ANALYTE DETECTION
20230115785 · 2023-04-13
Inventors
- Mukhil Raveendran (Freiburg im Breisgau, DE)
- Paolo Actis (Leeds, GB)
- Christopher Paul Walti (Leeds, GB)
- Andrew James Lee (Leeds, GB)
Cpc classification
B82Y5/00
PERFORMING OPERATIONS; TRANSPORTING
C12Q2563/155
CHEMISTRY; METALLURGY
G01N33/48721
PHYSICS
G01N33/52
PHYSICS
C12Q2563/155
CHEMISTRY; METALLURGY
International classification
G01N33/52
PHYSICS
B82Y5/00
PERFORMING OPERATIONS; TRANSPORTING
Abstract
A carrier molecule for the detection of a target analyte comprises a molecular frame which defines a central void, and a binding moiety which is specific for the target analyte. The binding moiety is bound to the frame and positioned such that the target analyte, when bound to the binding moiety, is located in the central void. The carrier molecule finds use in the detection and/or quantification of target analytes in a sample.
Claims
1. A carrier molecule for the detection and/or quantification of a target analyte, the carrier molecule comprising: a molecular frame which defines a central void; and a binding moiety which is specific for the target analyte, wherein the binding moiety is bound to the frame and positioned such that the target analyte, when bound to the binding moiety, is located in the central void.
2. The carrier molecule according to claim 1, wherein the carrier molecule is for carrying the target analyte through a nanopore.
3. The carrier molecule according to claim 1 or claim 2, wherein the molecular frame is formed from a nucleic acid, protein, peptide, or a mixture thereof.
4. The carrier molecule according to any one of claims 1 to 3, wherein the molecular frame is formed partially or entirely from DNA.
5. The carrier molecule according to any one of claims 1 to 4, wherein the molecular frame is formed by DNA or protein origami.
6. The carrier molecule according to any preceding claim, wherein the molecular frame is rectangular, square, circular, oval, triangular, trapezoid, rhomboid, pentagonal, hexagonal, octagonal, kite-shaped or irregular in shape.
7. The carrier molecule according to any preceding claim, wherein the molecular frame has a thickness of no more than about 20 nm.
8. The carrier molecule according to any preceding claim, wherein the molecular frame is substantially 2-dimensional.
9. The carrier molecule according to any preceding claim, wherein the molecular frame has a single conformation.
10. The carrier molecule according to any preceding claim, wherein the molecular frame is substantially rigid.
11. The carrier molecule according to any preceding claim, wherein the central void is sized such that it is capable of receiving the target analyte therein.
12. The carrier molecule according to any preceding claim, wherein the carrier molecule is configured such that: in the absence of a bound target analyte, the carrier molecule produces a double peak in an ion current signature upon translocation of the carrier molecule through a nanopore; and when a target analyte is bound by the binding moiety and located in the central void of the carrier molecule, a single peak in the ion current signature is generated upon translocation of the carrier molecule through a nanopore.
13. The carrier molecule according to any preceding claim, wherein the carrier molecule is configured such that the target analyte, when bound to the binding moiety, substantially fills or occludes the void.
14. The carrier molecule according to any preceding claim, wherein the molecular frame is configured such that at least a portion of a target analyte, when bound by the binding moiety, extends outside of the frame.
15. The carrier molecule according to any preceding claim, wherein the binding moiety comprises an aptamer, an affimer, an antibody (or a derivative or fragment thereof) a molecularly imprinted polymer (MIP) or a nucleic acid-protein fusion molecule.
16. The carrier molecule according to any preceding claim, wherein the binding moiety is bound to the frame via an anchor moiety.
17. A carrier molecule for the detection and/or quantification of a target analyte in a multiplex system comprising: a detection region comprising at least one detection frame, which is a molecular frame which defines a central void, and a binding moiety which is specific for the target analyte, wherein the binding moiety is bound to the frame and positioned such that the target analyte, when bound to the binding moiety, is located in the central void; and a barcode region attached to the detection region, wherein the barcode region comprises at least one nanostructure, wherein the nanostructure is a molecular tile or a molecular frame which lacks a binding moiety.
