon sequence, mutant bases not matching the target motif are allowed at certain positions.
Methods for Screening Ribozyme Recognition Sites
[0396] In some embodiments, the present disclosure provides a method for screening a target coding region sequence containing a ribozyme recognition site, the method including the following steps:
[0397] (1) Determining a sequence to be screened, which contains an intron sequence derived from Group I intron, a first exon sequence ligated to the 5 end of the intron sequence, and a second exon sequence ligated to the 3 end of the intron sequence.
[0398] Specifically, the sequence to be screened may be any type of sequence with self-splicing activity of Group I intron.
[0399] (2) Obtaining a predicted RNA secondary structure based on the sequence to be screened.
[0400] Specifically, the obtaining the RNA secondary structure of the sequence to be screened includes:
[0401] receiving, by a sequence alignment software (for example, ClustalW), an input of a sequence to be screened, to determine highly conserved sequences P7 and P7 in the sequence to be screened derived from the Group I intron, and determine J6/7 and J8/7 sequences to obtain first pairing information;
[0402] determining P3, and determining whether a P3 sequence exists after P7, and if not, adding a P3 sequence, to obtain second pairing information;
[0403] determining one or more of the following sequences: P2, P4, P5, P6, P8, and P9, according to the first pairing information and the second pairing information, and further according to a typical structure of the Group I intron (
[0404] determining P1 and P10 together with the ribozyme recognition site by a first exon sequence at the 5 end and a second exon sequence at the 3 end; and predicting by the method based on minimum free energy in Mfold or RNAstructure using the obtained pairing information to obtain the predicted RNA secondary structure.
[0405] (3) Obtaining a ribozyme recognition site I with ribozyme recognition activity in the first exon sequence and a ribozyme recognition site II with ribozyme recognition activity in the second exon sequence based on the predicted RNA secondary structure.
[0406] In some embodiments, the nucleotide sequence of the ribozyme recognition site I is hybridized with a leader sequence in the intron sequence, or the nucleotide sequence of the ribozyme recognition site II is hybridized with a leader sequence in the intron sequence. The nucleotide sequence of the ribozyme recognition site I and/or the ribozyme recognition site II are hybridized with the leader sequence in the intron sequence, keeping two ends of the Clean
[0407] PIE system close to each other during self-splicing to form a circular RNA, which facilitates successive cleavage and ligating at positions of the ribozyme recognition site I and the ribozyme recognition site II to form the circular RNA.
[0408] As a limited number of base mutations in the ribozyme recognition site sequence have no impact on effective circularization of ribozyme recognition site, in some embodiments, the bases on the ribozyme recognition site I are successively replaced to obtain a mutant sequence of the ribozyme recognition site I with ribozyme recognition activity. In some embodiments, the bases on the ribozyme recognition site II are successively replaced to obtain a mutant sequence of the ribozyme recognition site II with ribozyme recognition activity.
[0409] (4) Determining the ribozyme recognition site sequence based on the nucleotide
[0410] sequence of the ribozyme recognition site I and the nucleotide sequence of the ribozyme recognition site II. Specifically, the ribozyme recognition site sequence contains at least one selected from the group consisting of (i) to (iv):
[0411] (i) the nucleotide sequence of the ribozyme recognition site I,
[0412] (ii) the nucleotide sequence of the ribozyme recognition site II,
[0413] (iii) a mutant sequence of the ribozyme recognition site I with ribozyme recognition activity,
[0414] (iv) a mutant sequence of the ribozyme recognition site II with ribozyme recognition activity.
[0415] In some embodiments, the ribozyme recognition site contains (i) the nucleotide sequence of the ribozyme recognition site I, and (ii) the nucleotide sequence of the ribozyme recognition site II. In other embodiments, the ribozyme recognition site consists of (i) the nucleotide sequence of the ribozyme recognition site I and (ii) the nucleotide sequence of the ribozyme recognition site II.
[0416] In some embodiments, the ribozyme recognition site contains (iii) a mutant sequence of the ribozyme recognition site I with ribozyme recognition activity, and (iv) a mutant sequence of the ribozyme recognition site II with ribozyme recognition activity. In other embodiments, the ribozyme recognition site consists of (iii) a mutant sequence of the ribozyme recognition site I with ribozyme recognition activity and (iv) a mutant sequence of the ribozyme recognition site II with ribozyme recognition activity.
[0417] In some embodiments, the ribozyme recognition site contains (i) the nucleotide sequence of the ribozyme recognition site I, and (iv) a mutant sequence of the ribozyme recognition site II with ribozyme recognition activity. In other embodiments, the ribozyme recognition site consists of (i) the nucleotide sequence of the ribozyme recognition site I and (iv) a mutant sequence of the ribozyme recognition site II with ribozyme recognition activity.
[0418] In some embodiments, the ribozyme recognition site contains (iii) a mutant sequence of the ribozyme recognition site I with ribozyme recognition activity, and (ii) the nucleotide sequence of the ribozyme recognition site II. In other embodiments, the ribozyme recognition site consists of (iii) a mutant sequence of the ribozyme recognition site I with ribozyme recognition activity, and (ii) the nucleotide sequence of the ribozyme recognition site II.
Screening System for Screening Target Coding Region Sequence Containing Ribozyme Recognition Site
[0419] In some embodiments, the present disclosure provides a screening system for screening a target coding region sequence containing a ribozyme recognition site, which includes:
[0420] a target motif constructing module configured to ligate x nucleotide to at least one end of the 5 end and the 3 end of a ribozyme recognition site sequence to obtain a target motif with 3n nucleotide; where each x is an integer 0 independently of one another, and each ligated nucleotide is selected from any type of nucleotide independently of one another; an amino acid unit extraction module configured to extract m amino acid units from
[0421] the target polypeptide containing q amino acids in the N-terminal-to-C-terminal direction, with each of the amino acid units containing n amino acids; where at least one repeated amino acid is contained between any two adjacent amino acid units, n is an integer and n2, m is an integer and m1; preferably, m=q+1n;
[0422] a codon sequence set extraction module configured to determine m codon sequence sets, where each of the codon sequence sets includes a codon sequence corresponding to each of the amino acid units;
[0423] a matching value calculation module configured to traverse the m codon sequence sets to obtain a matching value of each codon sequence in each of the codon sequence sets with the target motif;
[0424] a target codon sequence screen module configured to determine the target codon sequence in the codon sequence set based on the matching value, where a position of the target codon sequence corresponding to the coding region sequence is an implantation position of the ribozyme recognition site, and the coding region sequence containing the target codon sequence at the implantation position is the target coding region sequence containing the ribozyme recognition site.
[0425] In some embodiments, the matching value calculation module includes: an effective base pair determination unit configured to determine whether a base at the position corresponding to an effective base pair in the codon sequence is an effective base, and if the codon sequence does not contain the effective base pair, disable output of the alignment value of the codon sequence;
[0426] an alignment value determination unit configured to determine the alignment value between each base in each codon sequence with the corresponding base in the target motif in the 5 to 3 direction;
[0427] a matching value output unit configured to obtain the matching value of each codon
[0428] sequence with the target motif based on the alignment value of each base in each codon sequence.
