VACCINES COMPRISING GLYCOENGINEERED BACTERIA
20230111599 · 2023-04-13
Inventors
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
A61K39/102
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/70
CHEMISTRY; METALLURGY
International classification
A61K39/102
HUMAN NECESSITIES
C12N15/70
CHEMISTRY; METALLURGY
C12N15/74
CHEMISTRY; METALLURGY
Abstract
The present invention is directed to a gram-negative bacterial host cell for vaccine use comprising a heterologous functional Actinobacillus pleuropneumoniae (APR) rfb gene cluster producing an APR O-anti-gen bound to the lipid A-core of the bacterial host cell and located on the bacterial host outer surface, and wherein the endogenous rib gene cluster of the bacterial host cell is not functional. The invention further pertains to compositions comprising said host cells, in particular vaccines, and corresponding uses in the prophylaxis and/or therapy of Actinobacillus pleuropneumoniae (APR) infections.
Claims
1.-20. (canceled).
21. A gram-negative bacterial host cell suitable for vaccines, the bacterial host cell comprising (a) a heterologous functional Actinobacillus pleuropneumoniae (APP) rfb gene cluster, wherein the heterologous functional APP rfb gene cluster produces an APP O-antigen that is bound to the lipid A-core of the bacterial host cell and is located on the bacterial host outer surface, and wherein the endogenous rfb gene cluster of the bacterial host cell is not functional.
22. The bacterial host cell according to claim 1, further comprising at least one of: (b) a heterologous promoter for regulating the transcription of the heterologous APP rfb gene cluster that is stronger than the endogenous promoter for the endogenous rfb gene cluster; (c) at least one further gene for functionally expressing an enzyme assisting the APP O-antigen synthesis; or (d) at least one neutralizing epitope of Apx toxins.
23. The bacterial host cell according to claim 21, wherein the bacterial host cell is selected from the group consisting of Enterobacteriaceae, Burkholderiaceae, Pseudomonadaceae, Vibrionaceae, optionally Burkholderia thailandensis, Pseudomonas aeruginosa, Vibrio natriegens, Vibrio cholerae, Escherichia coli, optionally E. coli_5, Salmonella enterica, optionally Salmonella enterica subsp. enterica, optionally Salmonella enterica subsp. enterica selected from the group consisting of serovar Typhimurium, Enteritidis, Heidelberg, Gallinarum, Hadar, Agona, Kentucky and Infantis, and Salmonella enterica subsp. enterica serovar Typhimurium SL1344.
24. The bacterial host cell according to claim 21, wherein the heterologous rfb gene cluster is selected from the APP1 to 18 rfb gene clusters, (i) comprising or consisting of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 4; (ii) having at least 70, 80, 90, 95 or 98% nucleic acid sequence identity to SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 4, optionally over the whole sequence; (iii) hybridizing to the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 4 under stringent conditions; and/or (iv) is degenerated with respect to the nucleic acid sequence of any of (i) to (iii).
25. The bacterial host cell according to claim 22, wherein the heterologous rfb gene cluster is selected from the APP1 to 18 rfb gene clusters, (i) comprising or consisting of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 4; (ii) having at least 70, 80, 90, 95 or 98% nucleic acid sequence identity to SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 4, optionally over the whole sequence; (iii) hybridizing to the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 4 under stringent conditions; and/or (iv) is degenerated with respect to the nucleic acid sequence of any of (i) to (iii).
26. The bacterial host cell according to claim 21, wherein the heterologous functional APP rfb gene cluster produces an O-antigen of APP1 to 18.
27. The bacterial host cell according to claim 21, wherein the endogenous rfb gene cluster of the bacterial host cell is at least partially or completely deleted.
28. The bacterial host cell according to claim 22, wherein the heterologous promoter for regulating the transcription of the heterologous APP rfb gene cluster is a promoter selected from the group consisting of kanamycin promoter, proD promoter, j23101 promoter, proC promoter, STER_RS05525 promoter, STER_RS01225 promoter, STER_RS04515 promoter, STER_RS05020 promoter, STER_RS06870 promoter, STER_RS00780 promoter, and P32 promoter.
29. The bacterial host cell according to claim 22, wherein at least one further gene for functionally expressing an enzyme assisting the APP O-antigen synthesis is selected from the group consisting of the enzymes for nucleotide activated glycan biosynthesis, undecaprenylpyrophosphate glycosyltransferases, O-antigen glycosyltransferases, O-antigen polymerases, O-antigen chain length determinant protein, N-glycan epimerases, and combinations thereof.
30. The bacterial host cell according to claim 22, wherein the at least one neutralizing epitope of Apx toxins: is at least one neutralizing epitope of Apx toxins I, II and III; is located on the bacterial host outer cell surface and/or secreted from the cell; and/or is bound to a membrane protein.
31. The bacterial host cell according to claim 21, wherein (a) the heterologous functional APP rfb gene cluster, (b) the at least one further gene for functionally expressing an enzyme assisting the APP O-antigen synthesis, and/or (c) the at least one neutralizing epitope of Apx toxins, is codon-optimized for the bacterial host cell.
32. The bacterial host cell according to claim 22, wherein (a) the heterologous functional APP rfb gene cluster, (b) the at least one further gene for functionally expressing an enzyme assisting the APP O-antigen synthesis, and/or (c) the at least one neutralizing epitope of Apx toxins is codon-optimized for the bacterial host cell.
33. The bacterial host cell according to claim 31, wherein the heterologous functional APP rfb gene cluster (a) is codon-optimized for the bacterial host cell.
34. The bacterial host cell according to claim 21, wherein the bacterial host is Escherichia coli or Salmonella enterica, wherein (a) the heterologous functional APP rfb gene cluster is selected from APP1 to 18 rfb gene clusters; (b) the heterologous promoter for regulating the transcription of the heterologous APP rfb gene cluster is the kanamycin or proD promoter; (c) the at least one further gene for functionally expressing an enzyme assisting the APP O-antigen synthesis is the wzy gene, and/or the gne gene; wherein (i) the APP1 to 18 rfb gene cluster, (ii) the gne gene and/or (iii) the wzy gene are codon-optimized for the bacterial host cell Escherichia coli or Salmonella enterica.
35. The bacterial host cell according to claim 34, wherein the bacterial host is Salmonella enterica subsp. enterica serovar Typhimurium, wherein (a) the codon optimized heterologous functional APP rfb gene cluster is the APP2 rfb gene cluster; (b) the heterologous promoter for regulating the transcription of the heterologous APP2 rfb gene cluster is the kanamycin promoter; and (c) the at least one further gene for functionally expressing an enzyme assisting the APP O-antigen synthesis is the gne gene and/or the wzy gene.
36. The bacterial host cell according to claim 34, wherein the bacterial host is E. coli, wherein (a) the heterologous functional APP rfb gene cluster is the APP2 rfb gene cluster (b) the heterologous promoter for regulating the transcription of the heterologous APP2 rfb gene cluster is the kanamycin or the proD promoter; and (c) the at least one further gene for functionally expressing an enzyme assisting the APP O-antigen synthesis is the gne gene.
37. The bacterial host cell according to claim 34, wherein the bacterial host is Salmonella enterica subsp. enterica serovar Typhimurium or Escherichia coli, wherein (a) the heterologous functional APP rfb gene cluster is the APP8 rfb gene cluster, (b) the heterologous promoter for regulating the transcription of the heterologous APP2 rfb gene cluster is the kanamycin or proD promoter; and (c) the at least one further gene for functionally expressing an enzyme of the APP O-antigen synthesis is the wzy and/or gne gene.
38. The bacterial host cell according to claim 34, wherein the bacterial host is E. coli_5, Salmonella enterica subsp. Enterica, Salmonella enterica subsp. enterica serovar Typhimurium, or Salmonella enterica subsp. enterica serovar Typhimurium SL1344.
39. The bacterial host cell according to claim 34, wherein the heterologous functional APP rfb gene cluster is the APP2 or APP8 rfb gene cluster.
40. The bacterial host cell according to claim 34, wherein the wzy gene is a codon optimized wzy gene, and/or both the wzy and the gne genes are integrated into the genome of the bacterial host cell or located on a plasmid.
41. The bacterial host cell according to claim 34, comprising at least one of neutralizing epitopes of Apx toxins I, II and III, at least one of neutralizing epitopes of Apx toxins I, II and III bound to a membrane protein, or at least one of neutralizing epitopes of Apx toxins I, II and III bound to cytolysin A of E. coli, or secreted from the host cell.
42. The bacterial host cell according to claim 34, the APP2 rfb gene cluster and the wzy gene, are codon-optimized for the bacterial host cell Escherichia coli or Salmonella enterica.
43. The bacterial host cell according to claim 34, wherein the bacterial host is Salmonella enterica subsp. enterica serovar Typhimurium, Salmonella enterica subsp. enterica serovar Typhimurium strain SL1344, E. coli or E. coli_5 and at least one of: the codon optimized heterologous functional APP rfb gene cluster is the APP2 rfb gene cluster, (i) comprising or consisting of SEQ ID NO: 3; (ii) having at least 70, 80, 90, 95 or 98% nucleic acid sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3; (iii) hybridizing to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under stringent conditions; and/or (iv) is degenerated with respect to the nucleic acid sequence of any of (i) to (iii), and the endogenous rfb gene cluster of the bacterial host cell is at least partially or completely deleted; the at least one further gene for functionally expressing an enzyme assisting the APP O-antigen synthesis is the gne gene and/or the wzy gene is integrated into the genome of the bacterial host cell; i. wherein the gne gene comprises or consists of SEQ ID NO: 6 or has a nucleic acid sequence at least 70, 80, 90, 95 or 98% identical to SEQ ID NO: 6, and/or hybridizes to the nucleic acid sequence of SEQ ID NO: 6 under stringent conditions; ii. wherein the wzy gene comprises or consists of SEQ ID NO: 7 or SEQ ID NO: 8, or has a nucleic acid sequence at least 70, 80, 90, 95 or 98% identical to SEQ ID NO: 7 or SEQ ID NO: 8, and/or hybridizes to the nucleic acid sequence of SEQ ID NO: 7 or SEQ ID NO: 8 under stringent conditions; and/or the bacterial host cell comprises at least 2 neutralizing epitopes of Apx toxins I, II and III.
44. The bacterial host cell according to claim 21, wherein the bacterial host is live or inactivated.
45. The bacterial host cell according to claim 22, wherein the at least one neutralizing epitope of Apx toxins is a neutralizing epitope of Apx toxins I, II and III.
46. The bacterial host cell according to claim 22, wherein the at least one neutralizing epitope of Apx toxins is located on the bacterial host outer cell surface and/or is secreted from the cell.
47. The bacterial host cell according to claim 1, wherein (a) is codon-optimized for the bacterial host cell.
48. The bacterial host cell according to claim 22, wherein at least one of (a), (c) and (d) is codon-optimized for the bacterial host cell.
49. The bacterial host cell according to claim 21, wherein the heterologous rfb gene cluster is selected from the APP1 to 18 rfb gene clusters.
50. The bacterial host cell according to claim 21, wherein the heterologous rfb gene cluster is the APP2 or APP8 rfb gene cluster.
51. The bacterial host cell according to claim 21, wherein the heterologous functional APP rfb gene cluster produces an O-antigen of APP1 to 18.
52. The bacterial host cell according to claim 21, wherein the heterologous functional APP rfb gene cluster produces an O-antigen of APP2 or APP8.
53. The bacterial host cell according to claim 21, wherein the APP rfb gene cluster expresses at least one protein comprising or consisting of the amino acids of any one of SEQ ID NOs: 2, 50-61, or SEQ ID NO: 5, 62-72, or the at least one protein having at least 70, 80, 90, 95 or 98% amino acid sequence identity to these sequences.
54. The bacterial host cell according to claim 22, wherein the at least one further gene for functionally expressing an enzyme assisting the APP O-antigen synthesis is selected from the group consisting of the gne gene and the wzy gene.
55. The bacterial host cell according to claim 54, wherein i) the gne gene encodes an UDP-galactose/UDP-N-actetylgalacosamine epimerase, and/or ii) the wzy gene encodes an O-antigen polymerase of APP,
56. The bacterial host cell according to claim 54, wherein i) the gne gene encodes an epimerase from Campylobacter jejuni, and/or ii) the wzy gene encodes an O-antigen polymerase of APP2.
57. The bacterial host cell according to claim 54, wherein i) the gne gene encodes an epimerase from Campylobacter jejuni; and/or ii) the wzy gene comprises or consists of SEQ ID NO: 7 or the codon optimized wzy of SEQ ID NO:8 or having a nucleic acid sequence at least 70, 80, 90, 95 or 98% identical to SEQ ID NO: 7 or SEQ ID NO:8, and/or hybridizing to the nucleic acid sequence of SEQ ID NO: 7 or SEQ ID NO:8 under stringent conditions.
58. The bacterial host cell according to claim 54, wherein the gne gene comprises or consists of SEQ ID NO: 6, or having a nucleic acid sequence at least 70, 80, 90, 95 or 98% identical to SEQ ID NO: 6, and/or hybridizing to the nucleic acid sequence of SEQ ID NO: 6 under stringent conditions.
59. The bacterial host cell according to claim 22, wherein the at least one neutralizing epitope of Apx toxins is/are located on the bacterial host outer cell surface and bound to a membrane protein selected from the group consisting of cytolysin A, trimeric autotransporter adhesion, AIDA-I, EaeA , outer membrane proteins (OMP), and OmpA of E. coli.
