Antibodies targeting a galactan-based O-antigen of K. pneumoniae
11466074 · 2022-10-11
Assignee
Inventors
- Valeria Szijarto (Vienna, AT)
- Gábor NAGY (Sopron, HU)
- Luis Guachalla (Vienna, AT)
- Zehra VISRAM (Vienna, AT)
- Eszter Nagy (Vienna, AT)
- Jolanta Katarzyna LUKASIEWICZ (Wroclaw, PL)
Cpc classification
C07K2317/76
CHEMISTRY; METALLURGY
G01N33/56916
PHYSICS
C07K16/1228
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The invention provides for an isolated antibody that specifically recognizes a galactan-III epitope of the lipopolysaccharide (LPS) O-antigen structure of Klebsiella pneumoniae, which epitope is incorporated in galactan-III repeating units, wherein the galactan-III repeating unit is a branched galactose homopolymer of Formula (I). The invention further provides for a pharmaceutical or diagnostic preparation comprising said antibody, and a method of producing said antibody. ##STR00001##
Claims
1. An isolated antibody comprising an antigen-binding site that specifically recognizes a galactan-III epitope of the lipopolysaccharide (LPS) O-antigen structure of Klebsiella pneumoniae, which epitope is incorporated in galactan-III repeating units, wherein each galactan-III repeating unit is a branched galactose homopolymer of Formula (I) ##STR00004## which antigen-binding site is of an antibody heavy chain variable region (VH), which comprises a combination of VH-CDR sequences designated as CDR1 to CDR3, and an antibody light chain variable region (VL), which comprises a combination of VL-CDR sequences designated as CDR4 to CDR6, wherein the antibody is selected from the group consisting of: i) is an antibody which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID NO:7; b) a CDR2 consisting of the amino acid sequence of SEQ ID NO:8; c) a CDR3 consisting of the amino acid sequence of SEQ ID NO:9; d) a CDR4 consisting of the amino acid sequence of SEQ ID NO:19; e) a CDR5 consisting of the amino acid sequence of SEQ ID NO:20; and f) a CDR6 consisting of the amino acid sequence of SEQ ID NO:18; ii) is an antibody which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID NO:1; b) a CDR2 consisting of the amino acid sequence of SEQ ID NO:2; c) a CDR3 consisting of the amino acid sequence of SEQ ID NO:3; d) a CDR4 consisting of the amino acid sequence of SEQ ID NO:13; e) a CDR5 consisting of the amino acid sequence of SEQ ID NO:14; and f) a CDR6 consisting of the amino acid sequence of SEQ ID NO:15; iii) is an antibody which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID NO:4; b) a CDR2 consisting of the amino acid sequence of SEQ ID NO:5; c) a CDR3 consisting of the amino acid sequence of SEQ ID NO:6; d) a CDR4 consisting of the amino acid sequence of SEQ ID NO:16; e) a CDR5 consisting of the amino acid sequence of SEQ ID NO:17; and f) a CDR6 consisting of the amino acid sequence of SEQ ID NO:18; iv) is an antibody which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID NO:10; b) a CDR2 consisting of the amino acid sequence of SEQ ID NO:11; c) a CDR3 consisting of the amino acid sequence of SEQ ID NO:12; d) a CDR4 consisting of the amino acid sequence of SEQ ID NO:19; e) a CDR5 consisting of the amino acid sequence of SEQ ID NO:17; and f) a CDR6 consisting of the amino acid sequence of SEQ ID NO:18; v) is an antibody which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID NO:4; b) a CDR2 consisting of the amino acid sequence of SEQ ID NO:5; c) a CDR3 consisting of the amino acid sequence of SEQ ID NO:6; d) a CDR4 consisting of the amino acid sequence of SEQ ID NO:19; e) a CDR5 consisting of the amino acid sequence of SEQ ID NO:20; and f) a CDR6 consisting of the amino acid sequence of SEQ ID NO:18; and vi) is an antibody which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID NO:10; b) a CDR2 consisting of the amino acid sequence of SEQ ID NO:11; c) a CDR3 consisting of the amino acid sequence of SEQ ID NO:12; d) a CDR4 consisting of the amino acid sequence of SEQ ID NO:19; e) a CDR5 consisting of the amino acid sequence of SEQ ID NO:20; and f) a CDR6 consisting of the amino acid sequence of SEQ ID NO:18.
2. The antibody of claim 1, wherein the galactan-III epitope is of multi-drug resistant (MDR) Klebsiella pneumoniae.
3. The antibody of claim 1, which neutralizes endotoxin of Klebsiella pneumoniae strains expressing the galactan-III epitope and has an affinity to bind the galactan-III epitope with a Kd of less than 10.sup.−7M.
4. A pharmaceutical preparation comprising the antibody of claim 1, comprising a parenteral or mucosal formulation, which contains a pharmaceutically acceptable carrier or excipient.
5. A diagnostic preparation or a kit comprising a) the antibody of claim 1; b) a further diagnostic reagent; c) and optionally a solid phase to immobilize the antibody or the diagnostic reagent or both; wherein the diagnostic preparation is a composition.
6. The diagnostic preparation of claim 5, wherein the further diagnostic reagent is a diagnostic label or a reagent specifically reacting with the antibody and/or the reaction product of the antibody binding to the galactan-III epitope of the LPS O-antigen structure.
7. The antibody of claim 1, which is any of the following: a) an antibody comprising the VH sequence of SEQ ID NO:21, and the VL sequence of SEQ ID NO:22; or b) an antibody comprising the VH sequence of SEQ ID NO:23, and the VL sequence of SEQ ID NO:24; or c) an antibody comprising the VH sequence of SEQ ID NO:25, and the VL sequence of SEQ ID NO:26; or d) an antibody comprising the VH sequence of SEQ ID NO:27, and the VL sequence of SEQ ID NO:28; or e) an antibody comprising the VH sequence of SEQ ID NO:29, and the VL sequence of SEQ ID NO:30; or f) an antibody comprising the VH sequence of SEQ ID NO:31, and the VL sequence of SEQ ID NO:32; or g) an antibody comprising the VH sequence of SEQ ID NO:33, and the VL sequence of SEQ ID NO:34; or h) an antibody comprising the VH sequence of SEQ ID NO:35, and the VL sequence of SEQ ID NO:36; or i) an antibody comprising the VH sequence of SEQ ID NO:37, and the VL sequence of SEQ ID NO:38, or which is a human, humanized, chimeric, murine, or affinity matured variant of any of the foregoing comprising said antigen-binding site.
8. The diagnostic preparation of claim 5, wherein the composition or kit further comprises a solid phase to immobilize the antibody or the diagnostic reagent or both.
9. The antibody of claim 2, wherein the galactan-III epitope is the galactan-III epitope of the MDR clone ST258.
10. A method of protecting against Klebsiella pneumoniae comprising administering an effective amount of the antibody of claim 1 to a mammalian subject at risk of Klebsiella pneumoniae infection or Klebsiella pneumoniae colonization, or to a patient suffering from Klebsiella pneumoniae infection.
11. A method of diagnosing a Klebsiella pneumoniae infection or colonization by a Klebsiella pneumoniae strain in a mammalian subject, the method comprising: (a) providing a biological sample of the subject and providing the antibody according to claim 1, and (b) detecting the specific binding of the antibody to the galactan-Ill epitope of the LPS O-antigen structure of the Klebsiella pneumoniae strain in the biological sample of the subject, thereby diagnosing the Klebsiella pneumoniae infection or the Klebsiella pneumoniae colonization.
12. The method of claim 10, wherein the biological sample is a body fluid or a tissue sample.
13. The method of claim 12, wherein the body fluid or the tissue sample is selected from the group consisting of a blood sample, stool sample, skin sample, urine sample, cerebrospinal sample, and respiratory tract specimen.
14. The method of claim 13, wherein the respiratory tract specimen is an endotracheal aspirate, pleural fluid, lung tap, nasal swab, or sputum.
Description
FIGURES
(1)
(2) The nomenclature as used in
(3) VH CDR1=CDR1
(4) VH CDR2=CDR2
(5) VH CDR3=CDR3
(6) VL CDR4=CDR4=VL CDR1
(7) VL CDR5=CDR5=VL CDR2
(8) VL CDR6=CDR6=VL CDR3
(9)
(10) G3-43 VH: (including CDR sequences of VH 5A4-A7)
(11) G3-43 VL: (including CDR sequences of VL 5A4-A7)
(12) G3-46 VH: (including CDR sequences of VH 5A4-A7)
(13) G3-46 VL: (including CDR sequences of VL 5A4-A7)
(14) G3-77 VH: (including CDR sequences of VH 9H9-H7)
(15) G3-77 VL: (including CDR sequences of VL 5A4-A7)
(16) G3-78 VH: (including CDR sequences of VH 9H9-H7)
(17) G3-78 VL: (including CDR sequences of VL 5A4-A7)
(18) G3-97 VH: (including CDR sequences of VH 2D8-A10)
(19) G3-97 VL: (including CDR sequences of VL 5A4-A7)
(20) FR sequences of the VH: FR1 (located N-terminal to CDR1), FR2 (located between CDR1 and CDR2), FR3 (located between CDR2 and CDR3) and FR4 (located C-terminal to CDR3).
(21) FR sequences of the VL: FR1 (located N-terminal to CDR4), FR2 (located between CDR4 and CDR5), FR3 (located between CDR5 and CDR6) and FR4 (located C-terminal to CDR6).
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
DETAILED DESCRIPTION OF THE INVENTION
(32) The term “antibody” as used herein shall refer to polypeptides or proteins that consist of or comprise antibody domains, which are understood as constant and/or variable domains of the heavy and/or light chains of immunoglobulins, with or without a linker sequence. Polypeptides are understood as antibody domains, if comprising a beta-barrel structure consisting of at least two beta-strands of an antibody domain structure connected by a loop sequence. Antibody domains may be of native structure or modified by mutagenesis or derivatization, e.g. to modify the antigen binding properties or any other property, such as stability or functional properties, such as binding to the Fc receptors FcRn and/or Fcgamma receptor.
(33) The antibody as used herein has a specific binding site to bind one or more antigens or one or more epitopes of such antigens, specifically comprising a CDR binding site of a single variable antibody domain, such as VH, VL or VHH, or a binding site of pairs of variable antibody domains, such as a VL/VH pair, an antibody comprising a VL/VH domain pair and constant antibody domains, such as Fab, F(ab′), (Fab).sub.2, scFv, Fv, or a full length antibody.
(34) The term “antibody” as used herein shall particularly refer to antibody formats comprising or consisting of single variable antibody domain, such as VH, VL or VHH, or combinations of variable and/or constant antibody domains with or without a linking sequence or hinge region, including pairs of variable antibody domains, such as a VL/VH pair, an antibody comprising or consisting of a VL/VH domain pair and constant antibody domains, such as heavy-chain antibodies, Fab, F(ab'), (Fab).sub.2, scFv, Fd, Fv, or a full-length antibody, e.g. of an IgG type (e.g., an IgG1, IgG2, IgG3, or IgG4 sub-type), IgA1, IgA2, IgD, IgE, or IgM antibody. The term “full length antibody” can be used to refer to any antibody molecule comprising at least most of the Fc domain and other domains commonly found in a naturally occurring antibody monomer. This phrase is used herein to emphasize that a particular antibody molecule is not an antibody fragment.
(35) The term “antibody” shall specifically include antibodies in the isolated form, which are substantially free of other antibodies directed against different target antigens or comprising a different structural arrangement of antibody domains. Still, an isolated antibody may be comprised in a combination preparation, containing a combination of the isolated antibody, e.g. with at least one other antibody, such as monoclonal antibodies or antibody fragments having different specificities.
(36) The term “antibody” shall apply to antibodies of animal origin, including human species, such as mammalian, including human, murine, rabbit, goat, lama, cow and horse, or avian, such as hen, which term shall particularly include recombinant antibodies which are based on a sequence of animal origin, e.g. human sequences.
(37) The term “antibody” further applies to chimeric antibodies with sequences of origin of different species, such as sequences of murine and human origin.
(38) The term “chimeric” as used with respect to an antibody refers to those antibodies wherein one portion of each of the amino acid sequences of heavy and light chains is homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular class, while the remaining segment of the chain is homologous to corresponding sequences in another species or class. Typically the variable region of both light and heavy chains mimics the variable regions of antibodies derived from one species of mammals, while the constant portions are homologous to sequences of antibodies derived from another. For example, the variable region can be derived from presently known sources using readily available B-cells or hybridomas from non-human host organisms in combination with constant regions derived from, for example, human cell preparations.