[0429] In some embodiments, the matching value calculation module further includes: a complementary value calculation module configured to determine whether each codon sequence in each of the codon sequence sets is hybridized with an intron sequence to obtain the complementary value of each codon sequence in each of the codon sequence sets;
[0430] the matching value output unit configured to determine the matching value of each codon sequence in each of the codon sequence sets with the target motif based on the alignment value and the complementary value.
[0431] Moreover, the present disclosure also discloses a processing device for screening a target coding region sequence containing a ribozyme recognition site, which includes:
[0432] a memory configured to store computer programs;
[0433] a processor configured to execute a computer program to implement the above method for screening a target coding region sequence containing a ribozyme recognition site.
[0434] Moreover, the present disclosure also discloses a computer-readable storage medium, on which a computer program is stored, which, when executed by a processor, implements the above method for screening a target coding region sequence containing a ribozyme recognition site.
[0435] It may be further appreciated by those skilled in the art that the units and algorithm steps of each example described in connection with the embodiments disclosed herein may be implemented by electronic hardware, computer software, or a combination thereof. In order to clearly illustrate the interchangeability of hardware and software, components and steps of each example have been generally described in terms of functions in the above description. Whether these functions are performed by hardware or software depends on the specific application and design constraints of the technical scheme. Those skilled in the art may use different methods to achieve the described functions for each specific application, which should not be construed as beyond the scope of the present disclosure.
EXAMPLES
[0436] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples (although indicating the embodiments of the present disclosure) are given only for purposes of illustration, as various changes and modifications made within the spirit and scope of the present disclosure will become apparent to those skilled in the art after reading the detailed description.
[0437] Unless otherwise specified, the experimental techniques and methods used in the examples herein are conventional ones, such as those without specific conditions in the following examples, which are carried out in accordance with conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or those suggested by manufacturers. The materials and reagents used are commercially available, unless otherwise specified.
Example 1: Matching Value Calculation Module
[0438] This example illustrates the scoring criteria of matching value calculation module in the screening system for target coding region sequences. The scoring principle of the matching calculation module is intended to find a target codon sequence closest to Group I intron PIE E1E2 in the ORF (open reading frame) of the circularization gene according to the degeneracy principle of encoding amino acids, thereby determining a ribozyme recognition site in the coding region.
[0439] If there was no target codon sequence completely matching to the Group I intron E1E2 in the coding region, the scoring was performed according to the following principles:
[0440] 1. The completely matched sequence was taken as the baseline and given a score of 100. By taking T4td PIE as an example, the scoring criteria are shown in
[0441] The score was 17.6 if the 1st position of the sequence was T, or it was 0. If the 2nd position of the sequence was T and C, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 3rd position of the sequence was G and A, the score was accumulated by 17.6 and 5.8 respectively, or by 0. If the 4th position of the sequence was G, the score was accumulated by 17.6, or by 0. if the 5th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 8th position of the sequence was T and A, the score was accumulated by 12 and 5.8, respectively, or by 0. Finally, the total score was the scoring of the sequence.
[0442] 2. The E1E2 sequences were counted, and the bases (effective base pair) at the circularization site were excluded, which were not scored (taking T4td PIE as an example, where E1E2 sequence was TTGGGTCT and TC was the circularization site, then TC was not scored).
[0443] Weighted average was carried out according to the following four situations:
[0444] a) if the sequence in the coding region completely matched the E1E2 sequence, and the circularization position sequence in the coding region was base complementary to IG sequence (a leader sequence) in the intron, then the weighted average was 3;
[0445] b) if the sequence in the coding region completely matched the E1E2 sequence, whereas the circularization position sequence in the coding region was not base complementary to IG sequence (a leader sequence) in the intron, then the weighted average was 2;
[0446] c) if sequences in the coding region cannot match E1E2 sequence, whereas the circularization position sequence in the coding region was base complementary to IG sequence (guide sequence) in the intron, then the weighted average was 1; and
[0447] b) if sequences in the coding region cannot match the E1E2 sequence, and the circularization position sequence in the coding region was not base complementary to IG sequence (guide sequence) in the intron, then the weighted average was 0.
[0448] The circularization sequence may be scored based on the above principles.
[0449] The present circularization sequence scoring system may be applied to Example 2 to obtain the target codon sequence, which is the same as or similar to the Group I intron PIE E1E2 sequence.
Example 2: Screening for Target Coding Region Sequence Containing Ribozyme Recognition Site
[0450]
[0451] (1) converting the coding region of a complete gene sequence into an amino acid sequence;
[0452] (2) in the amino acid unit extraction module, performing a slide window on the amino acid sequence, with a step of 1 (step=1) and a window length of 3 or 4 (win=3, 4), to obtain a short amino acid sequence with a length of 3 or 4;
[0453] (3) in the codon sequence set extraction module, translating the short amino acid sequence obtained in (2) into a nucleotide sequence according to the codon table in (1) to obtain a codon sequence set; and
[0454] (4) in the matching value calculation module, scoring the codon sequence, with the E1E2 sequence as the ribozyme recognition site being TGGGTCT and taking the following sequences as the target motif, respectively, successively calculating the matching values of the codon sequences in the codon sequence sets with the target motif, where X=A, T, C, G.
TABLE-US-00002 TTGGGTCTX; XTTGGGTCT; XTCTGGGTT; TCTGGGTTX; XXTTGGGTCTXX; XXTCTGGGTTXX.
[0455] i) The sequences obtained in (3) were traversed (win=3, with a sequence length of 9 bp) and scored based on TTGGGTCTX (X=A, T, C, G), and the 6th position of the sequence must be the base T and the 7th position must be the base C. If the 1st position of the sequence was T, the score was 17.6, or it was 0. If the 2nd position of the sequence was T and C, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 3rd position of the sequence was G and A, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 4th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 5th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 8th position of the sequence was T and A, the score was accumulated by 12 and 5.8, respectively, or by 0.
[0456] ii) The sequences obtained in (3) were traversed (win=3, with a sequence length of 9 bp) and scored based on XTTGGGTCT (X=A, T, C, G), and the 7th position of the sequence must be the base T and the 8th position must be the base C. If the 2nd position of the sequence was T, the score was 17.6, or it was 0. If the 3rd position of the sequence was T and C, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 4th position of the sequence was G and A the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 5th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 6th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 9th position of the sequence was T and A, the score was accumulated by 12 and 5.8, respectively, or by 0.
[0457] iii) The sequences obtained in (3) were traversed (win=3, with a sequence length of 9 bp) and scored based on XTCTGGGTT (X=A, T, C, G), and the 3rd position of the sequence must be the base C and the 4th position must be the base T, If the 9th position of the sequence was T, the score was 17.6, or it was 0. If the 8th position of the sequence was T and C, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 7th position of the sequence was G and A, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 6th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 5th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 2nd position of the sequence was T and A, the score was accumulated by 12 and 5.8, respectively, or by 0.
