GENETICALLY MODIFIED CLOSTRIDIUM BACTERIA, PREPARATION AND USES OF SAME

Abstract

The present invention relates to the genetic modification of bacteria of the genus Clostridium, typically solventogenic bacteria of the genus Clostridium, in particular bacteria possessing in the wild type a gene encoding an amphenicol-O-acetyltransferase. It thus relates to methods, tools and kits allowing such a genetic modification, in particular the removal or modification of a sequence encoding or controlling the transcription of an amphenicol-O-acetyltransferase, to the genetically modified bacteria obtained and to uses thereof, in particular for producing a solvent, preferably on an industrial scale.

Claims

1-15. (canceled)

16. A nucleic acid recognizing the catB gene of sequence SEQ ID NO: 18 or a sequence at least 70% identical thereto within the genome of a bacterium of the genus Clostridium.

17. The nucleic acid according to claim 16, characterized in that said nucleic acid is selected from an expression cassette, a vector, and a plasmid.

18. The nucleic acid according to claim 16, characterized in that the nucleic acid comprises a guide RNA (gRNA) and/or a modification template.

19. The nucleic acid according to claim 16, characterized in that the Clostridium bacterium is a bacterium capable of producing isopropanol in the wild type.

20. The nucleic acid according to claim 16, characterized in that the Clostridium bacterium is a C. beijerinckii bacterium whose subclade is selected from DSM 6423, LMG 7814, LMG 7815, NRRL B-593, NCCB 27006 and a subclade having at least 95% identity with strain DSM6423.

21. The nucleic acid according to claim 17, characterized in that it is the plasmid pCas9ind-ΔcatB of sequence SEQ ID NO: 21 or the plasmid pCas9ind-gRNA_catB of sequence SEQ ID NO: 38.

22. A process for transforming a bacterium of the genus Clostridium by means of a genetic modification tool, characterized in that it comprises a step of transforming the bacterium by introducing into said bacterium a nucleic acid according to claim 16.

23. The process according to claim 22, characterized in that the bacterium is transformed with a CRISPR tool using an enzyme responsible for cutting at least one strand of the target sequence encoding or controlling the transcription of an amphenicol-O-acetyltransferase.

24. The process according to claim 22, characterized in that the bacterium of the genus Clostridium is a C. beijerinckii subclade selected from DSM 6423, LMG 7814, LMG 7815, NRRL B-593, NCCB 27006, and a subclade exhibiting at least 95% identity to strain DSM 642, and in that the nucleic acid does not exhibit methylation at the motifs recognized by Dam- and Dcm-type methyltransferases.

25. The process according to claim 22, characterized in that the bacterium of the genus Clostridium is a C. beijerinckii DSM 6423 bacterium and in that the nucleic acid recognizes the catB gene of sequence SEQ ID NO: 18 or a sequence at least 70% identical thereto within the genome of C. beijerinckii DSM 6423.

26. A genetically modified bacterium of the genus Clostridium obtained by the process according to claim 22.

27. The genetically modified bacterium of the genus Clostridium obtained by the process according to claim 22, wherein the genetically modified bacterium is a Clostridium bacterium capable of producing isopropanol in the wild type.

28. A C. beijerinckii DSM6423 ΔcatB bacterium deposited under the number LMG P-31151.

29. A method for producing a solvent or a mixture of solvents comprising a step of using the genetically modified bacterium according to claim 27 to produce a solvent or a mixture of solvents.

30. The method according to claim 29, wherein the method is performed on an industrial scale.

31. A kit comprising (i) a nucleic acid according to claim 17 and (ii) at least one tool selected from the elements of a genetic modification tool; a nucleic acid as gRNA; a nucleic acid as repair template; at least one primer pair; and an inducer allowing the expression of a protein encoded by said tool.

32. A method for producing a solvent or a mixture of solvents comprising a step of using the C. beijerinckii DSM6423 ΔcatB bacterium deposited under the number LMG P-31151 according to claim 28 to produce a solvent or mixture of solvents.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0143] FIG. 1 shows the Classification of 30 solventogenic Clostridium strains, from Poehlein et al., 2017. Note that the subclade C. beijerinckii NRRL B-593 is also identified in the literature as C. beijerinckii DSM 6423.

[0144] FIG. 2 shows the pCas9ind-ΔcatB plasmid map.

[0145] FIG. 3 shows the pCas9acr plasmid map.

[0146] FIG. 4 shows the pEC750S-uppHR plasmid map.

[0147] FIG. 5 shows the pEX-A2-gRNA-upp plasmid map.

[0148] FIG. 6 shows the pEC750S-Δupp plasmid map.

[0149] FIG. 7 shows the pEC750C-Δupp plasmid map.

[0150] FIG. 8 shows the pGRNA-pNF2 map.

[0151] FIG. 9 shows the PCR amplification of the catB gene in clones derived from the bacterial transformation of C. beijerinckii strain DSM 6423.

[0152] Amplification of about 1.5 kb if the strain still has the catB gene, or about 900 bp if this gene is deleted.

[0153] FIG. 10 shows the growth of C. beijerinckii strains DSM6423 WT and ΔcatB on 2YTG medium and 2YTG thiamphenicol selective medium.

[0154] FIG. 11 shows the induction of the CRISPR/Cas9.sub.acr system in transformants of C. beijerinckii strain DSM 6423 containing pCas9.sub.acr and a upp-targeting gRNA expression plasmid, with or without a repair template. Legend: Em, erythromycin; Tm, thiamphenicol; aTc, anhydrotetracycline; ND, not diluted.

[0155] FIG. 12A shows the modification of the upp locus of C. beijerinckii DSM 6423 via the CRISPR/Cas9 system. FIG. 12A represents the genetic organization of the upp locus: genes, gRNA target site and repair templates, associated with the corresponding homology regions on the genomic DNA. The primer hybridization sites for PCR verification (RH1010 and RH011) are also indicated.

[0156] FIG. 12B shows the modification of the upp locus of C. beijerinckii DSM 6423 via the CRISPR/Cas9 system. FIG. 12B shows the amplification of the upp locus using primers RH010 and RH011. An amplification of 1680 bp is expected in the case of a wild-type gene, compared to 1090 bp for a modified upp gene. M, 100 bp-3 kb size marker (Lonza); WT, wild-type strain.

[0157] FIG. 13 shows the PCR amplification verifying the presence of the plasmid pCas9.sub.ind. in C. beijerinckii strain 6423 ΔcatB.

[0158] FIG. 14 shows PCR amplification (≈900 bp) verifying the presence or not of the natural plasmid pNF2 before induction (positive control 1 and 2) and then after induction on medium containing aTc of the CRISPR-Cas9 system.

[0159] FIG. 15 shows the genetic tool for bacterial modification, adapted to bacteria of the genus Clostridium, based on the use of two plasmids (see WO2017/064439, Wasels et al., 2017).

[0160] FIG. 16 shows the pCas9ind-gRNA_catB plasmid map.

[0161] FIG. 17 shows the CRISPR/Cas9 system used for genome editing as a genetic tool to create one or more gRNA-directed double-stranded cut(s) in genomic DNA using the Cas9 nuclease.

[0162] gRNA, guide RNA; PAM, Protospacer Adjacent Motif. Figure modified from Jinek et al., 2012.

[0163] FIG. 18 shows the homologous recombination repair of a double-stranded break induced by Cas9. PAM, protospacer adjacent motif.