(39) The term “antibody” may further apply to humanized antibodies.
(40) The term “humanized” as used with respect to an antibody refers to a molecule having an antigen binding site that is substantially derived from an immunoglobulin from a non-human species, wherein the remaining immunoglobulin structure of the molecule is based upon the structure and/or sequence of a human immunoglobulin. The antigen binding site may either comprise complete variable domains fused onto constant domains or only the complementarity determining regions (CDR) grafted onto appropriate framework regions in the variable domains. Antigen-binding sites may be wild-type or modified, e.g. by one or more amino acid substitutions, preferably modified to resemble human immunoglobulins more closely. Some forms of humanized antibodies preserve all CDR sequences (for example a humanized mouse antibody which contains all six CDRs from the mouse antibody). Other forms have one or more CDRs which are altered with respect to the original antibody.
(41) The term “antibody” further applies to human antibodies.
(42) The term “human” as used with respect to an antibody, is understood to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibody of the invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs. Human antibodies include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin.
(43) The term “antibody” specifically applies to antibodies of any class or subclass. Depending on the amino acid sequence of the constant domain of their heavy chains, antibodies can be assigned to the major classes of antibodies IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2.
(44) The term further applies to monoclonal or polyclonal antibodies, specifically a recombinant antibody, which term includes all antibodies and antibody structures that are prepared, expressed, created or isolated by recombinant means, such as antibodies originating from animals, e.g. mammalians including human, that comprises genes or sequences from different origin, e.g. murine, chimeric, humanized antibodies, or hybridoma derived antibodies. Further examples refer to antibodies isolated from a host cell transformed to express the antibody, or antibodies isolated from a recombinant, combinatorial library of antibodies or antibody domains, or antibodies prepared, expressed, created or isolated by any other means that involve splicing of antibody gene sequences to other DNA sequences.
(45) It is understood that the term “antibody” also refers to derivatives of an antibody, in particular functionally active derivatives. An antibody derivative is understood as any combination of one or more antibody domains or antibodies and/or a fusion protein, in which any domain of the antibody may be fused at any position of one or more other proteins, such as other antibodies, e.g. a binding structure comprising CDR loops, a receptor polypeptide, but also ligands, scaffold proteins, enzymes, toxins and the like. A derivative of the antibody may be obtained by association or binding to other substances by various chemical techniques such as covalent coupling, electrostatic interaction, di-sulphide bonding etc. The other substances bound to the antibody may be lipids, carbohydrates, nucleic acids, organic and inorganic molecules or any combination thereof (e.g. PEG, prodrugs or drugs). In a specific embodiment, the antibody is a derivative comprising an additional tag allowing specific interaction with a biologically acceptable compound. There is not a specific limitation with respect to the tag usable in the present invention, as far as it has no or tolerable negative impact on the binding of the antibody to its target. Examples of suitable tags include His-tag, Myc-tag, FLAG-tag, Strep-tag, Calmodulin-tag, GST-tag, MBP-tag, and S-tag. In another specific embodiment, the antibody is a derivative comprising a label. The term “label” as used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody so as to generate a “labeled” antibody. The label may be detectable by itself, e.g. radioisotope labels or fluorescent labels, or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.
(46) The preferred derivatives as described herein are functionally active with regard to the antigen binding, preferably which have a potency to combat K. pneumonia, e.g. as determined in an SBA, OPK or LAL assay, or to protect against bacterial challenge or to neutralize endotoxemia.
(47) Specifically, an antibody derived from an antibody of the invention may comprise at least one or more of the CDR regions or CDR variants thereof being functionally active in differentially binding to the gal-III antigen, e.g. specifically or selectively binding the gal-III antigen.
(48) Antibodies derived from a parent antibody or antibody sequence, such as a parent CDR or FR sequence, are herein particularly understood as mutants or variants obtained by e.g. in silico or recombinant engineering or else by chemical derivatization or synthesis.
(49) It is understood that the term “antibody” also refers to variants of an antibody, including antibodies with functionally active CDR variants of a parent CDR sequence, and functionally active variant antibodies of a parent antibody.
(50) Specifically, an antibody derived from an antibody of the invention may comprise at least one or more of the CDR regions or CDR variants thereof, e.g. at least 3 CDRs of the heavy chain variable region and/or at least 3 CDRs of the light chain variable region, with at least one point mutation in at least one of the CDR or FR regions, or in the constant region of the HC or LC, being functionally active, e.g. specifically binding the gal-III antigen.
(51) The term “variant” shall particularly refer to antibodies, such as mutant antibodies or fragments of antibodies, e.g. obtained by mutagenesis methods, in particular to delete, exchange, introduce inserts into a specific antibody amino acid sequence or region or chemically derivatize an amino acid sequence, e.g. in the constant domains to engineer the antibody stability, effector function or half-life, or in the variable domains to improve antigen-binding properties, e.g. by affinity maturation techniques available in the art. Any of the known mutagenesis methods may be employed, including point mutations at desired positions, e.g. obtained by randomization techniques. In some cases positions are chosen randomly, e.g. with either any of the possible amino acids or a selection of preferred amino acids to randomize the antibody sequences. The term “mutagenesis” refers to any art recognized technique for altering a polynucleotide or polypeptide sequence. Preferred types of mutagenesis include error prone PCR mutagenesis, saturation mutagenesis, or other site directed mutagenesis.
(52) The term “variant” shall specifically encompass functionally active variants.
(53) The term “functionally active variant” of a CDR sequence as used herein, is understood as a “functionally active CDR variant”, and the “functionally active variant” of an antibody as used herein, is understood as “functionally active antibody variant”. The functionally active variant means a sequence resulting from modification of this sequence (a parent antibody or a parent sequence) by insertion, deletion or substitution of one or more amino acids, or chemical derivatization of one or more amino acid residues in the amino acid sequence, or nucleotides within the nucleotide sequence, or at either or both of the distal ends of the sequence, e.g. in a CDR sequence the N-terminal and/or C-terminal 1, 2, 3, or 4 amino acids, and/or the centric 1, 2, 3, or 4 amino acids (i.e. in the midst of the CDR sequence), and which modification does not affect, in particular impair, the activity of this sequence. In the case of a binding site having specificity to a selected target antigen, the functionally active variant of an antibody would still have the predetermined binding specificity, though this could be changed, e.g. to change the fine specificity to a specific epitope, the affinity, the avidity, the Kon or Koff rate, etc. For example, an affinity matured antibody is specifically understood as a functionally active variant antibody. Hence, the modified CDR sequence in an affinity matured antibody is understood as a functionally active CDR variant.
(54) Specifically, the functionally active variants of an antibody of the invention have the potency to bind gal-III antigen and the specificity or selectivity to preferentially bind to the gal-III antigen relative to other antigens of K. pneumoniae, e.g. binding to gal-III and not binding to the gal-I antigen of K. pneumoniae, or not significantly binding the gal-I antigen, and/or not binding to other antigens of K. pneumoniae.
(55) Functionally active variants may be obtained, e.g. by changing the sequence of a parent antibody, e.g. an antibody comprising the same binding site as any of the antibodies as listed in Table 1 and
(56) The term “substantially the same biological activity” as used herein refers to the activity as indicated by substantially the same activity being at least 20%, at least 50%, at least 75%, at least 90%, e.g. at least 100%, or at least 125%, or at least 150%, or at least 175%, or e.g. up to 200%, or even a higher activity as determined for the comparable or parent antibody.
(57) The preferred variants or derivatives as described herein are functionally active with regard to the antigen binding, preferably which have a potency to specifically bind gal-III antigen, and not binding to other antigens of K. pneumoniae, e.g. binding to gal-III and not binding to the gal-I antigen of K. pneumoniae, or not significantly binding the gal-I antigen, or preferentially binding the gal-III antigen relative to gal-I, or binding the gal-III with higher affinity as compared to current polyclonal typing sera raised against gal-I strains. Preferred variants are not binding to other antigens of K. pneumoniae, with a Kd value difference of at least 2 logs, preferably at least 3 logs, and optionally further including a potency of complement mediated killing in an SBA assay, e.g. to achieve significant reduction in bacterial counts relative to control samples not containing the antibody, and/or optionally further including a potency of an antibody mediated phagocytosis in an OPK assay, such as to achieve significant reduction in bacterial counts relative to control samples not containing the antibody, and/or optionally further including endotoxin neutralization function in a LAL or TLR4 signaling assay, such as to achieve significant reduction of endotoxin activity relative to control samples not containing the antibody, e.g. with substantially the same biological activity, as determined by the specific binding assay or functional test to target K. pneumoniae. The significant reduction of activity in the various assays typically means the reduction of at least 50%, preferably at least 60%, 70%, 80%, 90%, 95% or 98% up to complete reduction of about 100% (+/−1%).
(58) In a preferred embodiment the functionally active variant of a parent antibody
(59) a) is a biologically active fragment of the antibody, the fragment comprising at least 50% of the sequence of the molecule, preferably at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% and most preferably at least 97%, 98% or 99%;
(60) b) is derived from the antibody by at least one amino acid substitution, addition and/or deletion, wherein the functionally active variant has a sequence identity to the molecule or part of it, such as an antibody of at least 50% sequence identity, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, still more preferably at least 90%, even more preferably at least 95% and most preferably at least 97%, 98% or 99%; and/or
(61) c) consists of the antibody or a functionally active variant thereof and additionally at least one amino acid or nucleotide heterologous to the polypeptide or the nucleotide sequence.
(62) In one preferred embodiment of the invention, the functionally active variant of the antibody according to the invention is essentially identical to the variant described above, but differs from its polypeptide or the nucleotide sequence, respectively, in that it is derived from a homologous sequence of a different species. These are referred to as naturally occurring variants or analogs.
(63) The term “functionally active variant” also includes naturally occurring allelic variants, as well as mutants or any other non-naturally occurring variants. As is known in the art, an allelic variant is an alternate form of a (poly) peptide that is characterized as having a substitution, deletion, or addition of one or more amino acids that does essentially not alter the biological function of the polypeptide.
(64) Functionally active variants may be obtained by sequence alterations in the polypeptide or the nucleotide sequence, e.g. by one or more point mutations, wherein the sequence alterations retains or improves a function of the unaltered polypeptide or the nucleotide sequence, when used in combination of the invention. Such sequence alterations can include, but are not limited to, (conservative) substitutions, additions, deletions, mutations and insertions.
(65) Specific functionally active variants are CDR variants. A CDR variant includes an amino acid sequence modified by at least one amino acid in the CDR region, wherein said modification can be a chemical or a partial alteration of the amino acid sequence, which modification permits the variant to retain the biological characteristics of the unmodified sequence. A partial alteration of the CDR amino acid sequence may be by deletion or substitution of one to several amino acids, e.g. 1, 2, 3, 4 or 5 amino acids, or by addition or insertion of one to several amino acids, e.g. 1, 2, 3, 4 or 5 amino acids, or by a chemical derivatization of one to several amino acids, e.g. 1, 2, 3, 4 or 5 amino acids, or combination thereof. The substitutions in amino acid residues may be conservative substitutions, for example, substituting one hydrophobic amino acid for an alternative hydrophobic amino acid.
(66) Conservative substitutions are those that take place within a family of amino acids that are related in their side chains and chemical properties. Examples of such families are amino acids with basic side chains, with acidic side chains, with non-polar aliphatic side chains, with non-polar aromatic side chains, with uncharged polar side chains, with small side chains, with large side chains etc.
(67) A point mutation is particularly understood as the engineering of a polynucleotide that results in the expression of an amino acid sequence that differs from the non-engineered amino acid sequence in the substitution or exchange, deletion or insertion of one or more single (non-consecutive) or doublets of amino acids for different amino acids.
(68) Preferred point mutations refer to the exchange of amino acids of the same polarity and/or charge. In this regard, amino acids refer to twenty naturally occurring amino acids encoded by sixty-four triplet codons. These 20 amino acids can be split into those that have neutral charges, positive charges, and negative charges:
(69) The “neutral” amino acids are shown below along with their respective three-letter and single-letter code and polarity:
(70) Alanine: (Ala, A) nonpolar, neutral;
(71) Asparagine: (Asn, N) polar, neutral;
(72) Cysteine: (Cys, C) nonpolar, neutral;
(73) Glutamine: (Gln, Q) polar, neutral;
(74) Glycine: (Gly, G) nonpolar, neutral;
(75) Isoleucine: (Ile, I) nonpolar, neutral;
(76) Leucine: (Leu, L) nonpolar, neutral;
(77) Methionine: (Met, M) nonpolar, neutral;
(78) Phenylalanine: (Phe, F) nonpolar, neutral;
(79) Proline: (Pro, P) nonpolar, neutral;
(80) Serine: (Ser, S) polar, neutral;
(81) Threonine: (Thr, T) polar, neutral;
(82) Tryptophan: (Trp, W) nonpolar, neutral;
(83) Tyrosine: (Tyr, Y) polar, neutral;
(84) Valine: (Val, V) nonpolar, neutral; and
(85) Histidine: (His, H) polar, positive (10%) neutral (90%).