[0458] iv) The sequences obtained in (3) were traversed (win=3, with a sequence length of 9 bp) and scored based on TCTGGGTTX (X=A, T, C, G), and the 3rd position of the sequence must be the base T and the 2nd position must be the base C. If the 8th position of the sequence was T, the score was 17.6, or it was 0. If the 7th position of the sequence was T and C, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 6th position of the sequence was G and A, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 5th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 4th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 1st position of the sequence was T and A, the score was accumulated by 12 and 5.8, respectively, or by 0.
[0459] v) The sequences obtained in (3) were traversed (win=4 with a sequence length of 12bp) and scored based on XXTTGGGTCTXX (X=A, T, C, G), and the 7th position of the sequence must be the base T and the 8th position must be the base C. If the 1st position of the sequence was T, the score was 17.6, or it was 0. If the 3rd position of the sequence was T and C, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 4th position of the sequence was G and A, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 5th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 6th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 9th position of the sequence was T and A, the score was accumulated by 12 and 5.8, respectively, or by 0.
[0460] vi) The sequences obtained in (3) were traversed (win=4, with a sequence length of 12bp) and scored based on XXTCTGGGTTXX (X=A, T, C, G), and the 4th position of the sequence must be the base C and the 5th position must be the base T. If the 10th position of the sequence was T, the score was 17.6, or it was 0. If the 9th position of the sequence was T and C, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 8th position of the sequence was G and A, the score was accumulated by 17.6 and 5.8, respectively, or by 0. If the 7th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 6th position of the sequence was G, the score was accumulated by 17.6, or by 0. If the 3rd position of the sequence was T and A, the score was accumulated by 12 and 5.8, respectively, or by 0.
[0461] (4) Sorting according to the sequence score from high to low.
[0462] By taking EGFP protein as an example, the nuclease recognition site in the nucleotide sequence encoding EGFP protein was determined through the following steps.
[0463] i) EGFP nucleotide sequence seq1 (SEQ ID NO: 1) was translated into amino acid sequence seq 2 (SEQ ID NO: 2).
[0464] ii) A slide window was performed: (a) splitting the seq2 sequence with a step of 1 (step =1) and a window length of 3 to obtain amino acid fragments with a length of three amino acids, randomly recombining different codons corresponding to each amino acid fragment to obtain possible base sequences corresponding to all amino acid fragments by exhaustion, and constructing a codon sequence set; and (b) splitting the seq2 sequence with a step of 1 (step =1) and a window length of 4 to obtain amino acid fragments with a length of 4 amino acids, randomly recombining different codons corresponding to each amino acid fragment, to obtain possible base sequences corresponding to all amino acid fragments by exhaustion, and adding the corresponding base sequences into the constructed codon sequence set above.
[0465] Illustratively, the seq2 sequence is split with a step of 1 and a window length of 3 amino acids, to obtain the amino acid fragments shown below:
TABLE-US-00003 MVS, VSK, SKG, KGE, GEE, ... LYK, YK*;
[0466] where the above . . . represents the amino acid fragments between GEE and LYK obtained by successively splitting the seq2 sequence with a step of 1 and a window length of 3 amino acids, and the * stands for a stop codon.
[0467] The seq2 sequence was split with a step of 1 and a window length of 4 amino acids, to obtain the amino acid fragments shown below:
TABLE-US-00004 (SEQIDNO:60) MVSK, (SEQIDNO:61) VSKG, (SEQIDNO:62) SKGE, ... (SEQIDNO:63) ELYK, LYK*;
[0468] where the above . . . represents the amino acid fragments between SKGE and ELYK obtained by successively splitting the seq2 sequence with a step of 1 and a window length of 4 amino acids, and the * stands for a stop codon.
[0469] iii) The codon sequence set constructed in (2) were transversed, scoring was performed by taking TTGGGTCTX, XTTGGGTCT, XXTTGGGTCTXX, TCTGGGTTX, XTTGGTTT and XXTCTGGGTTXX as target motifs, which were used as the matching values of codon sequences with the target motif, and the sequence scores were sorted from high to low, as 10 shown in Table 1, where the . . . represents the traversed codon sequences in the codon sequence set and corresponding matching values.
TABLE-US-00005 TABLE1 seq score SEQIDNO: XXTTGGGTCTXX SEQIDNO:64 TTTTCGGTCTCT 82.4 SEQIDNO:65 ATTTTGGTCGAG 76.2 SEQIDNO:66 ACTTTGGTCAAT 76.2 SEQIDNO:67 GGTTCGGTCCAG 76.2 SEQIDNO:68 TTTTCGGTCAGT 76.2 SEQIDNO:69 ACTGGGGTCGTT 76.2 SEQIDNO:70 TATGGGGTCCAG 76.2 SEQIDNO:71 ... ... XTTGGGTCT GATGGGTCT 82 GATGGGTCG 76.2 GATGGGTCC 76.2 GATGGGTCA 76.2 ... ... TTGGGTCTX TTGGGTCAT 93.8 TTAGGTCAT 82 CTGGGTCAT 76.2 ... ... XXTCTGGGTTXX SEQIDNO:72 ATTCTGGGTCAT 82 SEQIDNO:73 ACTCTGGGTATG 82 SEQIDNO:74 ACGCTGGGTATG 76.2 SEQIDNO:75 ATCCTGGGTCAT 76.2 SEQIDNO:76 ACCCTGGGTATG 76.2 SEQIDNO:77 ATACTGGGTCAT 76.2 SEQIDNO:78 ACACTGGGTATG 76.2 SEQIDNO:79 ... ... XTCTGGGTT ATCTTGGTT 82 TTCTCGGTT 82 GGCTCGGTT 76.2 ACCTTGGTT 76.2 ... ... TCTGGGTTX TCTGCGTTG 82 GCTGGGATT 76.2 CCTGTGTTG 76.2 ACTGGGGTT 76.2 ... ...
[0470] iv) The target codon sequence was obtained according to the calculation results of matching values in step (3), wherein the coding region sequence containing the target codon sequence was the target coding region sequence.
Example 3: In Vitro Synthesis of Circular mRNA Encoding eGFP
[0471] This example provides a method for preparing a circular mRNA capable of expressing eGFP by the coding region sequence of eGFP containing ribozyme recognition site screened by the present disclosure.
(1) Screening of eGFP Gene Truncation Site and Plasmid Construction
[0472] DGS, the amino acid unit to be optimized obtained by the method provided in Example 1-2, was codon-optimized to GAT GGA TCA (ribozyme recognition site sequence) and truncated by TC (effective base pair) to form a structure in the form of T4td intron fragment II-eGFP truncated fragment II-ev29-eGFP truncated fragment I-T4td intron fragment I, and the amino acids and nucleotide sequences involved in this example were shown in Table 2 below.
TABLE-US-00006 TABLE 2 SEQ ID NO: eGFP protein sequence: SEQ ID NO: 3 Intron fragment II SEQ ID NO: 4 Intron fragment I SEQ ID NO: 5 Ev29 sequence SEQ ID NO: 10 Untruncated eGFP sequence SEQ ID NO: 11 eGFP truncated fragment I sequence SEQ ID NO: 12 eGFP truncated fragment II sequence SEQ ID NO: 13
[0473] Plasmid synthesis and cloning under this architecture was commissioned to Suzhou GENEWIZ, from Azenta Life Sciences Suzhou, China. The resultant gene fragment was ligated to pUC57 vector. The resultant plasmid was as follows: pUC57-EV29-eGFP (SEQ ID NO: 14).
