Mutant p-hydroxyphenylpyruvate dioxygenase, and coding nucleic acid and use thereof
12428627 ยท 2025-09-30
Assignee
Inventors
- Lei LIAN (Qingdao, CN)
- SUDONG MO (Qingdao, CN)
- HUARONG LI (Qingdao, CN)
- Guangdi YUAN (Qingdao, CN)
- Zhenguo LI (Qingdao, CN)
- Junjie ZHANG (Qingdao, CN)
- DEHUI DING (Qingdao, CN)
- Bo Chen (Qingdao, CN)
- Guizhi LIU (Qingdao, CN)
- Chao SONG (Qingdao, CN)
- Lei Wang (Qingdao, CN)
Cpc classification
C12Y113/11027
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof and an isolated polynucleotide comprising a nucleic acid sequence encoding the protein or fragment thereof, wherein the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof retains or enhances the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisate and is significantly less sensitive to HPPD-inhibiting herbicides than a wild-type HPPD. The present invention also relates to a nucleic acid construct, an expression vector and a host cell comprising the polynucleotide, as well as to a method for producing a plant that has the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisate and significantly reduced sensitivity to HPPD-inhibiting herbicides.
Claims
1. A mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein, comprising the amino acid sequence of SEQ ID NO: 2 with the exception of substitution set forth in R93S, A103S, H141R, H141K, H141T, A165V, V191I, R220K, G226H, L276W, N338D, N338S, N338Y, G342D, D370N, I377C, P386T, M392L, E403G, K410I, N420S, N420T, E430G or Y431 L, or a combination thereof.
2. The mutant p-hydroxphenylpyruvate dioxygenase (HPPD) protein according to claim 1, wherein the mutant p-hydroxyphenylpyruvate dioxygenase protein comprises the amino acid sequence as set forth in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 60, SEQ ID NO; 62, SEQ ID NO: 66, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82 or SEQ ID NO: 84.
3. A mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein comprising the amino acid sequence of SEQ ID NO: 2 with the exception of substitution set forth in: H141R/G342D, H141R/D370N, G342D/D370N, H141R/N338D, N338D/G342D, G342D/R346H, H141R/N420S, H141R/G342D/D370N, H141R/N338D/N420S, H141R/N338S/N420S, N338D/G342D/R346H, N338S/G342D/R346H, N338Y/G342D/R346H, H141R/N338D/G342D, H141R/G342D/P386T, H141R/G342D/R346H, H141R/G342D/N420S, H141R/G342D/L276W, H141R/G342D/I377C, H141R/G342D/M392L, H141R/N338S/G342D, H141R/N338Y/G342D, H141R/N338D/G342D/P386T, or H141R/N338D/G342D/R346H.
4. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein according to claim 1, wherein the mutant p-hydroxyphenylpyruvate dioxygenase protein filer comprises the amino acid sequence as set forth in SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 86, SEQ ID NO: 90, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 108, SEQ ID NO: 114, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 130, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 162, SEQ ID NO: 166, SEQ ID NO: 204, SEQ ID NO: 210, or SEQ ID NO: 216.
5. A fusion protein, comprising the mutant HPPD protein according to claim 1 and an additional component that is fused thereto.
6. The fusion protein comprising the mutant HPPD protein according to claim 5, wherein the additional component is a tag peptide or a guiding peptide for plastid.
Description
DESCRIPTION OF FIGURES
(1)
(2) ##STR00001##
at different concentrations, displaying different degrees of color change. In wells with the herbicide at same concentration, the darker the color, the higher the resistance/tolerance to this herbicide.
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10) ##STR00002##
at different concentrations, displaying different degrees of color change. In wells with the herbicide at same concentration, the darker the color, the higher the resistance/tolerance to this herbicide.
(11)
(12)
(13)
(14)
(15)
(16)
(17) A: the base-edited seedlings: in the culture medium containing 0.4 M of tembotrione, the unsuccessfully edited seedlings are whitened (phytotoxicity), and the successfully edited ones remain green.
(18) B: the sequence of the base-edited target: the amino acid at the position 141 of the wild-type rice HPPD is histidine (His), and the corresponding codon is CAC (the above panel), while, after editing, the corresponding amino acid is arginine (Arg), and the corresponding codon is CGC (the example is a hybrid, and there is a double peak).
(19)
(20)
(21)
(22) A: the rice HPPD gene-edited seedlings: in the culture medium containing 0.4 M of tembotrione, the unsuccessfully edited seedlings (wild-type WT) are whitened (phytotoxicity), and the successfully edited ones (two seedlings: AW2 and AW3) remain green;
(23) B: after the homologous replacement, the codons corresponding to the amino acid positions 342 and 370 change, i.e., GGC becomes GAC and GAC becomes AAC (a hybrid: leading to partial G342D and D370N); H141R (CAC>CGC) is also successfully edited (the sequence is not listed in the figure).
DETAILED DESCRIPTION OF THE INVENTION
(24) Some terms used in the specification are defined as follows.
(25) In the present invention, the term HPPD-inhibiting herbicide refers to a substance that has herbicidal activity per se or a substance that is used in combination with other herbicides and/or additives which can change its effect, and the substance can act by inhibiting HPPD. Substances which are capable of producing herbicidal activity by inhibiting HPPD are well known in the art, including many types: 1) triketones, e.g., sulcotrione (CAS No.: 99105-77-8), mesotrione (CAS No.: 104206-82-8), bicyclopyrone (CAS No.: 352010-68-5), tembotrione (CAS No.: 335104-84-2), tefuryltrione (CAS No.: 473278-76-1), benzobicyclon (CAS No.: 156963-66-5); 2) diketonitriles, e.g., 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-4-trifluoromethylphenyl)propane-1,3-dione (CAS No.: 143701-75-1), 2-cyano-3-cyclopropyl-1-(2-methylsuffonyl-3,4-dichlorophenyl)propane-1,3-dione (CAS No.: 212829-55-5), 2-cyano-1-[4-(methylsulfonyl)-2-trifluoromethylphenyl]-3-(1-methylcycloprop-yl)propane-1,3-dione (CAS No.: 143659-52-3): 3) isoxazoles, e.g., isoxaflutole (CAS No.: 141112-29-0); isoxachlortole (CAS No.: 141112-06-3), clomazone (CAS No.: 81777-89-1); 4) pyrazoles, e.g., topramezone (CAS No.: 210631-68-8); pyrasulfotole (CAS No.: 365400-11-9), pyrazoxyfen (CAS No.: 71561-11-0); pyrazolate (CAS No.: 58011-68-0), benzofenap (CAS No.: 82692-44-2), shuangzuocaotong (CAS No.: 1622908-18-2), tolpyralate (CAS No.: 1101132-67-5), benzuofucaotong (CAS No.: 1992017-55-6), huanbifucaotong (CAS No.: 1855929-45-1), sanzuohuangcaotong (CAS No.: 1911613-97-2); 5) benzophenons; 6) others: lancotrione (CAS No.: 1486617-21-3), fenquinotrione (CAS No.: 1342891-70-6). Preferably, the said herbicides are tembotrione, benzuofucaotong, huanbifucaotong, topramezone, mesotrione, shuangzuocaotong or any combinations thereof and the like.