18. The carrier molecule according to claim 17, wherein the carrier molecule is defined according to any one of claims 2 to 16.
19. The carrier molecule according to claim 17 or claim 18, wherein the barcode region comprises a plurality of nanostructures arranged in series.
20. A composition comprising a carrier molecule according to any one of claims 1 to 19 in solution.
21. The use of a carrier molecule according to any one of claims 1 to 19, for detecting and/or quantifying the presence of a target analyte in a sample, said use comprising translocating the carrier molecule through a nanopore.
22. A complex comprising a carrier molecule according to any one of claims 1 to 19, bound to a target analyte.
23. A method for detecting and/or quantifying the presence of a target analyte in a sample, the method comprising: contacting a carrier molecule according to any one of claims 1 to 19 with the sample; and detecting the presence of a carrier molecule-target analyte complex.
24. The method according to claim 23, wherein detecting the presence of the carrier molecule-target analyte complex is carried out by voltage-driven translocation of the complex through a nanopore.
25. The method of claim 24, wherein a change in the ion current signature relative to the carrier molecule alone, is indicative of the presence of the target analyte in the sample.
26. The method of claim 25, wherein the change in the ion current signature is a change in the peak shape, the peak amplitude and/or the dwell time.
27. The method of claim 25 or claim 26, wherein a change in the peak shape from a double peak to a single peak is indicative of the presence of the target analyte in the sample.
28. The method according to any one of claims 24 to 27, wherein the nanopore is sized so as to avow the passage of a single carrier molecule at a time therethrough.
29. The method according to any one of claims 24 to 28, wherein the nanopore is located at the tip of a nanopipette.
30. The method according to any one of claims 23 to 29, wherein the method is for quantifying the amount of target analyte present in the sample, the method further comprising: contacting the sample with a known concentration of carrier molecule; and determining the ratio of occupied carrier molecules (i.e. carrier molecule-target analyte complexes) to unoccupied carrier molecules (i.e. carrier molecules to which no target analyte has bound).
31. The method according to claim 30, wherein determining the ratio of occupied carrier molecules to unoccupied carrier molecules comprises: subjecting the sample to voltage-driven translocation through a nanopore; and measuring the ion current signatures produced as the carrier molecules translocate through the nanopore, wherein the ratio of single peaks to double peaks in the ion current signatures is indicative of the ratio of occupied carrier molecules to unoccupied carrier molecules.
32. A system for detecting and/or quantifying a target analyte in a sample, the system comprising: a first electrolyte reservoir and a second electrolyte reservoir, the first and second reservoirs being separated by a barrier comprising a nanopore; and optionally, electrodes for translocating molecules through the nanopore from the first electrolyte reservoir to the second electrolyte reservoir, wherein at least one of the first and second electrolyte reservoirs comprises carrier molecules according to any one of claims 1 to 19.
33. The system according to claim 32, wherein the barrier comprises or consists of a membrane, optionally wherein the membrane is a biological membrane or a solid-state membrane.
34. A kit for the detection of a target analyte, the kit comprising: a carrier molecule according to any one of claims 1 to 19; and instructions for use.
35. The kit according to claim 34, wherein the kit further comprises a nanopore, optionally wherein the nanopore is comprised within a nanopipette.
Description
[0168] Embodiments of the invention will now be described by way of example with reference to the accompanying drawings in which:
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
EXAMPLES
[0195] Materials and Methods
[0196] DNA Origami Design
[0197] The three concentric square origamis were designed using the custom made single-stranded DNA (ssDNA) scaffolds of 9073 bp, 8515 bp and 6307 bp whereas the DNA nanostructures used as carriers in this project were designed from 7249 bp m13mp18 ssDNA from Tillibit (Garching, Germany). The procedure for custom made scaffolds is provided below. All short staple strands for the respective nanostructure designs were purchased from IDT (Coralville, Iowa, USA).