(2) Preparation of Linear Plasmid Template
1) Plasmid Extraction
[0474] i) The stab cultured bacteria custom-synthesized were activated under conditions of 37 C./220 rpm/3-4 h.
[0475] ii) The activated bacterial solution was taken for amplification culture under culture conditions of 37 C./220 rpm/overnight.
[0476] iii) The plasmids were extracted (with TIANGEN EndoFree Mini Plasmid Kit II), and then the OD value thereof was measured.
2) Plasmid Enzyme Digestion
[0477] The plasmid prepared in the above step 1) was digested by Xbal single enzyme digestion method, and the digestion system was shown in the following table:
TABLE-US-00007 TABLE 3 Reagent Volume Plasmid 10 g Enzyme (1000 units) 5 L 10 cutsmart buffer 50 L Nuclease free, H.sub.2O Total 500 L
[0478] Enzyme digestion was carried out at 37 C. overnight. The enzyme digestion products were recovered by universal DNA gel recovery kit (Universal DNA Purification Kit, TIANGEN BIOTECH CO., LTD.), and then the OD value thereof was measured. After that, the restriction enzyme products were identified by 1% agarose gel electrophoresis. The purified linear plasmid template was used for in vitro transcription.
(3) In Vitro Transcription for Preparing Linear mRNA
1) In Vitro Transcription
[0479] mRNA was synthesized by T7 in vitro transcription kit (APExBIO T7 High Yield RNA Synthesis Kit), and the transcription system was shown in the following table.
TABLE-US-00008 TABLE 4 Reagent Volume 10 Reaction Buffer 2 L ATP (20 mM) 2 L CTP (20 mM) 2 L IKA (20 mM) 2 L GTP (20 mM) 2 L Linearized DNA template 1 g T7 RNA Polymerase Mix 2 L RNA Nuclease free, H.sub.2O Total 20 L
[0480] The resultant was incubated at 37 C. for 2.5 h. Then, the entire product was incubated for 15 min at 37 C. to digesting the linearized DNA template by DNase I.
2) Purification of Linear mRNA
[0481] The transcript obtained from step 1) above was purified by silica-based membrane technology in the form of a spin column (Thermo, Gene Jet RNA Purification Kit), and then the OD value thereof was measured. Further, the RNA size was identified by 1% denaturing agarose gel electrophoresis.
3) Purification of Linear mRNA
[0482] The transcript obtained from the above step 1) was purified by silica-based membrane technology in the form of a spin column (Thermo, Gene Jet RNA Purification Kit), and then the OD value thereof was measured. Further, the RNA size was identified by 1% denaturing agarose gel electrophoresis.
[0483] The method for preparing 1% denaturing agarose gel includes:
[0484] 1) 1 g of agarose was weighed into 72 mL of nuclease-free H.sub.2O and heated until
[0485] dissolved in a microwave oven.
[0486] 2) After the above agarose was cooled to 55-60 C., 0.1% gel red, 10 mL of 10MOPS, and 18 mL of formaldehyde were added therein in the fume hood. Then, pouring gel was carried out.
[0487] 3) The procedure of denaturing agarose gel electrophoresis includes: the sample RNA and 2 Loading buffer were taken in equal volume, and denaturated at 65-70 C. for 5 to 10 min. The sample was loaded and electrophoresed at 100 V/30 min, and then photographed by gel imaging system.
(4) Circularization of mRNA
1) Circularization Reagent
[0488] GTP Buffer: 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, about pH 7.5.
2) Circularization System and Conditions
TABLE-US-00009 TABLE 5 Solution Volume mRNA 25 g mRNA GTP solution (20 mM) 50 L GTP buffer up to 500 L
[0489] The above solution was heated at 55 C. for 15 min and then placed on ice, the circularized RNA products were purified by silica-based membrane technology in the form of a spin column (Thermo, Gene Jet RNA Purification Kit), and then the OD value thereof was measured. Further, the RNA size was identified by 1% denaturing agarose gel electrophoresis.
3) Identification of Circular RNA by 1% Denaturing Agarose Gel
[0490] Reagent preparation: 1 g agarose powder was added into 72 mL of nuclease-free water and heated until dissolved, then 10 mL of 10 MOPS buffer solution was added. Then 18 mL of fresh 37% formaldehyde was added in the fume hood and mixed thoroughly, and the gel was poured into the tank.
[0491] mRNA detection: About 500 ng of mRNA solution was taken for mixing with 2RNA loading buffer in equal volume, followed by heating at 65 C. for 5 min. Further, agarose gel detection was carried out.
Experimental Results
TABLE-US-00010 TABLE 6 ENZYME TRANSCRIP- DNASEI PLASMID-1 CUT TION DIGEST CIRCULIZATION Con. Con. Con. Con. Con. (ng/L) Vol. (ng/L) Vol. (ng/L) Vol. (ng/L) Vol. (ng/L) Vol. Classic PIE 313 105 L 162.2 50 L 2372 70 L 2007.5 55 L 248 35 L EGFP (Clean 329 105 L 128.8 50 L 3992 70 L 1725.3 55 L 269.2 35 L PIE) of the present disclosure
[0492] classic
[0493] The above results showed that compared with the classic PIE system, the circularization process and technology of preparing circular RNAs using the Clean PIE system in the present disclosure involved no additional changes, showing obvious circularization effect. The circularization efficiency using the Clean PIE system was found similar to that using the classic PIE system through agarose gel electrophoresis, with no obvious difference found.
Example 4: Verification of In Vitro Expression of Circular mRNAs Synthesized In Vitro by the Method of the Present Disclosure
[0494] In this example, the circular mRNAs prepared in Example 3 were delivered into 293T cells, and the expression in 293T cells of the circular mRNAs synthesized in vitro by the present method was detected, with the following specific process:
(1) Cell Culture
[0495] 293T cells were inoculated into DMEM high-sugar medium containing 10% fetal bovine serum and 1% penicillin-streptomycin solution, and cultured in an incubator containing 5% CO.sub.2 at 37 C. Cells were subcultured every 2 to 3 days.
(2) Cell Transfection
[0496] Before transfection, 293T cells were inoculated into a 24-well plate with 110.sup.5 cells/well, and cultured in an incubator containing 5% CO.sub.2 at 37 C. After the cells reached 70-90% confluence, mRNAs were transfected into 293T cells by Lipofectamine
[0497] MessengerMax (Invitrogen) transfection reagent at 500 ng/well, according to the following specific process:
[0498] 1) Messenger MAX Reagent was diluted with a dilution ratio shown in the following table.
TABLE-US-00011 TABLE 7 Reagent Volume/well MEM serum-free medium 25 L MessengerMAX Reagent 0.75 L
[0499] After diluting and mixing, the solution was allowed to stand at room temperature for incubating for 10 min.
[0500] 2) mRNAs were diluted with a dilution ratio shown in the following table:
TABLE-US-00012 TABLE 8 Reagent Volume/well mRNA 1 g MEM serum-free medium up to 25 L
[0501] 3) The mixed and diluted Messenger MAX Reagent and mRNA (1:1) as shown in the following table was taken.