60. A pharmaceutical composition comprising at least one bacterial host cell according to claim 1.
61. The pharmaceutical composition of claim 60, comprising bacterial host cells expressing at least two different O-Antigens from APP.
62. A method of treatment comprising the step of administering a physiologically effective amount of a bacterial host cell according to claim 1 to a mammalian subject in need thereof for the treatment and/or prophylaxis of APP infections.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
DETAILED DESCRIPTION OF THE INVENTION
[0115] In the following the present invention will by described by representative examples, none of which are to be interpreted as limiting the scope of the claims as appended.
Examples
Materials and Methods
[0116] The bacterial strains used in the experimental examples and their sources are listed in Table 1.
TABLE-US-00001 TABLE 1 Bacteria Background Genotype Resistance Source/reference APP Serotype 2 strain P1875 Provided by V. Perreten, University of Bern APP Serotype 2 strain HK361 NCTC 10976 APP Serotype 1 strain S4074 — ATCC 27088 APP Serotype 3 strain ORG1224 — Provided by V. Perreten, University of Bern APP Serotype 5 strain K17 — APP reference strain provided by V. Perreten, University of Bern APP Serotype 7 WF83 — APP reference strain provided by V. Perreten, University of Bern APP Serotype 8 strain MIDG2331 — Provided by V. Perreten, University of Bern SL1344 his- (histidine auxotroph) Strep Hoiseth et al. 1981, Nature, Vol. 291(5812), p238-239 SL1344 his-, Δrfb::kanR Kan, Strep This study SL1344 his-, Δrfb Strep This study SL1344 his-, Δrfb::APP2.LPS/kanR Kan, Strep This study SL1344 his-, Δrfb::APP2.LPS Strep This study SL1344 his-, Δrfb:: kanR -APP2.LPS Strep, Kan, Cm This study SL1344 his-, Δrfb::kanR -APP2.LPS(cod. opt.) Kan, Strep This study SL1344 his-, Δrfb::kanR -APP2.LPS rfaL-Ωgne/cat Kan, Strep, Cm This study SL1344 his-, Δrfb::kanR -APP2.LPS rfaL-Ωgne- Strep, Kan, Cm This study wzy(cod. opt.)/cat SL1344 his-, Δrfb::kanR -APP2.LPS(cod. opt.) Strep, Kan, Cm This study rfaL-Ωgne-wzy(cod. opt.)/cat SL1344 his-, Δrfb::APP2.LPS(cod. opt.) Strep This study rfaL-Ωgne-wzy(cod. opt.) SL1344 his-, Δrfb::cat/kP-APP2.LPS rfaL- Strep, Cm This study Ωgne-wzy(cod. opt.) SL1344 his-, Δrfb::kP-APP2.LPS(cod. opt.) Strep This study rfaL-Ωgne-wzy(cod. opt.) SL1344 his-, Δrfb rfaK-ΩproD-ClyA- Strep This study ApxI(aa626-845)-ApxII(aa612-801)- ApxIII(aa626-860)-HIS6-rfaL SL1344 his-, Δrfb::kP-APP2.LPS(cod. opt.) Strep This study rfaL-Ωgne-wzy(cod. opt) pliC-ΩproD- ClyA-ApxI(aa626-845)-ApxII(aa612-801)- ApxIII(aa626-860)-HIS6-pagC SL1344 his-, Δrfb::cat-kP-APP8.LPS(cod. opt.) Strep This study E. coli_5 Amp, Strep Provided by Roger Stephan, University of Zurich E. coli_5 Δrfb::kanR Kan, Amp, This study Strep E. coli_5 Δrfb Amp, Strep This study E. coli_5 Δrfb:APP2.LPS/kanR Kan, Amp, This study Strep E. coli_5 Δrfb::APP2.LPS Amp, Strep This study E. coli_5 Δrfb::kanR -APP2.LPS Amp, Strep, This study Kan E. coli_5 Δrfb::kanR -APP2.LPS(cod. opt.) Kan, Amp, This study Strep E. coli_5 Δrfb::kanR -APP2.LPS(cod. opt.) Amp, Strep, This study rfaL-Ωgne/cat Kan, Cm E. coli_5 Δrfb::kanR-APP2.LPS(cod. opt.) Amp, Strep, This study rfaL-Ωgne-wzy(cod. opt.)/cat Kan, Cm
[0117] The plasmids used in the experimental examples and their sources are listed in Table 2.
TABLE-US-00002 TABLE 2 Plasmids pMLBAD Tmp Lefebre et al. 2002, Appl. Environ. Microbiol., Vol. 68(12), p5956-64 pEC415 Amp Schulz et al. 1998, Science, Vol. 181, p1197-1199 pMLBAD-HIS10-APXII(439-801aa) Tmp This study pMLBAD-HIS10-APXIII-APP2 Tmp This study pMLBAD-APXIII(27-245aa)-HIS9 Tmp This study pMLBAD-gne-HA Tmp This study pEC415-wzy Amp This study pDOC Amp Lee et al. 2009, BMC Mircobiol., Vol. 9(252) pDOC_E.coli_5_Δrfb::APP2.LPS/kanR Amp, Kan This study pDOC_SL1344_Δrfb::APP2.LPS/kanR Kan, Amp This study pDOC_E.coli_5_Δrfb::kanR-APP2.LPS(cod. opt.) Amp, Kan This study pDOC_SL1344_Δrfb::kanR-APP2.LPS(cod. opt.) Amp, Kan This study pDOC_SL1344_Δrfb::cat-kP-APP8.LPS(cod. opt.) Amp, Cm This study pACBSCE Cm Lee et al. 2009, BMC Mircobiol., Vol. 9(252) pKD46 Amp Datsenko et al. 2000, PNAS, Vol. 97(12), P6640-6645 PLAMBDA46 Gent This study pCP20 Amp, Cm Cherepanov et al. 1995, Gene, Vol. 158, p9-14 pCP20-GentR Gent, Cm This study pKD3 Amp, Cm Datsenko et al. 2000, PNAS, Vol. 97(12), P6640-6645 pKD4 Amp, Kan Datsenko et al. 2000, PNAS, Vol. 97(12), P6640-6645
[0118] The plasmids' oligonucleotides used in the experimental examples and their nucleic acid sequences are listed in Table 3.
TABLE-US-00003 TABLE 3 OLIGO name Sequence Ec_SL/Kan_f CAAATTCCGGTTAAAAAAAG W ACCGCTTGTTTGAGAGTGAT AATCGCAAACAAGCGGTCTT TTTTGATCAA AATATTATTACACGTCTTGA GCGATTG (SEQ ID NO: 9) Ec_SL/Kan_re GATGAAGAGCAAAGATTGGG V AGATAATGTGAGAAATCTTT AGATTCAAACTAAGCTGAGA AGAAAAAG GTCCATATGAATATCCTCCT TAG (SEQ ID NO: 10) E.c._5_Δrfb GTAATGTTAATGAAAGCATA fw TAAGAAATTTTCAAATGAAT AAAGAAACTGTTTCAGTTAT TATTACACGT CTTGAGCGATTG (SEQ ID NO: 11) E.c._5_Δrfb GAGCATGTAATCTTCTGATA rev AAAATCATTTGTACGATATT TTCAGTTACATACTATGCGT AGGTCCATATG AATATCCTCCTTAG (SEQ ID NO: 12) SL1344_Δrfb GAGCAATTAATTTTTATTGG fw CAAATTAAATACCACATTAA ATACGCCTTATGGAATAGAA AAATTACACG TCTTGAGCGATTG (SEQ ID NO: 13) SL1344_Δrfb GCGTTCAGATTTTACGCAGG rev CTAATTTATACAATTATTAT TCAGTACTTCTCGGTAAGCG GTCCATATGAA TATCCTCCTTAG (SEQ ID NO: 14) Ec_SL/Kan_ CAGGGCTAGCGCTAATTACC fw_elo AATTTATTGTTTAGCTTAGG AATTTTTTTAGGTTAGTTGC AAATTCCGGTT AAAAAAAGACCGCTTGTTTG A (SEQ ID NO: 15) Ec_SL/Kan_ CAATATTAGCTTATGTATTA rev_elo TATTAGAAGGCCTACAGATA AGCAAAAAATATTATTGATG AAGAGCAAA GATTGGGAGATAATGTGAGA AAT (SEQ ID NO: 16) BamHI-Fw CGGGAATTCAAGCTTGGATC KanR-Fw CC (SEQ ID NO: 17) XhoI 3′rspU- GACGCTAGCATATGAGCTCG Rev AG (SEQ ID NO: 18) BamHI-SL- GTTTCATCAGTAATGGGACA gnd Fw ext GAAAGGTACC (SEQ ID NO: 19) XhoI-SL-GalF CACACTCGAGCAATTGACCG Rev ext GTTTTTCTATTCCATAAGGC (SEQ ID NO: 20) 5′ NdeI_wzy CAGGTACCATATGAACTCCT TAGTATATAGAATAGATATT AGAACA (SEQ ID NO: 21) 3′ EcoRI_wzy CTTATCAGAATTCATTTTTT ACATTCCAAATAGCGTACAA (SEQ ID NO: 22) 3′ GTACCGAGCTCGAATTCTTG EcoRI_pEC41 AAGACGAAAGG 5fw (SEQ ID NO: 23) 5′ CACTGCAATCGCGATAGCTG NdeI_pEC415 TCTTTTTCATATGT rev (SEQ ID NO: 24) 3′-gne- GAATAGGAACTAAGGAGGAT cat_overlap ATTCATATGGACCTTAAGCG TAATCTGGAACATCGTATGG G (SEQ ID NO: 25) 5′- ATTGCTCAAATTGGTATCAT gne_SI1344rf TACCGGTTTTLTGCTGGCGC aL TAAGAAATAGATAATGAAAA TTCTTATTAG CGGTGGTGCA (SEQ ID NO: 26) 3′- AAAAACTGGTTTGATAAGTG cat_SI1344 ATTGAGTCCTGATGATGGAA rfaL AACGCGCTGATACCGTAATT GTGTAGGCT GGAGCTGCTTC (SEQ ID NO: 27) 5′-elo- TTTTATCTTTCGTCGGTTTT gne_SH344rf TATAFCGTTCGTGGCAATTT aL TGAACAGGTCGATATTGCTC AAATTGGTATC ATTACCGGT (SEQ ID NO: 28) 3′-elo- TTTCAAAATACAGTTGGGAA cat_SI1344 AATGTAGCGCAGCGTTTCGA rfaL GGAACAAATGAAAAACTGGT TTGATAAGT GATTGAGTCCT (SEQ ID NO: 29) 5′-cat-P2new GGTCCATATGAATATCCTCC TTAGTTCCTATTC (SEQ ID NO: 30) 5′ gne CCCATACGATGTTCCAGATT overlap_wzy ACGCTTAATGAATTCTTTAG (co) TGTATCGCATTGACATCC (SEQ ID NO: 31) 3′ wzy GAATAGGAACTAAGGAGGAT (co)- ATTCATATGGACCTCATTTT cat_overlap TTACACTCTAAATAACGCAC AATATTGG (SEQ ID NO: 32) 3′ gne_wzy GGATGTCAATGCGATACACT (co) overlap AAAGAATTCATTAAGCGTAA TCTGGAACATCGTATGGG (SEQ ID NO: 33) 5′ XmaI-XhoI- AAAAAACCCGGGCTCGAGAT APXIIIne-HIS- GGATGTAACTAAAAATGGTT fw TGCAATATGGG (SEQ ID NO: 34) 3′ APXIIIne- AAAAAAAAGCTTTTAGTGGT HIS-HindIII- GATGATGATGGTGATGGT rv (SEQ ID NO: 35) FW_ CTAATTAGTAACCACTTTTA pliCint AGCATGGTTAATCCTATTTT GAAAAAGCAAAATCCCTGGT GTTTTCAAAAT A (SEQ ID NO: 36) REV_ GATTCACTCTGAAAAATTTT pagCint CCTGGAATTAATCACAATGT CAGGTCGATATTGCTCAAAT TGGTATCATTA (SEQ ID NO: 37) eloFW_ CGTAACGTTAAAGAATATGT pliCint GAATCACTACCGTAGTATAA TGGCTAATTAGTAACCACTT TTAAGCATGG TTAATC (SEQ ID NO: 38) eloREV_ GATAAGCAGGAAGGAAAATC pagCint TGGTGTAAATAACGCCAGAT CTCACAAGATTCACTCTGAA AAATTTTCC TGGAATTAAT (SEQ ID NO: 39) FW_rfaK_ CTATTTATATGGCGCTATCA rfaL TCAGGGAAACAG (SEQ ID NO: 40) REV_rfaL_ GACAGTATAATTAATGATAT rfaK TAACCGTGCGCTTG (SEQ ID NO: 41)
Methods—Growth of Bacterial Strains
[0119] The bacterial strains and plasmids listed in above table 1 and 2 were grown in Luria-Bertani (LB) medium (10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl), TB medium (12 g/L tryptone, 24 g/L yeast extract, 0.017 M KH.sub.2PO.sub.4, 0.072 M K.sub.2HPO.sub.4) or BHI+NAD (37 g/L brain heart infusion broth (BHI; exact composition see Sigma Aldrich cat. Nr. 53286) supplemented with 2 mg/L β-Nicotinamide adenine dinucleotide (NAD)).