(26) Plants having enhanced tolerance to HPPD-inhibiting herbicides or enhanced resistance to HPPD-inhibiting herbicides refer to such plants that have higher tolerance or resistance to the said HPPD-inhibiting herbicides as compared to plants with wild type HPPD genes. HPPD enzymes having enhanced tolerance to HPPD-inhibiting herbicides or enhanced resistance to HPPD-inhibiting herbicides refer to such HPPD enzymes that exhibit an enzyme activity that is at least 10%, preferably at least 15%, more preferably at least 20%, higher than wild-type HPPD enzymes at herbicide concentrations known to inhibit the activity of the corresponding wild-type HPPD enzyme protein. In the present invention, the terms HPPD-inhibiting herbicide tolerance and HPPD-inhibiting herbicide resistance are used interchangeably and the both refer to tolerance to HPPD-inhibiting herbicides and resistance to HPPD-inhibiting herbicides.
(27) The term wild type refers to an existing nucleic acid molecule or protein that can be found in nature.
(28) The terms protein, polypeptide and peptide can be used interchangeably in the present invention and refer to a polymer of amino acid residues, including polymers of chemical analogs in which one or more amino acid residues are natural amino acid residues. The proteins and polypeptides of the present invention may be recombinantly produced or chemically synthesized. The term mutated protein or mutant protein refers to a protein having substitutions, insertions, deletions and/or additions of one or more amino acid residues as compared to the amino acid sequence of a corresponding wild-type protein.
(29) The terms polynucleotide and nucleic acid are used interchangeably, including DNA, RNA or hybrids thereof, which are either double-stranded or single-stranded.
(30) In the present invention, the host organism should be understood to mean any single or multicellular organism into which a nucleic acid encoding a mutant HPPD protein can be introduced, including, for example, bacteria such as Escherichia coli, fungi such as yeast (e.g., Saccharomyces cerevisiae), molds (e.g., aspergillus), plant cells, plants and the like.
(31) In the present invention, the plant should be understood to mean any differentiated multicellular organism capable of performing photosynthesis, in particular monocotyledonous or dicotyledonous plants, for example, (1) food crops: Oryza spp., like Oryza sativa, Oryza latifolia, Oryza sativa, Oryza glaberrima; Triticum spp., like Triticum aestivum, T. Turgidumssp. durum; Hordeum spp., like Hordeum vulgare, Hordeum arizonicum; Secale cereale; Avena spp., like Avena sativa, Avena fatua, Avena byzantine, Avena fatua var.sativa, Avena hybrida; Echinochloa spp., like Pennisetum glaucum, Sorghum, Sorghum bicolor, Sorghum vulgare, Triticale, Zea mays or Maize, Millet, Rice, Foxtail millet, Proso millet, Sorghum bicolor, Panicum, Fagopyrum spp., Panicum miliaceum, Setaria italica, Zizania palustris, Eragrostis tef, Panicum miliaceum, Eleusine coracana; (2) legume crops: Glycine spp. like Glycine max, Soja hispida, Soja max, Vicia spp., Vigna spp., Pisum spp., field bean, Lupinus spp., Vicia, Tamarindus indica, Lens culinaris, Lathyrus spp., Lablab, broad bean, mung bean, red bean, chickpea; (3) oil crops: Arachis hypogaea, Arachis spp, Sesamum spp., Helianthus spp. like Helianthus annuus, Elaeis like Eiaeis guineensis, Elaeis oleifera, soybean, Brassicanapus, Brassica oleracea, Sesamum orientale, Brassica juncea, Oilseed rape, Camellia oleifera, oil palm, olive, castor-oil plant, Brassica napus L., canola; (4) fiber crops: Agave sisalana, Gossypium spp. like Gossypium, Gossypium barbadense, Gossypium hirsutum, Hibiscus cannabinus, Agave sisalana, Musa textilis Nee, Linum usitatissimum, Corchorus capsularis L, Boehmeria nivea (L.), Cannabis sativa, Cannabis sativa; (5) fruit crops: Ziziphus spp., Cucumis spp., Passiflora edulis, Vitis spp., Vaccinium spp., Pyrus communis, Prunus spp., Psidium spp., Punica granatum, Malus spp., Citrullus lanatus, Citrus spp., Ficus carica, Fortunella spp., Fragaria spp., Crataegus spp., Diospyros spp., Eugenia unifora, Eriobotrya japonica, Dimocarpus longan, Carica papaya, Cocos spp., Averrhoa carambola, Actinidia spp., Prunus amygdalus, Musa spp. (musa acuminate), Persea spp. (Persea Americana), Psidium guajava, Mammea Americana, Mangifera indica, Canarium album (Oleaeuropaea), Caricapapaya, Cocos nucifera, Malpighia emarginata, Manilkara zapota, Ananas comosus, Annona spp., Citrus reticulate (Citrus spp.), Artocarpus spp., Litchi chinensis, Ribes spp., Rubus spp., pear, peach, apricot, plum, red bayberry, lemon, kumquat, durian, orange, strawberry, blueberry, hami melon, muskmelon, date palm, walnut tree, cherry tree; (6) rhizome crops: Manihot spp., Ipomoea batatas, Colocasia esculenta, tuber mustard, Allium cepa (onion), eleocharis tuberose (water chestnut), Cyperus rotundus, Rhizoma dioscoreae; (7) vegetable crops: Spinacia spp., Phaseolus spp., Lactuca sativa, Momordica spp, Petroselinum crispum, Capsicum spp., Solanum spp. (such as Solanum tuberosum, Solanum integrifolium, Solanum lycopersicum), Lycopersicon spp. (such as Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Kale, Luffa acutangula, lentil, okra, onion, potato, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, carrot, cauliflower, celery, collard greens, squash, Benincasa hispida, Asparagus officinalis, Apium graveolens, Amaranthus spp., Allium spp., Abelmoschus spp., Cichorium endivia, Cucurbita spp., Coriandrum sativum, B. carinata, Rapbanus sativus, Brassica spp. (such as Brassica napus, Brassica rapa ssp., canola, oilseed rape, turnip rape, turnip rape, leaf mustard, cabbage, black mustard, canola (rapeseed), Brussels sprout, Solanaceae (eggplant), Capsicum annuum (sweet pepper), cucumber, luffa, Chinese cabbage, rape, cabbage, calabash, Chinese chives, lotus, lotus root, lettuce; (8) flower crops: Tropaeolum minus, Tropaeolum majus, Canna indica, Opuntia spp., Tagetes spp., Cymbidium (orchid), Crinum asiaticum L., Clivia, Hippeastrum rutilum, Rosa rugosa, Rosa Chinensis, Jasminum sambac, Tulipa gesneriana L., Cerasus sp., Pharbitis nil (L.) Choisy, Calendula officinalis L., Nelumbo sp., Bellis perennis L., Dianthus caryophyllus, Petunia hybrida, Tulipa gesneriana L., Lilium brownie, Prunus mume, Narcissus tazetta L., Jasminum nudiflorum Lindl., Primula malacoides, Daphne odora, Camellia japonica, Michelia alba, Magnolia liliiflora, Viburnum macrocephalum, Clivia miniata, Malus