(86) The “positively” charged amino acids are:
(87) Arginine: (Arg, R) polar, positive; and
(88) Lysine: (Lys, K) polar, positive.
(89) The “negatively” charged amino acids are:
(90) Aspartic acid: (Asp, D) polar, negative; and
(91) Glutamic acid: (Glu, E) polar, negative.
(92) “Percent (%) amino acid sequence identity” with respect to the antibody sequences and homologs described herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific polypeptide sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
(93) An antibody variant is specifically understood to include homologs, analogs, fragments, modifications or variants with a specific glycosylation pattern, e.g. produced by glycoengineering, which are functional and may serve as functional equivalents, e.g. binding to the specific targets and with functional properties.
(94) An antibody of the present invention may or may not exhibit Fc effector function. Though the mode of action is mainly mediated by neutralizing antibodies without Fc effector functions, Fc can recruit complement and aid elimination of the target antigen, such as a toxin, from the circulation via formation of immune complexes.
(95) Specific antibodies may be devoid of an active Fc moiety, thus, either composed of antibody domains that do not contain an Fc part of an antibody or that do not contain an Fc gamma receptor binding site, or comprising antibody domains lacking Fc effector function, e.g. by modifications to reduce Fc effector functions, in particular to abrogate or reduce ADCC and/or CDC activity. Alternative antibodies may be engineered to incorporate modifications to increase Fc effector functions, in particular to enhance ADCC and/or CDC activity.
(96) Such modifications may be effected by mutagenesis, e.g. mutations in the Fc gamma receptor binding site or by derivatives or agents to interfere with ADCC and/or CDC activity of an antibody format, so to achieve reduction or increase of Fc effector function.
(97) A significant reduction of Fc effector function is typically understood to refer to Fc effector function of less than 10% of the unmodified (wild-type) format, preferably less than 5%, as measured by ADCC and/or CDC activity. A significant increase of Fc effector function is typically understood to refer to an increase in Fc effector function of at least 10% of the unmodified (wild-type) format, preferably at least 20%, 30%, 40% or 50%, as measured by ADCC and/or CDC activity.
(98) The term “glycoengineered” variants with respect to antibody sequences shall refer to glycosylation variants having modified immunogenic or immunomodulatory (e.g. anti-inflammatory) properties, ADCC and/or CDC, as a result of the glycoengineering. All antibodies contain carbohydrate structures at conserved positions in the heavy chain constant regions, with each isotype possessing a distinct array of N-linked carbohydrate structures, which variably affect protein assembly, secretion or functional activity. IgG1 type antibodies are glycoproteins that have a conserved N linked glycosylation site at Asn297 in each CH2 domain. The two complex bi-antennary oligosaccharides attached to Asn297 are buried between the CH2 domains, forming extensive contacts with the polypeptide backbone, and their presence is essential for the antibody to mediate effector functions such as antibody dependent cellular cytotoxicity (ADCC). Removal of N-Glycan at N297, e.g. through mutating N297, e.g. to A, or T299 typically results in aglycosylated antibody formats with reduced ADCC. Specifically, the antibody of the invention may be glycosylated or glycoengineered, or aglycosylated antibodies.
(99) Major differences in antibody glycosylation occur between cell lines, and even minor differences are seen for a given cell line grown under different culture conditions. Expression in bacterial cells typically provides for an aglycosylated antibody. CHO cells with tetracycline-regulated expression of β(1,4)-N-acetylglucosaminyltransferase III (GnTIII), a glycosyltransferase catalyzing formation of bisecting GlcNAc, was reported to have improved ADCC activity (Umana et al., 1999, Nature Biotech. 17:176-180). In addition to the choice of host cells, factors that affect glycosylation during recombinant production of antibodies include growth mode, media formulation, culture density, oxygenation, pH, purification schemes and the like.
(100) The term “antigen-binding site” or “binding site” refers to the part of an antibody that participates in antigen binding. The antigen binding site is formed by amino acid residues of the N-terminal variable (“V”) regions of the heavy (“H”) and/or light (“L”) chains, or the variable domains thereof. Three highly divergent stretches within the V regions of the heavy and light chains, referred to as “hypervariable regions”, are interposed between more conserved flanking stretches known as framework regions, The antigen-binding site provides for a surface that is complementary to the three-dimensional surface of a bound epitope or antigen, and the hypervariable regions are referred to as “complementarity-determining regions”, or “CDRs.” The binding site incorporated in the CDRs is herein also called “CDR binding site”.
(101) The term “antigen” as used herein interchangeably with the terms “target” or “target antigen” shall refer to a whole target molecule or a fragment of such molecule recognized by an antibody binding site. Specifically, substructures of an antigen, e.g. a polypeptide or carbohydrate structure, generally referred to as “epitopes”, e.g. B-cell epitopes or T-cell epitope, which are immunologically relevant, may be recognized by such binding site. Specific antigens like the gal-III or gal-I antigens are carbohydrate structures and may be provided as isolated antigens optionally provided on an artificial carrier, or else in the form of K. pneumoniae cells expressing the antigens or cell fractions thereof.
(102) The term “epitope” as used herein shall in particular refer to a molecular structure which may completely make up a specific binding partner or be part of a specific binding partner to a binding site of an antibody. An epitope may either be composed of a carbohydrate, a peptidic structure, a fatty acid, an organic, biochemical or inorganic substance or derivatives thereof and any combinations thereof. If an epitope is comprised in a peptidic structure, such as a peptide, a polypeptide or a protein, it will usually include at least 3 amino acids, preferably 5 to 40 amino acids, and more preferably between about 10-20 amino acids. Epitopes can be either linear or conformational epitopes. A linear epitope is comprised of a single segment of a primary sequence of a polypeptide or carbohydrate chain. Linear epitopes can be contiguous or overlapping.
(103) Conformational epitopes are comprised of amino acids or carbohydrates brought together by folding the polypeptide to form a tertiary structure and the amino acids are not necessarily adjacent to one another in the linear sequence. Specifically and with regard to polypeptide antigens a conformational or discontinuous epitope is characterized by the presence of two or more discrete amino acid residues, separated in the primary sequence, but assembling to a consistent structure on the surface of the molecule when the polypeptide folds into the native protein/antigen.
(104) Herein the term “epitope” shall particularly refer to the single epitope recognized by an antibody, or a cross-reactive epitope which is shared by at least two different antigens and optionally recognized by the cross-reactive antibody.
(105) The term “expression” is understood in the following way. Nucleic acid molecules containing a desired coding sequence of an expression product such as e.g. an antibody as described herein, and control sequences such as e.g. a promoter in operable linkage, may be used for expression purposes. Hosts transformed or transfected with these sequences are capable of producing the encoded proteins. In order to effect transformation, the expression system may be included in a vector; however, the relevant DNA may also be integrated into the host chromosome. Specifically the term refers to a host cell and compatible vector under suitable conditions, e.g. for the expression of a protein coded for by foreign DNA carried by the vector and introduced to the host cell.
(106) Coding DNA is a DNA sequence that encodes a particular amino acid sequence for a particular polypeptide or protein such as e.g. an antibody. Promoter DNA is a DNA sequence which initiates, regulates, or otherwise mediates or controls the expression of the coding DNA. Promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms. Recombinant cloning vectors will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g. antibiotic resistance, and one or more expression cassettes.
(107) “Vectors” used herein are defined as DNA sequences that are required for the transcription of cloned recombinant nucleotide sequences, i.e. of recombinant genes and the translation of their mRNA in a suitable host organism.
(108) An “expression cassette” refers to a DNA coding sequence or segment of DNA that code for an expression product that can be inserted into a vector at defined restriction sites. The cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame. Generally, foreign DNA is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA. A segment or sequence of DNA having inserted or added DNA, such as an expression vector, can also be called a “DNA construct”.
(109) Expression vectors comprise the expression cassette and additionally usually comprise an origin for autonomous replication in the host cells or a genome integration site, one or more selectable markers (e.g. an amino acid synthesis gene or a gene conferring resistance to antibiotics such as zeocin, kanamycin, G418 or hygromycin), a number of restriction enzyme cleavage sites, a suitable promoter sequence and a transcription terminator, which components are operably linked together. The term “vector” as used herein includes autonomously replicating nucleotide sequences as well as genome integrating nucleotide sequences. A common type of vector is a “plasmid”, which generally is a self-contained molecule of double-stranded DNA that can readily accept additional (foreign) DNA and which can readily be introduced into a suitable host cell. A plasmid vector often contains coding DNA and promoter DNA and has one or more restriction sites suitable for inserting foreign DNA. Specifically, the term “vector” or “plasmid” refers to a vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence.
(110) The term “host cell” as used herein shall refer to primary subject cells transformed to produce a particular recombinant protein, such as an antibody as described herein, and any progeny thereof. It should be understood that not all progeny are exactly identical to the parental cell (due to deliberate or inadvertent mutations or differences in environment), however, such altered progeny are included in these terms, so long as the progeny retain the same functionality as that of the originally transformed cell. The term “host cell line” refers to a cell line of host cells as used for expressing a recombinant gene to produce recombinant polypeptides such as recombinant antibodies. The term “cell line” as used herein refers to an established clone of a particular cell type that has acquired the ability to proliferate over a prolonged period of time. Such host cell or host cell line may be maintained in cell culture and/or cultivated to produce a recombinant polypeptide.
(111) The term “isolated” or “isolation” as used herein with respect to a nucleic acid, an antibody or other compound shall refer to such compound that has been sufficiently separated from the environment with which it would naturally be associated, so as to exist in “substantially pure” form. “Isolated” does not necessarily mean the exclusion of artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification. In particular, isolated nucleic acid molecules of the present invention are also meant to include those which are not naturally occurring, e.g. codon-optimized nucleic acids or cDNA, or chemically synthesized.
(112) Likewise, the isolated antibody of the invention is specifically non-naturally occurring, e.g. as provided in a combination preparation with another antibody or active agent, which combination does not occur in nature, or an optimized or affinity-maturated variant of a naturally occurring antibody, or an antibody with a framework-region which is engineered to improve the manufacturability of the antibody. By such optimizing or engineering the antibody comprises one or more synthetic sequences or characteristics, which would not be found in the context of the antibody in nature.
(113) With reference to nucleic acids of the invention, the term “isolated nucleic acid” is sometimes used. This term, when applied to DNA, refers to a DNA molecule that is separated from sequences with which it is immediately contiguous in the naturally occurring genome of the organism in which it originated. For example, an “isolated nucleic acid” may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryotic or eukaryotic cell or host organism. When applied to RNA, the term “isolated nucleic acid” refers primarily to an RNA molecule encoded by an isolated DNA molecule as defined above. Alternatively, the term may refer to an RNA molecule that has been sufficiently separated from other nucleic acids with which it would be associated in its natural state (i.e., in cells or tissues). An “isolated nucleic acid” (either DNA or RNA) may further represent a molecule produced directly by biological or synthetic means and separated from other components present during its production.
(114) With reference to polypeptides or proteins, such as isolated antibodies or epitopes of the invention, the term “isolated” shall specifically refer to compounds that are free or substantially free of material with which they are naturally associated such as other compounds with which they are found in their natural environment, or the environment in which they are prepared (e g. cell culture) when such preparation is by recombinant DNA technology practiced in vitro or in vivo. Isolated compounds can be formulated with diluents or adjuvants and still for practical purposes be isolated—for example, the polypeptides or polynucleotides can be mixed with pharmaceutically acceptable carriers or excipients when used in diagnosis or therapy. In particular, the isolated antibody of the invention differs from polyclonal serum preparations raised against K. pneumoniae strains, because it is provided in the isolated and purified form, preferably provided in a preparation comprising the isolated antibody as the only active substance. This does not preclude, however, that the isolated antibody is provided in a combination product comprising a limited number of further well-defined (isolated) antibodies. Isolated antibodies may as well be provided on a solid, semi-liquid or liquid carrier, such as beads.