TABLE-US-00013 TABLE 9 Reagent Volume/well Diluted MessengerMAX Reagent 25 L Diluted mRNA 25 L
[0502] After diluting and mixing, the solution was allowed to stand at room temperature for incubating for 5 min.
[0503] 4) 50 L of the above mixture was taken up, and slowly added into a 24-well plate adhering to the wall, then incubated in an incubator containing 5% CO.sub.2 at 37 C.
(3) Protein Expression Detection
[0504] 1) Fluorescence observation of cells: 24 hours after transfection, the expression of EGFP was observed in 293T cells under a 200 fluorescence microscope.
[0505] 2) Detecting the average fluorescence intensity of cells by flow cytometry: the average fluorescence intensity of 293T cells 24 hours after transfection was detected by flow cytometry.
[0506]
[0507] The results in
Example 5: Application of Clean PIE System for Different Proteins
[0508] In this example, many circularization applications for a variety of other different proteins were prepared by the Clean PIE system. The coding region sequences involved in the present disclosure included spCas9, firefly Luciferase, IL12, and FLAG-con1-SPOP167-274, as follows:
[0509] 1) DGS, the amino acid unit to be optimized of spCas9 obtained by the method provided in Examples 1-2, was codon-optimized to GAT GGA TCA (ribozyme recognition site sequence) and truncated by TC (effective base pair) site to form a structure in the form of T4td intron fragment II-spCas9 truncated fragment II-ev29-spCas9 truncated fragment I-T4td intron fragment I;
[0510] 2) LRS, the amino acid unit to be optimized of firefly Luciferase obtained by the method provided in Examples 1-2, was codon-optimized to CTT AGG TCT (ribozyme recognition site sequence) and truncated by TC (effective base pair) site to form a structure in the form of T4td intron fragment II-fLUC truncated fragment II-ev29-fLUC truncated fragment I-T4td intron fragment I;
[0511] 3) LGS, the amino acid unit to be optimized of IL12 obtained by the method provided in Examples 1-2, was codon-optimized to CTT GGG TCT (ribozyme recognition site sequence) and truncated by TC (effective base pair) site to form a structure in the form of T4td intron fragment II-IL12 truncated fragment II-ev29-IL 12 truncated fragment I-T4td intron fragment I; 4) LGP, the amino acid unit to be optimized of FLAG-con1-SPOP167-274 obtained by
[0512] the method provided in Examples 1-2, was codon-optimized to TTG GGT CCT (ribozyme recognition site sequence) and truncated by TC (effective base pair) site to form a structure in the form of T4td intron fragment II-FLAG-con1-SPOP167-274 truncated fragment II-ev29-FLAG-con1-SPOP167-274S truncated fragment I-T4td intron fragment I.
[0513] Circular mRNAs expressing spCas9, firefly Luciferase, IL12 and
[0514] FLAG-con1-SPOP167-274 were prepared, respectively, by the experimental method in Example 3, and the sequences involved in this example were shown in the following table.
TABLE-US-00014 TABLE 10 SEQ ID NO: spCas9 truncated fragment I SEQ ID NO: 15 spCas9 truncated fragment II SEQ ID NO: 16 fLUC truncated fragment I SEQ ID NO: 17 fLUC truncated fragment II SEQ ID NO: 18 IL12 truncated fragment I SEQ ID NO: 19 IL12 truncated fragment II SEQ ID NO: 20 FLAG-con1-SPOP167-274 truncated SEQ ID NO: 21 fragment I FLAG-con1-SPOP167-274 truncated SEQ ID NO: 22 fragment II
[0515]
Example 6: Analysis of Applicability of Clean PIE System
[0516] In this example, the availability of the Clean PIE system of the present disclosure in the genes of Escherichia coli genome was verified and analyzed by way of bioinformatics. The results indicated that the method of searching for the target circularization sequence (the sequence containing ribozyme recognition site) by the present disclosure has universal applicability.
[0517] By taking T4td PIE system as an example: bioinformatics evaluation of genes over 1000 bp and 500 bp in the genome sequence of Escherichia coli was performed to screen the effective circularization sequences (score >70).
[0518]
[0519] By placing the genes of Escherichia coli genome over 1000 bp and 500 bp into the screening system, and performing evaluation using the matching value calculation module, it was found that the probability of finding the target circularization sequence with a score of 82 or more in the genes over 500 bp reached 100%. In addition, this probability can be further improved by combining E1E2 sequences of different Group I introns for the coding gene. That is, the most suitable intron and its corresponding E1E2 sequence were screened by the matching value calculation module as the circularization site (ribozyme recognition site) of circular mRNA.
Example 7: RNaseR Validation of Circularization
[0520] In this example, the feasibility of the circularization method of the present disclosure was verified by digesting linear and circular mRNAs. Specifically, as compared with linear RNAs, circular RNAs have better tolerance to RNaseR, thus the sequence circularization can be verified by comparing the tolerance to RNaseR of linear mRNAs and circular mRNAs circularized by Clean PIE.
[0521] On the basis of Example 3, the linear and circular mRNAs derived from classic PIE system and Clean PIE system, respectively, were digested by RNase, which was purchased from MClab with ITEM NO. RNASR-100, with the RNaseR digestion system as follows:
TABLE-US-00015 TABLE 11 mRNA 1 g RNase R 1U 10 Reaction buffer 2 L H.sub.2O Up to 20 L
[0522] Incubation was carried out at 37 C. for 5 min, and then inactivation was carried out by incubating at 70 C. for 5 min.
[0523]
Example 8: Verification of Clean PIE System Circularization Method by Capillary Electrophoresis
[0524] In this example, the prepared circular mRNAs were detected by capillary electrophoresis.
[0525] The concentration of crude products of circular RNA obtained by circularization in Example 7 were measured by micro-spectrophotometry (Nano-Drop Technologies, Thermo). Then, the crude products were treated by RNA 6000 Assay Kit (Agilent 5067-1511), detected and analyzed by Agilent 2100 automated nucleic acid analyzer. The procedures for the kit and ananyzer can be found in Agilent's official website.
[0526]
[0527] By capillary electrophoresis, the circularized RNA showed single peak, and had two intron peaks at nt-218 and nt-243, and one intron dimer peak at nt-349. The total circular mRNAs accounted for 89.6% (before purification), further indicating that the method of the present disclosure can effectively realize the circularization of circular messenger ribonucleotides.
Example 9: Verification of Sequence Integrity and Sequence Accuracy at Circularization Site (Ribozyme Recognition Site)
[0528] In this example, the sequence integrity and accuracy at the circularization site of the circular mRNA circularized by the circularization method of the invention were identified by sequencing after reverse transcription. The primer sequences used in this example were as follows:
TABLE-US-00016 Fluc-R: (SEQIDNO:23) TACTTGTCGATCAGGGTGCT Fluc-F: (SEQIDNO:24) TGGACAGCAAGACCGACTAC IL12-R: (SEQIDNO:25) CTGCATCAGCTCGTCGATGG IL12-F: (SEQIDNO:26) TACTACAACAGCAGCTGCAGCA
[0529] Each of the linear and circular mRNAs of firefly Luciferase (Fluc) and IL12 in Example 5 was reverse transcribed into a first strand cDNA by the reverse transcription kit of Takara Company (RR037B, Takara). By using cDNA as a template, PCR amplification was carried out with specific primers to obtain amplified fragments. The sequence of the actually synthesized circular mRNA was compared with that of the designed circular mRNA by sequencing.