[0164] FIG. 19 shows the use of CRISPR/Cas9 in Clostridium.

[0165] ermB, erythromycin resistance gene; catP (SEQ ID NO: 70), thiamphenicol/chloramphenicol resistance gene; tetR, gene whose expression product represses transcription from Pcm-tetO2/1; Pcm-2tetO1 and Pcm-tetO2/1, anhydrotetracycline-inducible promoters, “aTc” (Dong et al., 2012); miniPthl, constitutive promoter (Dong et al., 2012).

[0166] FIG. 20 shows the pCas9acr plasmid map (SEQ ID NO: 23).

[0167] ermB, erythromycin resistance gene; rep, origin of replication in E. coli; repH, origin of replication in C. acetobutylicum; Tthl, thiolase terminator; miniPthl, constitutive promoter (Dong et al., 2012); Pcm-tetO2/1, promoter repressed by the product of tetR and inducible by anhydrotetracycline, “aTc” (Dong et al. 2012); Pbgal, a promoter repressed by the product of lacR and inducible by lactose (Hartman et al. 2011); acrIIA4, a gene encoding the anti-CRISPR protein AcrII14; bgaR, a gene whose expression product represses transcription from Pbgal.

[0168] FIG. 21 shows the relative transformation rates of C. acetobutylicum DSM 792 containing pCas9.sub.ind (SEQ ID NO: 22) or pCas9.sub.acr (SEQ ID N: 23). Frequencies are expressed as the number of transformants obtained per μg of DNA used in transformation, relative to the transformation frequencies of pEC750C (SEQ ID NO: 106), and represent the means of at least two independent experiments.

[0169] FIG. 22 shows the induction of the CRISPR/Cas9 system in DSM 792 strain transformants containing pCas9.sub.acr and a bdhB-targeting gRNA expression plasmid, with (SEQ ID NO: 79 and SEQ ID NO: 80) or without (SEQ ID NO: 105) repair template. Em, erythromycin; Tm, thiamphenicol; aTc, anhydrotetracycline; ND, not diluted.

[0170] FIG. 23A shows the modification of the bdh locus of C. acetobutylicum DSM792 via the CRISPR/Cas9 system. FIG. 23A shows the genetic organization of the bdh locus. Homologies between repair template and genomic DNA are highlighted with light gray parallelograms. The hybridization sites of primers V1 and V2 are also shown.

[0171] FIG. 23B shows the modification of the bdh locus of C. acetobutylicum DSM792 via the CRISPR/Cas9 system. FIG. 23B shows the amplification of the bdh locus using primers V1 and V2. M, 2-log size marker (NEB); P, pGRNA-ΔbdhAΔbdhB plasmid; WT, wild-type strain.

[0172] FIG. 24 shows the transformation efficiency (in observed colonies per μg of transformed DNA) for 20 μg of pCas9.sub.ind plasmid in C. beijerinckii strain DSM6423. Error bars represent the standard error of the mean for a biological triplicate.

[0173] FIG. 25 shows the NF3 plasmid map.

[0174] FIG. 26 shows the pEC751S plasmid map.

[0175] FIG. 27 shows the pNF3S plasmid map.

[0176] FIG. 28 shows the pNF3E plasmid map.

[0177] FIG. 29 shows the pNF3C plasmid map.

[0178] FIG. 30 shows the transformation efficiency (in observed colonies per μg of transformed DNA) of the plasmid pCas9ind in three strains of C. beijerinckii DSM 6423. Error bars are the standard deviation from the mean for a biological duplicate.

[0179] FIG. 31 shows the transformation efficiency (in observed colonies per μg of transformed DNA) of plasmid pEC750C in two strains derived from C. beijerinckii DSM 6423. Error bars are the standard deviation from the mean for a biological duplicate.

[0180] FIG. 32 shows the transformation efficiency (in observed colonies per μg of transformed DNA) of the plasmids pEC750C, pNF3C, pFW01, and pNF3E in C. beijerinckii strain IFP963 ΔcatB ΔpNF2. Error bars are the standard deviation of the mean for a biological triplicate.

[0181] FIG. 33 shows the transformation efficiency (in colonies observed per μg of transformed DNA) of the plasmids pFW01, pNF3E and pNF3S in C. beijerinckii strain NCIMB 8052.

EXAMPLES

Example No. 1

Materials and Methods

Culture Conditions

[0182] C. acetobutylicum DSM 792 was grown in 2YTG medium (Tryptone 16 g.Math.l.sup.−1, yeast extract 10 g.Math.l.sup.−1, glucose 5 g.Math.l.sup.−1, NaCl 4 g.Math.l.sup.−1). E. coli NEB10B was grown in LB medium (Tryptone 10 g.Math.l.sup.−1, yeast extract 5 g.Math.l.sup.−1, NaCl 5 g.Math.l.sup.−1). Solid media were made by adding 15 g.Math.l.sup.−1 of agarose to liquid media. Erythromycin (at concentrations of 40 or 500 mg.Math.l.sup.−1 in 2YTG or LB media, respectively), chloramphenicol (25 or 12.5 mg.Math.l.sup.−1 in solid or liquid LB media, respectively), and thiamphenicol (15 mg.Math.l.sup.−1 in 2YTG media) were used when necessary.

Handling of Nucleic Acids

[0183] All enzymes and kits were used according to the suppliers' recommendations.

Construction of Plasmids

[0184] The pCas9.sub.acr plasmid (SEQ ID NO: 23), shown in FIG. 20, was constructed by cloning the fragment (SEQ ID NO: 81) containing bgaR and acrIIA4 under the control of the Pbgal promoter synthesized by Eurofins Genomics at the SacI site of the pCas9.sub.ind vector (Wasels et al., 2017).

[0185] The pGRNA.sub.ind plasmid (SEQ ID NO: 82) was constructed by cloning an expression cassette (SEQ ID NO: 83) of a gRNA under the control of the Pcm-2tetO1 promoter (Dong et al., 2012) synthesized by Eurofins Genomics at the SacI site of the pEC750C vector (SEQ ID NO: 106) (Wasels et al., 2017).

[0186] The pGRNA-xylB (SEQ ID NO: 102), pGRNA-xylR (SEQ ID NO: 103), pGRNA-glcG (SEQ ID NO: 104) and pGRNA-bdhB (SEQ ID NO: 105) plasmids were constructed by cloning the respective primer pairs 5′-TCATGATTTCTCCATATTAGCTAG-3′ (SEQ ID NO: 84) and 5′-AAACCTAGCTAATATGGAGAAATC-3′ (SEQ ID NO: 85), 5′-TCATGTTACACTTGGAACAGGCGT-3′ (SEQ ID NO: 86) and 5′-AAACACGCCTGTTCCAAGTGTAAC-3′ (SEQ ID NO: 87), 5′-TCATTTCCGGCAGTAGGATCCCCA-3′ (SEQ ID NO: 88) and 5′-AAACTGGGGATCCTACTGCCGGAA-3′ (SEQ ID NO: 89), 5′-TCATGCTTATTACGACATAACACA-3′ (SEQ ID NO: 90) and 5′-AAACTGTGTTATGTCGTAATAAGC-3′ (SEQ ID NO: 91) within the BsaI-digested pGRNA.sub.ind plasmid (SEQ ID NO: 82).