(115) The term “neutralizing” or “neutralization” is used herein in the broadest sense and refers to any molecule that inhibits a pathogen, such as K. pneumoniae from infecting a subject, or to inhibit the pathogen from promoting infections by producing endotoxins, or to inhibit the endotoxins from exerting their biological activity, irrespective of the mechanism by which neutralization is achieved. Neutralization can be achieved, e.g., by an antibody that inhibits the colonization by K. pneumoniae of mucosal surfaces, invasion to sterile body sites, and eliciting adverse biological signals (in worst case inducing septic shock) in the host.
(116) In the strict sense neutralization means, inhibiting the binding of specific LPS to its cognate receptor (e.g., Toll-like receptor-4 complex) and hence eliciting biological activity. This neutralization potency is typically determined in a standard assay, e.g. an in vitro or in vivo neutralization assay, e.g. a LAL test, or TLR-4 based assays, where the inhibition of endotoxin's biological activity is measured, e.g. by colorimetry.
(117) Antibodies combating or neutralizing K. pneumoniae are interfering with the pathogens and pathogenic reactions, thus able to limit or prevent infection and/or to ameliorate a disease condition resulting from such infection, or to inhibit K. pneumoniae pathogenesis, in particular dissemination and replication into or within sterile body compartments/sites of the host. In this regard the neutralizing antibody is also understood as being a “protective antibody” meaning that the antibody is responsible for immunity to an infectious agent observed in active or passive immunity. In particular, neutralizing or protective antibodies as described herein are possibly used for therapeutic purposes, e.g. for prophylaxis or therapy, to prevent, ameliorate, treat or at least partially arrest disease symptoms, side effects or progression of disease induced by a pathogen. Specifically, protective antibodies are able to kill or impede replication of live K. pneumoniae cells by e.g. inducing serum bactericidal or opsonophagocytic activities, or remove whole bacterial cells or the LPS molecules thereof from the sterile body sites following therapeutic applications (i.e. given on an established infection). Alternatively, prophylactically applied protective antibodies inhibit establishment of an infection (i.e. spread of K. pneumoniae from non-sterile sites to sterile body compartments) by one of the abovementioned or other mechanisms.
(118) The term “biological sample” as used herein shall refer to any material obtained from a subject, such as a human being, that contains, or potentially contains, biological material which could contain K. pneumoniae. The biological sample can be a tissue, fluid or cell culture sample. Examples of samples for use in accordance with the invention include, but are not limited to patient samples, e.g., tissue or body fluids, specifically a respiratory tract specimen such as endotracheal aspirates, pleural fluid, lung tap, nasal swab or sputum, a blood sample, stool sample, skin and urine sample or cerebrospinal fluid.
(119) The biological sample typically comprises a complex biological matrix such as complex viscous biological fluids containing multiple types of biological and small organic molecules, for example mucous exudates rich in protein matter. Suitable additives or extraction procedures may be used to reduce the non-specific binding that can be associated with a matrix in the sample and/or lower the matrix viscosity by solubilizing and/or breaking down viscous or solid components of the sample matrix. Sample preparation methods may be employed that liberate markers from organisms and/or break down and/or liquefy biological matrices. Biological matrices that may be analyzed include mucus-containing samples such as nasal secretions, sputum, phlegm, pharyngeal exudates, urethral or vaginal secretions, and washes of such membrane surfaces.
(120) Suitable sample preparation methods include method steps to reduce the effect of the biological matrix on the assay. Such method steps may include but are not limited to, e.g., capture, chromatography, spin-centrifugation and dialysis.
(121) The material obtained from a subject may also be in the form of bacterial isolates, e.g., in the form of a cell culture for cultivating the isolated K. pneumoniae or a cell culture product. Culture media may be selective to enrich solely the K. pneumoniae population, or non-selective.
(122) Bacterial isolate preparation typically involves an incubating step to maintain the sample in conditions that enhance the proliferation of K. pneumoniae, thereby enriching the K. pneumoniae population in the sample.
(123) Once the isolate is obtained, the bacterium may be further investigated by biochemical and/or serological tests, e.g., to determine the O type, and the level of gal-III expressed. Several typing methods are available to study K. pneumoniae strains. These methods typically include serotyping, standard typing for genetic relationship/phylogeny including multi-locus sequence typing (MLST), or Pulsed Field Gel Electrophoresis (PFGE).
(124) The term “galactan-III” also referred to as “gal-III” as used herein shall refer to the carbohydrate structure of the LPS O-antigen of K. pneumoniae comprising a galactose polymer and a structure comprising at least one of the repeating unit of Formula (I). Such repeating unit includes a branched galactose polymer, see
(125) The respective O-antigen comprising the gal-III structure is herein referred to as “gal-III antigen” which includes the “gal-III epitope” being recognized by a gal-III specific antibody of the invention. The gal-III antigen is understood as the outer part of the LPS of K. pneumoniae of the gal-III O-type, which is the surface accessible antigenic carbohydrate structure comprising one or more specific gal-III epitopes incorporated therein.
(126) The genotype of K. pneumoniae of the gal-III O-type is specifically characterized by the rfb.sub.gal-I locus complemented by gtr genes (
(127) Any K. pneumoniae which is characterized by a LPS O-antigen comprising at least one gal-III structure is herein referred to as K. pneumoniae of the gal-III O-type. LPS of K. pneumoniae of the gal-III O-type may comprise exclusively the gal-III structure, or both, gal-III and gal-I structures.
(128) The term “galactan-l” also referred to as “gal-I” as used herein shall refer to the carbohydrate structure of the LPS O-antigen of K. pneumoniae comprising a galactose polymer and a structure comprising at least one of the repeating unit of Formula (II), but not a repeating unit of Formula (I). Such repeating unit includes a linear galactose polymer. Gal-I is characteristic for the O2a serotype which does not comprise any gal-III antigen.
(129) The respective O-antigen comprising the gal-I structure is herein referred to as “gal-I antigen” which includes the “gal-I epitope” being recognized by a gal-I specific antibody of the invention. The genotype of K. pneumoniae of the gal-I O-type is specifically characterized by the rfb.sub.gal-I locus which does not incorporate the gtr genes, which is responsible for expressing the linear tri-galactose repeat unit that is different from the branched one of the gal-III type.
(130) The gal-I antigen is understood as the outer part of the LPS of K. pneumoniae of the gal-I O-type, which is the surface accessible antigenic carbohydrate structure comprising one or more specific gal-I epitopes incorporated therein, and which does not include any gal-III structure.
(131) “Specific” binding, recognizing or targeting as used herein, means that the binder, e.g., antibody or antigen-binding portion thereof, exhibits appreciable affinity for the target antigen or a respective epitope in a heterogeneous population of molecules. Thus, under designated conditions (e.g., immunoassay), a binder specifically binds to the target gal-III antigen and does not bind in a significant amount to other molecules present in a sample. The specific binding means that binding is selective in terms of target identity, high, medium or low binding affinity or avidity, as selected. Selective binding is usually achieved if the binding constant or binding dynamics is at least 10-fold different (understood as at least 1 log difference), preferably the difference is at least 100-fold (understood as at least 2 logs difference), and more preferred a least 1000-fold (understood as at least 3 logs difference) as compared to another target.
(132) The term “specificity” is also understood to apply to binders which bind to one or more molecules, e.g. cross-specific binders. Preferred cross-specific (also called polyspecific or cross-reactive) binders targeting at least two different targets or epitopes or nucleotide sequences of such targets or targeting a cross-reactive epitope or nucleotide sequence on at least two different targets, specifically bind the targets with substantially similar binding affinity, e.g. with less than 100-fold difference or even less than 10-fold difference, or, with substantially different binding affinity, e.g. with at least 10 fold or at least 100 fold difference. The cross-specific binder which recognizes both, a first (e.g. gal-III) and a second (e.g. the gal-I) target, which preferentially binds the first target over the second target is typically characterized by equal affinities or a higher affinity to the first target relative to the second one, specifically wherein the differential binding affinity to preferentially bind the first antigen relative to the second antigen is specifically at least equal or more than equal, e.g. at least 1.5 fold, or at least 2-fold, or at least 3-fold, or at least 4-fold, or at least 5 fold, or at least 6-fold, or at least 7-fold, or at least 8-fold, or at least 9-fold, or at least 10-fold higher. Such differential binding may be determined by an immunoassay, preferably immunoblotting, ELISA or other immunological methods.
(133) Preferred antibodies of the invention are binding the gal-III antigen (only gal-III, or preferentially binding gal-III relative to the gal-I antigen), with a high affinity, in particular with a high on and/or a low off rate, or a high avidity of binding. The binding affinity of an antibody is usually characterized in terms of the concentration of the antibody, at which half of the antigen binding sites are occupied, known as the dissociation constant (Kd, or K.sub.D). Usually a binder is considered a high affinity binder with a Kd<10.sup.−7 M, in some cases, e.g. for therapeutic purposes with higher affinities, e.g. with a Kd<10.sup.−8 M, preferably a Kd<10.sup.−9 M, even more preferred is a Kd<10.sup.−10 M.
(134) Yet, in a particularly preferred embodiment the individual antigen binding affinities are of medium affinity, e.g. with a Kd of less than 10.sup.−6 and up to 10.sup.−8 M, e.g. when binding to at least two antigens.
(135) Medium affinity binders may be provided according to the invention, preferably in conjunction with an affinity maturation process, if necessary.
(136) Affinity maturation is the process by which antibodies with increased affinity for a target antigen are produced. Any one or more methods of preparing and/or using affinity maturation libraries available in the art may be employed in order to generate affinity matured antibodies in accordance with various embodiments of the invention disclosed herein. Exemplary such affinity maturation methods and uses, such as random mutagenesis, bacterial mutator strains passaging, site-directed mutagenesis, mutational hotspots targeting, parsimonious mutagenesis, antibody shuffling, light chain shuffling, heavy chain shuffling, CDR1 and/or CDR1 mutagenesis, and methods of producing and using affinity maturation libraries amenable to implementing methods and uses in accordance with various embodiments of the invention disclosed herein, include, for example, those disclosed in: Prassler et al. (2009); Immunotherapy, Vol. 1(4), pp. 571-583; Sheedy et al. (2007), Biotechnol. Adv., Vol. 25(4), pp. 333-352; WO2012/009568; WO2009/036379; WO2010/105256; US2002/0177170; WO2003/074679.
(137) With structural changes of an antibody, including amino acid mutagenesis or as a consequence of somatic mutation in immunoglobulin gene segments, variants of a binding site to an antigen are produced and selected for greater affinities. Affinity matured antibodies may exhibit a several logfold greater affinity than a parent antibody. Single parent antibodies may be subject to affinity maturation. Alternatively pools of antibodies with similar binding affinity to the target antigen may be considered as parent structures that are varied to obtain affinity matured single antibodies or affinity matured pools of such antibodies.
(138) The preferred affinity maturated variant of an antibody according to the invention exhibits at least a 2 fold increase in affinity of binding, preferably at least a 5, preferably at least 10, preferably at least 50, or preferably at least 100 fold increase. The affinity maturation may be employed in the course of the selection campaigns employing respective libraries of parent molecules, either with antibodies having medium binding affinity to obtain the antibody of the invention having the specific target binding property of a binding affinity Kd<10.sup.−8 M. Alternatively, the affinity may be even more increased by affinity maturation of the antibody according to the invention to obtain the high values corresponding to a Kd of less than 10.sup.−9 M, preferably less than 10.sup.−10 M or even less than 10.sup.−11 M, most preferred in the picomolar range.
(139) In certain embodiments binding affinity is determined by an affinity ELISA assay. In certain embodiments binding affinity is determined by a BIAcore, ForteBio or MSD assays. In certain embodiments binding affinity is determined by a kinetic method. In certain embodiments binding affinity is determined by an equilibrium/solution method.
(140) Use of the term “having the same specificity”, “having the same binding site” or “binding the same epitope” indicates that equivalent monoclonal antibodies exhibit the same or essentially the same, i.e. similar immunoreaction (binding) characteristics and compete for binding to a pre-selected target binding sequence. The relative specificity of an antibody molecule for a particular target can be relatively determined by competition assays, e.g. as described in Harlow, et al., ANTIBODIES: A LABORATORY MANUAL, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1988).