[0530]
[0531] The experimental results showed that the specific amplification band was not present in linear mRNA group but appeared in circular mRNA group. The specific band was excised from the gel. The cDNA was recovered from the gel, and then subjected to Sanger sequencing after purification. The sequencing results showed that the PCR band was consistent with the expected band, and there was no additional base insertion or deletion near the circularization site. This demonstrated that Luciferase and IL12 have been accurately circularized.
Example 10: Analysis and Verification of Expression of Uncircularized Linear Part
[0532] This example verified that the linear RNAs produced by the Clean PIE system of the present disclosure cannot express any protein, indicating that the linear mRNAs in the present disclosure cannot produce any nonspecific translated protein before circularization.
[0533] In this example, according to the method of Example 5, the linear and circular mRNAs of FLAG-con1-SPOP in the classic PIE system as well as the linear and circular mRNAs in the Clean PIE system were transfected into 293T cells. After 24 hours, the cells were collected, lysed, and subjected to western blotting detection. Due to the presence of FLAG label after the promoter, the expressed protein can be detected by an anti-FLAG antibody.
[0534]
[0535] Under the classic PIE framework, the uncircularized mRNA can still be expressed,
[0536] while under the Clean PIE framework, no expression products of uncircularized mRNAs appeared. Circularized circular RNAs from different circularization systems can be expressed, and the difference in expression level of circular mRNAs from different systems is due to different elements in the systems. This example demonstrated that the Clean PIE system of the present disclosure has a high biological safety for preparing circular mRNAs.
Example 11: Translational Regulatory Elements Enhance Expression of Circular mRNAs Through Clean PIE Circularization
[0537] In this embodiment, an insertion element, specifically, a translational regulatory element, was inserted into the Clean PIE circularization system provided in Example 3, which was ligated to the 5 end of ev29. By adding a translational regulatory element, the expression of circular mRNAs produced by the circularization methods of the present disclosure can be enhanced. And the optimal polyAC length that is favorable to the expression of the encoded protein is obtained through screening.
[0538] The Clean PIE circularization system ligating translation regulatory element comprises structure as shown below:
[0539] T4td intron fragment II-eGFP truncated fragment II-translational regulatory element (PolyAC)-ev29-eGFP truncated fragment I-T4td intron fragment I.
[0540] Wherein, the nucleotide sequence of PolyAC is as shown in SEQ ID NO:1, and the circularized sequence after adding PolyAC is as shown in SEQ ID NO:2.
[0541] Circular mRNAs were prepared with the linear eGFP messenger ribonucleotide with translational regulatory expression element, according to the method of Example 3. Then, the circular mRNAs were transfected into 293T cells and the expression of eGFP was measured by flow cytometry, according to the method of Example 4.
[0542]
[0543] As the number of inserted translational regulatory elements increases, the expression level of eGFP encoded by circular mRNAs can be significantly increased to some extent. Wherein, adding 6 polyAC achieved the greatest improvement in expression efficiency, while further increasing the length did not significantly improve the expression of the encoded protein (data for 10 polyAC).
Example 12: Regulation of the Tissue-Specific Expression of Circular mRNAs Through Clean PIE Circularization by Translational Regulatory Elements
[0544] In this example, an insertion element, specifically, a translational regulatory element for regulating specific expression of circular mRNA in organs, was ligated to the Clean PIE circularization system at the 5 end of the IRES element. The Clean PIE system included the following structure, and each element sequence thereof can be referred to Examples 3-5:
[0545] T4td intron fragment II-LUC truncated fragment II-translational regulatory element-ev29-LUC truncated fragment I-T4td intron fragment I.
[0546] Circular mRNAs as follows were prepared according to the methods of Examples 3 to 4: EV29-LUC-3UTR (sequence set forth in SEQ ID NO: 56), EV29-LUC+1miR-122 (sequence set forth in SEQ ID NO: 57), and EV29-LUC+3miR-122 (sequence set forth in SEQ ID NO:58), each was encapsulated in the DLin-MC3-DMA LNP delivery system and prepared by a microfluidic device, to allow the mRNA active components in the aqueous phase to fully mix with four lipids in the organic phase to form a nano-sized circular mRNA-lipid nanoparticle complex with a high encapsulation efficiency. The specific procedure was as follows:
[0547] (1) diluting the circular mRNA stock solution to 0.4 mg/mL with citric acid solution at pH 4.0, then weighing four lipids and dissolving them in ethanol solution to give a total lipid concentration of 24.4 mg/mL;
[0548] (2) mixing the two phases quickly using a microfluidic device, with a total flow rate of 12 mL/min, aqueous phase (circular mRNA)/organic phase (lipid) (v/v)=3:1;
[0549] (3) After the preparation completed, removing ethanol by dialysis or tangential flow, and meanwhile replacing the solution with PBS solution at pH 7.4, to obtain the circular mRNA-lipid nanoparticle complex;
[0550] (4) detecting the particle size and polydispersity coefficient (PDI) of the circular mRNA-lipid nanoparticle complex by dynamic light scattering (DLS), and detecting the encapsulation efficiency of circular mRNAs in the complex by Ribogreen.
[0551] The mice were administered by tail vein injection, and the expression of Luciferase in mice was determined after 6 hours. Specifically, mice immunized with pUC-EV29-LUC, pUC-EV29-LUC+1miR-122, and pUC-EV29-LUC+3miR-122 respectively were intraperitoneally injected with 0.3 mL of luciferase substrate VivoGlo luciferin (In vivo Grade, Promega), and imaged after 8 minutes to observe in vivo distribution and fluorescence intensity of expression.
[0552]
[0553] The luciferase in control group (EV29-luc-3UTR) mice was mainly expressed at intramuscular injection site and in liver. The circular mRNA (EV29-LUC-+1miR-122) with a single acting site of miR-122 was mainly expressed at the tail vein injection site, and a small expression level in liver was found in individual mice, whereas the circular mRNA (EV29-LUC+3miR-122) in which three acting sites of miR-122 were added was only expressed at the intramuscular injection site, without detection of any expression in liver.
[0554] Therefore, the introduction of miR-122 binding site as a translational regulatory element in the Clean PIE system of the present disclosure can effectively avoid the expression of circular mRNAs in liver, and the more the introduced miR-122 sites, the more significant the inhibitory effects on expression in liver.