[0187] The pGRNA-ΔbdhB plasmid (SEQ ID NO: 79) was constructed by cloning the DNA fragment obtained by overlapping PCR assembly of the PCR products obtained with primers 5′-ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3′ (SEQ ID NO: 92) and 5′-GGTTGATTTCAAATCTGTGTAAACCTACCG-3′ (SEQ ID NO: 93) on the one hand, 5′-ACACAGATTTGAAATCAACCACTTTAACCC-3′ (SEQ ID NO: 94) and 5′-ATGCATGTCGACTCTTAAGAACATGTATAAAGTATGG-3′ (SEQ ID NO: 95) on the other hand, in the pGRNA-bdhB vector digested by BamHI and SacI.

[0188] The pGRNA-ΔbdhAΔbdhB plasmid (SEQ ID NO: 80) was constructed by cloning the DNA fragment obtained by overlapping PCR assembly of the PCR products obtained with primers 5′-ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3′ (SEQ ID NO: 96) and 5′-GCTAAGTTTTAAATCTGTGTAAACCTACCG-3′ (SEQ ID NO: 97) on the one hand, 5′-ACACAGATTTAAAACTTAGCATACTTCTTACC-3′ (SEQ ID NO: 98) and 5′-ATGCATGTCGACCTTCTAATCTCCTCTACTATTTTAG-3′ (SEQ ID NO: 99) on the other hand, in the pGRNA-bdhB vector digested by BamHI and SacI.

Transformation

[0189] C. acetobutylicum DSM 792 was transformed according to the protocol described by Mermelstein et al., 1993. Selection of C. acetobutylicum DSM 792 transformants already containing a Cas9 expression plasmid (pCas9.sub.ind or pCas9.sub.acr) transformed with a plasmid containing a gRNA expression cassette was performed on solid 2YTG medium containing erythromycin (40 mg.Math.l.sup.−1), thiamphenicol (15 mg.Math.l.sup.−1) and lactose (40 nM).

Induction of Cas9 Expression

[0190] Induction of cas9 expression was performed via growth of the obtained transformants on solid 2YTG medium containing erythromycin (40 mg.Math.l.sup.−1), thiamphenicol (15 mg.Math.l.sup.−1) and the cas9 and gRNA expression inducing agent, aTc (1 mg.Math.l.sup.−1).

Amplification of the Bdh Locus

[0191] Genome editing of C. acetobutylicum DSM 792 at the bdhA and bdhB gene locus was controlled by PCR using the Q5 High-Fidelity DNA Polymerase enzyme (NEB) with primers V1 (5′-ACACATTGAAGGGAGCTTTT-3′, SEQ ID NO: 100) and V2 (5′-GGCAACAACATCAGGCCTTT-3′, SEQ ID NO: 101).

Results

Transformation Efficiency

[0192] To evaluate the impact of insertion of the acrIIA4 gene on the transformation frequency of the cas9 expression plasmid, different gRNA expression plasmids were transformed into the DSM 792 strain containing pCas9.sub.ind (SEQ ID NO: 22) or pCas9.sub.acr (SEQ ID NO: 23), and the transformants were selected on lactose-supplemented medium. The transformation frequencies obtained are presented in FIG. 21.

Generation of ΔbdhB and ΔbdhAΔbdhB Mutants

[0193] The targeting plasmid containing the gRNA expression cassette targeting bdhB (pGRNA-bdhB—SEQ ID NO: 105) as well as two derived plasmids containing repair templates allowing deletion of the bdhB gene alone (pGRNA-ΔbdhB—SEQ ID NO: 79) or the bdhA and bdhB genes (pGRNA-ΔbdhAΔbdhB—SEQ ID NO: 80) were transformed into the DSM 792 strain containing pCas9.sub.ind (SEQ ID NO: 22) or pCas9.sub.acr (SEQ ID NO: 23). The transformation frequencies obtained are presented in Table 2:

TABLE-US-00002 TABLE 2 DSM 792 pCas9.sub.ind pCas9.sub.acr pEC750C 32.6 ± 27.1 cfu .Math. μg.sup.−1 24.9 ± 27.8 cfu .Math. μg.sup.−1 pGRNA-bdhB 0 cfu .Math. μg.sup.−1 17.0 ± 10.7 cfu .Math. μg.sup.−1 pGRNA-ΔbdhB 0 cfu .Math. μg.sup.−1  13.3 ± 4.8 cfu .Math. μg.sup.−1 pGRNA-ΔbdhAΔbdhB 0 cfu .Math. μg.sup.−1 33.1 ± 13.4 cfu .Math. μg.sup.−1

[0194] Transformation frequencies of strain DSM 792 containing pCas9.sub.ind or pCas9.sub.acr with plasmids targeting bdhB. Frequencies are expressed as the number of transformants obtained per μg of DNA used in the transformation, and represent the averages of at least two independent experiments.

[0195] The transformants obtained underwent an induction phase of the expression of the CRISPR/Cas9 system via a passage on medium supplemented with anhydrotetracycline, aTc (FIG. 22).

[0196] The desired changes were confirmed by PCR on genomic DNA from two aTc-resistant colonies (FIG. 23).

Conclusions

[0197] The CRISPR/Cas9-based genetic tool described in Wasels et al. (2017) uses two plasmids:

[0198] the first plasmid, pCas9.sub.ind, contains cas9 under the control of an aTc-inducible promoter, and

[0199] the second plasmid, derived from pEC750C, contains the gRNA expression cassette (under the control of a second aTc-inducible promoter) and an editing template to repair the double-strand break induced by the system.

[0200] However, the inventors observed that some gRNAs still appeared to be too toxic, despite the control of their expression as well as that of Cas9 using aTc-inducible promoters, consequently limiting the efficiency of bacterial transformation by the genetic tool and thus the chromosome modification.

[0201] In order to improve this genetic tool, the cas9 expression plasmid was modified by inserting an anti-CRISPR gene, acrIIA4, under the control of a lactose inducible promoter. The transformation efficiencies of different gRNA expression plasmids were thus significantly improved, allowing transformants for all the plasmids tested to be obtained.

[0202] It was also possible to perform editing of the bdhB locus within the C. acetobutylicum DSM 792 genome, using plasmids that could not be introduced into the DSM 792 strain containing pCas9.sub.ind. The frequencies of modification observed were the same as those observed previously (Wasels et al., 2017), with 100% of the colonies tested modified.

[0203] In conclusion, the modification of the cas9 expression plasmid allows a better control of the Cas9-gRNA ribonucleoprotein complex, advantageously facilitating the obtaining of transformants in which the action of Cas9 can be triggered in order to obtain mutants of interest.

Example No. 2

Materials and Methods

Culture Conditions

[0204] C. beijerinckii DSM 6423 was grown in 2YTG medium (Tryptone 16 g.Math.L.sup.−1, yeast extract 10 g.Math.L.sup.−1, glucose 5 g.Math.L.sup.−1, NaCl 4 g.Math.L.sup.−1). E. coli NEB 10-beta and INV110 were grown in LB medium (Tryptone 10 g.Math.L.sup.−1, yeast extract 5 g.Math.L.sup.−1, NaCl 5 g.Math.L.sup.−1). Solid media were made by adding 15 g.Math.L.sup.−1 of agarose to liquid media. Erythromycin (at concentrations of 20 or 500 mg.Math.L.sup.−1 in 2YTG or LB media, respectively), chloramphenicol (25 or 12.5 mg.Math.L.sup.−1 in solid or liquid LB media, respectively), and thiamphenicol (15 mg.Math.L.sup.−1 in 2YTG media) or spectinomycin (at concentrations of 100 or 650 mg.Math.L.sup.−1 in LB or 2YTG media, respectively) were used if necessary.