(141) The term “compete”, as used herein with regard to an antibody, means that a first antibody, or an antigen-binding portion thereof, binds to an epitope in a manner sufficiently similar to the binding of a second antibody, or an antigen-binding portion thereof, such that the result of binding of the first antibody with its cognate epitope is detectably decreased in the presence of the second antibody compared to the binding of the first antibody in the absence of the second antibody. The alternative, where the binding of the second antibody to its epitope is also detectably decreased in the presence of the first antibody, can, but need not be the case. That is, a first antibody can inhibit the binding of a second antibody to its epitope without that second antibody inhibiting the binding of the first antibody to its respective epitope. However, where each antibody detectably inhibits the binding of the other antibody with its cognate epitope, whether to the same, greater, or lesser extent, the antibodies are said to “compete” with each other for binding of their respective epitope(s). Antibodies that compete with any of the exemplified antibodies for binding the gal-III antigen are particularly encompassed by the present invention.
(142) Competition herein means a greater relative inhibition than about 30% as determined by competition ELISA analysis or by ForteBio analysis. It may be desirable to set a higher threshold of relative inhibition as criteria of what is a suitable level of competition in a particular context, e.g., where the competition analysis is used to select or screen for new antibodies designed with the intended function of the binding of the antigen. Thus, for example, it is possible to set criteria for the competitive binding, wherein at least 40% relative inhibition is detected, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or even at least 100%, before an antibody is considered sufficiently competitive.
(143) The term “diagnostic kit” as used herein refers to a kit or set of parts, which in combination or mixture can be used to carry out the measurement/detection of one or more analytes or markers to determine a disease or disease condition, or to predict the disease or the disease progression. In particular, the kit contains at least a detection molecule and/or a binder, wherein the detection molecule and/or the binder specifically recognizes the analyte or marker, or a reaction product of such analyte or marker. In addition, various reagents or tools may be included in the kit. The diagnostic kit may comprise any useful reagents for carrying out the subject methods, including substrates such as microbeads or planar arrays or wells, reagents for biomarker isolation, detection molecules directed to specific targets, reagents such as primers for nucleic acid sequencing or amplification, arrays for nucleic acid hybridization, detectable labels, solvents or buffers and the like, various linkers, various assay components, blockers, and the like.
(144) A kit may also include instructions for use in a diagnostic method. Such instructions can be, for example, provided on a device included in the kit, e.g. tools or a device to prepare a biological sample for diagnostic purposes, such as separating a cell and/or protein containing fraction before determining a marker. The kit may conveniently be provided in the storage stable form, such as a commercial kit with a shelf-life of at least 6 months.
(145) Specific diagnostic kits also comprise a solid support comprising a detection molecule or having an immobilized patterned array of detection molecules directed against markers of interest, preferably including a first region containing a first binding reagent directed against a first marker and a second region containing a second binding reagent directed against a second marker.
(146) In particular, a sandwich format can be used. For example, one or more binder is conjugated to a substrate prior to the contacting with a biological sample. The one or more binder may be conjugated to a detectable label to serve as a detection molecule. In other embodiments, the one or more binder is conjugated to a detectable label. In this configuration, the one or more binders may be conjugated to a substrate prior to the contacting with the biological sample to serve as a capture agent. Furthermore, the one or more binder can be conjugated to a substrate prior to the contacting with the biological sample, and/or the one or more binder is conjugated to a detectable label. In such cases, the one or more binder can act as either or both of a capture agent and a detection agent.
(147) The diagnostic kit is specifically provided for use in an immunoassay, wherein the detection molecule is a specific binder that binds to the analyte or marker by an immunoreaction. Such binder may be antibodies or antibody fragments or antibody-like scaffolds binding to a target antigen.
(148) Suitable immunoassays are any of ELISA, CIA, RIA, IRMA, agglutination assay, immunochromatography, dipstick assay and Western-blot.
(149) The term “K. pneumoniae infection” and “K. pneumoniae colonization” is understood in the following way: Klebsiella pneumoniae is a Gram-negative bacterium that is a member of the family Enterobacteriaceae. It is a ubiquitous bacterium, which can also colonize the human host, typically in the intestines or the upper airways. Being an opportunistic pathogen, from these sites it can invade sterile body sites in case not properly controlled by the immune system. Uncontrolled bacterial replication at these otherwise sterile sites will induce inflammation, in a great part, mediated by the endotoxin (i.e. LPS) molecules released from K. pneumoniae. In case of bacteremia, endotoxin molecules may trigger septic shock.
(150) K. pneumoniae colonization means that the subject has a sufficiently high concentration of K. pneumoniae bacteria at a site that they can be detected, yet the bacteria are causing no signs or symptoms. Colonization can persist for a long period of time, with resolution influenced by the immune response to the organism, competition at the site from other organisms and, sometimes, use of antimicrobials.
(151) In general, bacteremias caused by K. pneumoniae may be successfully treated with known conventional antibacterial therapy, such as treatment with antibiotics, steroid and non-steroid inhibitors of inflammation. The present invention provides for a new immunotherapy, employing antibodies specifically recognizing K. pneumoniae, which is optionally combined with anti-bacterial or anti-inflammatory therapy. Exemplary antibiotics used for treating patients with K. pneumoniae infection are aminoglycosides, cephalosporines, aminopenicillines, carbapenems, fluoroquinolons, tygecycline, colistin, etc.
(152) Multi-drug resistant (MDR) K. pneumoniae is particularly understood as those strains demonstrating resistance to three or more classes of antibiotics, e.g. the following agents/groups: penicillins, cephalosporins, carbapenems, aminoglycosides, tetracyclines, fluoroquinolones, nitrofurantoin, trimethoprim (and its combinations), fosfomycin, polymixins, chloramphenicol, azthreonam, or tigecycline.
(153) With the recent emergence of antibiotic-resistant strains, treating bacteremias of this nature has become significantly more difficult. Patients who develop MDR K. pneumoniae disease have longer hospital and ICU stays, high mortality, and greater health care costs than patients without K. pneumoniae disease. Patient care may be improved and nosocomial infections may be reduced by preventing, rather than treating, K. pneumoniae disease prophylaxis when a patient is heavily colonized by MDR K. pneumoniae.
(154) K. pneumoniae disease is specifically understood as a disease caused by K. pneumoniae infection. Such diseases include local and systemic disease. Severe cases of disease are e.g. primary and secondary bacteremia, pneumonia, urinary tract infection, liver abscess, peritonitis, or meningitis.
(155) The term “recombinant” as used herein shall mean “being prepared by or the result of genetic engineering”. A recombinant host specifically comprises an expression vector or cloning vector, or it has been genetically engineered to contain a recombinant nucleic acid sequence, in particular employing nucleotide sequence foreign to the host. A recombinant protein is produced by expressing a respective recombinant nucleic acid in a host. The term “recombinant antibody”, as used herein, includes antibodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom, (b) antibodies isolated from a host cell transformed to express the antibody, e.g., from a transfectoma, (c) antibodies isolated from a recombinant, combinatorial human antibody library or library of antigen-binding sequences of an antibody, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant antibodies comprise antibodies engineered to include rearrangements and mutations which occur, for example, during antibody maturation. In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Maniatis, Fritsch & Sambrook, “Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, (1982).
(156) Selective binding can be further improved by recombinant antibody optimization methods known in the art. For example, certain regions of the variable regions of the immunoglobulin chains described herein may be subjected to one or more optimization strategies, including light chain shuffling, destinational mutagenesis, CDR amalgamation, and directed mutagenesis of selected CDR and/or framework regions.
(157) The term “subject” as used herein shall refer to a warm-blooded mammalian, particularly a human being or a non-human animal. K. pneumoniae is a critically important human pathogen that is also an emerging concern in veterinary medicine. It is present in a wide range of non-human animal species. Thus, the term “subject” may also particularly refer to animals including dogs, cats, rabbits, horses, cattle, pigs and poultry. In particular the medical use of the invention or the respective method of treatment applies to a subject in need of prophylaxis or treatment of a disease condition associated with a K. pneumoniae infection. The subject may be a patient at risk of a K. pneumoniae infection or suffering from disease, including early stage or late stage disease. The term “patient” includes human and other mammalian subjects that receive either prophylactic or therapeutic treatment. The term “treatment” is thus meant to include both prophylactic and therapeutic treatment.
(158) A subject is e.g. treated for prophylaxis or therapy of K. pneumoniae disease conditions. In particular, the subject is treated, which is either at risk of infection or developing such disease or disease recurrence, or a subject that is suffering from such infection and/or disease associated with such infection.
(159) Specifically the term “prophylaxis” refers to preventive measures which is intended to encompass prevention of the onset of pathogenesis or prophylactic measures to reduce the risk of pathogenesis.
(160) Specifically, the treatment may be by interfering with the pathogenesis of K. pneumoniae as causal agent of the condition,
(161) The term “substantially pure” or “purified” as used herein shall refer to a preparation comprising at least 50% (w/w), preferably at least 60%, 70%, 80%, 90% or 95% of a compound, such as a nucleic acid molecule or an antibody. Purity is measured by methods appropriate for the compound (e.g. chromatographic methods, polyacrylamide gel electrophoresis, HPLC analysis, and the like).
(162) The term “therapeutically effective amount”, used herein interchangeably with any of the terms “effective amount” or “sufficient amount” of a compound, e.g. an antibody of the present invention, is a quantity or activity sufficient to, when administered to the subject effect beneficial or desired results, including clinical results, and, as such, an effective amount or synonym thereof depends upon the context in which it is being applied.
(163) An effective amount is intended to mean that amount of a compound that is sufficient to treat, prevent or inhibit such diseases or disorder. In the context of disease, therapeutically effective amounts of the antibody as described herein are specifically used to treat, modulate, attenuate, reverse, or affect a disease or condition that benefits from an inhibition of K. pneumoniae pathogenesis, for example, adhesion and colonization of mucosal surfaces, uncontrolled replication within sterile body sites, and toxicity of host cells by bacterial products.
(164) The amount of the compound that will correspond to such an effective amount will vary depending on various factors, such as the given drug or compound, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject or host being treated, and the like, but can nevertheless be routinely determined by one skilled in the art.
(165) A therapeutically effective amount of the antibody as described herein, such as provided to a human patient in need thereof, may specifically be in the range of 0.5-50 mg/kg, preferably 5-40 mg/kg, even more preferred up to 20 mg/kg, up to 10 mg/kg, up to 5 mg/kg, though higher doses may be indicated e.g. for treating acute disease conditions. The dose can be much lower if a highly potent antibody is used. In such case, the effective amount may be in the range of 0.005 to 5 mg/kg, preferably 0.05 to 1 mg/kg.
(166) Moreover, a treatment or prevention regime of a subject with a therapeutically effective amount of the antibody of the present invention may consist of a single administration, or alternatively comprise a series of applications. For example, the antibody may be administered at least once a year, at least once a half-year or at least once a month. However, in another embodiment, the antibody may be administered to the subject from about one time per week to about a daily administration for a given treatment. The length of the treatment period depends on a variety of factors, such as the severity of the disease, either acute or chronic disease, the age of the patient, the concentration and the activity of the antibody format. It will also be appreciated that the effective dosage used for the treatment or prophylaxis may increase or decrease over the course of a particular treatment or prophylaxis regime. Changes in dosage may result and become apparent by standard diagnostic assays known in the art. In some instances, chronic administration may be required.
(167) Monoclonal antibodies (mAbs) highly specific to gal-III have great potential as diagnostic reagents for the identification of MDR Klebsiella pneumoniae, specifically MDR strains belonging to the ST258 lineage. Furthermore, in particular when humanized, these mAbs are suitable to be used for the prophylaxis (e.g. for high risk groups) and treatment of K. pneumoniae infections caused by ST258-gal-III strains.
(168) The gal-III and gal-I carbohydrate structures were thought to be very similar and no different antigens. The genetic background of O-antigen synthesis in MDR Klebsiella pneumoniae, ST258 strains was not fully elucidated. It was surprising that a specific gene adjacent to the rfb (wb) cluster (encoding glycosyltransferases, gtr-s) forms the basis of PCR based identification of strains of the gal-III O-type.
(169) There is evidence of heterogeneity within the rfb gene clusters encoding the O-antigen factor galactan-I. The size difference observed between the variants originates from the presence or absence of a ˜3-kb fragment carrying gtr (glycosyltransferase)-like genes. A PCR reaction developed to differentiate between the variants revealed that more than 50% of all O1 and O2 Klebsiella clinical isolates and over 80% of all ST258 strains carry the gtr-like locus.