[0120] Agar plates were supplemented with 1.5% (w/v) agar. Antibiotics were used in the following final concentrations: Ampicillin (Amp) 100 μg/ml, kanamycin (Kan) 50 μg/ml, chloramphenicol (Cm) 25 μg/ml, streptomycin (Strep), trimethoprim (Tmp) 10 μg/ml, gentamycin (gent) 15 μg/ml.
Example 1
1) Generation of a vaccine strain Expressing The APP2 O-Antigen Biosynthesis Cluster
[0121] 1.1) Integration of the APP2 O-antigen Biosynthesis Cluster in E. coli and SL1344
[0122] In a first step an Actinobacillus pleuropneumoniae serotype 2 (APP2) strain (P1875) was sequenced and the O-antigen biosynthesis cluster (rfb cluster) identified according to Xu et al. 2010, J. Bacteriol., Vol. 192(21), p5625-5636. It was shown that the rfb cluster of all APP serotypes used in this publication were located between the erpA and rpsU genes.
TABLE-US-00004 TABLE 4 rfb locus of APP2 flanked by erpA and rpsU with its respective annotated genes and proteins/functions. Annotated gene Predicted protein/function wzzB chain length determinant protein kanE alpha-D-kanosaminyltransferase cpsP glycosyl transferase family 2 epsJ putative glycosyltransferase EpsJ setA subversion of eukaryotic traffic protein A hypothetical hypothetical protein gene rfbX putative O-antigen transporter vatD streptogramin A acetyltransferase pglC undecaprenyl phosphate N,N′- diacetylbacillosamine 1-phosphate transferase rffG dTDP-glucose 4,6-dehydratase 2 rmlA2 glucose-1-phosphate thymidylyltransferase 2 rmlD dTDP-4-dehydrorhamnose reductase rfbC dTDP-4-dehydrorhamnose 3,5-epimerase
[0123] As vaccine strains, two vector bacteria derived from Salmonella enterica subsp. enterica Typhimurium and Escherichia coli (see strain list) were selected. Salmonella enterica subsp. enterica serovar Typhimurium SL1344 parental strain was isolated from infected cattle (Hoiseth et al. 1981, Nature, Vol. 291(5812), p238-239). The strain SL1344 is the genetic marked version of the parental strain. The second strain, Escherichia coli strain 5 (E. coli_5) was isolated from tonsils of healthy pigs in Switzerland. It was shown to be PCR negative for virulence factors stx, eae, LT and ST. Both strains were sequenced and the endogenous O-antigen biosynthesis cluster (rfb cluster) identified between genes galF and gnd. Furthermore, both strains were genetically modified not to express endogenous O-antigen and instead a gene cluster encoding the O-antigen biosynthetic pathway of APP2 inserted at this position (Seq. 42,
[0124] The 13758 bp fragment (
[0125] In detail, to integrate the APP2 rfb cluster (Seq. 1) into E. coli_5 and SL1344, shuttle vector plasmids pDOC_E.coli_5_Δrfb::APP2.LPS/kanR (for E. coli_5) and pDOC_SL1344_Δrfb::APP2.LPS/kanR (for SL1344) based on the pDOC system of Lee et al. 2009 were generated/synthesized (by CRO). The identified APP2 rfb operon (gene wzzB to rfbC) was elongated on the 5′ and 3′ end to include the flanking upstream pro-moter region (containing also the erpA gene) and downstream the terminator region (containing the 3′ region of rpsU gene) of Sequence 1 (see
[0126] The shuttle vector plasmids (pDOC_E.coli_5_Δrfb::APP2.LPS/kanR in E. coli_5 and pDOC_SL1344_Δrfb::APP2.LPS/kanR in SL1344) together with the helper plasmid pACBSCE which encodes the arabinose inducible λ-recombination system, and carries the I-Scel restriction enzyme as well as I-Scel cleavage sites, were transformed into target cells. After transformation the expressed I-Scel enzyme cleaved the shuttle vector plasmid at the I-Scel restriction endonuclease cleavage sites, linearizing the above described modified APP2 rfb operon with the kanamycin resistance gene flanked by endogenous homologous sequences. The λ-recombination system recognized the homologous flanking regions at the respective sites in the genome of the recipient cell and exchanged the endogenous DNA with the donor DNA resulting in the integration of the APP2 O-antigen biosynthesis cluster with a kanamycin resistance cassette in either E. coli_5 or SL1344 (resulting in strains E. coli_5 Δrfb::APP2.LPS/kanR and SL1344Δrfb::APP2.LPS/kanR). Cells selected on kanamycin and sucrose containing medium were positively tested by PCR for the presence of the foreign DNA and the absence of shuttle vector and helper plasmid by lack of growth on selective medium.
[0127] To “out-recombine” the kanamycin resistance marker, a temperature sensitive plasmid pCP20 (Cherepanov et al. 1995, Gene, Vol. 158, p9-14) for SL1344 derivatives or pCP20-Gent for E. coli_5 derivatives (downstream of the chloramphenicol resistance gene a gentamycin resistance gene was integrated), encoding for the flippase, which recognized the palindromic FRT sites, was introduced in the cells. After the “flip out” event only one FRT site remained in the genome. With increasing cultivation temperature, the positive clones were counter-selected against the flippase encoding plasmid. A final PCR verified the absence of all helper plasmids, absence of kanamycin resistance marker and the introduction of the APP2 rfb cluster construct (resulting in strains E. coli_5 Δrfb::APP2.LPS and SL1344 Δrfb::APP2.LPS). The expression of APP2 0-antigen displayed on the surface of E. coli_5 and SL1344 was verified by SDS-PAGE and immunoblotting (
[0128] As control, the endogenous rfb cluster was deleted in the wild type cells E. coli_5 and SL1344. For this a knock-out cassette was generated by PCR using pKD4 as template (Datsenko et al. 2000, PNAS, Vol. 97(12), p6640-6645) and oligonucleotides E.c._5_Δrfb fw/E.c._5_Δrfb rev for E. coli_5 rfb and SL1344_Δrfb fw/ SL1344_Δrfb fw for SL1344 rfb cluster deletion. The resulting PCR product encodes the kanamycin resistance cassette flanked by FRT sites and in addition contains 21-24bp overlap sequences with the endogenous 5′ (before the start of the first gene of rfb cluster.fwdarw.wfgD (E. coli_5) or rfbB (SL1344)) and 3′ (after stop codon of last gene of rfb cluster.fwdarw.pg/H (E. coli_5) or rfbP (SL1344)) needed for homologous recombination. The DNA fragment (E. coli_5 1759bp, SL1344 1623bp) and a temperature sensitive helper plasmid encoding λ-recombination system pKD46 (Datsenko et al. 2000, PNAS, Vol. 97(12), p6640-6645) for SL1344 and pLAMBDA46 (the β-lactamase gene was exchanged with a gentamycin resistance gene) for E. coli_5 were introduced. The λ-recombination system recognized the homologous flanking regions at the respective sites before the start of the first gene and after the stop codon of the last gene in the rfb cluster and deleted the endogenous rfb gene cluster by integrating the kanamycin resistance cassette flanked by the FRT sites. The resulting strains E. coli_5 Δrfb::kanR and SL1344 Δrfb::kanR were further manipulated to lose the antibiotic marker. To “out-recombine” the kanamycin resistance marker, the flip out technique established by Cherepanov et al. 1995, Gene, Vol. 158, p9-14 was used as described above. The final E. coli_5 Δrfb and SL1344 Δrfb strains were verified by PCR and analyzed for the loss of O-antigen expression by immunoblotting (
1.2) Improving the Expression of the APP2 O-antigen in E. coli_5 and SL1344 by introducing the kanR resistance marker upstream of the APP2 rfb cluster
[0129] To improve the APP2 O-antigen presentation in the glycoengineered E. coli_5 and SL1344 strains the promoter region of the rfb cluster was exchanged with a kanamycin resistance gene of which the kanamycin promoter is exploited to induce transcription of downstream genes. For this a PCR fragment was generated using oligonucleotide Ec_SL/Kan_fw and Ec_SL/Kan_rev and pKD4 as template amplifying the encoded kanamycin promoter and resistance gene with the 5′ and 3′ encoded FRT sites. Furthermore, the oligonucleotides introduced homologous recombination sequences homologous to the erpA gene before the start codon and after the stop codon. The resulting product with a size of 1644bp was used together with oligonucleotides Ec_SL/Kan_fw_elo and Ec_SL/Kan_rev_elo for a second PCR reaction to elongate the homologous recombination sequences for an increase in integration efficiency. This DNA fragment and a temperature sensitive helper plasmid encoding λ-recombination system pKD46 (Datsenko et al. 2000, PNAS, Vol. 97(12), p6640-6645) for SL1344 Δrfb::APP2.LPS and pLAMBDA46 for E. coli_5 Δrfb::APP2LPS strain were introduced. The λ-recombination system recognized the homologous flanking regions at the respective sites at the start and stop codon of erpA and “out-recombined” the erpA gene and integrated the kanamycin promoter and resistance gene flanked by the FRT sites into the respective site. The introduced kanamycin resistance gene allowed the selection of positive clones (successful integration). These positive candidates were verified for the deletion of erpA and the integration of the PCR fragment by PCR. The temperature sensitive helper plasmid was lost from the cells by increasing the growth temperature for several rounds of incubations. The O-antigen presentation in the final strains E. coli_5 Δrfb::kanR-APP2.LPS and SL1344 Δrfb::kanR-APP2.LPS was tested by immunoblotting (
1.3) Improving the Expression of the APP2 O-antigen in E. coli_5 and SL1344 by Codon Optimization of the APP2 rfb Cluster
[0130] To improve the APP2 O-antigen cluster protein/enzyme expression and ultimately increase the APP2 O-antigen presentation on lipid A, the nucleotide triplet codons of the gene coding sequences could be optimized for SL1344 and E. coli_5. This results in the decrease of usage of unwanted triplets which might be in favour in A. pleuropneumoniae but unfavourable in SL1344 and E. coli_5. In this study the codon optimization was done by CRO and done for E. coli expression levels. If the same holds true for Salmonella enterica subsp. enterica serovar Typhimurium SL1344 needed to be shown by integration of the same codon optimized APP2 rfb cluster into SL1344 endogenous rfb cluster.
[0131] To integrate the codon optimized rfb cluster of APP2 into SL1344 and E. coli_5 the original integration sites at the endogenous rfb cluster where kept identical. A codon optimized (for E. coli expression) APP2 rfb cluster was synthesized which encoded the kanamycin resistance cassette (flanked by FRT sites) at its 5′ end. This results in the transcription of the APP2 rfb cluster (codon optimized) regulated by the promoter of the kanamycin gene. In detail, a new integration cassette was designed (
1.4) Improving the Expression of the APP2 O-antigen in SL1344 Expressing the APP2 rfb Cluster by Introducing gne and wzy
[0132] As seen in the generated strains expressing the APP2 rfb cluster the typical “ladder” pattern of the lipopolysaccharide was only weakly present or not detectable (
[0133] A second potential limiting factor for O-antigen biosynthesis could be the availability and/or transfer of the glycans. LPS structural data for certain APP serotypes were published by Perry et al. 1990, identifying galactose at the reducing end of the APP2 O-antigen pentasaccharide [.fwdarw.2)-α-D-Galp-(1.fwdarw.3)-γ-D-Glcp-(1.fwdarw.4)-α-D-Glcp(6-(Ac).sub.0-65)-(1.fwdarw.4)-β-D-GalpNAc-(1.fwdarw.2)-α-L-Rhap-(1.fwdarw.].sub.n. One key enzyme in the generation of galactose in the bacterial cells is the conversion of galactose from glucose as substrate. This needs the action of an epimerase. The UDP-GlcNAc/Glc 4-epimerase gne of Campylobacter jejuni was identified to provide galactose and N-acetylgalactosamine in the bacterial cell for cell-surface carbohydrates (Bernatchez et al. 2005). The sequence of gne of C. jejuni 81116 (locus C8J_1070) was fused with a C-terminal HA (hemagglutinin) tag and 5′ EcoRI and 3′ Xbal restriction cleavage sites. This fragment was synthesized and afterwards cloned into the EcoRI/Xbal cleavage sites of pMLBAD to be under the control of an arabinose inducible promoter (pMLBAD-gne-HA).