spectabilis, Paeonia suffruticosa, Paeonia lactiflora, Syzygium aromaticum, Rhododendron simsii, Rhododendron hybridum, Michelia figo (Lour.) Spreng., Cercis chinensis, Kerria japonica, Weigela florida, Fructus forsythiae, Jasminum mesnyi, Parochetus communis, Cyclamen persicum Mill., Phalaenophsis hybrid, Dendrobium nobile, Hyacinthus orientalis, Iris tectorum Maxim, Zantedeschia aethiopica, Calendula officinalis, Hippeastrum rutilum, Begonia semperflorenshybr, Fuchsia hybrida, Begonia maculataRaddi, Geranium; (9) medicinal crops: Carthamus tinctorius, Mentha spp., Rheum rhabarbarum, Crocus sativus, Lycium chinense, Polygonatum odoratum, Polygonatum Kingianum, Anemarrhena asphodeloides Bunge, Radix ophiopogonis, Fritillaria cirrhosa, Curcuma aromatica, Amomum villosum Lour., Polygonum multiflorum, Rheum officinale, Glycyrrhiza uralensis Fisch, Astragalus membranaceus, Panax ginseng, Panax notoginseng, Acanthopanax gracilistylus, Angelica sinensis, Ligusticum wallichii, Bupleurum sinenses DC., Datura stramonium Linn., Datura metel L., Mentha haplocalyx, Leonurus sibiricus L., Agastache rugosus, Scutellaria baicalensis, Prunella vulgaris L., Pyrethrum carneum, Ginkgo biloba L., Cinchona ledgeriana, Hevea brasiliensis (wild), Medicago sativa Linn, Piper Nigrum L.; (10) raw material crops: Hevea brasiliensis, Ricinus communis, Vernicia fordii, Morus alba L., Hops Humulus lupulus, Betula, Alnus cremastogyne Burk., Rhus verniciflua stokes; (11) pasture crops: Agropyron spp., Trifolium spp., Miscanthus sinensis, Pennisetum sp., Phalaris arundinacea, Panicum virgatum, prairiegrasses, Indiangrass, Big bluestem grass, Phleum pratense, turf, cyperaceae (Kobresia pygmaea, Carex pediformis, Carex humilis), Medicago sativa Linn, Phleum pratense L., Medicago sativa, Melilotus suavcolen, Astragalus sinicus, Crotalaria juncea, Sesbania cannabina, Azolla imbircata, Eichhomia crassipes, Amorpha fruticosa, Lupinus micranthus, Trifolium, Astragalus adsurgens pall, Pistia stratiotes linn, Altemanthera philoxeroides, Lolium; (12) sugar crops: Saccharum spp., Beta vulgaris; (13) beverage crops: Camellia sinensis, Camellia Sinensis, tea, Coffee (Coffea spp.), Theobroma cacao, Humulus lupulus Linn.; (14) lawn plants: Ammophila arenaria, Poa spp. (Poa pratensis (bluegrass)), Agrostis spp. (Agrostis matsumurae, Agrostis palustris), Lolium spp. (Lolium), Festuca spp. (Festuca ovina L.), Zoysia spp. (Zoysiajaponica), Cynodon spp. (Cynodon dactylon/bermudagrass), Stenotaphrum secunda turn (Stenotaphrum secundatum), Paspalum spp., Eremochloa ophiuroides (centipedegrass), Axonopus spp. (carpetweed), Bouteloua dactyloides (buffalograss), Bouteloua var. spp. (Bouteloua gracilis), Digitaria sanguinalis, Cyperusrotundus, Kyllingabrevifolia, Cyperusamuricus, Erigeron canadensis, Hydrocotylesibthorpioides, Kummerowiastriata, Euphorbia humifusa, Viola arvensis, Carex rigescens, Carex heterostachya, turf; (15) tree crops: Pinus spp., Salix spp., Acer spp., Hibiscus spp., Eucalyptus spp., Ginkgo biloba, Bambusa sp., Populus spp., Prosopis spp., Quercus spp., Phoenix spp., Fagus spp., Ceiba pentandra, Cinnamomum spp., Corchorus spp., Phragmites australis, Physalis spp., Desmodium spp., Populus, Hedera helix, Populus tomentosa Carr, Viburnum odoratissinum, Ginkgo biloba L., Quercus, Ailanthus altissima, Schima superba, Ilex pur-purea, Platanus acerifolia, ligustrum lucidum, Buxus megistophylla Levl., Dahurian larch, Acacia mearnsii, Pinus massoniana, Pinus khasys, Pinus yunnanensis, Pinus finlaysoniana, Pinus tabuliformis, Pinus koraiensis, Juglans nigra, Citrus limon, Platanus acerifolia, Syzygium jambos, Davidia involucrate, Bombax malabarica L., Ceiba pentandra (L.), Bauhinia blakeana, Albizia saman, Albizzia julibrissin, Erythrina corallodendron, Erythrina indica, Magnolia gradiflora, Cycas revolute, Lagerstroemia indica, coniferous, macrophanerophytes, Frutex; (16) nut crops: Bertholletia excelsea, Castanea spp., Corylus spp., Carya spp., Juglans spp., Pistacia vera, Anacardium occidentale, Macadamia (Macadamia integrifolia), Carya illinoensis Koch, Macadamia, Pistachio, Badam, other plants that produce nuts; (17) others: Arabidopsis thaliana, Bra chiaria eruciformis, Cenchrus echinatus, Setaria faberi, Eleusine indica, Cadaba farinose, algae, Carex elata, ornamental plants. Carissa macrocarpa, Cynara spp., Daucus carota, Dioscorea spp., Erianthus sp., Festuca arundinacea, Hemerocallis fulva, Lotus spp., Luzula sylvatica, Medicago sativa, Melilotus spp., Morus nigra, Nicotiana spp., Olea spp., Ornithopus spp., Pastinaca sativa, Sambucus spp., Sinapis sp., Syzygium spp., Tripsacum dactyloides, Triticosecale rimpaui, Viola odorata, and the like.
(32) In the present invention, the term plant tissue or plant part includes plant cells, protoplasts, plant tissue cultures, plant callus, plant blocks, and plant embryos, pollens, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, cores, spikes, roots, root tips, anthers, etc.
(33) In the present invention, the plant cell should be understood to mean any cell derived from or found in a plant that is capable of forming, for example, an undifferentiated tissue such as callus, a differentiated tissue such as an embryo, a plant part, a plant or a seed.
(34) For the terms regarding amino acid substitutions used in the specification, the first letter represents a naturally occurring amino acid at a certain position in a particular sequence, the following number represents the position corresponding to the SEQ ID NO: 2, and the second letter represents a different amino acid substituting for the naturally occurring amino acid. For example, A103S represents that the alanine at position 103 is substituted with serine relative to the amino acid sequence of SEQ ID NO: 2. For an amino acid substitution in which the first letter is absent, it is meant that, relative to the amino acid sequence of the wild-type protein, the naturally occurring amino acid at the position corresponding to SEQ ID NO: 2 is substituted with the amino acid represented by the second letter after the number. For double or multiple mutations, each mutation is separated by /. For example, H141R/G342D/D370N means that, relative to the amino acid sequence of SEQ ID NO: 2, the histidine at position 141 is substituted with arginine, the glycine at position 342 is substituted with aspartic acid, and the aspartic acid at position 370 is substituted with asparagine, and all three mutations are present in the specific mutant HPPD protein.