(170) It was surprising that an antibody of invention could specifically bind the gal-III antigen. It turned out that immunization of mice with a gtr+ O2 strain elicits anti-galactan antibodies, which exclusively recognize galactan-I molecules decorated by the gtr locus (i.e. galactan-III antigens). Though the nature of this modification was identified as the same branching galactan structure described earlier as the repeating unit of serotype O2 (2a, 2f, 2g), the structures were not found to be antigenically different. The present invention provides for the first time mAbs specific to galactan-III generated by standard hybridoma technique. Capacity of this mAbs to bind to the surface of live O2 gtr+ Klebsiella isolates (including ST258 strains) was observed. It was surprising that protective efficacy of galactan-III specific mAbs could be shown in murine models of bacteraemia and endotoxaemia. The putative mode of action for protection is neutralization of endotoxin, which was confirmed by an in vitro functional assay.
(171) Aiming to develop therapeutic monoclonal antibodies for the prevention and treatment of infections caused by MDR Klebsiella strains, the molecular target of specific mAbs suitably is the LPS O-antigen, which shows limited heterogeneity in Klebsiella. Such O-side chain is considered immunorelevant because not fully masked by bulky capsular polysaccharide.
(172) Once antibodies with the desired binding properties are identified, such antibodies, including antibody fragments can be produced by methods well-known in the art, including, for example, hybridoma techniques or recombinant DNA technology.
(173) Recombinant monoclonal antibodies can, for example, be produced by isolating the DNA encoding the required antibody chains and transfecting a recombinant host cell with the coding sequences for expression, using well known recombinant expression vectors, e.g. the plasmids of the invention or expression cassette(s) comprising the nucleotide sequences encoding the antibody sequences. Recombinant host cells can be prokaryotic and eukaryotic cells, such as those described above.
(174) According to a specific aspect, the nucleotide sequence may be used for genetic manipulation to humanize the antibody or to improve the affinity, or other characteristics of the antibody. For example, the constant region may be engineered to more nearly resemble human constant regions to avoid immune response, if the antibody is used in clinical trials and treatments in humans. It may be desirable to genetically manipulate the antibody sequence to obtain greater affinity to the gal-III target and greater efficacy against Klebsiella pneumoniae, specifically the MDR clone ST258. It will be apparent to one of skill in the art that one or more polynucleotide changes can be made to the antibody and still maintain its binding ability to the target gal-III antigen.
(175) The production of antibody molecules, by various means, is generally well understood. U.S. Pat. No. 6,331,415 (Cabilly et al.), for example, describes a method for the recombinant production of antibodies where the heavy and light chains are expressed simultaneously from a single vector or from two separate vectors in a single cell. Wibbenmeyer et al., (1999, Biochim Biophys Acta 1430(2):191-202) and Lee and Kwak (2003, J. Biotechnology 101:189-198) describe the production of monoclonal antibodies from separately produced heavy and light chains, using plasmids expressed in separate cultures of host cells. Various other techniques relevant to the production of antibodies are provided in, e.g., Harlow, et al., ANTIBODIES: A LABORATORY MANUAL, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1988).
(176) If desired, the antibody of the invention, e.g. any of the antibodies of
(177) In another aspect, the invention provides an isolated nucleic acid comprising a sequence that codes for production of the recombinant antibody of the present invention.
(178) An antibody encoding nucleic acid can have any suitable characteristics and comprise any suitable features or combinations thereof. Thus, for example, an antibody encoding nucleic acid may be in the form of DNA, RNA, or a hybrid thereof, and may include non-naturally-occurring bases, a modified backbone, e.g., a phosphorothioate backbone that promotes stability of the nucleic acid, or both. The nucleic acid advantageously may be incorporated in an expression cassette, vector or plasmid of the invention, comprising features that promote desired expression, replication, and/or selection in target host cell(s). Examples of such features include an origin of replication component, a selection gene component, a promoter component, an enhancer element component, a polyadenylation sequence component, a termination component, and the like, numerous suitable examples of which are known.
(179) The present disclosure further provides the recombinant DNA constructs comprising one or more of the nucleotide sequences described herein. These recombinant constructs are used in connection with a vector, such as a plasmid, phagemid, phage or viral vector, into which a DNA molecule encoding any disclosed antibody is inserted.
(180) Monoclonal antibodies are produced using any method that produces antibody molecules by cell lines in culture, e.g. cultivating recombinant eukaryotic (mammalian or insect) or prokaryotic (bacterial) host cells. Examples of suitable methods for preparing monoclonal antibodies include the hybridoma methods of Kohler et al. (1975, Nature 256:495-497) and the human B-cell hybridoma method (Kozbor, 1984, J. Immunol. 133:3001; and Brodeur et al., 1987, Monoclonal Antibody Production Techniques and Applications, (Marcel Dekker, Inc., New York), pp. 51-63).
(181) Antibodies of the present invention may be identified or obtained employing a hybridoma method. In such method, a mouse or other appropriate host animal, such as a hamster, is immunized to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for immunization. Alternatively, lymphocytes may be immunized in vitro. Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell.
(182) Culture medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies directed against the antigen. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).
(183) mAbs may then be purified from hybridoma supernatants for further testing for its specific binding of the gal-III antigen and possibly for its differential binding affinity to preferentially bind the gal-III antigen relative to the gal-I antigen, and engineering of antibodies, e.g. for different diagnostic or therapeutic purposes.
(184) Gal-III specific antibodies, in some instances, emerge through screening against the single gal-III antigen. To increase the likelihood of isolating differentially binding clones one would apply multiple selective pressures by processively screening against the different antigens. Special mAb selection strategies employ the gal-III and gal-I components or other K. pneumoniae antigens in an alternating fashion.
(185) Screening methods for identifying antibodies with the desired selective binding properties may be done by display technologies using a library displaying antibody sequences or antigen-binding sequences thereof (e.g. using phage, bacterial, yeast or mammalian cells; or in vitro display systems translating nucleic acid information into respective (poly)peptides). Reactivity can be assessed based on ELISA, Western blotting or surface staining with flow cytometry, e.g. using standard assays.
(186) Isolated antigen(s) may e.g. be used for selecting antibodies from an antibody library, e.g. a yeast-displayed antibody library.
(187) For example, the invention specifically provides for gal-III specific antibodies, which are obtained by a process to identify antibodies with specificities to bind the gal-III antigen, e.g. by a specific discovery selection scheme. Accordingly, an antibody library including antibodies showing reactivity with the gal-III target, may be selected for reactivity with the target.
(188) The invention moreover provides pharmaceutical compositions which comprise an antibody as described herein and a pharmaceutically acceptable carrier or excipient. These pharmaceutical compositions can be administered in accordance with the present invention as a bolus injection or infusion or by continuous infusion. Pharmaceutical carriers suitable for facilitating such means of administration are well known in the art.
(189) Pharmaceutically acceptable carriers generally include any and all suitable solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible with an antibody or related composition or combination provided by the invention. Further examples of pharmaceutically acceptable carriers include sterile water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and the like, as well as combinations of any thereof.
(190) In one such aspect, an antibody can be combined with one or more carriers appropriate a desired route of administration, antibodies may be, e.g. admixed with any of lactose, sucrose, starch, cellulose esters of alkanoic acids, stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulphuric acids, acacia, gelatin, sodium alginate, polyvinylpyrrolidine, polyvinyl alcohol, and optionally further tableted or encapsulated for conventional administration. Alternatively, an antibody may be dissolved in saline, water, polyethylene glycol, propylene glycol, carboxymethyl cellulose colloidal solutions, ethanol, corn oil, peanut oil, cottonseed oil, sesame oil, tragacanth gum, and/or various buffers. Other carriers, adjuvants, and modes of administration are well known in the pharmaceutical arts. A carrier may include a controlled release material or time delay material, such as glyceryl monostearate or glyceryl distearate alone or with a wax, or other materials well known in the art.
(191) Additional pharmaceutically acceptable carriers are known in the art and described in, e.g. REMINGTON′S PHARMACEUTICAL SCIENCES. Liquid formulations can be solutions, emulsions or suspensions and can include excipients such as suspending agents, solubilizers, surfactants, preservatives, and chelating agents.
(192) Pharmaceutical compositions are contemplated wherein an antibody of the present invention and one or more therapeutically active agents are formulated. Stable formulations of the antibody of the present invention are prepared for storage by mixing said immunoglobulin having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers, in the form of lyophilized formulations or aqueous solutions. The formulations to be used for in vivo administration are specifically sterile, preferably in the form of a sterile aqueous solution. This is readily accomplished by filtration through sterile filtration membranes or other methods. The antibody and other therapeutically active agents disclosed herein may also be formulated as immunoliposomes, and/or entrapped in microcapsules.
(193) Administration of the pharmaceutical composition comprising an antibody of the present invention, may be done in a variety of ways, including orally, subcutaneously, intravenously, intranasally, intraotically, transdermally, mucosal, topically, e.g., gels, salves, lotions, creams, etc., intraperitoneally, intramuscularly, intrapulmonary, e.g. employing inhalable technology or pulmonary delivery systems, vaginally, parenterally, rectally, or intraocularly.
(194) Examplary formulations as used for parenteral administration include those suitable for subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution, emulsion or suspension.
(195) In one embodiment, the antibody of the present invention is the only therapeutically active agent administered to a subject, e.g. as a disease modifying or preventing monotherapy.
(196) In another embodiment, the antibody of the present invention is combined with further antibodies in a cocktail, e.g. combined in a mixture or kit of parts, to target Klebsiella pneumoniae, specifically MDR strains belonging to the ST258 lineage, such that the cocktail contains more than one therapeutically active agents administered to a subject, e.g. as a disease modifying or preventing combination therapy.
(197) Further, the antibody of the present invention may be administered in combination with one or more other therapeutic or prophylactic agents, including but not limited to standard treatment, e.g. antibiotics, steroid and non-steroid inhibitors of inflammation, and/or other antibody based therapy, e.g. employing anti-bacterial or anti-inflammatory agents.
(198) A combination therapy is particularly employing a standard regimen, e.g. as used for treating infection by Klebsiella pneumoniae, specifically the MDR clone ST258. This may include antibiotics, e.g., tygecycline, colistin, polymixin B, and beta lactams combined with non-beta lactam inhibitors.
(199) In a combination therapy, the antibody may be administered as a mixture, or concomitantly with one or more other therapeutic regimens, e.g. either before, simultaneously or after concomitant therapy.
(200) The biological properties of the antibody or the respective pharmaceutical preparations of the invention may be characterized ex vivo in cell, tissue, and whole organism experiments. As is known in the art, drugs are often tested in vivo in animals, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and monkeys, in order to measure a drug's efficacy for treatment against a disease or disease model, or to measure a drug's pharmacokinetics, pharmacodynamics, toxicity, and other properties. The animals may be referred to as disease models. Therapeutics are often tested in mice, including but not limited to nude mice, SCID mice, xenograft mice, and transgenic mice (including knockins and knockouts). Such experimentation may provide meaningful data for determination of the potential of the antibody to be used as a therapeutic or as a prophylactic with the appropriate half-life, effector function, (cross-) neutralizing activity and/or immune response upon active or passive immunotherapy. Any organism, preferably mammals, may be used for testing. For example because of their genetic similarity to humans, primates, monkeys can be suitable therapeutic models, and thus may be used to test the efficacy, toxicity, pharmacokinetics, pharmacodynamics, half-life, or other property of the subject agent or composition. Tests in humans are ultimately required for approval as drugs, and thus of course these experiments are contemplated. Thus, the antibody and respective pharmaceutical compositions of the present invention may be tested in humans to determine their therapeutic or prophylactic efficacy, toxicity, immunogenicity, pharmacokinetics, and/or other clinical properties.
(201) The subject matter of the following definitions is considered embodiments of the present invention:
(202) 1. An isolated antibody that specifically recognizes a galactan-III epitope of the lipopolysaccharide (LPS) O-antigen structure of Klebsiella pneumoniae, which epitope is incorporated in galactan-III repeating units, wherein the galactan-III repeating unit is a branched galactose homopolymer of Formula (I)
(203) ##STR00003##
(204) 2. The antibody of definition 1, which preferentially binds to the galactan-III epitope relative to the galactan-I epitope, or which does not cross-react with the galactan-I epitope, wherein the galactan-I epitope is incorporated in galactan-I repeating units of the LPS O2a-antigen structure of Klebsiella pneumoniae, and wherein the galactan-I repeating unit is a linear galactose homopolymer of Formula (II)
[.fwdarw.3)-β-D-Galf-(1.fwdarw.3)-α-D-Galp-(1.fwdarw.] Formula (II)
(205) 3. The antibody of definition 1 or 2, wherein the galactan-III epitope is of multi-drug resistant (MDR) Klebsiella pneumoniae, specifically the MDR clone ST258.