Example 13: Role of Translational Regulatory Elements in Purification of Circular mRNA
[0555] In this example, an aptamer was added to the translational regulatory element to purify the circular mRNA. Specifically, as described in the literature (Leppek K, Stoecklin G. An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins [J]. Nucleic Acids Research, 2014, 42 (2): e13-e13.), four SIm aptamer sequences were added to the translational regulatory elements of the Clean PIE system of the present disclosure, and circularization was carried out according to the method of Example 3. The structure was shown below:
[0556] T4td intron fragment II-eGFP truncated fragment II-translational regulatory element (with Slm aptamer added)-ev29-eGFP truncated fragment I-T4td intron fragment I; Slm sequence (SEQ ID NO: 37):
TABLE-US-00017 AUGCGGCCGCCGACCAGAAUCAUGCAAGUGCGUAAGAUAGUCGCGGGUCGG CGGCCGCAU;
[0557] The circularized circRNA was shown in SEQ ID NO: 59.
[0558] In a LoBind tube (Eppendorf) centrifuge tube, Wash Buffer (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1.5 mM MgCl2, 2 mM DTT, 2 mM vanadylribonucleosid complex RNase inhibitor (NEB), 1 tablet/10 ml Mini Complete Protease Inhibitors, EDTA-free (Roche)) was used to clean Streptavidin Sepharose High Performance (GEHealthcare) agarose gel beads. 30 g of crude products of circular RNAs (Input) were incubated at 37 C. for 10 minutes, then rotary mixed with 100 ul agarose gel magnetic beads as well as 3 uL RNase inhibitors and incubated at 4 C. for 2-3 hours, centrifuged, unbound, and incubated continually at 4 C. for 1 hour in 50 ul of lysis buffer added with 10 mM biotin, and centrifuged to obtain the supernatant as the purified products (biotin elution).
[0559]
Example 14: Detection of Immunogenicity of Circularized eGFP
[0560] In this example, the expression of corresponding immune factors in A549 cells induced by circular mRNAs was detected, where the circular mRNAs were prepared by Anabaena PIE system and the Clean PIE system of the present disclosure as follows.
[0561] As provided in Example 3, circular mRNAs prepared by circularization of Anabaena PIE system and the Clean PIE system of the present disclosure were digested by RNaseR and purified by HPLC. Then, the purified circular mRNAs were transfected into A549 cells by Lipofectamine Messenger Max (Invitrogen), with the following specific operation procedure.
[0562] A549 cells were inoculated into DMEM high-sugar medium containing 10% fetal bovine serum and 1% penicillin-streptomycin solution and cultured in an incubator containing 5% CO2 at 37 C. Cells were subcultured every 2 to 3 days.
(1) Cell Transfection
[0563] Before transfection, A549 cells were inoculated into a 24-well plate with 110.sup.5 cells/well, and cultured in an incubator containing 5% CO.sub.2 at 37 C. When the cells reached 70-90% confluence, mRNAs were transfected into A549 cells by Lipofectamine MessengerMax (Invitrogen) transfection reagent at 500 ng/well, with the following specific operations.
[0564] 1) Messenger MAX Reagent was diluted according to a dilution system shown in the following table.
TABLE-US-00018 TABLE 12 Reagent Volume/well MEM serum-free medium 25 L Messenger MAX Reagent 0.75 L
[0565] After diluting and mixing, the solution was allowed to stand at room temperature for incubating for 10 min.
[0566] 2) mRNAs were diluted according to a dilution system shown in the following table.
TABLE-US-00019 TABLE 13 Reagent Volume/well mRNA 1 g MEM serum-free medium up to 25 L
[0567] 3) The mixed and diluted Messenger MAX Reagent and mRNA (1:1) was taken.
TABLE-US-00020 TABLE 14 Reagent Volume/well Diluted Messenger MAX 25 L Reagent Diluted mRNA 25 L
[0568] After diluting and mixing, the solution was allowed to stand at room temperature for incubating for 5 min.
[0569] (2) 50 L of the above mixture was taken up, and slowly add into a 24-well plate adhering to the wall, and then incubated in an incubator containing 5% CO.sub.2 at 37 C.
[0570] (3) Lysing on the cells after 8 hours of expression was performed, and the expression level of immune response protein was verified by fluorescence quantitative PCR.
[0571] The primer sequences used by fluorescence quantitative PCR were as follows:
TABLE-US-00021 IFNb-F: (SEQIDNO:42) TGGGAGGATTCTGCATTACC IFNb-R: (SEQIDNO:43) CAGCATCGCTGGTTGAGA RIG-1-F: (SEQIDNO:44) CTCCCGGCACAGAAGTGTAT RIG-1-R: (SEQIDNO:45) CTTCCTCTGCCTCTGGTTTG IFNa-F: (SEQIDNO:46) CCATCTCTGTCCTCCATGAG IFNa-R: (SEQIDNO:47) ATTTCTGCTCTGACAACCTC PKR-F: (SEQIDNO:48) TGCAAAATGGGACAGAAAGA PKR-R: (SEQIDNO:49) TGATTCAGAAGCGAGTGTGC MDA5-F: (SEQIDNO:50) ACCAAATACAGGAGCCATGC MDA5-R: (SEQIDNO:51) GCGATTTCCTTCTTTTGCAG TNFa-F: (SEQIDNO:52) CGTCTCCTACCAGACCAAGG TNFa-R: (SEQIDNO:53) CCAAAGTAGACCTGCCCAGA IL-6-F: (SEQIDNO:54) TACCCCCAGGAGAAGATTCC IL-6-R: (SEQIDNO:55) GCCATCTTTGGAAGGTTCAG
[0572] The circular mRNA sequences prepared by two kinds of PIE systems were shown in the following table.
TABLE-US-00022 TABLE 15 SEQ ID NO: Circular mRNA sequence expressing SEQ ID NO: 38 eGFP after circularization by Clean PIE system of the present disclosure Circular mRNA sequence expressing SEQ ID NO: 39 eGFP after circularization by Anabaena PIE system
[0573]
[0574] After ana-PIE underwent detestation by RNase R and purification by HPLC, although INF- might still lead to immune response, there was a significantly decreased immune response in the circular mRNAs prepared by the circularization system of the present disclosure compared to that by ana-PIE, proving that the circular mRNA with more accurate sequence can reduce the induction of immunogenicity.
Example 15: No Effect on In Vitro Circularization for Circular mRNAs With Deletion of Homology Arms
[0575] In this example, the effect of adding homology arms to the Clean PIE system of the present disclosure on the circularization efficiency was detected. Specifically, DGS, the amino acid unit to be optimized obtained by the method provided in Examples 1 to 2, was codon-optimized to GAT GGA TCA (ribozyme recognition site sequence) and truncated by TC (effective base pair) to form a structure in the form of T4td intron fragment II-eGFP truncated fragment II-ev29-eGFP truncated fragment I-T4td intron fragment I, while intron sequences with or without homology arms were constructed with the specific structures as follows.
[0576] Sequence information involved in this example was shown in the following table.
TABLE-US-00023 TABLE 16 SEQ ID NO: eGFP protein sequence: SEQ ID NO: 3 Intron fragment II SEQ ID NO: 4 (with homology arms) Intron fragment I SEQ ID NO: 5 (with homology arms) Intron fragment II SEQ ID NO: 6 (without homology arms) Intron fragment I SEQ ID NO: 7 (with homology arms) Ev29 sequence SEQ ID NO: 10
[0577] The two constructs were transcribed and circularized by the experimental method of Example 3 to obtain their circular mRNAs. The circularization results were detected by denaturing agarose gel electrophoresis.