(35) In one aspect, the present invention discloses a mutant HPPD protein or a bioactive fragment thereof, which retains the activity to catalyze the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisate whilst having improved resistance or tolerance to HPPD-inhibiting herbicides, as compared to a wild-type p-hydroxyphenylpyruvate dioxygenase protein. In particular, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein according to the present invention has one or more of mutations selected from the group consisting of 93S, 103S, 141R, 141 K, 141 T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431 L at one or more positions corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild-type rice p-hydroxyphenylpyruvate dioxygenase protein as set forth in SEQ ID NO: 2. Preferably, the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence as set forth in SEQ ID NO: 2. More preferably, the mutant p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence as set forth in SEQ ID NO: 2, except that it has one or more amino acid mutations selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431 L at one or more positions corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild-type rice p-hydroxyphenylpyruvate dioxygenase protein as set forth in SEQ ID NO: 2.
(36) In one embodiment, the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein according to the present invention further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of the wild-type rice p-hydroxyphenylpyruvate dioxygenase protein as set forth in SEQ ID NO: 2, and has one or more amino acid mutations selected from the group consisting of 93S, 103S, 141R, 141 K. 141 T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431 L at one or more positions corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild-type rice p-hydroxyphenylpyruvate dioxygenase protein as set forth in SEQ ID NO: 2. Preferably, the mutant p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence as set forth in SEQ ID NO: 2, except that it has one or more of mutations selected from the group consisting of R93S, A103S, H141R, H141K, H141T, A165V, V191I, R220K, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, G342D, R346C, R346D, R346H, R346S, R346Y, D370N, I377C, P386T, L390I, M392L, E403G, K410I, K418P, G419F, G419L, G419V, N420S, N420T, E430G and Y431 L at one or more positions corresponding to 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild-type rice p-hydroxyphenylpyruvate dioxygenase protein as set forth in SEQ ID NO: 2.
(37) A particular amino acid position (numbering) within the protein of the present invention is determined by aligning the amino acid sequence of a protein of interest with SEQ ID NO: 2 using a standard sequence alignment tool, for example, Smith-Waterman algorithm or Clustal W2 algorithm is used to align two sequences, wherein the sequences are considered to be aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, W. J. and Lipman, D. J. (1983), Rapid similarity searches of nucleic acid and protein data banks, Proc. Natl. Acad. Sci. USA, 80: 726-730. The default parameters used in the ClustalW2 (1.82) algorithm are preferably: protein gap opening penalty=10.0; protein gap extension penalty=0.2; protein matrix=Gonnet; protein/DNA end gap=1; and protein/DNA GAPDIST=4.
(38) Preferably, the AlignX program (a part of the vector NTI set) is used to match the default parameters for the multiple alignment (gap opening penalty: 10 og, gap extension penalty: 0.05), and the position of a particular amino acid within a protein of the present invention is determined by aligning the amino acid sequence of the protein with SEQ ID NO: 2.
(39) The identity of amino acid sequences can be determined by conventional methods, for example, by referring to the teachings of Smith and Waterman, (1981, Adv. Appl. Math. 2: 482, Pearson & Lipman, 1988, Proc. Natl. Acad. Sci. USA 85: 2444), algorithms on computer of Thompson et al. (1994, Nucleic Acids Res 22:467380, etc., as determined by computerized (GAP, BESTFIT, FASTA, and TFASTA, Genetics Computer Group in the Wisconsin Genetics software package), or can be determined by using the BLAST algorithm (Altschul et al., 1990, Mol. Biol. 215:403-10) available from the National Center for Biotechnology Information www.ncbi.nlm.nih.gov/) with the default parameters.
(40) In one further embodiment, the mutant p-hydroxyphenylpyruvate dioxygenase protein according to the present invention has an amino acid sequence as set forth in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82 or EQ ID NO: 84.
(41) In one further embodiment, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein according to the present invention has the following amino acid mutations in its amino acid sequence:
(42) TABLE-US-00001 H141R/G342D,H141R/D370N,G342D/D370N,H141R/N338D, H141R/G342D,N338D/G342D,K418P/G419F,G419F/N420S, G342D/R346C,G342D/R346H,H141R/N420S,G338D/K418P, P277N/N338D,L276W/P277N,H141R/G342D/D370N, H141R/N338D/N420S,H141R/N338S/N420S, P336D/N338D/G342D,P336D/N338S/G342D, P336D/N338Y/G342D,N338D/G342D/R346C, N338D/G342D/R346H,N338D/G342D/R346S, N338S/G342D/R346C,N338S/G342D/R346H, N338S/G342D/R346S,N338Y/G342D/R346C, N338Y/G342D/R346H,N338Y/G342D/R346S, P336D/G342D/R346C,P336D/G342D/R346H, P336D/G342D/R346S,P336D/N338D/R346C, P336D/N338D/R346H,P336D/N338D/R346S P336D/N338S/R346C,P336D/N338S/R346H, P336D/N338S/R346S,P336D/N338Y/R346C, P336D/N338Y/R346H,P336D/N338Y/R346S, H141R/N338D/G342D,H141R/G342D/K418P, H141R/G342D/G419F,H141R/G342D/P386T, K418P/G419F/N420T,K418T/G419F/N420T, H141R/G342D/R346C,H141R/G342D/R346H, H141R/G342D/N420S,H141R/G342D/P277N, H141R/G342D/P336D,H141R/G342D/L276W, H141R/G342D/R346S,H141R/G342D/L3901, H141R/G342D/1377C,H141R/G342D/M392L, H141R/P337A/G342D,H141R/N338S/G342D, H141R/N338Y/G342D,P277N/N338D/G342D, P277N/G342D/R346C,P277N/N338D/N420S, N338D/G342D/K418P,H141R/N338D/G342D/K418P, H141R/N338D/G342D/G419F,H141R/N338D/G342D/P386T, H141R/N338D/G342D/R346C,H141R/N338D/G342D/R346H, H141R/G342D/K418P/G419F,H141R/G342D/L276W/P277N, P336D/N338D/G342D/R346C,P336D/N338D/G342D/R346H, P336D/N338D/G342D/R346S,P336D/N338S/G342D/R346C, P336D/N338S/G342D/R346H,P336D/N338S/G342D/R346S, P336D/N338Y/G342D/R346C,P336D/N338Y/G342D/R346H, P336D/N338Y/G342D/R346S,P277N/P336D/N338D/G342D, P277N/N338D/G342D/R346C,P277N/N338D/K418P/G419F, H141R/N338D/G342D/K418P/G419F, H141R/N338D/G342D/G419F/N420S, H141R/G336D/G342D/K418P/G419F/N420S, H141R/N338D/G342D/K418P/G419F/N420S, H141R/N338D/G342D/K418P/G419F/N420T, H141R/N338D/G342D/R346C/K418P/G419F/N420S, H141R/N338D/G342D/R346H/K418P/G419F/N420S, H141R/P277N/N338D/G342D/K418P/G419F/N420S,or H141R/P277N/P336D/N338D/G342D/K418P/G419F/N420S.