Nucleic Acids and Plasmid Vectors

[0205] All enzymes and kits were used according to the suppliers' recommendations.

[0206] Colony PCR tests followed the following protocol:

[0207] An isolated colony of C. beijerinckii DSM 6423 is resuspended in 100 μL of 10 mM Tris pH 7.5, 5 mM EDTA. This solution is heated at 98° C. for 10 min without stirring. 0.5 of this bacterial lysate can then be used as a PCR template in 10 μL reactions with Phire (Thermo Scientific), Phusion (Thermo Scientific), Q5 (NEB) or KAPA2G Robust (Sigma-Aldrich) polymerase.

[0208] The list of primers used in all the constructs (name/DNA sequence) is detailed below:

TABLE-US-00003 ΔcatB_fwd: (SEQ ID NO: 1) TGTTATGGATTATAAGCGGCTCGAGGACGTCAAACCATGTTAATCATTGC ΔcatB_rev: (SEQ ID NO: 2) AATCTATCACTGATAGGGACTCGAGCAATTTCACCAAAGAATTCGCTAGC AcatB_gRNA rev: (SEQ ID NO: 41) AATCTATCACTGATAGGGACTCGAGGGGCAAAAGTGTAAAGACAAGCTTC RH076: (SEQ ID NO: 3) CATATAATAAAAGGAAACCTCTTGATCG RH077: (SEQ ID NO: 4) ATTGCCAGCCTAACACTTGG RH001: (SEQ ID NO: 5) ATCTCCATGGACGCGTGACGTCGACATAAGGTACCAGGAATTAGAGCAGC RH002: (SEQ ID NO: 6) TCTATCTCCAGCTCTAGACCATTATTATTCCTCCAAGTTTGCT RH003: (SEQ ID NO: 7) ATAATGGTCTAGAGCTGGAGATAGATTATTTGGTACTAAG RH004: (SEQ ID NO: 8) TATGACCATGATTACGAATTCGAGCTCGAAGCGCTTATTATTGCATTAGC pEX-fwd: (SEQ ID NO: 9) CAGATTGTACTGAGAGTGCACC pEX-rev: (SEQ ID NO: 10) GTGAGCGGATAACAATTTCACAC pEC750C-fwd: (SEQ ID NO: 11) CAATATTCCACAATATTATATTATAAGCTAGC M13-rev: (SEQ ID NO: 12) CAGGAAACAGCTATGAC RH010: (SEQ ID NO: 13) CGGATATTGCATTACCAGTAGC RH011: (SEQ ID NO: 14) TTATCAATCTCTTACACATGGAGC RH025: (SEQ ID NO: 15) TAGTATGCCGCCATTATTACGACA RH134: (SEQ ID NO: 16) GTCGACGTGGAATTGTGAGC pNF2_fwd: (SEQ ID NO: 39) GGGCGCACTTATACACCACC pNF2_rev: (SEQ ID NO: 40) TGCTACGCACCCCCTAAAGG RH021 (SEQ ID NO: 107) ACTTGGGTCGACCACGATAAAACAAGGTTTTAAGG RH022 (SEQ ID NO: 108) TACCAGGGATCCGTATTAATGTAACTATGATATCAATTCTTG aad9-fwd2 (SEQ ID NO: 109) ATGCATGGTCCCAATGAATAGGTTTACACTTACTTTAGTTTTATGG aad9-rev (SEQ ID NO: 110) ATGCGAGTTAACAACTTCTAAAATCTGATTACCAATTAG RH031 (SEQ ID NO: 111) ATGCATGGATCCCAATGAATAGGTTTACACTTACTTTAGTTTTATGG RH032 (SEQ ID NO: 112) ATGCGAGAGCTCAACTTCTAAAATCTGATTACCAATTAG RH138 (SEQ ID NO: 113) ATGCATGGATCCGTCTGACAGTTACCAGGTCC RH139 (SEQ ID NO: 114) ATGCGAGAGCTCCAATTGTTCAAAAAAATAATGGCGGAG RH140 (SEQ ID NO: 115) ATGCATGGATCCCGGCAGTTTTTCTTTTTCGG RH141 (SEQ ID NO: 116) ATGCGAGAGCTCGGTTAAATACTAGTTTTTAGTTACAGAC

[0209] The following nine plasmid vectors were prepared: [0210] Plasmid no. 1: pEX-A258-ΔcatB (SEQ ID NO: 17).

[0211] It contains the synthesized DNA fragment ΔcatB cloned into plasmid pEX-A258. This ΔcatB fragment comprises i) a guide RNA expression cassette targeting the catB gene (chloramphenicol resistance gene encoding a chloramphenicol-O-acetyltransferase—SEQ ID NO: 18) of C. beijerinckii DSM6423 under the control of an anhydrotetracycline inducible promoter (expression cassette: SEQ ID NO: 19), and ii) an editing template (SEQ ID NO: 20) comprising 400 homologous bp located upstream and downstream of the catB gene. [0212] Plasmid no. 2: pCas9ind-ΔcatB (see FIG. 2 and SEQ ID NO: 21).

[0213] It contains the ΔcatB fragment amplified by PCR (primers ΔcatB_fwd and ΔcatB_rev) and cloned into pCas9ind (described in the patent application WO2017/064439—SEQ ID NO: 22) after digestion of the individual DNAs with the XhoI restriction enzyme. [0214] Plasmid no. 3: pCas9acr (see FIG. 3 and SEQ ID NO: 23). [0215] Plasmid no. 4: pEC750S-uppHR (see FIG. 4 and SEQ ID NO: 24).

[0216] It contains a repair template (SEQ ID NO: 25) used for the deletion of the upp gene and consisting of two homologous DNA fragments upstream and downstream of the upp gene (respective sizes: 500 (SEQ ID NO: 26) and 377 (SEQ ID NO: 27) base pairs). The assembly was obtained using the Gibson cloning system (New England Biolabs, Gibson assembly Master Mix 2X). To this end, the upstream and downstream parts were amplified by PCR from the genomic DNA of strain DSM 6423 (see Maté de Gerando et al., 2018 and accession number PRJEB11626 (see Worldwide Website: ebi.ac.uk/ena/data/view/PRJEB11626)) using the respective primers RH001/RH002 and RH003/RH004. These two fragments were then assembled into the previously linearized pEC750S by restriction enzyme (SalI and SacI restriction enzymes). [0217] Plasmid no. 5: pEX-A2-gRNA-upp (see FIG. 5 and SEQ ID NO: 28).

[0218] This plasmid comprises the gRNA-upp DNA fragment corresponding to an expression cassette (SEQ ID NO: 29) of a guide RNA targeting the upp gene (upp-targeting protospacer (SEQ ID NO: 31)) under the control of a constitutive promoter (non-coding RNA of sequence SEQ ID NO: 30), inserted into a replication plasmid named pEX-A2. [0219] Plasmid no. 6: pEC750S-Δupp (see FIG. 6 and SEQ ID NO: 32).

[0220] It has as a base the plasmid pEC750S-uppHR (SEQ ID NO: 24) and additionally contains the DNA fragment containing a guide RNA expression cassette targeting the upp gene under the control of a constitutive promoter.