[0134] The plasmid-based expression of wzy and/or gne was tested in SL1344 and E. coli_5 expressing the APP2 O-antigen on its surface. SL1344 and its derivatives (Δrfb, Δrfb::kanR-APP2.LPS pMLBAD-gne pEC415-wzy, Δrfb::kanR-APP2.LPS(cod.opt.) pMLBAD pEC415, Δrfb::kanR-APP2.LPS(cod.opt.) pMLBAD-gne, Δrfb::kanR-APP2.LPS(cod.opt.) pEC415-wzy and Δrfb::kanR-APP2.LPS(cod.opt.) pMLBAD-gne pEC415-wzy) as well as E. coli_5 and its derivatives (Δrfb, Δrfb::kanR-APP2.LPS(cod.opt.), Δrfb::kanR-APP2.LPS(cod.opt.) pMLBAD, Δrfb::kanR-APP2.LPS(cod.opt.) pMLBAD-gne) were grown in LB medium supplemented with antibiotics (according to table 1 and 2) until an OD.sub.600 of 0.6 shaking at 37° C. To induce the wzy and/or gne expression arabinose was added to a final concentration of 0.1% (for SL1344 and its derivatives) or 0.2% (for E. coli_5 and its derivatives). After another 5 h of incubation at 37° C. (shaking) arabinose was added again to 0.1% (for SL1344 and its derivatives) or 0.2% (for E. coli_5 and its derivatives) and the cultures were incubated for about 16 h at 37° C. (shaking). Stationary cells were harvested and further processed. As a control for the APP2 O-antigen presentation on lipid A, APP2 P1875 strain was grown in BHI +NAD at 37° C. with slow shaking (110 rpm) to a stationary phase after which the cells were harvested. For APP2 O-antigen analysis, cells were re-suspended in 1×Lämmli buffer (1 OD.sub.600 cells/100 μ1×Lämmli buffer). The samples were incubated at 95° C. for 5 min. 12 μg proteinase K per OD.sub.600 equivalent cells (stock 20 mg/ml in 10 mM Tris-HCl pH 7.5, 20 mM CaCl.sub.2, 50% glycerol) was added and the samples were incubated for 1 h at 60° C. Afterwards proteinase K treated samples (0.1 OD.sub.600 cell equivalent) were loaded on 4-12% Bis-Tris gels, and molecules were separated by size in MES buffer. The gels were further processed for immunoblotting and silver staining. To analyze the LPS synthesis via immunoblot, LPS was transferred from the gel onto PVDF membranes. The membrane was incubated in blocking solution (PBS pH 7.5/0.05% Tween/0.1% casein) shaking for 2 h at room temperature. Then, the membrane was incubated shaking overnight at 4° C. in antibody binding solution (PBS pH 7.5/0.05% Tween/0.05% casein) containing a 1:2000 dilution of a rabbit serum reactive against APP2 LPS (rabbit immunized with proteinase K treated extracts of APP2 P1875). The immunoblot was washed 3 times for 5 min with an excess of PBS 0.05% Tween buffer pH 7.5. Afterwards the membrane was incubated for 1 h shaking at room temperature in antibody binding solution with secondary goat anti rabbit IgG-HRP antibody (BETHYL Cat# A120-401P) in a 1:2000 dilution. The membrane was washed 4 times for 5 min with an excess of PBS 0.05% Tween buffer pH 7.5. The antibody binding was visualized with overlaying the membrane with ECL solution (GE healthcare #RPN2105) and light signal detection with Stella 8300 (Raytest). For silver staining the protocol described by Tsai et al. 1982, Anal. Biochem., Vol. 119(1), p115-9. was used. Briefly, the gel was fixed overnight in 40% EtOH/5% acetic acid at room temperature. After, the gel was treated for 10 min with 0.7% periodic acid in 40% EtOH/5% acetic acid, followed by 3 times 15 min washes with ddH.sub.2O. The gel was stained with staining solution (0.187 N sodium hydroxide, 0.2 N ammonium hydroxide, 0.667% silver nitrate) and again extensively washed 3 times 10 min with ddH.sub.2O. The LPS on the gel was visualized by using developing solution (0.25 mg/ml citric acid monohydrate, 0.0185% formaldehyde solution).
[0135] Analyzing the immunoblot of the membrane treated with the rabbit serum against the LPS of APP2 demonstrated a strong staining of the lipid A fraction at around 10 kDa, as well as a ladder pattern migrating between ˜12.5 and 190 kDa (O-antigen polymerization on lipid A) of strain APP2 P1875 (
1.5) Integration of gne and Codon Optimized wzy into SL1344 Expressing the APP2 0-Antigen
[0136] Having seen an improvement of APP2 O-antigen synthesis after introducing gne and/or wzy on plasmid into genetically modified 5L1344, these genes were integrated into the genome of strains expressing the APP2 rfb cluster. To compare the expression levels of APP2 LPS, gne alone and gne fused to the codon-optimized wzy (wzy(cod.opt.) of APP2, Seq. 8) were integrated. As integration site, the downstream area of the O-antigen ligase rfaL was chosen to use the rfaL promoter to transcribe as well the integrated gne and wzy(cod.opt.). The general design (
[0137] To generate rfaL-Ωgne/cat (
TABLE-US-00005 TABLE 5 PCR1 overlap/elongation PCR2 Fusion construct Fragment Template Oligo 1 Oligo 2 Template Oligo 1 Oligo 2 rfaL-gne/cat gne pMLBAD-gne-HA 5′-gne_Sl1344rfaL 3′-gne-cat_overlap SL1344 PCR1 5′-ela- 3′-elo- cat pkD3 5′-cat-P2new 3′-cat_Sl1344faL gne/PCR1 cat gne_Sl1344rf cat_Sl1344rfaL rfaL-gne- gne pMLBAD-gne-HA 5′-gne_Sl1344rfaL 3′-gne_wzy (co) SL1344 PCR1 5′-elo- 3′-elo- wzy(cod.opt.)/cat overlap gne/PCR1 gne_ cat_Sl1344rfaL wzy(cod. pDOC_E.coli_5_Δrfb::kanR 5′ gne overlap_wzy 3′ wzy (co)- wzy(cod.opt.) Sl1344rfaL opt.) APP2.LPS(cod.opt.) (co) cat_overlap PCR1cat cat pKD3 5′-cat-P2new 3-cat_Sl1344rfaL
[0138] The fusion constructs resulting from overlap PCR were transformed together with the temperature sensitive helper plasmid encoding λ-recombination system pLAMBDA46 (modified from Datsenko et al. 2000, PNAS, Vol. 97(12), p6640-6645) for SL1344 Δrfb::kanR-APP2.LPS, SL1344 Δrfb::kanR-APP2.LPS(cod.opt.). The λ-recombination system recognized the homologous flanking regions of the fusion constructs and recombined them in the genome downstream after the stop codon of rfaL. The introduced chloramphenicol resistance gene (cat) allowed the selection of positive clones (successful integration). These positive candidates were verified for the integration of the PCR fragment by PCR. The temperature sensitive helper plasmid was lost from the cells by increasing the growth temperature for several rounds of incubations. The O-antigen presentation in the final strains SL1344 Δrfb::kanR-APP2.LPS rfaL-Ωgne/cat, SL1344 Δrfb::kanR-APP2.LPS rfaL-Ωgne-wzy(cod. opt.)/cat, SL1344 Δrfb::kanR-APP2.LPS(cod.opt.) rfaL-Ωgne/cat and SL1344 Δrfb::kanR-APP2.LPS(cod.opt.) rfaL-Ωgne-wzy(cod. opt.)/cat was tested by immunoblotting (
1.6) Exchanging the Kanamycin Resistance Cassette with Only the Kanamycin Promoter to “Drive” the Expression of the APP2 rfb Cluster
[0139] For vaccines based on whole cell bacteria, it is recommended to have no antibiotic resistance. Therefore, the kanamycin resistance—which was introduced to enhance the APP2 rfb expression—needed to be deleted from the genome. But the advantage of increased transcription by the kanamycin promoter may be used in future bacterial vaccine strains. In a first step, the kanamycin and chloramphenicol resistance cassettes were “flipped out” by introducing the temperature sensitive plasmid pCP20 (Cherepanov et al. 1995, Gene, Vol. 158, p9-14) into SL1344 Δrfb::kanR-APP2.LPS(cod.opt.) rfaL-Ωgne-wzy(cod. opt.)/cat cells. After “flip out” event of the kanamycin and chloramphenicol resistance cassettes at each location only one FRT site remained in the genome. With increasing cultivation temperature, the positive clones were counter selected against the flippase encoding plasmid. By PCR the absence of pCP20 and the absence of kanamycin as well as chloramphenicol resistance marker was verified. To integrate the kanamycin promoter (kP) upstream of the codon optimized APP2 rfb cluster a 1414 bp construct was synthesized containing a chloramphenicol resistance cassette with flanking FRT sites followed by the 373 bp promoter region of the kanamycin resistance cassette (
[0140] Wild type SL1344 and E. coli_5 as well as genetically modified cells lacking the endogenous O-antigen biosynthesis (E. coli_5 Δrfb and SL1344 Δrfb) or expressing the APP2 rfb cluster (E. coli_5 Δrfb::APP2.LPS, Δrfb::kanR-APP2.LPS, Δrfb::kanR-APP2.LPS(cod.opt.) and SL1344 Δrfb::APP2.LPS, Δrfb::kanR-APP2.LPS, Δrfb::kanR-APP2.LPS(cod.opt.), Δrfb::kanR-APP2.LPS rfaL-Ωgne/cat, Δrfb::kanR-APP2.LPS rfaL-Ωgne-wzy(cod. opt.)/cat, Δrfb::kanR-APP2.LPS(cod. opt.) rfaL-Ωgne-wzy(cod. opt.)/cat, Δrfb::kP-APP2.LPS(cod.opt.) rfaL-Ωgne-wzy(cod.opt.), Δrfb rfaK-ΩClyA-ApxI(aa626-845)-ApxII(aa612-801)-ApxIII(aa626-860)-HIS6-rfaL, Δrfb::kP-APP2.LPS(cod.opt.) rfaL-Ωgne-wzy(cod.opt.) pliC-ΩClyA-ApxI(aa626-845)-ApxII(aa612-801)-ApxIII(aa626-860)-HIS6-pagC) were grown to saturation (OD.sub.600 >2) in LB medium, shaking at 37° C. For further processing cells were harvested. As a control for the APP2 O-antigen presentation on lipid A, APP2 P1875 strain was grown in BHI+NAD to a stationary phase at 37° C. with slow shaking (110 rpm). Cells were harvested and used for further processing. For APP2 O-antigen analysis, cells were re-suspended in 1×Lämmli buffer (1 OD.sub.600 cells/100 μl 1×Lämmli buffer). The samples were incubated at 95° C. for 5 min. 12 μg proteinase K per OD.sub.600 equivalent cells (stock 20 mg/ml in 10 mM Tris-HCl pH 7.5, 20 mM CaCl.sub.2, 50% glycerol) were added and the samples were incubated for 1 h at 60° C. Afterwards proteinase K treated samples (0.1 OD.sub.600 cell equivalent) were loaded on 4-12% Bis-Tris gels, and molecules were separated by size in MES buffer. The gels were further processed for Immunoblotting and Silver staining. To analyze the LPS synthesis via immunoblot, LPS was transferred from the gel onto PVDF membrane. The membrane was incubated in blocking solution (PBS pH 7.5/0.05% Tween/0.1% casein) shaking for 2 h at room temperature. After, the membrane was incubated shaking overnight at 4° C. in antibody binding solution (PBS pH 7.5/0.05% Tween/0.05% casein) containing a rabbit serum reactive against APP2 LPS in a in a 1:2000 dilution. The immunoblot was washed 3 times for 5 min with an excess of PBS 0.05% Tween buffer pH 7.5. Afterwards the membrane was incubated for 1 h shaking at room temperature in antibody binding solution with secondary goat anti rabbit IgG-HRP antibody (BETHYL Cat# A120-401P) in a 1:2000 dilution. The membrane was washed 4 times for 5 min with an excess of PBS 0.05% Tween buffer pH 7.5. Afterwards the specific antibody binding was visualized by adding ECL solution (GE healthcare #RPN2105) to the membrane and recording the light signal detected with Stella 8300 (Raytest). For silver staining the protocol described by Tsai et al. 1982, Anal. Biochem., Vol. 119(1), p115-9. was used. Briefly, the gel was fixed overnight in 40% EtOH/5% acetic acid at room temperature. After that the gel was treated for 10 min with 0.7% periodic acid in 40% EtOH/5% acetic acid followed by 3 times 15 min washes with ddH.sub.2O. The gel was stained with staining solution (0.187 N sodium hydroxide, 0.2 N ammonium hydroxide, 0.667% silver nitrate) and again extensively washed for 3 times 10 min with ddH.sub.2O. The LPS on the gel was visualized by adding developing solution (0.25 mg/ml citric acid monohydrate, 0.0185% formaldehyde solution).
[0141] Immunoblotting by using the rabbit serum against the LPS of APP2 showed a strong staining of the lipid A fraction at around 10 kDa and a ladder pattern migrating between ˜12.5 and 190 kDa (O-antigen polymerization on lipid A) of strain APP2 P1875 (
1.7) Integration of the Codon Optimized APP8 0-Antigen Biosynthesis Cluster Controlled by the kP Promoter in SL1344
[0142] To prove that the described transfer of heterologous O-antigen into host bacteria can be applied to various O-antigen types, the rfb cluster of Actinobacillus pleuropneumoniae serotype 8 (APP8) strain (MIDG2331) was genomically integrated into SL1344 and tested for the APP8 O-antigen presentation on lipid A.