[0198] All DNA origami nanostructures were designed using caDNAno software. For the origami folding, a mixture of ssDNA scaffold with a tenfold molar excess of the staple strands in the folding buffer containing 10 nM TrisAc (pH 7.4), 10 mM MgAc and 1 mM EDTA (Sigma Aldrich, USA) was heated to 95° C. and then cooled to room temperature with 1° C./minute decrease. The folded structures were then purified by removal of excess staples via a Sephacryl S400 (GE healthcare,UK) size inclusion column and eluted into the same folding buffer.
[0199] The aptamer sequence containing a modified end sequence with 5′ (aptamer 1) and 3′ (aptamer 2) amine attachment was incorporated into the carrier design in a second thermal annealing step (heating up to 35° C. followed by decrease to room temperature at 0.5° C. per minute) either in the presence of the staples before the purification step, or alternatively immediately after the purification step. Either way resulted in precisely folded frame DNA origami carriers inserted with a aptamer.
TABLE-US-00001 Specific hCRP aptamer 1: (SEQ ID NO. 1) NH2-AAGCCTTTATTTCAACGGCAGGAAGACAAACACGATGGGGGGGTA TGATTTGATGTGGTTGTTGCATGATCGTGGTCTGTGGTGCTGT Specific hCRP aptamer 2: (SEQ ID NO. 2) CGAAGGGGATTCGAGGGGTGATTGCGTGCTCCATTTGGTGTTTTTTTTT TTTGCAAGGATAAAAATTT-NH2 Nonspecific random aptamer: (SEQ ID NO. 3) NH2-CTGAACAAGAAAAATAGCAGAACTTACGAGCCAGGGGAAACAGTA AGGCCTAATTAGGTAAAGGAGTAAGTGCTCGAACGCTTCAGA
[0200] SPR Study
[0201] Aptamer-protein binding studies were carried out via an ESPRIT SPR instrument from Metrohm Autolab B.V (Utrecht, The Netherlands). For this, the end-modified aptamers attached with an amine group were anchored onto the gold SPR surface functionalized with a self-assembled monolayer (SAM) of C11PEG6COOH via EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) NHS (N-hydroxysuccinimide) coupling chemistry. The gold SPR surface from XanTec bioanalytics was cleaned by sonication twice in acetone for 10 minutes and then immersed in an ethanolic 1 mM SAM solution containing 5% acetic acid and allowed to stand at room temperature for 48 hours. Following the incubation, the surface was rinsed with 100% ethanol, quickly dried with nitrogen and was mounted on the SPR system. To attach the DNA aptamers to the gold surface, the COOH-terminated SAM surface was activated with 50 mM EDC and 200 mM NHS in 100 mM MES buffer at pH5.5 for around 15 min. The surface was washed with the MES buffer, followed by a 30-minute incubation with 5 μM of DNA aptamer in 10 mM sodium acetate buffer at pH5.5. Any remaining activated COOH sites were quenched by exposing the surface to 100 mM ethanolamine in water for around 10 min. The surface was then washed with the binding buffer (10 mM TrisAc, 10 mM MgAc, 2 mM CaCl.sub.2 and 1 mM EDTA in water) and then challenged with varying concentration of human CRP. The binding was measured as the change in resonance angle.
[0202] Generation of Concentric Squares Origamis
[0203] A modified phagemid (plasmid with m13 region) was used to create the three scaffolds of varying lengths to create the DNA origamis with similar outer but different cavity dimensions. The scaffolds required for the three DNA origamis (concentric squares (Con) A, B and C) were stitched together from two separate fragments derived from lambda phage DNA along with pBluescript II SK(+) phagemid (PBS). The PBS(+) are plasmids containing the phage origin of replication (f1 ori) and an antibiotic resistance gene which allows for sense strand rescue by a helper phage. The 9 kb custom scaffold required for the DNA origami ConA was created by inserting a 6.1 kb sequence, derived as two separate fragments from lambda phage, into the 2.9 kb phagemid. These two fragments (approximately 1.8 kb and 4.2 kb) were selected devoid of protein coding regions to eliminate any interference in the phage growth and downstream process.