[0578] Regardless of whether homology arms were included or not in the present Clean PIE system framework, circular mRNAs can realize effective circularization. This result demonstrated that homology arms can be omitted in the circularization system of the present disclosure. The reason for this is that under the frame of the present disclosure, the circularization site (ribozyme recognition site) always divided the coding gene into two parts, and the coding fragment usually did not have a very complicated secondary structure, such benign sequence separated the promoter element from the self-splicing intron sequence, thus forming a unique secondary structure, which was more conducive to the correct folding and approach of intron sequences. As a result, an effective circularization can be achieved without homology arms under the frame of the present disclosure.
Example 16: Validation of Circularization at Circularization Sites With Different Scores
[0579] This example compared the circularization efficiency of circularization sites (ribozyme recognition sites) with different scores and at different positions in the same protein sequence (IL12 human) obtained by the screening system.
[0580] Specifically, DRVF (866, score 93.8), IWS (377, score88), SGS (1021, score 88), GGS (1285, score88) and LGS (211, score 100), the amino acid units to be optimized obtained by the method provided in Examples 1 to 2, were respectively codon-optimized to the ribozyme recognition site sequences as follows: GAT CGG GTC TTT, ATT TGG TCT, TCT GGG TCT, GGT GGG TCT, and CTT GGG TCT, and truncated by TC site to form the following structure: [0581] T4td intron fragment II-IL12 human truncated fragment II-ev29-IL 12 human truncated fragment I-T4td intron fragment I.
TABLE-US-00024 TABLE 17 SEQ ID NO: IL12 (human, 866 score 93.8) SEQ ID NO: 27 truncated fragment II IL12 (human, 866 score 93.8) SEQ ID NO: 28 truncated fragment I IL12 (human, 377 score 88) SEQ ID NO: 29 truncated fragment II IL12 (human, 377 score 88) SEQ ID NO: 30 truncated fragment I IL12 (human, 1021 score 88) SEQ ID NO: 31 truncated fragment II IL12 (human, 1021 score 88) SEQ ID NO: 32 truncated fragment I IL12 (human, 1285 score 88) SEQ ID NO: 33 truncated fragment II IL12 (human, 1285 score 88) SEQ ID NO: 34 truncated fragment I IL12 (human, 211 score 100) SEQ ID NO: 35 truncated fragment II IL 12 (human, 211 score 100) SEQ ID NO: 36 truncated fragment I
[0582] The two constructs were transcribed and circularized by the experimental method of Example 3 to obtain their corresponding circular mRNAs. The structure shown in
[0583] IL 12human truncated at circularization sites with different scores can be circularized, but with different circularization efficiencies. The difference of circularization efficiency may be due to different secondary structures at different open-loop positions. Therefore, it may be deduced that a small score difference of circularization site cannot properly reflect the 10 circularization efficiency. Further evaluation is required in combination with the secondary structure in the sequence.
Example 17: Exploration of the Lowest Score Allowing for Circularization
[0584] In this embodiment, the lowest circularization score was determined by verifying circularization of truncated fragments with different scores.
[0585] Taking T4td as an example, by comparing the changed sequences at the circularization site (ribozyme recognition site) (TTGGGTCT), the circularization site sequence of eGFP sequence in Examples 6 and 7, was changed to the following base sequences with different scores for verifying circularization:
[0586] Score 100 (TTGGGTCT), score 94.2 (TCGGGTCT), score 82.4 (TAGGGTCT, ATGGGTCT), score 64.8 (AAGGGTCT, ATGGCTCT), score 47.2 (AACGGTCT, TTCATTCT), score 29.6 (AACGCTCT, AAACCGTCT, TACCCTCT).
[0587] Circularization verification was performed according to the method described in Example 7. To be specific, sequences with scores of 80 or more can be circularized with a circularization efficiency of 50% or more. In addition, the circularization test of sequences with scores of 47.2 and 64.8 showed that not all sequences can be circularized, and some sequences can be circularized but with low circularization efficiency. Further, it was difficult for the sequence with score 29.6 to circularize.
Example 18: Expression of Polypeptides Ligated in Tandem by Linker T2A
[0588] In this example, the coding regions of eGFP and firefly Luciferase were ligated in tandem by 2A peptide (T2A) encoded by a linker, and then the expression of those proteins were verified.
[0589] Specifically, according to the method of Example 3, a circular mRNA was constructed by using the Clean PIE system containing the following structure, and the circular mRNA capable of expressing eGFP and firefly Luciferase ligated in tandem by T2A was obtained.
[0590] Intron fragment II-eGFP truncated fragment II-EV29-Luciferase coding region-linker-eGFP truncated fragment I-intron fragment I, where the sequence of eGFP truncated fragment II-EV29-Luciferase coding region-linker-eGFP truncated fragment I was shown in SEQ ID NO: 40.
[0591] The obtained circular mRNAs were transfected into 293T cells by the method provided in Example 4, and the expression of eGFP and firefly Luciferase was detected by fluorescence microscope and Luciferase reporter assay kit (abcam).
[0592]
[0593] As verified by the fluorescence microscope and Luciferase Reporter Assay Kit, the expression of eGFP and Luciferase was normally expressed, proving that it was feasible to link coding regions in tandem by a linker (T2A). By this method, two or more proteins can be encoded on the same circular mRNA at the same time.
Example 19: Expression of Different Target Polypeptides Ligated in Tandem by IRES
[0594] In this example, the coding regions of eGFP and firefly Luciferase were ligated in tandem by IRES, and then the expression of those proteins were verified.
[0595] According to the method of Example 3, a circular mRNA was constructed by using the Clean PIE system containing the following structure, and the circular mRNA capable of expressing eGFP and firefly Luciferase ligated in tandem by IRES was obtained.
[0596] Intron truncated fragment II-EV29-Luciferase coding fragment II-eGFP region-IRES-eGFP truncated fragment I-intron fragment I, where the sequence of eGFP truncated fragment II-EV29-Luciferase coding region-IRES-eGFP truncated fragment I was shown in SEQ ID NO: 41.
[0597] The obtained circular mRNAs were transfected into 293T cells by the method provided in Example 4, and the expression of eGFP and firefly Luciferase was detected by fluorescence microscope and Luciferase reporter assay kit (abcam).
[0598]
[0599] eGFP and Luciferase were ligated in tandem in the same circular mRNA by different IRES, enabling an effective circularization. As verified by the fluorescent microscope and Luciferase Reporter Assay Kit, GFP and Luciferase were normally expressed, proving that it was feasible to express different coding regions ligated in tandem by IRES. By this method, two or more proteins can be encoded on the same circular mRNA at the same time.
[0600] The above examples of the present disclosure are only for clearly illustrating the present disclosure, and are not limitations on the embodiments of the present disclosure. For those of ordinary skill in the art to which the present disclosure belongs, other changes or variations can be made on the basis of the above description. It is not necessary and impossible to exhaust all the embodiments herein. Any modification, equivalent substitution, improvement, and the like made within the spirit and principle of the present disclosure should be included within the scope of the claims of the present disclosure.