[0221] This fragment was inserted into a pEX-A2, designated pEX-A2-gRNA-upp. The insert was then amplified by PCR with the primers pEX-fwd and pEX-rev, and digested with the restriction enzymes XhoI and NcoI. Finally, this fragment was cloned by ligation into pEC750S-uppHR previously digested with the same restriction enzymes to obtain pEC750S-Δupp. [0222] Plasmid no. 7: pEC750C-Δupp (see FIG. 7 and SEQ ID NO: 33).

[0223] The cassette containing the guide RNA as well as the repair template were then amplified with the primers pEC750C-fwd and M13-rev. The amplicon was digested by restriction enzyme with XhoI and SacI enzymes, and then cloned by enzymatic ligation into pEC750C to obtain pEC750C-Δupp. [0224] Plasmid no. 8: pGRNA-pNF2 (see FIG. 8 and SEQ ID NO: 34).

[0225] This plasmid has pEC750C as its base and contains a guide RNA expression cassette targeting the pNF2 plasmid (SEQ ID NO: 118). [0226] Plasmid no. 9: pCas9ind-gRNA_catB (see FIG. 16 and SEQ ID NO: 38).

[0227] It contains the coding sequence for the guide RNA targeting the catB locus amplified by PCR (primers ΔcatB_fwd and ΔcatB_gRN A_rev) and cloned into pCas9ind (described in the patent application WO2017/064439) after digestion of the individual DNAs with XhoI restriction enzyme and ligation. [0228] Plasmid no. 10: pNF3 (see FIG. 25 and SEQ ID NO: 119).

[0229] It contains a portion of pNF2, including in particular the origin of replication and a gene encoding a plasmid replication protein (CIBE_p20001), amplified with primers RH021 and RH022. This PCR product was then cloned at the SalI and BamHI restriction sites into plasmid pUC19 (SEQ ID NO: 117). [0230] Plasmid no. 11: pEC751S (see FIG. 26 and SEQ ID NO: 121).

[0231] It contains all the elements of pEC750C (SEQ ID NO: 106), except the catP chloramphenicol resistance gene (SEQ ID NO: 70). The latter was replaced by the Enterococcus faecalis aad9 gene (SEQ ID NO: 130), which confers resistance to spectinomycin. This element was amplified with primers aad9-fwd2 and aad9-rev from plasmid pMTL007S-E1 (SEQ ID NO: 120) and cloned into the AvaII and HpaI sites of pEC750C in place of the catP gene (SEQ ID NO: 70). [0232] Plasmid no. 12: pNF3S (see FIG. 27 and SEQ ID NO: 123).

[0233] It contains all the elements of pNF3, with an insertion of the aad9 gene (amplified with primers RH031 and RH032 from pEC751S) between the BamHI and SacI sites. [0234] Plasmid no. 13: pNF3E (see FIG. 28 and SEQ ID NO: 124).

[0235] It contains all the elements of pNF3, with an insertion of the Clostridium difficile ermB gene (SEQ ID NO: 131) under the control of the miniPthl promoter. This element was amplified from pFW01 with primers RH138 and RH139 and cloned between the BamHI and SacI sites of pNF3E. [0236] Plasmid no. 14: pNF3C (see FIG. 29 and SEQ ID NO: 125).

[0237] It contains all the elements of pNF3, with an insertion of the Clostridium perfringens catP gene (SEQ ID NO: 70). This element was amplified from pEC750C with primers RH140 and RH141 and cloned between the BamHI and SacI sites of pNF3E.

Results No. 1

[0238] Transformation of C. beijerinckii Strain DSM 6423

[0239] The plasmids were introduced and replicated into an E. coli dam.sup.− dcm.sup.− strain (INV110, Invitrogen). This allows the removal of Dam- and Dcm-type methylations on the pCas9ind-ΔcatB plasmid before introducing it by transformation into strain DSM 6423 according to the protocol described by Mermelstein et al. (1993), with the following modifications: the strain is transformed with a larger amount of plasmid (20 μg), at an OD.sub.600 of 0.8, and using the following electroporation parameters: 100 Ω, 25 μF, 1400 V. Spreading on Petri dish containing erythromycin (20 μg/mL) thus resulted in C. beijerinckii DSM 6423 transformants containing the pCas9ind-ΔcatB plasmid.

Induction of Cas9 Expression and Obtaining C. beijerinckii Strain DSM 6423 ΔcatB

[0240] Several erythromycin-resistant colonies were then taken up in 100 μL of culture medium (2YTG) and serially diluted to a dilution factor of 10.sup.4 in culture medium. For each colony, 8 μL of each dilution was placed on a Petri dish containing erythromycin and anhydrotetracycline (200 ng/mL) to induce expression of the Cas9 nuclease gene.

[0241] After extraction of genomic DNA, the deletion of the catB gene within the clones grown on this plate was verified by PCR, using primers RH076 and RH077 (see FIG. 9).

Verification of the Sensitivity of C. beijerinckii Strain DSM 6423 ΔcatB to Thiamphenicol

[0242] To ensure that the deletion of the catB gene does confer a novel sensitivity to thiamphenicol, comparative analyses on agar medium were performed. Pre-cultures of C. beijerinckii DSM 6423 and C. beijerinckii DSM 6423 ΔcatB were grown on 2YTG medium and then 100 μL of these pre-cultures was plated on 2YTG agar media supplemented or not with thiamphenicol at a concentration of 15 mg/L. FIG. 10 shows that only the initial C. beijerinckii DSM 6423 strain is able to grow on thiamphenicol-supplemented media.

Deletion of the Upp Gene by the CRISPR-Cas9 Tool in C. beijerinckii Strain DSM 6423 ΔcatB

[0243] A clone of C. beijerinckii strain DSM 6423 ΔcatB was previously transformed with the pCas9.sub.acr vector not exhibiting methylation at the dam- and dcm-type methyltransferase-recognized motifs (prepared from an Escherichia coli bacterium with the dam.sup.− dcm.sup.− genotype). Verification of the presence of the plasmid pCas9.sub.acr maintained in C. beijerinckii strain DSM 6423 was verified by colony PCR with primers RH025 and RH134.

[0244] An erythromycin-resistant clone was then transformed with previously demethylated pEC750C-Δupp. The resulting colonies were selected on medium containing erythromycin (20 μg/mL), thiamphenicol (15 μg/mL) and lactose (40 mM).

[0245] Several of these clones were then resuspended in 100 μL of culture medium (2YTG) and serially diluted in culture medium (to a dilution factor of 10.sup.4). Five (5) μL of each dilution was placed on a Petri dish containing erythromycin, thiamphenicol and anhydrotetracycline (200 ng/mL) (see FIG. 11).

[0246] For each clone, two aTc-resistant colonies were tested by PCR colony with primers designed to amplify the upp locus (see FIG. 12).

Deletion of the Natural Plasmid pNF2 by the CRISPR-Cas9 Tool in C. beijerinckii Strain DSM 6423 ΔcatB

[0247] A clone of C. beijerinckii strain DSM 6423 ΔcatB was previously transformed with the pCas9.sub.ind vector not exhibiting methylation at the Dam- and Dcm-type methyltransferase-recognized motifs (prepared from an Escherichia coli bacterium with the dam.sup.− dcm.sup.− genotype). The presence of the plasmid pCas9.sub.ind within C. beijerinckii strain DSM6423 was verified by PCR with the primers pCas9.sub.ind_fwd (SEQ ID NO: 42) and pCas9.sub.ind_rev (SEQ ID NO: 43) (see FIG. 13).