(43) In yet further embodiment, the mutant p-hydroxyphenylpyruvate dioxygenase protein according to the present invention has an amino acid sequence as set forth in SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 240, SEQ ID NO: 242, SEQ ID NO: 244, SEQ ID NO: 246, SEQ ID NO: 248, SEQ ID NO: 250, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 256, SEQ ID NO: 258 or EQ ID NO: 260.
(44) In the present invention, the wild-type p-hydroxyphenylpyruvate dioxygenase protein can be derived from any plant, particularly the aforementioned monocotyledonous or dicotyledonous plants. The sequences of some wild-type p-hydroxyphenylpyruvate dioxygenase proteins from other sources and coding sequences thereof are disclosed in the prior technical literatures, which are incorporated herein by reference.
(45) Preferably, the wild-type p-hydroxyphenylpyruvate dioxygenase protein of the present invention is derived from Oryza, particularly Oryza sativa. More preferably, the wild-type p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence as set forth in SEQ ID NO: 2, or at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence as set forth in SEQ ID NO: 2.
(46) It will also be apparent for a person skilled in the art that the structure of a protein can be altered, without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions can be introduced into the amino acid sequence of the protein without adversely affecting the activity and/or three-dimensional configuration of the protein molecule. A person skilled in the art knows examples and embodiments of conservative amino acid substitutions. Specifically, an amino acid residue at certain site may be substituted with another amino acid residue belonging to the same group as the amino acid to be substituted, that is, a non-polar amino acid residue is substituted with another non-polar amino acid residue, a polar uncharged amino acid residue is substituted with another polar uncharged amino acid residue, a basic amino acid residue is substituted with another basic amino acid residue, and an acidic amino acid residue is substituted with an acidic amino acid residue. As long as a substitution does not impair the biological activity of the protein, such a conservative substitution that one amino acid is substituted by other amino acid which belong to the same group falls within the scope of the present invention.
(47) Accordingly, the mutant HPPD protein of the present invention may further contain one or more other mutations such as conservative substitutions in the amino acid sequence in addition to the above mutations. In addition, the invention also encompasses mutant HPPD proteins that further contain one or more other non-conservative substitutions, so long as the non-conservative substitutions do not significantly affect the desired function and biological activity of the protein of the present invention.
(48) As is well known in the art, one or more amino acid residues can be deleted from the N- and/or C-terminus of a protein, and the protein still retains the function and activity. Accordingly, in another aspect, the present invention also relates to fragments which lack one or more amino acid residues at the N- and/or C-terminus of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein while retaining the desired function and activity. Within the scope of the invention, and the fragments are referred to as bioactive fragments. In the present invention, the bioactive fragment refers to a portion of a mutant HPPD protein of the present invention which retain the biological activity of the mutant HPPD protein of the present invention while having improved resistance or tolerance to HPPD inhibitors as compared to a HPPD fragment having no the mutation(s). For example, a bioactive fragment of a mutant HPPD protein may be a bioactive fragment that lacks a moiety of one or more (for example, 1-50, 1-25, 1-10 or 1-5, e.g., 1, 2, 3, 4 or 5) of amino acid residues at the N- and/or C-terminus of the protein, but still retains the desired biological activity of the full-length protein.
(49) The present invention also provides a fusion protein comprising a mutant HPPD protein or a bioactive fragment thereof according to the present invention and an additional component that is fused thereto. In one preferred embodiment, the additional component is a plastid-directed peptide, such as a chloroplast-directed peptide, which enables the mutated HPPD protein to target for chloroplast. In another embodiment, the additional component is a tag peptide, such as 6His. In yet another embodiment, the additional component is a peptide that contributes to increasing the solubility of the mutant HPPD protein, such as a NusA peptide.
(50) In yet another aspect, the present invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding an above-described mutation p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof, or a complementary sequence thereof. The term isolated polynucleotide means that the polynucleotide does not substantially comprise components normally associated therewith in a naturally occurring environment. In one embodiment, the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence as set forth in SEQ ID NO: 2, and further has one or more amino acid mutations selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431 L at one or more positions corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild-type rice p-hydroxyphenylpyruvate dioxygenase protein as set forth in SEQ ID NO: 2. Preferably, the mutation is one or more mutations selected from the group consisting of R93S, A103S, H141R, H141 K, H141T, A165V, V191 I, R220K, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, G342D, R346C, R346D, R346H, R346S, R346Y, D370N, 1377C, P386T, L390I, M392L, E403G, K410I, K418P, G419F, G419L, G419V, N420S, N420T, E430G and Y431 L. More preferably, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or bioactive fragment thereof is derived from a rice HPPD protein and has one or more amino acid substitutions selected from the above those.
(51) It will be apparent for a person skilled in the art that a variety of different nucleic acid sequences can encode the amino acid sequences disclosed herein due to the degeneracy of genetic codes. A person skilled in the art is able to generate additional nucleic acid sequences encoding a same protein, and thus the present invention encompasses nucleic acid sequences encoding the same amino acid sequence due to the degeneracy of genetic codes. For example, in order to achieve high expression of a heterologous gene in a host organism, such as a plant, the gene can be optimized using host-preferred codons for better expression.
(52) Accordingly, in some embodiments, the polynucleotide of the present invention has a nucleic acid sequence selected from: (1) a nucleic acid sequence encoding an amino acid sequence as set forth in: SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 240, SEQ ID NO: 242, SEQ ID NO: 244, SEQ ID NO: 246, SEQ ID NO: 248, SEQ ID NO: 250, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 256, SEQ ID NO: 258 or SEQ ID NO: 260, or a complementary sequence thereof; (2) a nucleic acid sequence as set forth in: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, SEQ ID NO: 235, SEQ ID NO: 237, SEQ ID NO: 239, SEQ ID NO: 241, SEQ ID NO: 243, SEQ ID NO: 245, SEQ ID NO: 247, SEQ ID NO: 249, SEQ ID NO: 251, SEQ ID NO: 253, SEQ ID NO: 255, SEQ ID NO: 257 or EQ ID NO: 259, or complementary sequence thereof. (3) a nucleic acid sequence that hybridizes to the sequence shown in (1) or (2) under stringent conditions; and (4) a nucleic acid sequence encoding an amino acid sequence same as a sequence shown in (1) or (2) due to degeneracy of genetic code, or a complementary sequence thereof.
(53) Further preferably, the polynucleotide of the present invention has a nucleic acid sequence selected from the nucleic acid sequence as set forth in: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, SEQ ID NO: 235, SEQ ID NO: 237, SEQ ID NO: 239, SEQ ID NO: 241, SEQ ID NO: 243, SEQ ID NO: 245, SEQ ID NO: 247, SEQ ID NO: 249, SEQ ID NO: 251, SEQ ID NO: 253, SEQ ID NO: 255, SEQ ID NO: 257 or EQ ID NO: 259, or complementary sequence thereof.