[0143] The codon optimized (for E. coli expression which has been shown for the APP2 rfb cluster to work as well for SL1344) 13598 bp fragment (
[0144] The shuttle vector plasmids (pDOC_SL1344_Δrfb::cat-kP-APP8.LPS(cod.opt.) together with the helper plasmid pACBSCE, were transformed into SL1344. The procedure was followed as described above and by Lee et al. 2019. The final strains SL1344 Δrfb::cat-kP-APP8.LPS(cod.opt.) were verified by PCR and the O-antigen expression tested by immunoblotting (
[0145] Wild type SL1344 as well as genetically modified cells lacking the endogenous O-antigen biosynthesis (SL1344 Δrfb) or expressing the codon optimized APP8 rfb cluster under the control of the kP promoter (SL1344 Δrfb::cat-kP-APP8.LPS(cod.opt.)) were grown to saturation (OD.sub.600>2) in LB medium, shaking at 37° C. For further processing cells were harvested. As a control for the APP8 O-antigen presentation on lipid A, APP8 (MIDG2331) and APP3 (ORG1224) strain were grown in BHI+NAD to a stationary phase at 37° C. with slow shaking (110 rpm). Cells were harvested and used for further processing. For APP8 O-antigen analysis, cells were re-suspended in 1×Lämmli buffer (1 OD.sub.600 cells/100 μl 1×Lämmli buffer). The samples were incubated at 95° C. for 5 min. 12 μg proteinase K per OD.sub.600 equivalent cells (stock 20 mg/ml in 10 mM Tris-HCl pH 7.5, 20 mM CaCl.sub.2, 50% glycerol) were added and the samples were incubated for 1 h at 60° C. Afterwards proteinase K treated samples (0.1 OD.sub.600 cell equivalent) were loaded on 4-12% Bis-Tris gels, and molecules were separated by size in MES buffer. The gels were further processed for Immunoblotting and Silver staining. To analyze the LPS synthesis via immunoblot, LPS was transferred from the gel onto PVDF membrane. The membrane was incubated in blocking solution (PBS pH 7.5/0.05% Tween/0.1% casein) shaking for 2 h at room temperature. After, the membrane was incubated shaking overnight at 4° C. in antibody binding solution (PBS pH 7.5/0.05% Tween/0.05% casein) containing a pig serum reactive against APP3 LPS in a in a 1:500 dilution. The immunoblot was washed 3 times for 5 min with an excess of PBS 0.05% Tween buffer pH 7.5. Afterwards the membrane was incubated for 1 h shaking at room temperature in antibody binding solution with secondary pig anti-IgG-HRP (BETHYL Cat#A100-105P) in a 1:2000 dilution. The membrane was washed 4 times for 5 min with an excess of PBS 0.05% Tween buffer pH 7.5. Afterwards the specific antibody binding was visualized by adding ECL solution (GE healthcare #RPN2105) to the membrane and recording the light signal detected with Stella 8300 (Raytest). For silver staining the protocol described by Tsai et al. 1982, Anal. Biochem., Vol. 119(1), p115-9. was used. Briefly, the gel was fixed overnight in 40% EtOH/5% acetic acid at room temperature. After that the gel was treated for 10 min with 0.7% periodic acid in 40% EtOH/5% acetic acid followed by 3 times 15 min washes with ddH.sub.2O. The gel was stained with staining solution (0.187 N sodium hydroxide, 0.2 N ammonium hydroxide, 0.667% silver nitrate) and again extensively washed for 3 times 10 min with ddH.sub.2O. The LPS on the gel was visualized by adding developing solution (0.25 mg/ml citric acid monohydrate, 0.0185% formaldehyde solution).
[0146] A rabbit serum reactive against serotype 3 was used since the O-antigen structures of APP3 and APP8 are identical (Perry et al. 1990, Serodiagnosis and Immunotherapy in Infectious Disease, Vol. 4(4), p299-308).
[0147] Immunoblotting by using the rabbit serum against the LPS of APP3 showed a strong staining of the lipid A fraction at around 10 kDa and a ladder pattern migrating between ˜12.5 and 190 kDa (O-antigen polymerization on lipid A) of strain APP8 and 3 (
[0148] It can be concluded that the heterologous APP8 rfb cluster (codon optimized and under the control of the kP promoter) could be successfully transferred into the heterologous host SL1344 and resulted in the presentation of APP8 O-antigen on lipid A.
Example 2
2) Cloning of Neutralizing Epitopes of Apx Toxins of APP as Potential Vaccination Candidates
[0149] 2.1) Generation of plasmids encoding soluble neutralizing epitopes of ApxII and ApxIII
[0150] For an effective vaccine against APP infection inactivated toxins (Apx toxoids) are considered to be present in the final vaccine formulation. These pore-forming Apx toxin belong to the major virulence factors of APP and do contribute strongly to the pathogenesis of infection (Bosse et al. 2002, Microbes Infect., Vol. 4(2), p225-235). Four identified Apx toxins (ApxI, II, III and IV) are encoded in their pretoxin structural forms in the apx operon which furthermore encodes the activator gene and secretion-apparatus-encoding genes. The four toxins are expressed in various combinations in the different APP serotypes. APP serotype 2 encodes for ApxII, III and IV (Beck et al. 1994, J. Clin. Microbiol., Vol. 32(11), p2749-2754). Here truncated versions of ApxII and III were generated, expressed in E. coli and purified. In recent publications neutralizing epitopes of ApxII and III were identified which could induce an immune response, and antibodies generated against these epitopes were protective in vitro. Kim et al. 2010 described an N-terminally HIS10 tagged truncated ApxII from APP2 containing amino acid 439-801aa. The Sequence of RTX toxin IIA (ApxII) was retrieved from the database (GenBank: AF363362.1), synthesized and used for generating the truncated HIS10 tagged ApxII(439-801aa) (Seq. 47) encoded on the pMLBAD vector pMLBAD-HIS10-ApxII(439-801aa)). The sequence of ApxIII was retrieved from the database (GenBank: AF363363.1) and used as template for synthesis. In a previous study, it was shown that the N-terminal domain of ApxIII was recognized by a convalescent pig serum, having cytotoxicity neutralizing activity and preventing in vitro neutrophil apoptosis induced by ApxIII (Seah et al. 2004, Vaccine, Vol. 22(11-12), p1494-1497). The N-terminal domain of ApxIII (amino acid 27-245) was synthesized with a C-terminal HIS10 tag (Seq. 48) and used as a template to introduce a start codon and 5′ Xmal/3′ HindIII restriction endonuclease cleavage sites by using primer 5′ Xmal-Xhol-APXIIIne-HIS-fw/3′ APXIIIne-HIS-HindIII-ry in a PCR reaction. The resulting fragment was digested with the respective enzymes and ligated into Xmal/HindIII treated pMLBAD vector (pMLBAD-ApxIII (27-245aa)-H159; in the course of the cloning one HIS epitope was lost). Both plasmids were introduced into E. coli BL21 for protein expression testing and purification for pig vaccination trials. To purify HIS10-ApxII(439-801aa) an overnight culture of BL21 pMLBAD-HIS10-ApxII (439-801aa) grown at 37° C. shaking in LB+Tmp (10 μg/ml) was diluted to 0.1 OD.sub.600 in 1 L LB+Tmp and incubated shaking at 37° C. until the OD600 was around 0.8-0.9. Arabinose (0.2% final concentration) was added to induce the protein expression. Cells were incubated for another 4 h at 37° C. on a shaker and then harvested by centrifugation (5000×g/4° C./10 min and discarding the supernatant). For cell lysis, 20 ml 0.1 mg/ml lysozyme in lx PBS were added. Cells were broken by sonication-freeze-thaw rounds. Briefly, cell pellets were sonicated with an amplitude of 85%, frozen in liquid nitrogen for 1 min and thawed for 10 min at 37° C. (shaking). This procedure was repeated 3 times. The cell suspension was centrifuged for 5 min at 4° C. with 10000×g. It was noticed that during the before described procedure HIS10-ApxII(439-801aa) aggregates which results in the protein to be found in the pellet fraction after centrifugation. Around 20 ml denaturing buffer (6 M guanidinium hydrochloride, 0.1 M TrisHCl pH 8.0) were added to the pellet and the material was centrifuged again for 20 min at 10000×g at 4° C. 4 ml equilibrated Nickel-NTA resin was added to the supernatant and the material was incubated for 1 h on a rotation wheel at 4° C. Afterwards the suspension was loaded on a gravity flow column. The resin was washed 3 times with 10 ml 1×PBS and proteins eluted with 5 times 1 ml denaturing buffer containing 0.5 M imidazole. To analyze the collected material 60 μl of each elution fraction were mixed with 20 μl 4×Lämmli buffer. The samples were cooked for 5 min at 95° C. and 10 μl were loaded on 4-12% Bis-Tris gels, and molecules were separated by size in MES buffer. The gels were further processed for Coomassie staining (
[0151] With the applied method of protein expression and purification, the HIS10-ApxII(439-801aa) could be purified in high quantities via binding to Nickel-NTA resin and elution using gravity flow (
[0152] To purify ApxIII(27-245aa)-HISS an overnight culture of BL21 pMLBAD-ApxIII(27-245aa)-HIS9 grown at 37° C. shaking in TB+Tmp (10 μg/ml) was diluted to 0.1 OD.sub.600 in 1 L TB+Tmp and incubated shaking at 37° C. until the OD.sub.600 was around 0.6-0.8. Arabinose (0.2% final concentration) was added to induce the protein expression. Cells were incubated for another 4 h at 37° C. on a shaker and then harvested by centrifugation. A similar procedure was followed as described for HIS10-ApxII(439-801aa). Briefly, cell lysis was done in a final volume of 70 ml (30 mM Tris HCl pH 7.5, 300 mM NaCl, 20% sucrose, 1 mM EDTA, 1 g/l lysozyme, 1× protease inhibitor cocktail). Cells were lysed by 3 rounds of sonication-freeze-thaw rounds (as described above). The cell suspension was centrifuged for 15 min at 4° C. at 5525×g. The supernatant was centrifuged again for 1 h at 20000×g at 4° C. 0.3 ml Nickel-NTA resin equilibrated in binding buffer (30 mM Tris HCl pH 7.5, 300 mM NaCl) was added to the supernatant and the material was incubated for 1 h on a rotation wheel at 4° C. Afterwards, the suspension was loaded on a gravity flow column. The resin was washed 2 times with 3 ml binding buffer and 1 time with 3 ml washing buffer (30 mM Tris HCl pH 7.5, 300 mM NaCl, 10 mM imidazole). Elution was done by adding 4 times 0.3 ml elution buffer 1 (3 0mM Tris HCl pH 7.5, 300 mM NaCl, 200 mM imidazole), 2 times 0.5 ml elution buffer 2 (30 mM Tris HCl pH 7.5, 300 mM NaCl, 500 mM imidazole) and 3 times 0.5 ml elution buffer 3 (30 mM Tris HCl pH 7.5, 300 mM NaCl, 1M imidazole). To analyze the cell preparation and protein purification all fractions were tested by immunoblot against the HIS epitope and Coomassie staining and it was decided to pool elution fraction 4-8 and exchange the buffer by dialysis in PBS. To analyze the pooled and dialyzed sample, 60 μl of material were mixed with 20 μl 4×Lämmli buffer. The samples were cooked for 5 min at 95° C. and 10 μl were loaded on 4-12% Bis-Tris gels, and molecules were separated by size in MES buffer. The immunoblot using a HIS specific antibody and the Coomassie staining were performed as described above (
2.2) Genomic Integration Of Neutralizing Epitopes of ApxI, II and III as fusion Constructs to be Expressed on Cell Surfaces of Either E. coli_5 or SL1344, Both Expressing the APP2 O-antigen
[0153] For generating a live Salmonella vaccine strain presenting the APP2 LPS and the neutralizing epitopes of Apx toxins on its surface, the corresponding genes were genomically integrated to result in a surface presentation of the neutralizing epitopes. Xu et al. 2018, PlosOne, Vol. 13(1) described a fusion construct consisting of ClyA, a pore-forming hemolytic protein expressed on the cell surface which induces specific immune responses linked to truncated ApxI (628-845aa), truncated ApxII (612-801aa) and truncated ApxIII (626-860aa) with a C-terminal HIS6 tag. In vaccination and challenge studies of mice the group showed elevated immunoglobulin and cytokine levels as well as an increased survival rate after the challenge with different APP serotypes. The sequence of the construct is publicly available and was modified as follows. With an algorithm provided by the synthesizing company the codon usage of ClyA-ApxI(628-845aa)-ApxII(612-801aa)-ApxIII(626-860aa)-HIS6 was optimized for E. coli expression systems. For a strong transcription rate the sequence of the synthetic promoter proD (Davis et al. 2010, Nucleic acids research, Vol. 39(3), p1121-1141) was integrated before the start codon. To select for successful integration into the genome a chloramphenicol resistance cassette (cat) with flanking FRT sites (based on pKD3; Datsenko et al. 2000, PNAS, Vol. 97(12), p6640-6645) was added after the stop codon of the fusion construct. For homologous integration into the genome, upstream and downstream of the construct homologous sequences to the intergenic rfaK-rfaL region were chosen (addition 213bp 5′ of proD promoter, 250bp after the chloramphenicol resistance cassette). The complete synthesized construct is schematically represented in
[0154] Overnight cultures of wild type SL1344, genetically modified cells lacking the endogenous O-antigen biosynthesis (SL1344 Arfb), expressing the APP2 rfb cluster (SL1344 Δrfb::APP2.LPS, Δrfb::KanR-APP2.LPS, Δrfb::KanR-APP2.LPS(cod.opt.), Δrfb::KanR-APP2.LPS rfaL-Ωgne/cat, Δrfb::KanR-APP2.LPS rfaL-Ωgne-wzy(cod. opt.)/cat, Δrfb::KanR-APP2.LPS(cod. opt.) rfaL-Ωgne-wzy(cod. opt.)/cat, Δrfb::kP-APP2.LPS(cod.opt.) rfaL-Q gne-wzy(cod.opt.) or cells with or without integrated improved APP2 rfb cluster expressing ClyA-ApxI(aa626-845)-ApxII(aa612-801)-ApxIII(aa626-860)-HIS6-pagC (SL1344 Δrfb rfaK-ΩproD-ClyA-ApxI(aa626-845)-ApxII(aa612-801)-ApxIII(aa626-860)-HIS6-rfaL, Δrfb::kP-APP2.LPS(cod.opt.) rfaL-Ωgne-wzy(cod.opt.) pliC-ΩproD-ClyA-ApxI(aa626-845)-ApxII(aa612-801)-ApxIII(aa626-860)-HIS6-pagn were diluted to an OD.sub.600/ml of 0.05 in LB medium and grown at 37° C. on a shaker to a logarithmical growth phase (OD.sub.600˜1). In addition, APP2 P1875 strain was grown BHI+NAD to a stationary phase at 37° C. with slow shaking (110 rpm). SL1344 derivatives and APP2 cells were harvested and cooked in 1×Lämmli (1 OD600 cell equivalent/100 μl 1×Lämmli) for 5 min at 95° C. 0.1 OD.sub.600 cell equivalents were loaded on a on 4-12% Bis-Tris gels. As controls purified 2.5 μg HIS10-APXII(439-801aa) and 5 μg ApxIII(27-245aa)-HISS in 1×Lämmli were loaded on the gel. Proteins and whole cell extracts were separated by size in MOPS buffer (loading scheme in
Example 3—Clinical Studies
3.1) Immunization Study in Piglets with Inactivated Vaccine Strains Presenting the Recombinant APP2 O-antigen and Inactivated APP2 Bacteria
[0155] The goals of this first immunization trial was to test safety and immunogenicity of APP2 LPS after intranasal/oral or intramuscular immunization of pigs with inactivated E. coli_5 and SL1344 encoding the APP2 rfb cluster (for trial layout see Table 6).