[0248] An erythromycin-resistant clone was then used to transform pGRNA-pNF2, prepared from Escherichia coli bacteria with the dam.sup.− dcm.sup.− genotype.

[0249] Several colonies obtained on medium containing erythromycin (20 μg/mL) and thiamphenicol (15 μg/mL) were resuspended in culture medium and serially diluted to a dilution factor of 10.sup.4. Eight μL of each dilution was placed on a Petri dish containing erythromycin, thiamphenicol and anhydrotetracycline (200 ng/mL) to induce CRISPR/Cas9 expression.

[0250] The absence of the natural plasmid Pnf2 was verified by PCR with the primers Pnf2_fwd (SEQ ID NO: 39) and Pnf2_rev (SEQ ID NO: 40) (see FIG. 14).

Conclusions

[0251] In the course of this work, the inventors succeeded in introducing and maintaining different plasmids within Clostridium beijerinckii strain DSM 6423. They succeeded in deleting the catB gene using a CRISPR-Cas9 tool based on the use of a single plasmid. The sensitivity to thiamphenicol of the obtained recombinant strains was confirmed by agar tests.

[0252] This deletion allowed them to use the CRISPR-Cas9 tool requiring two plasmids described in the patent application FR1854835. Two examples demonstrating the interest of this application were performed: the deletion of the upp gene and the removal of a non-essential natural plasmid for Clostridium beijerinckii strain DSM 6423.

Results No. 2

[0253] Transformation of C. beijerinckii Strains

[0254] The plasmids prepared in the E. coli strain NEB 10-beta are also used to transform the C. beijerinckii strain NCIMB 8052. In contrast, for C. beijerinckii DSM 6423, the plasmids are previously introduced and replicated in an E. coli dam.sup.− dcm.sup.− strain (INV110, Invitrogen). This allows the removal of Dam- and Dcm-type methylations on the plasmids of interest before introducing them by transformation into strain DSM 6423.

[0255] Transformation is otherwise performed similarly for each strain, i.e., according to the protocol described by Mermelstein et al. 1992, with the following modifications: the strain is transformed with a larger amount of plasmid (5-20 μg), at an OD.sub.600 of 0.6-0.8, and the electroporation parameters are 100 Ω, 25 μF, 1400 V. After 3 h of regeneration in 2YTG, the bacteria are plated on Petri dish (2YTG agar) containing the desired antibiotic (erythromycin: 20-40 μg/mL; thiamphenicol: 15 μg/mL; spectinomycin: 650 μg/mL).

Comparison of Transformation Efficiencies of C. beijerinckii DSM 6423 Strains

[0256] Transformations were performed in biological duplicate in the following C. beijerinckii strains: DSM 6423 wild type, DSM 6423 ΔcatB and DSM 6423 ΔcatB ΔpNF2 (FIG. 30). For this, the pCas9.sub.ind vector, notably difficult to use to modify a bacterium because it does not allow good transformation efficiencies, was used. It also contains a gene conferring resistance to erythromycin, an antibiotic to which all three strains are sensitive.

[0257] The results indicate an increase in transformation efficiency by a factor of about 15-20 attributable to the loss of the natural plasmid pNF2.

[0258] Transformation efficiency was also tested for the plasmid pEC750C, which confers resistance to thiamphenicol, only in DSM 6423 ΔcatB (IFP962 ΔcatB) and DSM 6423 ΔcatB ΔpNF2 (IFP963 ΔcatB ΔpNF2) strains, since the wild-type strain is resistant to this antibiotic (FIG. 31). For this plasmid, the gain in transformation efficiency is even more striking (improvement by a factor of about 2000).

Comparison of Transformation Efficiencies of pNF3 Plasmids with Other Plasmids

[0259] To determine the transformation efficiency of plasmids containing the origin of replication of the natural plasmid pNF2, plasmids pNF3E and pNF3C were introduced into the C. beijerinckii strain DSM 6423 ΔcatB ΔpNF2. The use of vectors containing erythromycin or chloramphenicol resistance genes allows comparison of vector transformation efficiency based on the nature of the resistance gene. The plasmids pFW01 and pEC750C were also transformed. These two plasmids contain resistance genes to different antibiotics (erythromycin and thiamphenicol respectively) and are commonly used to transform C. beijerinckii and C. acetobutylicum.

[0260] As shown in FIG. 32, the pNF3-based vectors show excellent transformation efficiency, and are particularly usable in C. beijerinckii DSM 6423 ΔcatB ΔpNF2. In particular, pNF3E (which contains an erythromycin resistance gene) shows significantly higher transformation efficiency than pFW01, which comprises the same resistance gene. This same plasmid could not be introduced into the wild type C. beijerinckii DSM 6423 strain (0 colonies obtained with 5 μg of transformed plasmids in biological duplicate), demonstrating the impact of the presence of the natural plasmid pNF2.

Verification of Transformability of pNF3 Plasmids in Other Strains/Species

[0261] To illustrate the possibility of using this new plasmid in other solventogenic Clostridium strains, the inventors performed a comparative analysis of the transformation efficiencies of the plasmids pFW01, pNF3E, and pNF3S in the ABE strain C. beijerinckii NCIMB 8052 (FIG. 33). Since the NCIMB 8052 strain is naturally resistant to thiamphenicol, pNF3S, conferring resistance to spectinomycin, was used instead of pNF3C.

[0262] The results demonstrate that the NCIMB 8052 strain is transformable with the pNF3-based plasmids, proving that these vectors are applicable to C. beijerinckii species in a broad sense.

[0263] The applicability of the pNF3-based synthetic vector suite was also tested in the reference strain DSM 792 from C. acetobutylicum. A transformation assay showed the possibility of transforming this strain with the pNF3C plasmid (transformation efficiency of 3 colonies observed per μg of transformed DNA versus 120 colonies/μg for the pEC750C plasmid).

Verification of the Compatibility of pNF3 Plasmids with the Genetic Tool Described in the Application FR18/73492

[0264] The patent application FR18/73492 describes the ΔcatB strain as well as the use of a two-plasmid CRISPR/Cas9 system requiring the use of an erythromycin resistance gene and a thiamphenicol resistance gene. To demonstrate the value of the new pNF3 plasmid suite, the pNF3C vector was transformed into the ΔcatB strain already containing the pCas9.sub.acr plasmid. The transformation, performed in duplicate, showed a transformation efficiency of 0.625±0.125 colonies/μg DNA (mean±standard error), demonstrating that a pNF3C-based vector can be used in combination with pCas9acr in the ΔcatB strain.

[0265] In parallel to these results, a part of the pNF2 plasmid including its origin of replication (SEQ ID NO: 118) could be successfully reused to create a new suite of shuttle vectors (SEQ ID NO: 119, 123, 124 and 125), which can be modified at will, allowing in particular their replication in an E. coli strain as well as their reintroduction in C. beijerinckii DSM 6423. These new vectors present advantageous transformation efficiencies to perform gene editing for example in C. beijerinckii DSM 6423 and derivatives thereof, in particular using the CRISPR/Cas9 tool comprising two different nucleic acids.

[0266] These new vectors have also been successfully tested in another strain of C. beijerinckii (NCIMB 8052), and in Clostridium species (in particular C. acetobutylicum), demonstrating their applicability in other organisms of the phylum Firmicutes. A test is also performed on Bacillus.