(206) 4. The antibody of any of definitions 1 to 3, which has an affinity to bind the galactan-III epitope with a Kd of less than 10.sup.−7M, preferably less than 10.sup.−8M, even more preferably less than 10.sup.−9M.
(207) 5. The antibody of any of definitions 1 to 4, which is neutralizing endotoxin of Klebsiella pneumoniae strains expressing the galactan-III epitope.
(208) 6. The antibody of any of definitions 1 to 5, which is neutralizing endotoxin of Klebsiella pneumoniae strains expressing the galactan-III epitope, wherein the neutralization potency is at least the potency of a reference antibody, which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID 10; and b) a CDR2 consisting of the amino acid sequence of SEQ ID 11; and c) a CDR3 consisting of the amino acid sequence of SEQ ID 12; and d) a CDR4 consisting of the amino acid sequence of SEQ ID 19; and e) a CDR5 consisting of the amino acid sequence of SEQ ID 17; and f) a CDR6 consisting of the amino acid sequence of SEQ ID 18, according to the nomenclature of Kabat.
(209) 7. The antibody of definition 5 or 6, wherein the strain is characterized by a rfb.sub.gal-I locus incorporating gtr genes.
(210) 8. The antibody of any of definitions 5 to 7, which recognizes the MDR Klebsiella pneumoniae clone ST258.
(211) 9. The antibody of any of definitions 1 to 8, which is a full-length monoclonal antibody, an antibody fragment thereof comprising at least one antibody domain incorporating the binding site, or a fusion protein comprising at least one antibody domain incorporating the binding site, specifically wherein the antibody is a non-naturally occurring antibody which comprises a randomized or artificial amino acid sequence.
(212) 10. The antibody of any of definitions 1 to 9, which is of human, humanized, chimeric, or murine origin.
(213) 11. The antibody of any of definitions 1 to 10, which is a monoclonal antibody.
(214) 12. The antibody of any of definitions 1 to 11, which comprises at least an antibody heavy chain variable region (VH), which is characterized by any of the CDR1 to CDR3 sequences as listed in Table 1, which are designated according to the numbering system of Kabat, or functionally active CDR variants thereof.
(215) 13. The antibody of definition 12, which is
(216) A)
(217) selected from the group consisting of group members i) to iv), wherein
(218) i)
(219) is an antibody which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID 1; and b) a CDR2 consisting of the amino acid sequence of SEQ ID 2; and c) a CDR3 consisting of the amino acid sequence of SEQ ID 3;
(220) ii)
(221) is an antibody which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID 4; and b) a CDR2 consisting of the amino acid sequence of SEQ ID 5; and c) a CDR3 consisting of the amino acid sequence of SEQ ID 6;
(222) iii)
(223) is an antibody which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID 7; and b) a CDR2 consisting of the amino acid sequence of SEQ ID 8; and c) a CDR3 consisting of the amino acid sequence of SEQ ID 9;
(224) iv)
(225) is an antibody which comprises a) a CDR1 consisting of the amino acid sequence of SEQ ID 10; and b) a CDR2 consisting of the amino acid sequence of SEQ ID 11; and c) a CDR3 consisting of the amino acid sequence of SEQ ID 12;
(226) or
(227) B) an antibody which is a functionally active variant of a parent antibody that is any of the group members of A, which comprises at least one functionally active CDR variant of any of the CDR1, CDR2 or CDR3 of the parent antibody.
(228) 14. The antibody of definition 12 or 13, comprising a VH amino acid sequence selected from any of the VH sequences as depicted in
(229) 15. The antibody of any of definitions 12 to 14, which further comprises an antibody light chain variable region (VL), which comprises any of the CDR4 to CDR6 sequences as listed in Table 1, which are designated according to the numbering system of Kabat, or functionally active CDR variants thereof.
(230) 16. The antibody of definition 15, which is
(231) A)
(232) selected from the group consisting of group members i) to iv), wherein
(233) i)
(234) is an antibody which comprises a) a CDR4 consisting of the amino acid sequence of SEQ ID 13; and b) a CDR5 consisting of the amino acid sequence of SEQ ID 14; and c) a CDR6 consisting of the amino acid sequence of SEQ ID 15;
(235) ii)
(236) is an antibody which comprises a) a CDR4 consisting of the amino acid sequence of SEQ ID 16; and b) a CDR5 consisting of the amino acid sequence of SEQ ID 17; and c) a CDR6 consisting of the amino acid sequence of SEQ ID 18;
(237) iii)
(238) is an antibody which comprises a) a CDR4 consisting of the amino acid sequence of SEQ ID 19; and b) a CDR5 consisting of the amino acid sequence of SEQ ID 20; and c) a CDR6 consisting of the amino acid sequence of SEQ ID 18;
(239) iv)
(240) is an antibody which comprises a) a CDR4 consisting of the amino acid sequence of SEQ ID 19; and b) a CDR5 consisting of the amino acid sequence of SEQ ID 17; and c) a CDR6 consisting of the amino acid sequence of SEQ ID 18;
(241) or
(242) B) an antibody which is a functionally active variant of a parent antibody that is any of the group members of A, which comprises at least one functionally active CDR variant of any of the CDR4, CDR5 or CDR6 of the parent antibody.
(243) 17. The antibody of definition 16, comprising a VL amino acid sequence selected from any of the VL sequences as depicted in
(244) 18. The antibody of any of definitions 12 to 17, which comprises a) the CDR1-CDR6 sequences of any of the antibodies as listed in Table 1; or b) the VH and VL sequences of any of the antibodies as depicted in
(245) 19. The antibody of any of definitions 1 to 18, comprising a functionally active CDR variant of any of the CDR sequences as listed in Table 1, wherein the functionally active CDR variant comprises at least one of
(246) a) 1, 2, or 3 point mutations in the parent CDR sequence; and/or
(247) b) 1 or 2 point mutations in any of the four C-terminal or four N-terminal, or four centric amino acid positions of the parent CDR sequence; and/or
(248) c) at least 60% sequence identity with the parent CDR sequence; preferably wherein the functionally active CDR variant comprises 1 or 2 point mutations in any CDR sequence consisting of less than 4 or 5 amino acids.
(249) 20. The antibody of any of definitions 1 to 19, for use in treating a subject at risk of or suffering from Klebsiella pneumoniae infection or colonization comprising administering to the subject an effective amount of the antibody to limit the infection in the subject or to ameliorate a disease condition resulting from said infection, preferably for treatment or prophylaxis of any of primary and secondary bacteremia, pneumonia, urinary tract infection, liver abscess, peritonitis, or meningitis.
(250) 21. A pharmaceutical preparation comprising the antibody of any of definitions 1 to 19, preferably comprising a parenteral or mucosal formulation, optionally containing a pharmaceutically acceptable carrier or excipient.
(251) 22. Use of the antibody of any of definitions 1 to 19, for diagnosis of Klebsiella pneumoniae infection or colonization, or an associated disease such as primary and secondary bacteremia, pneumonia, urinary tract infection, liver abscess, peritonitis, or meningitis in a subject.
(252) 23. Use according to definition 22, wherein the subject is an immunocompromised or immunosuppressed patient, or a contact thereof.
(253) 24. Diagnostic preparation of the antibody of any of definitions 1 to 19, comprising the antibody and a further diagnostic reagent in a composition or a kit of parts, comprising the components a) the antibody; and b) the further diagnostic reagent; c) and optionally a solid phase to immobilize at least one of the antibody and the diagnostic reagent.
(254) 25. Diagnostic preparation of definition 24, wherein the further diagnostic reagent is a diagnostic label or a reagent specifically reacting with the antibody and/or the reaction product of the antibody binding to its antigen.
(255) 26. Method of diagnosing Klebsiella pneumoniae infection or colonization in a subject caused by a Klebsiella pneumoniae strain, comprising a) providing an antibody according to any of definitions 1 to 19, and b) detecting if the antibody specifically immunoreacts with the galactan-III epitope in a biological sample of the subject to be tested, thereby diagnosing Klebsiella pneumoniae infection or colonization.
(256) 27. Method of definition 26, wherein the biological samples is a body fluid or tissue sample, preferably a sample selected from the group consisting of a blood sample, stool sample, skin sample, urine sample, cerebrospinal fluid, and a respiratory tract specimen such as endotracheal aspirates, pleural fluid, lung tap, nasal swab or sputum, or a Klebsiella pneumoniae isolate originating from any of the foregoing.
(257) 28. Isolated nucleic acid encoding an antibody of any of the definitions 1 to 19.
(258) 29. An expression cassette or a plasmid comprising a coding sequence to express a proteinaceous construct or a protein, which comprises a VH and/or VL of an antibody of any of definitions 1 to 19.
(259) 30. A host cell comprising an expression cassette or a plasmid of definition 29.
(260) 31. Method of producing an antibody of any of definitions 1 to 19, wherein a host cell of definition 30 is cultivated or maintained under conditions to produce said antibody.
(261) 32. A method of identifying a candidate antibody comprising: a) providing a sample containing an antibody or antibody-producing cell; and b) assessing for binding of an antibody in or produced by the sample with a galactan-III epitope as defined in definition 1, wherein a positive reaction between the antibody and the epitope identifies the antibody as candidate antibody.
(262) 33. A method of identifying a candidate antibody comprising: a) providing a sample containing an antibody or antibody-producing cell; and b) assessing for binding of an antibody in or produced by the sample with the galactan-III epitope as defined in definition 1, wherein a specific positive reaction between the antibody and the galactan-III epitope relative to the galactan-I epitope identifies the antibody as candidate antibody.
(263) 34. A method of producing an antibody of any of definitions 1 to 19, comprising a) providing a candidate antibody identified according to definition 32 or 33; and b) producing a monoclonal antibody, or a humanized or human form of the candidate antibody, or a derivative thereof with the same epitope binding specificity as the candidate antibody.
(264) The present invention is further illustrated by the following examples without being limited thereto.
EXAMPLES
Example 1: Identification of the Genetic Background of a Novel Galactan Structure
(265) Since the original description (3) of the galactan-I specific rfb (also known as wb) cluster several full genome sequences have become available. As the rfb cluster always integrates between two conserved genes (uge and hisI), the exact size of the rfb loci could be determined. In silico analysis revealed two alternative lengths of the rfb operon (
(266) Even the shorter full length rfb operon is approx. 2 kb longer than that described by Clarke et al. and contains an additional gene annotated as hypothetical glycosyltransferase family protein. This gene shows poor homology between the long and short rfb operons. Given that the cloned cluster devoid of this gene restored galactan-I synthesis (5) this gene appears to be dispensable for galactan-I expression.
(267) In the longer form of the rfb locus there is an additional 3 kb region comprising 3 genes organized into one operon on the opposite DNA strand. These genes show high sequence similarity to the glycosyltransferase family often carried by mobile genetic elements in various members of Enterobacteriaceae. This kind of horizontally acquired glycosyltransferases are thought to play a role in serotype-conversion (6) or increase intra- and inter-strain phenotypic diversity. Interestingly, in case of Klebsiella oxytoca the identical gtr cluster was found at a chromosomal site unlinked to the rfb cluster (unpublished finding). It is, therefore, possible that certain K. pneumoniae strains obtained this cluster by horizontal gene transfer from K. oxytoca.
(268) The structure of O-antigen subunits purified from an O2 strain carrying the longer rfb locus (i.e. incorporating the gtr genes) showed a branching tri-galactose repeat unit (
(269) In contrast to what has been published earlier (5), biochemical analysis showed that this modification of galactan-I repeating units is not fully stoichiometric, although the vast majority of the units are galactan-III. Stoichiometry of the modification, nevertheless, may be strain dependent as well as under the influence of expressional regulation and hence needs further investigation.