[0204] The three fragments that make up the scaffold—referred to as f1, f2 and f3—were PCR amplified from lambda phage DNA and the PBS plasmid, respectively, using appropriate primers. The primers used in the amplification procedure were designed to incorporate the restriction sites EcoRI and NspI flanking f2, and NcoI and NspI flanking f3. The two fragments were then restriction digested with the respective enzymes to form compatible overhangs, and then ligated to yield one long fragment (f23). Fragment f1 was then combined with fragment f23 using HiFi DNA assembly cloning (NEB, UK), resulting in the double stranded circular f123 dsDNA.
[0205] Subsequently the circular dsDNA (f123) was chemically transformed in competent E. coli cells to produce the custom scaffold. The transformed cells with the f123 plasmid were selected using their antibiotic resistance gene and recovered with a miniprep to be co-transformed with helper plasmids (m13cp cells) to produce ssDNA f123. The final ssDNA f123 product constituted 9073 bp and made up the scaffold for the largest DNA construct ConA.
[0206] The scaffolds for the two smaller DNA constructs, ConB and ConC, were produced by PCR amplification of the double stranded f123 as template. As before the primers were designed to incorporate the restriction digest site KasI for the product ConB and BmtI for the product ConC. Subsequent restriction and ligation followed by similar co-transformation protocol with helper plasmids as above resulted in 8515 bp and 6307 bp ssDNA scaffolds for Con B and C, respectively. In the first instance, the scaffolds were produced in 5 ml cultures later on followed by large-scale scaffold harvesting by scaling up to 1-litre cultures. The cultures were harvested by separating the bacteria from the phage and subsequent phenol chloroform DNA extraction.
[0207] Nanopipette Fabrication and Ion Current Measurements
[0208] The nanopipettes with ˜100 nm pore diameters were fabricated from glass capillaries of 0.5 mm inner diameter (QF100-50-7.5, World precision Instruments, UK) using a Sutter instrument model P-2000 laser puller. The pulling protocol comprised two separate lines with the parameters HEAT 575 FIL 3 VEL 35 DEL 145 PULL 75 and HEA T900 FIL 2 VEL 15 DEL 128 PULL 150. The protocol revealed highly consistent glass nanopipettes with a standard deviation of less than ±12 nm with pipettes pulled on different days. An Ag/AgCl wire (0.25 mm diameter, Sigma Aldrich, UK) was inserted into the nanopipettes as a working electrode.
[0209] For the translocation experiments the nanopipettes with the working electrode were filled with the translocation buffer (0.1 M KCl with 10 mM TrisAc, 10 mM MgAc, 2 mM CaCl.sub.2) and 1 mM EDTA) containing the DNA origami and analyte where applicable at a final concentration of 500 pM. The Mg is required to maintain the stability of the DNA origami, and the Ca to match the buffer conditions used to select the DNA aptamers employed as binding moieties. The grounded counter electrode was immersed in a 0.1 M KCl solution completing the circuit. On application of a negative potential to the working electrode inside the nanopipette, DNA origami from inside the nanopipette are translocated out into the electrolyte solution resulting in a modulation of the ion current. Ion current data were acquired using an Axon instruments-patch clamp system (Molecular devices, USA). Measurements were recorded using the Axopatch 700b amplifier, and the data were acquired at a rate of 100 kHz and 20 kHz low pass filtered. Initial data analysis was carried out with a custom MATLAB script (provided by Prof. Joshua Edel, Imperial College, London, UK) and further data analysis was done using Pro FIT(QuanSoft, Switzerland).
[0210] AFM
[0211] DNA origami samples were deposited on freshly cleaved mica discs for 10-15 minutes at room temperature and topped up with scanning buffer containing 10 mM TrisAc (pH 7.4) and 10 mM MgAc, 1 mM EDTA. For observing protein binding to carriers, 2 mM CaCl.sub.2 was included to the scanning buffer similar to the nanopipette translocation experiments. The DNA origami samples were imaged using a Bruker Dimension Fastscan (Santa Barbara, Calif., USA) with Fastscan D Si.sub.3N.sub.4 cantilevers containing a Si tip in tapping mode in liquid. Images were obtained with scan rates of 20 kHz (256×256 pixels).