(54) Preferably, the stringent conditions may refer to conditions of 6M urea, 0.4% SDS and 0.5SSC or hybridization conditions equivalent thereto, and may also refer to conditions with higher stringency, such as 6M urea, 0.4% SDS, 0.1SSC or hybridization conditions equivalent thereto. In various conditions, the temperature may be above about 40 C., for example, when conditions with higher stringency are required, the temperature may be, such as, about 50 C., and further may be about 65 C.
(55) More preferably, the wild-type and mutant codons corresponding to the amino acid mutation sites are in chart below:
(56) TABLE-US-00002 Aminoacid Wild-type mutationsites codons Mutantcodons A103S GCC TCG;TCA;TCC;TCT;AGC;AGT H141R CAC CCG;CGA;CGC;CGT;AGG;AGA H141K CAC AAG;AAA H141T CAC ACC;ACT;ACA;ACG A165V GCG GTG;GTA;GTC;GTT V1911 GTC ATA;ATC;ATT R220K CGG AAG;AAA G342D GGC GAC;GAT D370N GAC AAC;AAT K4101 AAG ATA;ATC;ATT R93S CGC AGC;AGT;TCA;TCC;TCG;TCT G226H GGC CAC;CAT L276W CTG TGG P277N CCG AAC;AAT P336D CCG GAT;GAC P337A CCC GCA;GCC;GCG;CGT N338D AAC GAC;GAT N338S AAC AGC;TCG;TCA;TCC;TCT;AGT N338Y AAC TAC;TAT G342D GGC GAC;GAT R346C CGC TGC;TGT R346H CGC CAC;CAT R346S CGC AGC;TCG;TCA;TCC;TCT;AGT R346D CGC GAC;GAT R346Y CGC TAC;TAT I377C ATC TGC;TGT P386T CCA ACA;ACC;ACG;ACT L3901 TTG ATA;ATC;ATT M392L ATG CTA;CTC;CTG;CTT;TTA;TTG E403G GAG GGA;GGC;GGG;GGT P418P AAG CCA;CCC;CCG;CCT G419F GGC TTC;TTT G419L GGC CTA;CTC;CTG;CTT;TTA;TTG G419V GGC GTA;GTC;GTG;GTT N420S AAC AGC;TCG;TCA;TCC;TCT;AGT N420T AAC ACA;ACC;ACG;ACT E430G GAG GGA;GGC;GGG;GGT Y431L TAT CTA;CTC;CTG;CTT;TTA;TTG
(57) The present invention also provides a nucleic acid construct comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein or a bioactive fragment thereof or a fusion protein thereof according to the present invention, and one or more regulatory elements operably linked thereto. The term regulatory element as used in the present invention refers to a nucleic acid sequence capable of modulating the transcription and/or translation of a nucleic acid operably linked thereto.
(58) The regulatory element may be a suitable promoter sequence that is recognized by a host cell for expression of a nucleic acid sequence encoding a protein of the present invention. The promoter sequence comprises a transcriptional regulatory sequence that mediates the expression of the protein. The promoter may be any nucleotide sequence that exhibits transcriptional activity in a selected host cell, including mutated, truncated and hybrid promoters, and may be obtained from a gene encoding an extracellular or intracellular polypeptide that is homologous or heterologous to the gene of the host cell. As a promoter expressed in a plant cell or a plant, a naturally occurring promoter of the p-hydroxyphenylpyruvate dioxygenase or a heterologous promoter having activity in the plant can be used. The promoter may lead to a constitutive expression or inducible expression. Examples of the promoter include, for example, histone promoter, rice actin promoter, a plant viral promoter such as cauliflower mosaic virus promoter, and the like.
(59) The regulatory element may also be a suitable transcription terminator sequence that is recognized by the host cell to terminate the transcription. The terminator sequence is operably linked to the 3 end of a nucleic acid sequence encoding a protein of the invention. Any terminator that functions in a selected host cell can be used in the present invention.
(60) The regulatory element may also be a suitable leader sequence, i.e., an untranslated region of mRNA that is important for translation in a host cell. The leader sequence is operably linked to the 5 end of a nucleic acid sequence encoding a protein of the invention. Any leader sequence that functions in a selected host cell can be used in the present invention.
(61) The regulatory element may also be a polyadenylation sequence, i.e., a sequence operably linked to the 3 end of the nucleic acid sequence and recognized by a host cell as a signal for addition of polyadenylic acid residues to the transcribed mRNA during transcription. Any polyadenylation sequence that functions in a selected host cell can be used in the present invention.
(62) The regulatory element may also be a signal peptide coding region that encodes an amino acid sequence linked to the amino terminus of a protein and directs the encoded protein into secretory pathway in cells. The 5 end of the coding sequence of the nucleic acid sequence may inherently comprise a signal peptide coding region that is natively linked to the coding region encoding the secreted polypeptide within the translational reading frame. Alternately, the 5 end of the coding sequence may comprise a signal peptide coding region that is foreign to the coding sequence. A foreign signal peptide coding region may be required where a coding sequence does not natively comprise a signal peptide coding region. Alternately, the foreign signal peptide coding region may simply replace the native signal peptide coding region to facilitate secretion of the polypeptide. In any event, any signal peptide coding region that directs an expressed polypeptide into secretory pathway in a selected host cell, i.e., the secretion of the polypeptide into a culture medium, may be used in the present invention.
(63) Regulatory sequences that allow expression of the polypeptide to be regulated according to growth of a host cell can also be suitably added. Regulatory systems include, for example, regulatory systems that enable gene expression to turn on or off in response to chemical or physical stimuli, (including the presence of regulatory compounds), such as lac, tec, and tip operon systems, ADH2 systems or GAL1 systems, and the like. Examples of other regulatory sequences are those that allow for gene amplification. In a eukaryotic system, these include dihydrofolate reductase gene that is amplified in the presence of methotrexate, and metallothionein gene that is amplified due to heavy metals. In these cases, the nucleotide sequence encoding the polypeptide will be operably linked to the regulatory sequence.
(64) In the present invention, the regulatory element may also be a transcriptional activator, i.e., an enhancer, for example, the tobacco mosaic virus translation activator described in WO87/07644, or an intron, etc., such as maize adh1 intron, maize bronze 1 gene intron or rice actin intron 1. They can enhance the expression of a mutant HPPD protein, a bioactive fragment thereof or a fusion protein according to the present invention in a transgenic plant.
(65) The present invention also provides an expression vector comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein or a bioactive fragment thereof or a fusion protein according to the present invention, and an expression regulatory element operably linked thereto. The expression vector also contains at least one origin of replication for self-replication. The choice of a vector will generally depend on the compatibility of the vector with a host cell into which the vector is to be introduced. The vector can be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, and its replication is independent of chromosomal replication, such as plasm ids, extrachromosomal elements, minichromosomes, or artificial chromosomes. The vector can contain any element that ensures self-replication. Alternately, the vector can be a vector that is integrated into the genome of a host cell when introduced into the host cell and replicated together with the chromosome into which it is integrated. In addition, a single vector or plasmid, or two or more vectors or plasmids together with comprising a total DNA to be introduced into the genome of a host cell, or a transposon, may be used. Alternately, the vector can also be a vector for gene editing of the endogenous HPPD gene of the host cell.