Example 2: Epidemiology of Galactan-III
(270) In order to detect the gtr-like genes within the rfb cluster in clinical isolates of K. pneumoniae, primers annealing to the conserved wbbO and hisI genes (see
(271) TABLE-US-00001 TABLE 2 Primers used for the detection of gtr+ and gtr- strains Melting Fragment Fragment Primer temperature size in gtr- size in gtr+ name Primer sequence (5′-3′) (° C.) operon (bp) operon (bp) wbbO TGTTGTGGAGTAAAGGACTG 65.8 2183 5020 rev GGCG, SEQ ID 39 hisI ACCGCTTCGAGCTGAAGAAT 64 GAG, SEQ ID 40
(272) O1, O2 and O2ac prototype strains of K. pneumoniae were tested for the presence of the gtr-like genes with the above described primers. Genomic DNA was purified from the strains with Wizard® Genomic DNA purification kit (Promega) according to the manufacturer's instruction. PCR reaction was set up with Phusion® High-Fidelity PCR Master Mix (Thermo) in 20μl mixture with 20 pmol of forward and reverse primers and 0.2 μl purified gDNA. PCR was run in a TProfessional TRIO Thermocycler (Biometra) with the following program:
(273) TABLE-US-00002 Initial denaturing 98° C. 1 min Denaturing 98° C. 30 sec Annealing 64° C. 30 sec Elongation 72° C. 3 min Final elongation 72° C. 5 min cycles 30 cycles
(274) Reaction mixture was loaded on 1% agarose gel, visualized with GelRed™ (Biotium) and the image was captured with ImageQuant™ LAS 4000 (GE Healthcare) (
(275) The PCR confirmed that gtr+ and gtr− isolates can be detected among both O1 and O2 strains. To elucidate the frequency of gtr+ and gtr− isolates among clinical isolates, screened 45 O1 and 47 O2 clinical isolates were screened from different geographical origin. Among the O1 isolates isolated 27 (60%) gtr− and 18 (40%) gtr+ isolates were isolated, among the O2 strains, identified 15 (32%) gtr− and 32 (68%) gtr+ strains were identified.
(276) Interestingly, it was found that that the majority of strains belonging to the multi-drug resistant KPC (Klebsiella pneumoniae carbapenemase)-producing endemic clone ST258 carry the operon encoding galactan-III (i.e. the long rfb.sub.gal-I locus incorporating the gtr genes). 27 ST258 isolates were analysed by PCR and additionally 224 genome sequences available in databases were analysed in silico. A total of 210 (83.6%) of these strains carried an intact rfb operon incorporating the gtr genes (i.e. expected to express galactan-III antigen). Genomes of many of the remaining strains contained at least parts of the gtr genes, however, were not expected to express intact galactan-III due to deletions or transposon insertions.
(277) Since the genetic background of galactan-II synthesis was recently described (4), O1 and 2 strains could be differentiated solely by analysis of the genomic sequences. However, none of the ST258 isolates carried these O1 specific determinants. Moreover none of the available ST258 isolates reacted to galactan-II specific mAbs, confirming that these isolates are of the O2 serogroup.
(278) These data suggest that the clonal lineage ST258 is strongly associated with expression of galactan-III O-antigens and apparently, in the majority of ST258 strain galactan-III is the sole O-side chain determinant (i.e. galactan-III antigens are not capped by galactan-II). This renders galactan-III an attractive target for antibodies for immune based diagnostics and/or therapeutics.
Example 3: Generation of Monoclonal Antibodies Specific to Galactan-III
(279) Murine monoclonal mAbs were generated by standard hybridoma technique using mice immunized with gtr+ O2 (i.e. gal-III expressing) strain. Four mAbs were selected that showed specificity to galactan-III antigens. In order to investigate whether binding of these mAbs is influenced by the gtr-mediated decoration of galactan-I molecules, a panel of LPS molecules purified from gtr− as well as gtr+ O1 and O2 strains were investigated by immunoblots. Antibodies were diluted to 1 μg/ml concentration, anti-mouse IgG secondary antibody was diluted in 1:20,000.
(280) All 4 mAbs showed identical binding pattern. The results obtained with one representative mAb (9H9-H7) are shown in
(281) In order to further confirm specificity of these mAbs, immune reactivity was investigated on a panel of isogenic derivatives (
Example 4: Biolayer Interferometry (BLI) Measurement
(282) Antibody binding characteristics were investigated by biolayer interferometry (BLI). Antibody binding was measured by immobilizing biotinylated D-galactan III polysaccharide antigen (purified from an O2 gtr+ K. pneumoniae strain) on streptavidin sensors (ForteBio, Pall Life Sciences) and monitoring the association of the chimeric mAbs (10 μg/mL) to the preloaded sensors for 10 min in DPBS containing 1% bovine serum albumin (BSA) and 0.05% Tween-20, followed by dissociation (1 hour) in the same buffer. The K.sub.d, k.sub.on and k.sub.off values were determined using the Data Analysis 7 software (ForteBio, Pall Life Sciences). Response values below 0.05 nm were considered negative.
(283) The K.sub.d, k.sub.on and k.sub.off values are summarized in Table 3. All mAbs showed strong avid binding to the purified antigen (K.sub.d 0.1 nM-10 nM), with similar k.sub.on values (only 3-fold difference between the lowest and highest k.sub.on values). In contrast k.sub.off values of mAbs 5A4 and 9H9 are ˜2 orders of magnitude lower than that of 2D8 and 8E3. No binding to negative control antigen was observed with any of the mAbs.
(284) TABLE-US-00003 TABLE 3 K.sub.d, K.sub.on and K.sub.off values of chimeric D-galactan III specific mAbs mAb K.sub.d k.sub.on k.sub.off 2D8 1.12E−08 6.85E+04 7.66E−04 5A4 1.06E−10 9.19E+04 9.75E−06 9H9 3.40E−10 3.54E+04 1.20E−05 8E3 1.32E−08 6.29E+04 8.30E−04
Example 5: Surface Staining of Live Klebsiella Cells
(285) Surface binding of one representative mAb (9H9-H7) was tested with flow cytometry on several clinical isolates of Klebsiella with different O-types (Table 4).
(286) Overnight grown bacteria were diluted and grown to mid-log phase (OD.sub.600=0.5), washed in PBS and used for surface staining. 2×10.sup.6 bacteria were re-suspended in PBS containing 0.5% BSA+0.0.1% sodium azide, and stained with mAb 9H9-H7 in 40 μg/mL concentration for 30 minutes on ice. Samples were washed twice in PBS-buffer containing BSA and sodium azide, re-suspended in PBS containing 4 μg/mL AlexaFluor 488-conjugated goat anti-mouse IgG secondary antibody and incubated for 30 minutes on ice. After washing, samples were re-suspended in PBS containing 5 nM SYTO-62 dye and incubated for 10 minutes on ice before analysis on i-Cyt Eclipse flow cytometer.
(287) The flow results (Table 4) corroborate that the investigated mAbs have specificity towards galactan-III (i.e. gtr positive strains) based on the results obtained with clinical gtr+ and gtr− strains.
(288) TABLE-US-00004 TABLE 4 Surface staining by galactan-III specific mAbs of O1 and O2 strains with different gtr status. Values represent fluorescence intensity (FL-1)/1000 Strain Sec. Ctrl 2D8-A10 5A4-A7 9H9-H7 8E3-E5 O2 gtr− Kp20 4.2 4.2 4.2 4.4 4.1 Kp26 4.2 4.2 4.3 4.3 4.3 O2 gtr+ #79 4.3 281.1 230.1 157.8 288.9 Kp19 4.3 80.4 82.5 60.4 71.2
(289) Furthermore, binding to a collection of ST258 strains was also determined by flow cytometry as described above (Table 5). 8/11 of the investigated strains were stained strongly by all four mAbs, one strain was proven to be rough and the two remaining strains showed a non-typeable LPS structure (data not shown). None of these strains reacted to a galactan-II specific mAb (see above).
(290) TABLE-US-00005 TABLE 5 Surface staining by galactan-III specific mAbs of ST258 isolates. Values represent fluorescent intensity (FL-1). Strain Sec. ctrl 2D8-A10 5A4-A7 9H9-H7 8E3-E5 Kp30 171 32066 40815 36796 41652 Kp31 172 8720 10647 10797 16701 Kp32 202 4040 4077 4739 5940 Kp150 207 1616 2945 2249 2989 Kp151 198 29495 26435 28560 37665 Kp157 192 8344 9659 8849 10334 Kp159 210 202 207 202 201 Kp160 222 210 219 216 214 Kp161 213 2517 7644 5352 4304 Kp162 214 4366 8962 5891 4681
Example 6: Comparison of Functional Efficacy of the Different Galactan-III Specific mAbs
(291) Chimeric mAbs were generated in which mouse variable regions (VH and VL, for the heavy and light chains, respectively) were genetically fused to human IgG1 and kappa constant regions. Following testing in different functional assays in vitro and in vivo (see below), the best chimeric mAbs were subjected to humanization. Humanization was achieved by grafting the CDR sequences of both heavy and light chains from murine framework regions into corresponding (in silico predicted) human frameworks. Consequently, in these humanized mAbs the sole mouse-derived sequences are the CDR regions, the rest of the mAbs comprise of human sequences.
(292) Furthermore, humanized light chains were paired to different humanized heavy chains (light chain shuffling, see
Example 7: Protective Efficacy of Gal-III Specific mAbs In Vivo
(293) Groups of 5 mice were passively immunized intraperitoneally with chimeric (
(294) All chimeric mAbs tested showed significant protection at doses of as low as 1 μg/mouse (
(295) The most efficacious humanized mAbs with respect to endotoxin neutralization potential (see below in example 8) were tested in the same model. Since all of the humanized mAbs carried the 5A4-derived light chain CDR-s, protective efficacy was benchmarked against the chimeric mAb 5A4. As shown on
Example 8: In Vitro Neutralization of Endotoxin
(296) Given the high serum susceptibility of K. pneumoniae O2 strains, we have proposed that endotoxin neutralization and not bactericidal activity may be the primary mode of action for protection described above (Example 7). In order to corroborate this experimentally endotoxin neutralization potency of galactan-III specific mAbs was investigated in vitro.
(297) A commercial reporter cell line (HEK-Blue™ TLR4, Invivogen) was used to detect Toll like receptor 4 (TLR-4) signalling triggered by purified LPS according to the manufacturer's instructions. Thirty-five μl of mAb (diluted in HEK Blue™ medium) was mixed with 25 μl of freshly thawed purified LPS. O2 gtr+ LPS derived from strain PCM-27 (O2 gtr+:K27 Polish Collection of Microbes, Poland). Stock solutions were prepared at 0.4 ng/ml concentration in HEK Blue™ medium. Mixture was transferred into clear 96-well half-area plates and incubated at room temperature for 30 minutes. Fifty μl suspension of HEK-Blue™ cells was added (˜50,000 cells/well). Plates were wrapped in aluminium foil and incubated overnight (16-18 hours) at 37° C. with 5% CO.sub.2. On the following day optical density was measured at 630 nm and reporter protein level (secreted embryonic alkaline phosphatase—SEAP) over mock was calculated. Percent inhibition of SEAP induction relative to no antibody control was calculated and plotted at different mAb concentration. 50% inhibitory concentration (1050) was calculated with GraphPad Prism 5.0 using log(inhibitor) vs. response-variable slope nonlinear regression analysis. As positive control polymyxin B (PMB-Sulfate, FLUKA Cat. #81334) was used similar to the tested mAbs. As negative control, an irrelevant mAb was included.
(298) Neutralization potential of humanized mAbs was compared to their parental (with respect to the heavy chain, since humanized light chains were shuffled) chimeric mAbs at 1 ug/ml mAb doses (
(299) In order to further support this finding, the best humanized mAbs of each lineage as well as their parental chimeric mAbs were titrated in the same in vitro neutralization assay. As depicted on
REFERENCES
(300) (1) Hansen D S, Mestre F, Alberti S, et al. Klebsiella pneumoniae lipopolysaccharide O typing: revision of prototype strains and O-group distribution among clinical isolates from different sources and countries. J Clin Microbiol 1999 January; 37(1):56-62. (2) Trautmann M, Ruhnke M, Rukavina T, et al. O-antigen seroepidemiology of Klebsiella clinical isolates and implications for immunoprophylaxis of Klebsiella infections. Clin Diagn Lab Immunol 1997 September; 4(5):550-5. (3) Clarke B R, Whitfield C. Molecular cloning of the rfb region of Klebsiella pneumoniae serotype O1:K20: the rfb gene cluster is responsible for synthesis of the D-galactan I O polysaccharide. J Bacteriol 1992 July; 174(14):4614-21. (4) Hsieh P F, Wu M C, Yang F L, et al. D-galactan II is an immunodominant antigen in O1 lipopolysaccharide and affects virulence in Klebsiella pneumoniae: implication in vaccine design. Front Microbiol 2014; 5:608. (5) R. F. Kelly, M. B. Perry, L. L. MacLean, C. Whitfield. Structures of the O-antigens of Klebsiella serotypes 02 (2a,2e), 02 (2a, 2e, 2h), and 02 (2a, 2f, 2g) members of a family of related D-galactan O-antigens in Klebsiella spp. Journal of Endotoxin Research 1995; 2:131-40. (6) Allison G E, Verma N K. Serotype-converting bacteriophages and O-antigen modification in Shigella flexneri. Trends Microbiol 2000 January; 8(1):17-23.