Example 1: Concentric Squares
[0212] It was hypothesized that if a DNA origami is designed to contain a cavity in the center into which the analyte of interest can bind specifically, the presence or absence of the analyte from the origami can be detected using a nanopore by observing the characteristic translocation ion current peak. The frequencies of the two characteristically different peaks can be computed from the observation of a large number of individual peaks to obtain an analyte-concentration dependent signal.
[0213] To gain further insight into the design parameters of the cavity in the DNA origami, we designed three different DNA nanostructures with identical outer but variable cavity dimensions. The three DNA nanostructures resemble a set of three concentric squares and are referred to as ConA for a solid nanostructure (100 nm length×85 nm height), ConB and ConC for a nanostructure of identical outer dimension but containing a central cavity of 30 nm length×12 nm height and 65 nm length×35 nm height, respectively, as shown in
[0214] The concentric square nanostructures were all designed to be folded according to established DNA origami principles. The three tiles are made from the same DNA, i.e. the same set of DNA oligonucleotides staples and DNA scaffold by simply shorten in the scaffold and leaving out the appropriate staples to generate the cavities of different size. For example, the scaffold DNA used to assemble ConB was the same as the one used for assembling ConA but with the part that folds the central part removed. This ensures that as much as possible of the structure remained identical between DNA origami while varying the cavity dimension so we can directly correlate the ion current signature to the cavity volume.
[0215] The folded DNA nanostructures were imaged with Atomic Force Microscopy (AFM) to confirm successful assembly. Representative AFM images are shown in
[0216] Nanopore translocation study for the individual concentric square samples was conducted through glass nanopipettes with ˜100 nm pore diameter. The nanopipettes were fabricated via laser pulling and showed a resistance of 86±10 MΩ in 0.1 M KCl. Translocation of the concentric squares was carried out by loading a sample solution at a concentration of 500 pM into the nanopipette and recording the ion current while applying a constant voltage of −350 mV across the nanopore.
[0217]
[0218] ConC (large cavity) translocates through the nanopore significantly slower (dwell time=0.31±0.14 ms) and leads to a smaller ion current increase (peak amplitude=86±19 pA) when compared to that of ConB (small cavity; dwell time=0.22±0.06 ms and peak amplitude=97±13 pA). In contrast, the ConA (no cavity) nanostructure causes the largest ion current increase (peak amplitude=121±23 pA) with the shortest dwell time (0.15±0.01 ms). When taken together, these parameters allow us to identify distinct populations (
Example 2: DNA Nanostructures as Translocation Carriers in Biosensing
[0219] The relationship of translocation ion current peak signature to cavity geometry within these DNA nanostructures provides a unique opportunity to detect the presence of a much smaller molecule. If a binding moiety specific to the molecule of interest is placed within the cavity of the DNA nanostructure, the binding of a target analyte to the binding moiety partially fills the cavity which in turn results in a characteristic change to the ion current signature (
[0220] In order to explore this and as a proof of principle, we demonstrate the quantitative detection of C-reactive protein (CRP), which is an established inflammation biomarker. In a healthy adult the median CRP concentration is 0.8 mg/L, and its concentration in blood exceeds 1 mg/mL (8 μM) as a result of an inflammatory response. CRP exists as a pentamer with a molecular weight of approximately 125 kDa and a size of around 11 nm. We designed a DNA nanostructure with a central cavity large enough for a CRP molecule to fit in but at the same time small enough such that the presence of CRP in the cavity will make a measurable difference to the translocation ion current. As informed by the study with concentric squares (Example 1), the nanostructure was designed with a central cavity of 35 length×35 nm width to provide a robust double peak signature (
[0221] An internal anchor stub was introduced within the central cavity such that a specific capture moiety can be placed inside the cavity via DNA hybridization (
[0222] A notch was also included at one corner of the DNA origami to act as a polarity marker to identify the orientation of the origami in AFM images (