[0156] Bacterial whole cell vaccines were prepared as following: Group 1 and 6 contained SL1344 Δrfb::kanR-APP2.LPS pMLBAD-gne pEC415-wzy) in which wzy and gne expression needed to be induced (both genes under the control of an arabinose inducible promoter) before preparing the strains for immunization. Due to that the cells were cultivated in LB with the respective antibiotics (see Table 2) and 0.01% arabinose at 37° C. shaking at 180 rpm until an OD.sub.600 of around 0.6. Cells were induced with 0.1% arabinose. After 6 hours of incubation, cells were harvested and re-suspended in PBS buffer. Of these cell suspensions the OD600 was determined (1 OD600 corresponded to 4.1×10E8 cfu). Cells of group 4 and 8 consisted of SL1344 Δrfb and E. coli_5 Δrfb, which were used in a 1:1 mixture in the individual immunezations. These cells were cultured in LB medium until the cultures reached OD.sub.600 above 2 and harvested. APP serotype 2 cells (Group 5 and 9) were inoculated in BHI +NAD to a stationary phase at 37° C. with slow shaking (110 rpm) and harvested and resuspended in PBS buffer. Of the cell suspensions the OD.sub.600 was determined. Due to the culturing conditions the OD.sub.600 to cfu conversion rate varies from the descrybed above (1 OD.sub.600 corresponded to 4.1×10E5 cfu for APP2). Glycoengineered SL1344 as well as the SL1344 Δrfb, E. coli_5 Δrfb and the APP2 cells (in PBS buffer) were heat inactivated by incubating the material for 90 min at 80° C. shaking at 600 rpm. Before applying the material, the cells were tested for complete inactivation.
[0157] Protein based materials were prepared as follows: N-terminally HIS10 tagged neutralizing epitope of ApxII from APP2 (439-801aa) was expressed and purified from E. coli (BL21 pMLBAD-HIS10-ApxII(439-801aa)) via Ni-NTA sepharose binding and imidazole elution over FPLC. The purified protein was dialyzed in PBS. Protein concentration was determined.
[0158] To prepare the materials for intranasal and oral immunization (Groups 1-5) 2 doses of 1 ml per animal per immunization were prepared. Each dose contained 10E11 (Group 1, 4) or 10E8 (Group 5) cfu in PBS, 400 μg HIS10-ApxII(439-801aa) (Group 2) or PBS only (Group 3) and was mixed with Montanide IMS1313 (Seppic) according to supplier information to reach a concentration of 25%.
[0159] For the intramuscular immunization, 0.5 ml total volume per animal were prepared. Each dose contained 0.375 ml inactivated cells (Group 6, 8 with 10E8 cfu, Group 9 with 10E5 cfu in PBS) or 400 μg HIS10-ApxII(439-801aa) (Group 7) and 0.125 ml Montanide ISA 25 (Seppic) to reach a final concentration of 25% adjuvant. The mixture was homogenized according to supplier recommendations. Group 10 was adjuvant control (0.375 ml PBS buffer mixed with 0.125 ml Montanide ISA 25 and homogenized) and Group 11 was kept as an untreated control and did not receive any antigen.
[0160] Table 6 provides an overview of immunization groups 1-11 with applied inactivated cells, protein, adjuvant only or nothing for intranasal and oral or intramuscular application. The amount of antigen and the dose volumes are given. For intra nasal and oral vaccination 3 applications were prepared to be given into each nostril (0.5 ml per nostril) and oral (1 ml).
TABLE-US-00006 TABLE 6 Group Bacteria/proteins immunized Adjuvant Application Amount antigen Dose volume 1 SL1344 Δ rfb::kanR -APP2.LPS Montanide intra nasal 2 × 10E11 cfu 0.5 ml per nostril, pMLBAD-gene pEC415-wzy IMS 1313 & oral (10E11 cfu in 1.0 ml) 1.0 ml oral 2 purified HIS10-ApxII(439-801aa) 2 × 400 ug (400 ug in 1.0 ml) 3 Adjuvant control 4 SL1344 Δ rfb/E. coli_5 Δrfb 2 × 10E11 cfu (10E11 cfu in 1.0 ml) 5 APP serotype 2 strain P1875 2 × 10E8 cfu (10E8 cfu in
1.0 ml) 6 SL1344 Δ rfb::konR -APP2.LPS Montanide intra 10E8 cfu 0.5 ml pMLBAD-gene pEC415-wzy ISA 25 muscular 7 purified HIS10-ApxII(439-801aa) 400 ug 8 SL1344 Δ rfb/E. coli_5 Δrfb 10E8 cfu 9 APP serotype 2 strain P1875 10E5 cfu 10 Adjuvant control 11 Neg control n.a. n.a. n.a. n.a.
indicates data missing or illegible when filed
[0161] For the study, weaned pigs of approximately 4 weeks of age at study day (SD) 0 of a commercial breed of pigs (Swiss Landrace×Large White) were used. The pigs came from a confirmed APP-free holding and all animals were negative for antibodies against APP by ELISA at SD -7. Three animals per group (randomized) were immunized twice at SD 0 and SD 14 (
[0162] Intranasal administration was performed using MAD Nasal Intranasal Mucosal Atomization Device MAD 100 with 3 ml syringe (Teleflex). For each animal two syringes/MAD devices were filled with each 1 ml of air and 0.5 ml of the relevant antigen/adjuvant mixture. Each pig received 0.5 ml per nostril.
[0163] Oral administration was performed using MAD Nasal Intranasal Mucosal Atomization Device MAD 100 OS with 3 ml syringe (Teleflex). For each animal one syringe/MAD device was filled with 1 ml of air and 1 ml of the relevant antigen/adjuvant mixture. The materials were administered on the tonsils.
[0164] For intramuscular administration each animal received 0.5 ml of the antigen/adjuvant mixture by intramuscular injection to the right side of the neck.
[0165] Blood was taken weekly to isolate the serum and the animals were examined at least daily for clinical signs. In comparison to the untreated control, there was a transient increase of rectal temperature up to 41.0° C. from 4 to 10 h after intramuscular injection of adjuvants as well as the vaccine containing adjuvants suggesting a non-specific rise of body temperature in response to adjuvants.
[0166] After euthanasia at SD28 the lungs were removed and BALF (bronchoalveolar lavage fluid) was collected. For each set of lungs, a 500 ml volume of PBS was flushed into the trachea, the lungs were gently inverted for 5 to 10 seconds and the fluid recovered.
[0167] IgG and IgA responses in serum and BALF towards LPS were analyzed by ELISA. Phenol/chloroform extracted LPS (followed instruction manual of iNtRON Biotechnology #17141, processing 10 OD.sub.600 bacteria per reaction) of APP2 and 7 for sera analysis and APP1, 2, 5a and 7 for BALF analysis were coated (0.05 OD.sub.600 equivalent in 100 μl coating buffer (PBS buffer pH 7.5)/well) in a MaxiSorb 96 well plate. The plates were incubated overnight at 4° C. on a shaker. Plates were washed one time with 200 μl washing solution (PBS pH 7.5/0.05% Tween/0.05% casein) per well and 150 μl blocking buffer (PBS pH 7.5/0.05%Tween/0.1% casein) per well was added. The plates were incubated shaking for 1 h at room temperature. The blocking buffer was removed and pig sera from SD 0 (preimmune), and 28 (2 weeks after 2nd immunization/euthanasia date) were added in a 1:500 dilution (in washing solution). BALF from SD 28 was added in a 1:2 dilution (in washing solution). After an incubation period of 1 h, shaking at room temperature, the plates were washed 3 times with 200 μl washing solution per well and secondary pig anti-IgG-HRP (BETHYL Cat#A100-105P) for sera or pig anti-IgA-HRP (BETHYL Cat# A100-102P) antibody for BALF was added in a 1:1000 dilution in washing solution (total 100 μl per well). After an incubation period of 1 h on a shaker at room temperature, the plates were washed 4 times with 200 μl washing solution per well. Development of the plates was done by adding 110 μl developing solution per well (per plate 1.5 mg 3,3′,5,5′-Tetramethylbenzidine dihydrochloride was dissolved in 1.5 ml 100% DMSO and then 13.5 ml 0.05 M phosphate-citrate buffer was added; 2 μl of fresh 30% H.sub.2O.sub.2 was added prior usage). The reaction was stopped by adding 110 μl stop reagent BioFX after appropriate color development was observed. The absorbance was measured at 450 nm by using Tecan Infinite M Nano reader.
[0168] To analyze the immune response towards ApxII, purified N-terminally HIS10 tagged neutralizing epitope of ApxII expressed in BL21 pMLBAD-HIS10-ApxII(439-801aa) as well as purified AcrA-HIS6 protein (HIS6 tagged C. jejuni which was used as negative control) purified from E. coli were used. 500 ng of each protein were coated per well (in 100 μl coating buffer) in 96-well plates (TPP, 92096) and probed against pig sera and BALF. Procedure was done as described above. For the ELISA to detect specific ApxII antibody generation all animals of groups 2 and 7, two animals of groups 3 and 10 and one animal of group 11 were tested.
[0169] Serum IgG analysis (
[0170] For analysis of IgA responses towards APP2 LPS, BALF was used at a 1:2 dilution. The control groups immunized with SL1344 Δrfb and E. coli_5 Arfb, adjuvant and the non-immunized group showed a high background level (
[0171] Animals immunized with purified HIS10-ApxII(439-801aa) (
[0172] No specific IgA towards ApxII were detectable in BALF of pigs immunized with purified HIS10-ApxII(439-801aa). Animal 5136 showed also elevated BALF IgA for AcrA-HIS6 suggesting rather the development of HIS antibodies and not towards ApxII (both modified proteins AcrA and ApxII have only the HIS tag in common and no further homologies). In addition, animals of the control groups (adjuvant and non-immunized control groups) unspecifically recognized HIS10-ApxII(429-801aa) and AcrA-HIS6.
[0173] In conclusion, inactivated antigens were safe in pigs. The observed transient increase of body temperature was most likely mainly attributable to adjuvant reactions. Glycoengineered SL1344 (SL1344 Δrfb::kanR-APP2.LPS pMLBAD-gne pEC415-wzy) was immunogenic and specific serum IgG response towards APP2 LPS was detectable in all 6 pigs, specific IgA towards APP2 LPS was found in 4 out of 6 pigs. Immunization with purified HIS10-ApxII(439-801aa) initiated the formation of specific IgG in serum of intramuscularly immunized pigs (not after mucosal immunization). No specific IgA towards ApxII were detectable in BALF.
3.2) Immunization Study with Improved Live, Recombinant APP Vaccine Strains in Piglets
[0174] In the second immunization trial safety and immunogenicity of live SL1344 encoding the APP2 rfb cluster with improved APP2 O-antigen presentation on the cell surface was tested in pigs (for trial layout see Table 7). Group 1 with SL1344 Δrfb::kanR-APP2.LPS(cod.opt.) rfaL-Ωgne-wzy(cod. opt.)/cat and group 2 was kept as untreated control (no antigen applied).
[0175] For this experiment, live bacteria were prepared as following. Bacteria were cultured in LB medium shaking at 37° C. until the cultures reached OD.sub.600 above 2 and harvested. The OD.sub.600 was determined to estimate the cfu/ml (1 OD.sub.600 equals 4.1×10E8 cfu). The cells were washed with sterile PBS and resuspended in PBS to a cell concentration of 1×10E8 cfu/ml. Cells were kept on ice until applied to the animals.
[0176] Table 7 provides an overview of immunization groups 1 with applied live cells (intranasal and oral) or untreated control group 2. The amount of antigen and the dose volumes are given. For intranasal and oral vaccination 2 applications (2 times 1 ml) were prepared and given into each nostril (each nostril 0.5 ml) and oral (1 ml).