(66) The vector can be a plasmid, a virus, a cosmid, or a phage, and the like, which is well known to a person skilled in the art and is numerously described in the art. Preferably, the expression vector in the present invention is a plasmid. The expression vector can comprise a promoter, a ribosome binding site of translation initiation, a polyadenylation site, a transcription terminator, an enhancer, and the like. Such a selectable marker includes a gene encoding dihydrofolate reductase, a gene conferring tolerance to neomycin, a gene conferring tolerance to tetracycline or ampicillin, and the like.
(67) The vector of the present invention can comprise elements that allow for the integration of the vector into the genome of a host cell or autonomous replication independent of the genome in the cell. For integration into the genome of a host cell, the vector may rely on a polynucleotide sequence encoding the polypeptide or any other element of the vector which is suitably be integrated into the genome by homologous or non-homologous recombination. Alternately, the vector can comprise an additional nucleotide sequence for directing integration of the vector into the genome of a host cell at an exact location of the chromosome by homologous recombination. In order to increase the likelihood of integration at the exact position, an integration element should preferably comprise a sufficient number of nucleic acids, such as from 100 to 10,000 base pairs, preferably from 400 to 10,000 base pairs, more preferably from 800 to 10,000 base pairs, which is highly identical to a corresponding target sequence so as to increase the probability of homologous recombination. The integration element may be any sequence homologous to a target sequence within the genome of a host cell. Furthermore, the integration element may be a non-coding or coding nucleotide sequence. In another aspect, the vector may be integrated into the genome of a host cell by non-homologous recombination. For autonomous replication, the vector may further comprise an origin of replication enabling the vector to be replicated autonomously in the host cell. The origin of replication may be any plasmid replicon that mediates autonomous replication and functions in a cell. The term origin of replication or plasmid replicon is defined herein as a nucleotide sequence that enables a plasm id or vector to be replicated in vivo.
(68) The polynucleotide with more than one copy of the present invention is inserted into a host cell to increase the yield of a gene product. An increase in the number of polynucleotide copies can be achieved by integrating a sequence with at least one additional copy into the genome of a host cell or by combining an amplifiable selectable marker gene with the polynucleotide together. In the latter case, the cell comprising the selectable marker gene with amplified copy and the polynucleotide with the additional copy can be screened by artificially culturing the cell in the presence of a suitable selectable formulation.
(69) A nucleic acid sequence of the present invention can be inserted into a vector by a variety of methods, for example, by digesting the insert and the vector with an appropriate restriction endonuclease and then performing ligation. A variety of cloning techniques are known in the art and are within the scope of knowledge of a person skilled in the art.
(70) Vectors suitable for use in the present invention include commercially available plasmids, for example, but not limited to, pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA). pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174 pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia) and the like.
(71) The invention also provides a host cell comprising a nucleic acid sequence, a nucleic acid construct or an expression vector according to the present invention. A vector of the present application is introduced into a host cell such that the vector is present as part of a chromosomal integrant or as an extra-chromosomal vector for self-replication as described previously, or the vector can genetically edit the endogenous HPPD gene in the host cell. The host cell can be any host cell familiar to a person skilled in the art, including prokaryotic cells and eukaryotic cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells or plant cells, examples of which are E. coli, Streptomyces, Bacillus subtilis, Salmonella typhimurium, Pseudomonas, Streptomyces, Staphylococcus, Spodoptera Sf9, CHO, COS, etc. A person skilled in the art is able to select an appropriate host cell.
(72) In the present invention, the term host cell also encompasses any progeny of parental cell that is not completely identical to the parent cell due to mutations that occur during replication.
(73) A nucleic acid sequence, a nucleic acid construct or an expression vector of the present invention can be introduced into a host cell by a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid mediated gene delivery, and calcium phosphate transfection, DEAE-dextran mediated transfection, lipofection or electroporation and the like (see Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, 1986).
(74) In a specific embodiment, the mutant HPPD protein of the present invention can be targeted to a plastid in a plant, such as a chloroplast. This can be achieved by ligating a nucleic acid sequence encoding the mutant HPPD protein of the present invention into a reading frame of a nucleic acid sequence encoding a plastid-directed peptide, such as a chloroplast-directed peptide, or this can be achieved by directly transforming a polynucleotide, a nucleic acid construct or an expression vector of the present invention into the chloroplast genome of a plant cell. A person skilled in the art knows vectors and methods that can be used to transform the chloroplast genomes of plant cells. For example, a nucleic acid sequence encoding a mutant HPPD protein of the present invention can be integrated by bombarding the leaves of a target plant with DNA-coated ions and by means of homologous recombination or non-homologous recombination.
(75) Where appropriate, the transformed host cells can be cultured in conventional nutrient media. After transforming a suitable host cell and culturing the host cell to an appropriate cell density, the selected promoter can be induced by a suitable method such as temperature change or chemical induction, and the cells can be cultured for an additional period of time to a mutant HPPD protein or a bioactive fragment thereof or fusion protein according to the present invention.
(76) Accordingly, the present invention also relates to a method of producing a mutant HPPD protein or a bioactive fragment thereof or a fusion protein according to the present invention, comprising: (a) cultivating said host cell under conditions conducive for production of said mutant HPPD protein or bioactive fragment thereof or fusion protein; and (b) recovering the mutant HPPD protein or bioactive fragment thereof or fusion protein.
(77) In the producing method of the present invention, the cells are cultured on a nutrient medium suitable to produce the polypeptide by methods well known in the art. For example, the cells are cultivated means of shaft flask culture and small-scale or large-scale fermentation (including continuous, batch, feeding in batch, or solid-state fermentation) in a suitable culture medium in laboratory or industrial fermenter under conditions that permit expression and/or isolation of the polypeptide. The cultivation is carried out on a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts by procedures known in the art. Suitable media can be purchased from a supplier or formulated in accordance with compositions disclosed (e.g., those on the catalogue of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the culture medium. If the polypeptide is not secreted into the medium, it can be recovered from the cell lysates.
(78) The polypeptide can be detected by methods known in the art to be specific for the polypeptide. These detection methods can comprise the use of specific antibodies, formation of enzyme products, or loss of enzyme substrates.
(79) The produced polypeptide can be recovered by methods known in the art. For example, cells can be collected by centrifugation and disrupted by physical or chemical means, and a resulting crude extract is retained for further purification. The transformed host cells expressing a mutation HPPD protein or a bioactive fragment thereof or a fusion protein according to the present invention can be lysed by any convenient means, including freeze-thaw cycles, sonication, mechanical disruption, or using a cell lysing agent. These methods are well known for a person skilled in the art. A mutant HPPD protein or a bioactive fragment thereof according to the present invention can be recovered and purified from a culture of the transformed host cell, and a method used includes ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and phytohemagglutinin chromatography, and the like.