[0223] The performance of the DNA aptamer within the context of the carrier (i.e. aptamer hybridized within the DNA nanostructure,
[0224] To exploit the DNA nanostructure carrier in single-molecule nanopore sensing, the occupied and unoccupied carriers need to have unique fingerprints (composed of dwell time, amplitude and shape of the ion current peak) which relate to the presence of CRP within the carrier. Nanopore translocation studies of the carriers (at 500 pM concentration) using glass nanopipettes were carried out as above. The quantitative analysis of more than 100 translocation peaks revealed a peak amplitude of 65±6 pA and dwell time of 0.29±0.1 ms (
[0225] Similarly, to analyse the CRP-occupied carriers we used an equimolar solution of CRP and carriers at 9 nM with the aim of having a mixed population of occupied and unoccupied carriers. The solution was incubated at room temperature for 30 min in translocation buffer and subjected to nanopipette translocation at 500 pM concentration, which led to a mixed population of single and double peaks in the ion current. The analysis of the peak amplitudes and dwell times of the two classes of peaks revealed a bipolar distribution. The double peaks had an average peak amplitude of 62±4 pA and dwell time of 0.33±0.03 ms (
[0226] Together with the results of the concentric squares study which showed that the peak shape changes from a double peak to a single peak upon filling in the central cavity, we speculate that the single peak events correspond to occupied carriers, i.e. carriers with a CRP bound to the specific aptamer. Furthermore, the double peaks are accounting for approximately 30% of the total number of observed events. This is in line with the percentage of occupied carriers that would be expected based on the Kd obtained from the SPR experiments, which suggests that the percentage is concentration dependent as expected.
[0227] However, in order to use this approach for high-sensitivity biosensing, a reliable way of classifying the different ion current events is required.
[0228] This now enables the classification of observed ion current peaks into three categories, double peaks representing unoccupied carriers, single peaks representing CRP-occupied carriers, and unclassified peaks which resemble neither a double nor a single peak. This multi-parameter classification allows the discarding of ambiguous translocation events, for example resulting from broken carriers, in a robust way. Such events would likely resemble single peaks and hence represent false positives. To illustrate this, the DNA nanostructures were deliberately disrupted by incubating in 10 mM CaCl.sub.2 for 30 min to substitute the constituent Mg.sup.2+ with Ca.sup.2+ prior to translocation. AFM micrographs demonstrated that the carriers had been degraded significantly. During the translocation experiments only very few events were recorded, and the peak amplitude vs dwell time scatter plot shows that none of the recorded peaks fall within the relevant confidence ellipse (
[0229] Importantly, due to the large dimensions of the nanopipette pore (100 nm) compared to the diameter of CRP (11 nm), the translocation of CRP alone does not lead to a detectable ion current signature and hence cannot be detected by our nanopipette sensor (
Example 3: Quantitative Single Molecule Biosensing
[0230] To demonstrate quantitative sensing using the translocation of carriers with specific DNA aptamers, and the concept of counting single individual carrier molecules classified through the three-parameter approach (peak dwell time, amplitude and shape), we analysed the ion currents of a range of translocation experiments at different CRP concentrations.
[0231]
[0232]
[0233] To investigate the specificity of our sensing system, and in particular of the carriers to the CRP target, a random DNA sequence was selected to act as a non-specific aptamer and the translocation ion current was measured for carrier concentration of 9 nM and CRP concentration of 90 nM, i.e. the highest concentration reported in
[0234] Furthermore, the CRP-specific carrier (at a 9 nM concentration) was subjected to 90 nM of a control protein of similar size as CRP (MupB), and the results of the ion current analysis is shown in
[0235] Using the three-parameter classification (amplitude, dwell time and ion current signature) quantitative detection down to 3 nM CRP in ˜5 μl sample volume was achieved within a 2-minute sampling window.
[0236] Importantly, a similar study but with a different CRP-specific aptamer (aptamer 2) incorporated into the carrier was carried out. Very similar results to the carrier version with CRP aptamer 1 were obtained, demonstrating the robustness of the biosensing approach.