TABLE-US-00007 TABLE 7 Group Test material Application Amount antigen Dose volume 1 SL1344 Δ rfb::kanR -APP2.LPS(cod. opt.) intra nasal 2 × 10E8 cfu 0.5 ml per nostril, rfaL-Ωgne-wzy (cod. opt.)/cat & oral (10E8 cfu in 1.0 ml) 1.0 ml oral 2 untreated control n.a. n.a. n.a. n.a.—not applied
[0177] For the study, Danebreed (a commercial cross of landrace and large white) with Duroc sires pigs of approximately 4-5 weeks of age at SD 0 were used. 6 animals per group (randomized) were immunized twice at SD 0 and SD 14 (
[0178] After euthanasia at SD 28, the lung was removed and a BALF was collected. For each set of lungs, a 500 ml volume of PBS was flushed into the trachea, the lungs gently inverted for 5 to 10 seconds and the fluid recovered (BALF). Persistence of the bacterial strain used for immunization was tested after euthanasia. Swab samples were collected from the tonsils, lung (left and right diaphragmatic lobes) and tracheabronchial lymph nodes of each animal in group 1 and 2. Each swab was aseptically streaked onto a sterile LB agar plate containing Kanamycin and incubated at 37° C. for 16 to 24 hours.
[0179] All animals remained in good health throughout the study. No abnormal clinical signs were observed in any animal. After necropsies, no lung abnormalities were observed. No lesions or other pathologies were noted in the lungs of any animal.
[0180] Bacterial colonies were recovered from two animals in group 1. One animal (number 341609) had a total of 366 colonies recovered from the tonsils, but no other tissues. The second animal (number 341618) had a single colony present from the tonsils and tracheobronchial lymph nodes, but no other tissues. No bacteria could be isolated from animals of the non-immunized control group.
[0181] The sera and BALF immune responses directed against APP2 LPS were analyzed by immunoblot. APP2 P1875 strain was grown in BHI+NAD to a stationary phase at 37° C. with slow shaking (110 rpm). Cells were harvested and used for further processing. For APP2 0-antigen analysis, cells were resuspendded in 1×Lämmli buffer (1 OD.sub.600 cells/100 μl 1×Lämmli buffer). The sample was incubated at 95° C. for 5 min. 12 μg proteinase K per OD.sub.600 equivalent cells (stock 20 mg/ml in 10 mM Tris-HCl pH 7.5, 20 mM CaCl.sub.2, 50% glycerol) were added and the sample was incubated for 1 h at 60° C. Afterwards proteinase K treated sample (0.1 OD.sub.600 cell equivalent) was loaded on 4-12% Bis-Tris gels, and molecules were separated by size in MES buffer. The gels were further processed for immunoblotting. LPS was transferred from the gel onto PVDF membranes. The membranes were incubated in blocking solution (PBS pH 7.5/0.05%Tween/0.1% casein) shaking for 2 h at room temperature. After, the membranes were incubated shaking overnight at 4° C. in antibody binding solution (PBS pH 7.5/0.05% Tween/0.05% casein) containing pig sera of 6 animals of group 1 immunized with SL1344 Δrfb::kanR-APP2.LPS(cod.opt.) rfaL-Ωgne-wzy(cod. opt.)/cat and 2 animals of group 2 (untreated control) at SDO and 28 in a 1:500 dilution and BALF at SD28 in a 1:2 dilution. The immunoblot were washed 3 times for 5 min with an excess of PBS 0.05% Tween buffer pH 7.5. Afterwards the membrane was incubated for 1 h shaking at room temperature in antibody binding solution with secondary pig anti-IgG-HRP antibody (BETHYL Cat#A100-105P) or pig anti-IgA-HRP (BETHYL Cat# A100-102P) in a 1:2000 dilution. The membranes were washed 4 times for 5 min with an excess of PBS 0.05% Tween buffer pH 7.5. Afterwards the specific antibody binding was visualized by adding ECL solution (GE healthcare #RPN2105) to the membrane and recording the light signal detected with Stella 8300 (Raytest).
TABLE-US-00008 TABLE 8 Detected Group Test material immune response Response 1 SL1344 Drfb::kanR-APP2.LPS(cod. opt.) Systemic IgG 6 out of 6 animals rfaL Ωgne-wzy(cod. opt.)/cat Mucosal IgA 5 out of 6 animals 2 Untreated control Systemic IgG 0 out of 2 animals Mucosal IgA 0 out of 2 animals
[0182] Evaluating the specific immune responses against APP2 LPS (Table 8) showed for 6 out of 6 animals immunized with live SL1344 Δrfb::kanR-APP2.LPS(cod.opt.) rfaL-Ωgne-wzy(cod. opt.)/cat (group 1) a clear APP2 LPS recognition by sera IgG at SD 28, which was absent at SD 0. 2 tested animals of group 2 (untreated control) did not show any significant increase in serum IgG directed specifically towards APP2 LPS.
[0183] Analyzing IgA against APP LPS in the BALF shows for 5 out of 6 animals an elevated specific recognition of APP2 O-antigen in group 1. Both tested animals of the untreated control group 1 showed no IgA response against APP2.
[0184] In conclusion, live glycoengineered SL1344 was safe and colonization could be confirmed in 2 pigs after euthanasia. In addition, the recombinant APP2 O-antigen was immunogenic, both systemic IgG and mucosal IgA responses were induced.
3.3) Efficacy of Glycoengineered APP Vaccine Candidates Against APP Serotype 2 in Piglets
[0185] The aim of this study was to examine the efficacy of preventing an APP2 infection in pigs immunized with the developed glycoengineered SL1344 vaccine strain displaying the APP2 O-antigen on its surface (for group overview see Table 9).
[0186] Vaccine strain SL1344 Δrfb::kanR-APP2.LPS(cod.opt.) rfaL-Ωgne-wzy(cod. opt.)/cat was used as live vaccine (group 1), the second strain (SL1344 Δrfb::kanR-APP2.LPS pEC415-wzy pMLBAD-gne with induced wzy and gne expression) was used as inactivated vaccine (group 2). Both were applied in combination with neutralizing epitopes of ApxII and III. Vaccines were administered by oral and intranasal routes, neutralizing epitopes of Apx toxins by intramuscular application at SD 0 and 21 (
[0187] For this experiment bacteria and proteins were prepared as follows. To prepare 5L1344 Δrfb::kanR-APP2.LPS(cod.opt.) rfaL-Ωgne-wzy(cod. opt.)/cat for live vaccination (group 1) the cells were inoculated in LB medium at 37° C. shaking for around 24 h. On the day of vaccination, the bacterial culture grown to stationary phase (OD.sub.600>2) was cooled on ice for approximately 10 min. The culture was centrifuged for 15 minutes at 4100× g at 4° C. The pelleted cells were carefully re-suspended in sterile pre-cooled PBS buffer. The suspension was centrifuged again for 15 minutes at 4100× g at 4° C., the supernatant removed, and the resulting cell pellet resuspended in pre-chilled PBS. The optical density at 600 nm (OD.sub.600) was determined (1 OD.sub.600 corresponded to 4.1×10E8 cfu). Each vaccine dose applied to pigs contained 1×10E8 cfu in 1 ml volume.
[0188] To prepare SL1344 Δrfb::kanR-APP2.LPS pEC415-wzy pMLBAD-gne for inactivation and vaccination (group 2) the cells were inoculated in LB medium at 37° C. shaking overnight. The following day, the OD.sub.600was determined, and cells diluted to 0.075 OD.sub.600/ml in LB medium supplemented with Amp, Tmp and 0.01% arabinose. The culture was incubated at 37° C. shaking. At an OD.sub.600 of 0.6 arabinose was added to 0.1% final concentration to induce the expression of the plasmid-encoded proteins (gne and wzy). The culture was incubated further at 37° C. shaking. Again, after 6 h arabinose was added to 0.1%. The culture was further incubated at 37° C. shaking for 10-12 h. The next day the OD.sub.600 was determined, and the culture was centrifuged for 10 min at 7,000×g at 4° C. The supernatant was removed, then the pelleted cells were carefully resuspended with PBS. The optical density at OD.sub.600 was determined (1 OD.sub.600 corresponded to 4.1×10E8 cfu). For heat inactivation the cell suspension was incubated for 90 min at 80° C. in a water bath. Afterwards the suspension was frozen and stored at −80° C. until the day of vaccination. Before applying the material, the cells were tested for complete inactivation.
[0189] Protein based vaccines were prepared as follows. N-terminally HIS10-tagged neutralizing epitope of ApxII(439-801aa) (group 1-4) was expressed and purified from E. coli (BL21 pMLBAD-HIS10-ApxII(439-801aa)) via Ni-NTA sepharose binding and imidazole elution over FPLC. The purified protein was dialyzed in PBS. Protein concentration was determined. C-terminally HIS9 tagged neutralizing epitope of ApxIII(27-245aa) (group 1-4) was expressed and purified from E. coli (BL21 pMLBAD-APXIII(27-245aa)-H159) via Ni-NTA sepharose binding and imidazole elution. The purified protein was dialyzed in PBS. Protein concentration was determined.
[0190] To prepare the live vaccine (group 1) for intranasal and oral application 2 doses of 1 ml per animal were prepared. Each vaccine dose applied contained 1×10E8 cfu in 1 ml volume.
[0191] To prepare the inactivated vaccines for intranasal and oral vaccination (Groups 2 and 3) 2 doses of 1 ml per animal were prepared. Each dose contained 10E11 (Group 2) and 10E8 (Group 3) cfu in PBS and was mixed with the adjuvant Montanide IMS1313 (Seppic) according to supplier information to reach a concentration of 25%.
[0192] For the intramuscular vaccination of HIS10-APXII(439-801aa) and ApxIII(27-245aa)-HIS9 (group 1-3), 0.5 ml total volume per antigen and per animal were prepared. Each dose contained 0.375 ml 400 μg protein antigen and 0.125 ml Montanide ISA 28 (Seppic) to reach a final concentration of 25%. The mixture was homogenized according to supplier recommendations. Group 4 was kept as untreated control (no antigens applied).
[0193] Challenge material was prepared as follows. Two days prior to challenge infection the APP2 strain HK361 was cultured on HIS+V culture plates and grown overnight at 37° C. and 5% CO.sub.2. The following day, cultures were prepared by transferring one colony to 10 new HIS+V culture plates and incubated for 6 h. After, all colonies of each plate were transferred to tubes filled with PBS and stored overnight in the fridge. The cfu cell/PBS solution were determined by diluting and plating the cells on HIS+V culture plates. The next morning cfu's were determined and the solution was diluted to obtain the challenge concentration of 10E6 cfu/ml.
TABLE-US-00009 TABLE 9 No. Group animals Test materials Adjuvant Route Amount (Volume) Admin. day 1 7.sup.a Live SL1344 Δrfb::kanR- none oral & nasal 10E8 cfu (1 ml) oral & 10E8 SD 0 & SD 21 APP2.LPS(cod.opt.) rfaL - cfu (1 ml) i.n. Ωgne-wzy(cod. opt.)/cat Purified HIS10-APXII(439- MontanidelSA 28 intramuscular 400 μg HIS10-APXII(439- 801aa) 801aa) (0.5 ml)/400 μg Purified APXIII(27-245aa)-HIS9 APXIII(27-245aa)-HIS9 (0.5 ml) 2 7.sup.b Inactivated SL1344 Montanide IMS oral & nasal 10E11 cfu, 0.583 g (1 ml) oral Δrfb::kanR-APP2.LPS 1313 & 10E11 cfu, 0.583 g (1 ml) pEC415-wzy pMLBAD-gne i.n. Purified HIS10-APXII(439- MontanideISA 28 intramuscular 400 μg HIS10-APXII(439- 801aa) 801aa) (0.5 ml)/400 μg Purified APXIII(27-245aa)-HIS9 APXIII(27-245aa)-HIS9 (0.5 ml) 3 8 Purified HIS10-APXII(439- MontanideISA 28 intramuscular 400 μg HIS10-APXII(439- SD 0 & SD 21 801aa) 801aa) (0.5 ml)/400 μg Purified APXIII(27-245aa)-HIS9 APXIII(27-245aa)-HIS9 (0.5 ml) 4 8 Non-vaccinated control group .sup.aOne pig of group 1 died unexpectedly before the study start during the accommodation phase (day −5) most likely due to sudden heart failure. .sup.bOne pig of group 2 died unexpectedly on SD 5. The pig was found dead without prior disease signs. It is most likely not related to the vaccination. A comparable picture was found in the pig of group 1, which died prior to the first vaccination.
[0194] For the study, pigs of approximately 5 weeks of age of a commercial breed of pigs (TOPIGS-Norsvin, TN70, Z-line) were used. The pigs came from confirmed APP-free holdings and all animals were negative for antibodies against APP by ELISA at SD -7. 7-8 animals per group (randomized) were vaccinated 2 times in an interval of 3 weeks (SD 0, SD 21;
[0195] Intranasal administration was performed using MADgic Laryngotracheal Mucosal Atomization Device MAD 600 with 3 ml syringe (Teleflex). For each animal two syringes/MAD devices were filled with each 1 ml of air and 0.5 ml of the relevant antigen/adjuvant mixture. Each pig received 0.5 ml per nostril.
[0196] Oral administration was performed using Nasal Intranasal Mucosal Atomization Device MAD 100 OS with 3 ml syringe (Teleflex). For each animal one syringe/MAD device was filled with 1 ml of air and 1 ml of the relevant antigen/adjuvant mixture. The materials were administered on the tonsils.
[0197] For intramuscular administration each animal received 0.5 ml of each antigen/adjuvant mixture by intramuscular injection to the neck.
[0198] The challenge was performed on day 42 by intranasal inoculation of 2 ml with 10E6 cfu/ml of APP2 strain HK361 by the MAD Nasal™ Intranasal Mucosal Atomization Device)(Teleflex®.