Conclusions

[0267] These results demonstrate that deletion of the natural plasmid pNF2 significantly increases the transformation frequencies of the bacterium that contained it (by a factor of about 15 for pFW01 and by a factor of about 2000 for pEC750C). This result is particularly interesting in the case of bacteria of the genus Clostridium, known to be difficult to transform, and in particular for the strain C. beijerinckii DSM 6423 which naturally suffers from a low transformation efficiency (less than 5 colonies/μg of plasmid).

REFERENCES

[0268] Banerjee, A., Leang, C., Ueki, T., Nevin, K. P., & Lovley, D. R. (2014). Lactose-inducible system for metabolic engineering of Clostridium ljungdahlii. Applied and environmental microbiology, 80(8), 2410-2416. [0269] Chen J.-S., Hiu S. F. (1986) Acetone-butanol-isopropanol production by Clostridium beijerinckii (synonym, Clostridium butylicum). Biotechnol. Lett. 8:371-376. [0270] Cui, L., & Bikard, D. (2016). Consequences of Cas9 cleavage in the chromosome of Escherichia coli. Nucleic acids research, 44(9), 4243-4251. [0271] Currie, D. H., Herring, C. D., Guss, A. M., Olson, D. G., Hogsett, D. A., & Lynd, L. R. (2013). Functional heterologous expression of an engineered full length CipA from Clostridium thermocellum in Thermoanaerobacterium saccharolyticum. Biotechnology for biofuels, 6(1), 32. [0272] DiCarlo, J. E., Norville, J. E., Mali, P., Rios, X., Aach, J., & Church, G. M. (2013). Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic acids research, 41(7), 4336-4343. [0273] Dong, H., Tao, W., Zhang, Y., & Li, Y. (2012). Development of an anhydrotetracycline-inducible gene expression system for solvent-producing Clostridium acetobutylicum: A useful tool for strain engineering. Metabolic engineering, 14(1), 59-67. [0274] Dong, D., Guo, M., Wang, S., Zhu, Y., Wang, S., Xiong, Z., . . . & Huang, Z. (2017). Structural basis of CRISPR-SpyCas9 inhibition by an anti-CRISPR protein. Nature, 546(7658), 436. [0275] Dupuy, B., Mani, N., Katayama, S., & Sonenshein, A. L. (2005). Transcription activation of a UV-inducible Clostridium perfringens bacteriocin gene by a novel σ factor. Molecular microbiology, 55(4), 1196-1206. [0276] Egholm, M., Buchardt, O., Nielsen, P. E., & Berg, R. H. (1992). Peptide nucleic acids (PNA). Oligonucleotide analogs with an achiral peptide backbone. Journal of the American Chemical Society, 114(5), 1895-1897. [0277] Fonfara, I., Le Rhun, A., Chylinski, K., Makarova, K. S., Lecrivain, A. L., Bzdrenga, J., . . . & Charpentier, E. (2013). Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems. Nucleic acids research, 42(4), 2577-2590. [0278] Garcia-Doval C, Jinek M. Molecular architectures and mechanisms of Class 2 CRISPR-associated nucleases. Curr Opin Struct Biol. 2017 December; 47:157-166. doi: 10.1016/j.sbi.2017.10.015 Ajouter au projet Citavi par DOI. Epub 2017 Nov. 3. Review. [0279] George H. A., Johnson J. L., Moore W. E. C., Holdeman, L. V., Chen J. S. (1983) Acetone, Isopropanol, and Butanol Production by Clostridium beijerinckii (syn. Clostridium butylicum) and Clostridium aurantibutyricum. Appl. Env. Microbiol. 45:1160-1163. [0280] Gonzales y Tucker R D, Frazee B. View from the front lines: an emergency medicine perspective on clostridial infections in injection drug users. Anaerobe. 2014 December; 30:108-15. [0281] Hartman, A. H., Liu, H., & Melville, S. B. (2011). Construction and characterization of a lactose-inducible promoter system for controlled gene expression in Clostridium perfringens. Applied and environmental microbiology, 77(2), 471-478. [0282] Heap, J. T., Ehsaan, M., Cooksley, C. M., Ng, Y. K., Cartman, S. T., Winzer, K., & Minton, N. P. (2012). Integration of DNA into bacterial chromosomes from plasmids without a counter-selection marker. Nucleic acids research, 40(8), e59-e59. [0283] Heap, J. T., Kuehne, S. A., Ehsaan, M., Cartman, S. T., Cooksley, C. M., Scott, J. C., & Minton, N. P. (2010). The ClosTron: mutagenesis in Clostridium refined and streamlined. Journal of microbiological methods, 80(1), 49-55. [0284] Heap, J. T., Pennington, O. J., Cartman, S. T., Carter, G. P., & Minton, N. P. (2007). The ClosTron: a universal gene knock-out system for the genus Clostridium. Journal of microbiological methods, 70(3), 452-464. [0285] Heap, J. T., Pennington, 0. J., Cartman, S. T., & Minton, N. P. (2009). A modular system for Clostridium shuttle plasmids. Journal of microbiological methods, 78(1), 79-85. [0286] Hidalgo-Cantabrana, C., O'Flaherty, S., & Barrangou, R. (2017). CRISPR-based engineering of next-generation lactic acid bacteria. Current opinion in microbiology, 37, 79-87. [0287] Hiu S. F., Zhu C.-X., Yan R.-T., Chen J.-S. (1987) Butanol-ethanol dehydrogenase and butanol-ethanol-isopropanol dehydrogenase: different alcohol dehydrogenases in two strains of Clostridium beijerinckii (Clostridium butylicum). Appl. Env. Microbiol. 53:697-703. [0288] Huang, H., Chai, C., Li, N., Rowe, P., Minton, N. P., Yang, S., & Gu, Y. (2016). CRISPR/Cas9-based efficient genome editing in Clostridium ljungdahlii, an autotrophic gas-fermenting bacterium. ACS synthetic biology, 5(12), 1355-1361. [0289] Huggins, A. S., Bannam, T. L. and Rood, J. I. (1992) Comparative sequence analysis of the catB gene from Clostridium butyricum. Antimicrob. Agents Chemother. 36, 2548-2551. [0290] Ismaiel A. A., Zhu C. X., Colby G. D., Chen, J. S. (1993). Purification and characterization of a primary-secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii. J. Bacteriol. 175:5097-5105. [0291] Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096), 816-821. [0292] Jones D. T., Woods D. R. (1986) Acetone-butanol fermentation revisited. Microbiological Reviews 50:484-524. [0293] Kolek J., Sedlar K., Provaznik I., Patakova P. (2016). Dam and Dcm methylations prevent gene transfer into Clostridium pasteurianum NRRL B-598: development of methods for electrotransformation, conjugation, and sonoporation. Biotechnol Biofuels. 