[0237] For applications in clinical diagnostics, it is important that quantitative detection of analytes such as CRP can also be performed in complex biological fluids. To demonstrate the performance of this sensor system with such fluids, nanopipettes were filled with solution of 5% human plasma diluted in 0.1 M KCl and spiked with the desired concentration of CRP ranging from 3 nM to 36 nM. Similar to the situation in buffer, the carriers in 5% plasma without CRP produced ion current double peak events, but with a slightly lower dwell time of 0.26±0.06 ms and peak amplitude of 55±6 pA (
[0238] The different ion current events observed during a translocation experiment with 5% plasma can be classified into single peaks, double peaks and unclassified peaks in the same way as in buffer.
[0239] The normalised single peak count, i.e. the ratio of single peaks vs total classified peaks, is shown in
Example 4: Carrier Multiplexing and Identify Barcodes
[0240] In order to multiplex the biosensing technology we can form ‘ribbons’ or polymers through the connection of multiple DNA nanostructures together. These ribbons may contain two functional elements; 1) an analyte detection region and 2) a barcode region.
[0241] The analyte detection region comprises a structure which takes the form of the carrier molecules already described, comprising a nucleic acid frame and a binding moiety. The empty or unoccupied frame produces a double peak in the ion current signal, whereas the presence of a bound analyte produces a single peak.
[0242] The barcode region is for identifying the ribbon, and it is this region that enables the detection of multiple analytes in a single sample. The barcode region makes use of the identified relationship between ion current signature and nanostructure geometry: For example, a solid tile structure produces a single peak whereas a frame-like structure produces a double peak. A finer implementation of this includes variations of frame cavity sizes to provide additional signals. The barcode region may comprise two or more subunits attached together in a specific order to provide a unique ion current fingerprint. These arrangements are inherently modular and therefore provide a flexible and economic approach.
[0243]
[0244] The barcode region 12 is attached to a detection region 18 comprising a first detection frame 20 containing a first aptamer A1, and a second detection frame 22 containing a second aptamer A2. In the embodiment shown the second aptamer A2 is specific for a different analyte to the first aptamer A1, although it will be appreciated that in alternative embodiments the aptamers may be the same. Three further nucleic acid frames 16, 24, each lack a binding moiety, make up the detection region 18. However, it will be appreciated that this approach is inherently modular and the nanostructure subunits can be rearranged in any fashion to provide unique barcode/analyte ribbons for the desired purpose.
[0245] The frames and tiles of the ribbon structure 10 shown in
[0246] The attachment of the DNA nanostructure subunits together into ribbons can be achieved through the interaction of protruding DNA linkers.
CONCLUSIONS
[0247] We have demonstrated an alternative carrier molecule approach using a nucleic acid frame, specifically a DNA origami nanostructure, that is both selective and sensitive to the target analyte of interest. By utilizing the definite structural property of DNA origami towards translocating ion current, we employed frame DNA nanostructures in combination with glass nanopipettes as a biosensing platform that can detect and quantify single analyte molecules. We showed that by folding a long linear DNA, which is often the carrier of choice for nanopore experiments, many of the setbacks could be overcome. The specific ion current signature of the DNA origami carrier not only removes false positive incidents due to knots and folds but also eliminates the ‘tail to head’ and ‘head to tail’ events which are encountered with modified long linear DNA strands with respect to its translocation direction. This means our carriers exhibit a similar peak amplitude and dwell time translocation data that can be further verified with the specific ion current signature rather than the various ion current conductance events produced for linear DNA.
[0248] Moreover, the spatial addressability of the carriers of the present invention facilitates the incorporation of binding moieties such as aptamers in the DNA nanostructures at specific positions, that can influence the ion current.
[0249] Additionally, the change in ion current signature with respect to the position of the target analyte (CRP) provided a visual indication (double peak to single peak) towards target capture, in addition to the peak amplitude and dwell time difference. Through this three-factor technique we could quantitatively detect single analyte molecules in low concentrations high specificity. Importantly, the experiments demonstrated the ability of the carriers to detect the target analyte in complex plasma samples with similar sensitivity and signal to noise as seen in simple KCl buffer.
[0250] Yet another advantage of a nucleic acid frame carrier is that target capture can be visualized using microscopy techniques. Furthermore, the carrier molecule could be easily modified for multiplexing, enabling the detection of multiple target molecules simultaneously.