[0199] Blood was taken at SD -6, 7, 14, 21, 28, 35, 41 and 48 (
[0200] At SD 48 days the animals were euthanized, and necropsy was performed. Lesions of the lungs and pleura were scored according to Hannan et al. 1982, Res. Vet. Sci., Vol. 33(1), p76-88. Scoring was based on the percentage of each lobe (7 locations) that is affected by typical APP lesions (Table 10). Both the dorsal and ventral surfaces of each lung were palpated and visually examined, but a single value was arrived at for each lobe based on an average of the entire surface area. Tukey-Kramer's All Pairs Simultaneous Confidence Intervals of Mean Difference and P-Value was used as statistic evaluation method.
TABLE-US-00010 TABLE 10 Lesion scoring Description 0 0% area affected by lesions 1 1-15% area affected by lesions 2 16-30% area affected by lesions 3 31-45% area affected by lesions 4 46-60% area affected by lesions 5 Peracute lungs (swelling, haemorrhage and consolidation of a large part [>50%] or the whole of the lung volume, often with fibrin deposition on the surface)
[0201] To test for the presence or absence of the challenge APP2 strain, from all groups tissue specimens from the lung was sampled for bacteriological analysis. For re-isolation of APP2 bacteria, lung tissue samples were emerged in cooking water for 7 sec and thereafter disrupted in a stomacher to achieve a suspension, of which 100 μl were plated on HIS+V plates and incubated overnight at 37° C. and 5% CO.sub.2. Colonies confirmed by MALDI-TOF.
[0202] No pig showed abnormal local or systemic reactions after vaccinations. There was a moderate increase of body temperatures in all vaccinated pigs 0.5 days after both vaccinations, which returned to normal values 1 day after vaccinations.
[0203] Body temperature was measured twice daily after challenge. There was an increase of rectal temperature starting one day after challenge. In general, temperature rise was lower in vaccinated groups compared to the non-vaccinated control group. This difference was most pronounced at 4 days post challenge, when average temperatures of all vaccinated groups were statistically significantly lower compared to the unvaccinated control group (Table 11).
TABLE-US-00011 TABLE 11 Statistically significant (*) lower increase of body temperature in vaccinated groups (group 1 to 3) compared to the non-vaccinated control group (group 4). Group 1: live SL1344 Δrfb::kcanR- APP2.LPS(cod. opt.) rfaL-Ωgne-wzy(cod. opt.)/cat, purified HIS10-APXII(439-801aa), purified APXIII(27-245aa)-HIS9. Group 2: inactivated SL1344 Δrfb::kanR-APP2.LPS pEC415-wzy pMLBAD- gne, purified HIS10-APXII(439-801aa), purified APXIII(27-245aa)- HIS9. Group 3: purified HIS10-APXII(439-801aa), purified APXIII(27- 245aa)-HIS9. Group 4: non-vaccinated control group. Dunnett's multiple comparison test. Mean 95,00% difference confidence of rectal interval of Adjusted P temperatures difference Value 4 days post challenge, morning measurement Group 4 versus Group 1 0.7071 * 0.2709 to 1.143 0.0003 Group 4 versus Group 2 0.7214 * 0.2852 to 1.158 0.0002 Group 4 versus Group 3 0.5625 * 0.1410 to 0.9840 0.0042 4 days post challenge, afternoon measurement Group 4 versus Group 1 0.6661 * 0.2298 to 1.102 0.0008 Group 4 versus Group 2 0.7946 * 0.3584 to 1.231 <0.0001 Group 4 versus Group 3 0.7000 * 0.2785 to 1.121 0.0002
[0204] Evaluating the lung lesions (see
[0205] 6 out of 7 animals of group 1 vaccinated with inactivated APP2 and Apx neutralizing epitopes had no detectable lung lesions and one animal showed lung lesions with a score of 2. With a mean lung lesion score of 0.286 the lung lesions were significantly (P =0.00369) less developed than in the control animals (group 4).
TABLE-US-00012 TABLE 12 Tukey-Kramer's All Pairs Simultaneous Confidence Intervals of Mean Difference and P-Value of all groups compared to negative control group 4. Shown are the mean, the pairwise differences between the means of the Hannan lung scoring of each group as well as the multiple comparison P-value (group 4 against groups 1-3). This is the significance level at which the difference becomes significant using the Tukey- Kramer multiple comparison procedure. Statistic significant lung scoring compared to group 4 when P-value < 0.05. Mean Group Animals Mean difference P-value 4 8 3.75 1 7 0.285714 3.464 0.00369 2 7 0.285714 3.464 0.00369 3 8 2.25 1.5 0.42721
[0206] The semi-quantitative results of the re-isolation of the challenge strain (Table 13) showed that in all animals of group 4 high numbers of APP2 bacteria could be re-isolated. No statistical evaluation could be done with the data recorded, but a tendency was observed that lung lesion scores positively correlated with the numbers of re-isolated bacteria: In groups 1 only the one pig with detectable lesions revealed high numbers of re-isolated challenge bacteria. In 2 more animals of this group low amount of APP2 could be re-isolated from lung areas without visible lesions. Although groups 1 and 2 did not differ regarding their lung lesion scores (in both groups 6 out of 7 pigs were without lesions), in group 2 the one pig with detectable lesions and five lesion-free pigs were positive in reisolation of low to high numbers of challenge bacteria (6 out of 7 animals APP2 challenge strain positive). For the 4 animals with lung lesions of group 3 high amounts of APP2 could be isolated from the lungs either from areas with lesions or from regions without visible lesions.
TABLE-US-00013 TABLE 13 Comparison of lung lesions scores and culture scores. Lung Re-isolation of APP2 bacteria from lung lesion Total culture Score in lung Score outside Group Animal score score .sup.a lesions .sup.b of lesions .sup.c 1 233 2 +++ +++ − 1 234 0 + − + (17/4) 1 235 0 + − + (10/0) 1 232 0 − − − 1 236 0 − − − 1 237 0 − − − 1 238 0 − − − 2 244 2 +++ +++ + (0/13) 2 243 0 +++ − +++ (1000/0) 2 246 0 ++ − ++ (250/150) 2 239 0 + − + (1/0) 2 240 0 + − + (2/2) 2 245 0 + − + (2/2) 2 241 0 − − − (0/0) 3 265 6 +++ +++ + (3/0) 3 266 6 +++ +++ + (1/0) 3 261 4 +++ − +++ (0/1000) 3 262 2 +++ ++ +++ (>1000/0) 3 259 0 − − − (0/0) 3 260 0 − − − (0/0) 3 263 0 − − − (0/0) 3 264 0 − − − (0/0) 4 268 7 +++ +++ +++ (1000/16) 4 269 6 +++ +++ +++ (>1000/80) 4 257 5 +++ − +++ (2/>1000) 4 256 4 +++ +++ + (0/1) 4 267 4 +++ +++ + (0/2) 4 255 3 +++ +++ + (0/12) 4 258 1 +++ +++ + (21/0) 4 270 0 ++ − ++ (0/250) .sup.a The total challenge strain reisolation culture score is derived from the highest score determined (either in lung lesions or outside of visible lesions). .sup.a Samples were taken from visible lung lesions. .sup.b Samples were taken from two defined lung locations outside of visible lesions. Scoring see above. Total numbers of cfu isolated at 2 locations are given in brackets. Scoring: − (no growth), + (<50 cfu), ++ (50 to 500 cfu), +++ (>500 cfu).
[0207] In summary, the glycoengineered candidate vaccine was highly efficacious and significantly reduced lung lesions in vaccinated animals compared to untreated animals. The experiments prove that a recombinant bacterial vaccine presenting the heterologous APP O-antigen on the surface, optionally in combination with neutralizing epitopes of ApxII and III, can almost completely prevent lung lesion development and strongly reduce colonization of lung with APP challenge bacteria.
3.4) Efficacy of Glycoengineered APP Vaccine Candidates Against APP Serotype 2 in Piglets Administered by Oral and Nasal Route
[0208] The aim of this study was to reproduce the efficacy of inactivated APP2 vaccine strain (SL1344 Δrfb::kanR-APP2.LPS pEC415-wzy pMLBAD-gne with induced wzy and gne expression) when applied orally and intranasally in combination with intramuscularly injected neutralizing epitopes of ApxII and III (Group 1). Furthermore, the efficacy was compared to animals treated with the commercial vaccine Porcilis° APP (Group 2). The procedure was comparable to the experiment described in chapter 3.3. Vaccines were administered at SD 0 and 21. Both groups were compared to non-vaccinated animals (group 3). Pigs were challenged with an infectious dose of APP serotype 2 (HK 361, NCTC 10976) at SD 42 and euthanized at SD 48. The animals were regularly monitored for clinical signs (at least twice daily during the 6 days after challenge) and rectal temperature measurements were performed either once or twice daily.
[0209] For this experiment bacteria and proteins as well as the challenge material were prepared as described in chapter 3.3 above.
TABLE-US-00014 TABLE 14 No. Group animals Test materials Adjuvant Route Amount (Volume) Admin. day 1 8 Inactivated SL1344 Δrfb::kanR-APP2.LPS Montanide IMS 1313 oral & nasal 10E11 cfu (1 ml) oral & 1 SD 0 & SD 21 pEC415-wzy pMLBAD-gne 10E1 cfu, (1 ml) i.n. Purified HIS10-APXII(439-801aa) MontanideISA 28 intramuscular 400 μg HIS10-APXII(439- Purified APXHI(27-245aa)-HIS9 801aa) (0.5 ml)/400 μg APXIII(27-245aa)-HIS9 (0.5 ml) 2 8 Commercial APP vaccine (Porcilis APP) a-Tocopherol intramuscular According to manufacturer manual 3 8 Non-vaccinated control group oral & nasal Phosphate buffered saline
[0210] For the study pigs of approximately 5 weeks of age of a commercial breed of pigs (TOPIGS-Norsvin, TN70, Z-line) were used. The pigs came from confirmed APP-free holdings and all animals were negative for antibodies against APP prior study day 1. 8 animals per group (randomized) were vaccinated 2 times in an interval of 3 weeks (SD 0, SD 21). Intranasal and oral administration of the glycoengineered vaccine as well as the intramuscular injection of the Apx antigens (group 1) was performed as described in chapter 3.3 above. 2 ml Porcilis° APP were injected intramuscular in animals of group 2.
[0211] The challenge was performed on day 42 by intranasal inoculation of 2 ml with 10E6 cfu/ml of APP2 strain HK361 by the MAD Nasal™ Intranasal Mucosal Atomization Device (Teleflex®).
[0212] Blood was taken at SD -1, 7, 14, 20, 28, 35, 41 and 48 to isolate the serum and the animals were examined for clinical signs.
[0213] At SD 48 the animals were euthanized, and necropsy was performed. Lesions of the lungs and pleura were scored according to Hannan et al. 1982, Res. Vet. Sci., Vol. 33(1), p76-88. Scoring was based on the percentage of each lobe (7 locations) that is affected by typical APP lesions (Table 10). Both the dorsal and ventral surfaces of each lung were palpated and visually examined, but a single value was arrived at for each lobe based on an average of the entire surface area. Dunnett's multiple comparison test and P-Value was used as statistic evaluation method.
[0214] To test for the presence or absence of the challenge APP2 strain, from all groups tissue specimens from the lung was sampled for bacteriological analysis. For re-isolation of APP2 bacteria, lung tissue samples were emerged in cooking water for 7 sec and thereafter disrupted in a stomacher to achieve a suspension, of which 100 μl were plated on HIS+V plates and incubated overnight at 37° C. and 5% CO.sub.2. Colonies were confirmed by MALDI-TOF. The bacterial scoring values were translated in 0 =no APP2 bacteria isolated, 1=<20 CFU (colony forming units) APP2 bacteria isolated, 2=<200 CFU APP2 bacteria isolated and 3=>200 CFU APP2 bacteria isolated.
[0215] No pig showed abnormal local or systemic reactions after vaccinations. There was a moderate increase of body temperatures in all vaccinated pigs 0.5 days after both vaccinations, which returned to normal values 1 day after vaccinations.
[0216] Body temperature was measured twice daily after challenge. There was a moderate increase of rectal temperature starting one day after challenge in the control group 3. In general, temperature rise was lower in vaccinated groups compared to the non-vaccinated control group.
[0217] Due to the symptoms caused by the infection animals reaching the human endpoint criteria were euthanized and clinically evaluated.
[0218] Evaluating the lung lesions (see
[0219] None of the animals of group 1 vaccinated with inactivated APP2 and Apx neutralizing epitopes had detectable lung lesions. The vaccination group 1 was significantly different from the control group 3 (P =0.007).
TABLE-US-00015 TABLE 15 Dunnett's multiple comparison and P-Value of all groups compared to negative control group 3. Shown are the mean, the pairwise differences between the means of the Hannan lung scoring of each group as well as the multiple comparison P-value (group 3 against groups 1 and 2). Statistic significant lung scoring compared to group 3 when P-value < 0.05. Mean Group Animals Mean Difference P-value 3 8 3.75 1 8 0 3.75 0.007 2 8 1.125 2.625 0.0527
[0220] The semi-quantitative results of the re-isolation of the challenge strain (
[0221] In summary, the results of the previous study could be confirmed. The glycoengineered candidate vaccine was highly efficacious and resulted in no APP2 bacteria reisolation 6 days post challenge and no lung lesions development in vaccinated animals compared to untreated animals. Furthermore, the efficacy was higher than observed for animals treated with a commercial APP vaccine.