9:14. [0294] Li, Q., Chen, J., Minton, N. P., Zhang, Y., Wen, Z., Liu, J., . . . & Gu, Y. (2016). CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnology journal, 11(7), 961-972. [0295] Makarova, K. S., Haft, D. H., Barrangou, R., Brouns, S. J., Charpentier, E., Horvath, P., . . . & Van Der Oost, J. (2011). Evolution and classification of the CRISPR-Cas systems. Nature Reviews Microbiology, 9(6), 467. [0296] Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., . . . & Horvath, P. (2015). An updated evolutionary classification of CRISPR-Cas systems. Nature Reviews Microbiology, 13(11), 722. [0297] Marino, N. D., Zhang, J. Y., Borges, A. L., Sousa, A. A., Leon, L. M., Rauch, B. J., . . . & Bondy-Denomy, J. (2018). Discovery of widespread type I and type V CRISPR-Cas inhibitors. Science, 362(6411), 240-242. [0298] Máté de Gérando, H., Wasels, F., Bisson, A., Clement, B., Bidard, F., Jourdier E., Lopez-Contreras A., Lopes Ferreira N. (2018). Genome and transcriptome of the natural isopropanol producer Clostridium beijerinckii DSM 6423. BMC genomics. 19:242. [0299] Mearls, E. B., Olson, D. G., Herring, C. D., & Lynd, L. R. (2015). Development of a regulatable plasmid-based gene expression system for Clostridium thermocellum. Applied microbiology and biotechnology, 99(18), 7589-7599. [0300] Mermelstein L. D., Welker N. E., Bennett G. N., Papoutsakis E. T. (1993). Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC 824 10:190-195. [0301] Mermelstein L. D., Welker N. E., Bennett G. N., Papoutsakis E. T. (1993). Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC 824 10:190-195. [0302] Moon H G, Jang Y S, Cho C, Lee J, Binkley R, Lee S Y. One hundred years of clostridial butanol fermentation. FEMS Microbiol Lett. 2016 February; 363(3). [0303] Nagaraju, S., Davies, N. K., Walker, D. J. F., Köpke, M., & Simpson, S. D. (2016). Genome editing of Clostridium autoethanogenum using CRISPR/Cas9. Biotechnology for biofuels, 9(1), 219. [0304] Nariya, H., Miyata, S., Kuwahara, T., & Okabe, A. (2011). Development and characterization of a xylose-inducible gene expression system for Clostridium perfringens. Applied and environmental microbiology, 77(23), 8439-8441. [0305] Newcomb, M., Millen, J., Chen, C. Y., & Wu, J. D. (2011). Co-transcription of the celC gene cluster in Clostridium thermocellum. Applied microbiology and biotechnology, 90(2), 625-634. [0306] Pawluk, A., Davidson, A. R., & Maxwell, K. L. (2018). Anti-CRISPR: Discovery, mechanism and function. Nature Reviews Microbiology, 16(1), 12. [0307] Poehlein A., Solano J. D. M., Flitsch S. K., Krabben P., Winzer K., Reid S. J., Jones D. T., Green E., Minton N. P., Daniel R., Dürre P. (2017). Microbial solvent formation revisited by comparative genome analysis. Biotechnol Biofuels. 10:58. [0308] Pyne, M. E., Bruder, M. R., Moo-Young, M., Chung, D. A., & Chou, C. P. (2016). Harnessing heterologous and endogenous CRISPR-Cas machineries for efficient markerless genome editing in Clostridium. Scientific reports, 6. [0309] Rauch, B. J., Silvis, M. R., Hultquist, J. F., Waters, C. S., McGregor, M. J., Krogan, N. J., & Bondy-Denomy, J. (2017). Inhibition of CRISPR-Cas9 with bacteriophage proteins. Cell, 168(1-2), 150-158. [0310] Rajewska M., Wegrzyn K, Konieczny I., FEMS Microbiol Rev. 2012 March; 36(2). AT-rich region and repeated sequences—the essential elements of replication origins of bacterial replicons: 408-34. [0311] Ransom, E. M., Ellermeier, C. D., & Weiss, D. S. (2015). Use of mCherry red fluorescent protein for studies of protein localization and gene expression in Clostridium difficile. Applied and environmental microbiology, 81(5), 1652-1660. [0312] Rogers P., Chen J.-S., Zidwick M. (2006) in The prokaryotes. 3rd edition, Vol. 1, edited by Dworkin M (Springer, New York, USA, 2006). 3rd edition, Vol. 1, pp. 672-755. [0313] Schwarz S, Kehrenberg C, Doublet B, Cloeckaert A. Molecular basis of bacterial resistance to chloramphenicol and florfenicol. FEMS Microbiol Rev. 2004 November; 28(5):519-42. [0314] Stella S, Alcón P, Montoya G. Class 2 CRISPR-Cas RNA-guided endonucleases: Swiss Army knives of genome editing. Nat Struct Mol Biol. 2017 November; 24(11):882-892. doi: 10.1038/nsmb.3486. [0315] Wang, S., Dong, S., Wang, P., Tao, Y., & Wang, Y. (2017). Genome Editing in Clostridium saccharoperbutylacetonicum N1-4 with the CRISPR-Cas9 System. Applied and Environmental Microbiology, 83(10), e00233-17. [0316] Wang Y, Li X, Milne C B, et al. Development of a gene knockout system using mobile group II introns (Targetron) and genetic disruption of acid production pathways in Clostridium beijerinckii. Appl Environ Microbiol. 2013; 79(19): 5853-63. [0317] Wang, Y. et al. Markerless chromosomal gene deletion in Clostridium beijerinckii using CRISPR/Cas9 system. J. Biotechnol. 2015. 200: 1-5. [0318] Wang, Y., Zhang, Z. T., Seo, S. O., Lynn, P., Lu, T., Jin, Y. S., & Blaschek, H. P. (2016). Bacterial genome editing with CRISPR-Cas9: deletion, Integration, single nucleotide modification, and desirable “clean” mutant selection in Clostridium beijerinckii as an example. ACS synthetic biology, 5(7), 721-732. [0319] Wasels, F., Jean-Marie, J., Collas, F., López-Contreras, A. M., & Ferreira, N. L. (2017). A two-plasmid inducible CRISPR/Cas9 genome editing tool for Clostridium acetobutylicum. Journal of microbiological methods. 140:5-11. [0320] Xu, T., Li, Y., Shi, Z., Hemme, C. L., Li, Y., Zhu, Y., . . . & Zhou, J. (2015). Efficient genome editing in Clostridium cellulolyticum via CRISPR-Cas9 nickase. Applied and environmental microbiology, 81(13), 4423-4431. [0321] Yadav, R., Kumar, V., Baweja, M., & Shukla, P. (2018). Gene editing and genetic engineering approaches for advanced probiotics: A Review. Critical reviews in food science and nutrition, 58(10), 1735-1746. [0322] Yue Chen, Bruce A. McClane, Derek J. Fisher, Julian I. Rood, Phalguni Gupta; Construction of an Alpha Toxin Gene Knockout Mutant of Clostridium perfringens Type A by Use of a Mobile Group II Intron; Appl. Environ. Microbiol. November 2005, 71 (11) 7542-7547; DOI: 10.1128/AEM.71.11.7542-7547.2005. [0323] Zhang, J., Liu, Y. J., Cui, G. Z., & Cui, Q. (2015). A novel arabinose-inducible genetic operation system developed for Clostridium cellulolyticum. Biotechnology for biofuels, 8(1), 36. [0324] Zhang C., Tinggang L. Jianzhong H. (2018) Characterization and genome analysis of a butanol-isopropanol-producing Clostridium beijerinckii strain BGS1. Biotechnol Biofuels (2018) 11:280. [0325] Zhong, J., Karberg, M., & Lambowitz, A. M. (2003). Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition-activated selectable marker. Nucleic acids research, 31(6), 1656-1664.