(80) The invention also relates to a method for preparing a host organism, in particular, a plant cell, a plant tissue, a plant part or a plant, which is tolerant or resistant to an HPPD-inhibiting herbicide, comprising transforming the host organism with a nucleic acid sequence encoding a mutant HPPD protein or a bioactive fragment thereof according to the present invention or a nucleic acid structure or an expression vector comprising the nucleic acid sequence. Methods for transforming a host cell, such as a plant cell, are known in the art, including, for example, protoplast transformation, fusion, injection, electroporation, PEG-mediated transformation, ion bombardment, viral transformation, Agrobacterium-mediated transformation, electroporation perforation or bombardment, and the like. A series of such transformation methods are described in the prior art, for example, the technique for soybean transformation described in EP1186666, and suitable techniques for transforming monocotyledonous plants, especially rice, described in WO 92/09696. It is also advantageous to culture plant explants with Agrobacterium tumefaciens or Agrobacterium rhizogenes so as to transfer DNA into a plant cell. A whole plant can then be regenerated from an infected plant material part (such as leaf fragments, stem segments, roots, and protoplasts or suspension cultured cells) in a suitable culture medium, which may contain antibiotics or pesticides for selection. Transformed cells are grown in plants in a usual manner, they can form germ cells and transfer transformed traits to progeny plants. Such plants can be cultured in a normal manner and crossed with plants having the same transformed genetic factors or other genetic factors. The resulting hybrid individuals have corresponding phenotypic properties.
(81) The invention also provides a method for preparing a host organism, in particular, a plant cell, a plant tissue, a plant part or a plant, which is tolerant or resistant to an HPPD-inhibiting herbicide, comprising integrating a nucleic acid encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein or a bioactive fragment thereof according to the present invention into the genome of the host organism and expressing the nucleic acid. Suitable vectors and selectable markers are well known for a person skilled in the art, for example, a method of integration into the tobacco genome is described in WO06/108830, and the disclosures contained therein are incorporated herein by reference. The gene(s) of interest are preferably expressed either by constitutive or inducible promoters in the plant cell. Once expressed, the mRNA is translated into proteins, thereby incorporating amino acids of interest into protein. The genes encoding a protein expressed in the plant cells can be under the control of a constitutive promoter, a tissue-specific promoter, or an inducible promoter. For example, promoters of bacterial origin, such as the octopine synthase promoter, the nopaline synthase promoter, and the mannopine synthase promoter, promoters of viral origin, such as the cauliflower mosaic virus (35S and 19S), 35T (which is a re-engineered 35S promoter, see U.S. Pat. No. 6,166,302, especially Example 7E) can be used. Plant promoter regulatory elements can also be used, which includes but is not limited to ribulose-1,6-bisphosphate (RU BP) carboxylase small subunit (ssu), -conglycinin promoter, -phaseolin promoter, ADH promoter, heat-shock promoters, and tissue specific promoters. Constitutive promoter regulatory elements may also be used thereby directing continuous gene expression in all cell types and all the time (e.g., actin, ubiquitin, CaMV 35S, and the like). Tissue specific promoter regulatory elements are responsible for gene expression in specific cell or tissue types, such as the leaves or seeds (e.g., zein, oleosin, napin, ACP, globulin and the like) and these may also be used in the present invention. Promoter regulatory elements may also be active (or inactive) during a certain stage of the plant's development. Examples of such include but are not limited to pollen-specific, embryo-specific, corn-silk-specific, cotton-fiber-specific, root-specific, seed-endosperm-specific, or vegetative phase-specific promoter regulatory elements and the like. Under certain circumstances it may be desirable to use an inducible promoter regulatory element, which is responsible for expression of genes in response to a specific signal, such as: physical stimulus (heat shock genes), light (RUBP carboxylase), hormone (Em), metabolites, chemical (tetracycline responsive), and stress. Other desirable transcription and translation elements that function in plants may be used.
(82) The present invention also provides a method of improving the resistance or tolerance of a plant cell, plant tissue, plant part or plant to the HPPD-inhibiting herbicide, comprising transforming the plant or plant part with a nucleic acid molecule comprising a nucleic acid sequence encoding a mutant HPPD protein or a bioactive fragment thereof or a fusion protein according to the present invention and expressing the nucleic acid molecule. The nucleic acid molecule can be expressed as an extrachromosomal entity, or can be expressed by integrating it into the genome of a plant cell, particularly, can be expressed by integrating it into the endogenous gene position of a plant cell through homologous recombination. These embodiments are all within the scope of the present invention.
(83) The present invention also provides a method of improving the resistance or tolerance of a plant or a part thereof to the HPPD-inhibiting herbicide, comprising crossing a plant expressing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof or a fusion protein according to the present invention with another plant, and screening for a plant having improved resistance and tolerance to HPPD-inhibiting herbicides.
(84) The present invention also provides a method of improving the resistance or tolerance of a plant cell, plant tissue, plant part or plant to the HPPD-inhibiting herbicide, comprising gene editing an endogenous HPPD protein gene of the plant cell, plant tissue, plant part or plant to achieve expression of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof or a fusion protein according to the present invention.
(85) The present invention also relates to a method for preparing a plant that is tolerant or resistant to herbicide by traditional breeding techniques, which comprises self-crossing or crossing a plant in which a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein or a bioactive fragment thereof according to the present invention is integrated into the genome, and screening out a progeny comprising heterozygously or homozygously nucleic acid sequence.
(86) The invention further relates to a plant cell, a plant tissue, a plant part and a plant obtained by the above method, and progenies thereof.
(87) Preferably, a plant cell, a plant tissue or a plant part transformed with a polynucleotide according to the present invention can be regenerated into a whole plant. The present invention includes cell cultures, including tissue cell cultures, liquid cultures, and solid plate cultures. Seeds produced by the plants of the present invention and/or used to regenerate the plants of the present invention are also included within the scope of the present invention. Other plant tissues and parts are also included in the present invention. The present invention also encompasses a method of producing a plant or a cell comprising a nucleic acid molecule of the present invention. A preferred method of producing such a plant comprising planting a seed of the present invention. A plant transformed in this manner can be endowed with resistance to a variety of herbicides having different modes of action.
(88) For example, for transformation of plant cells using Agrobacterium, explants may be combined and incubated with the transformed Agrobacterium for enough time to allow transformation thereof. After transformation, the Agrobacteria are killed by selection with the appropriate antibiotic and plant cells are cultured with the appropriate selective medium. Once calli are formed, shoot formation can be promoted by employing the appropriate plant hormones according to methods well known in the art of plant tissue culturing and plant regeneration. However, a callus intermediate stage is not always necessary. After shoot formation, said plant cells can be transferred to medium which promotes root formation thereby completing plant regeneration. The plants may then be grown to seed and said seed can be used to establish future generations. Regardless of transformation technique, the gene encoding a bacterial protein is preferably incorporated into a gene transfer vector adapted to express said gene in a plant cell by including in the vector a plant promoter regulatory element, as well as 3 non-translated transcriptional termination regions such as Nos and the like.
(89) The present invention also provides a method for controlling weeds in a plant cultivation site, comprising applying to the locus comprising plants or seeds according to the present invention a herbicidally effective amount of one or more HPPD-inhibiting herbicide.
(90) In the present invention, the term cultivation site includes a site in which plants of the present invention are cultivated, such as soil, and also includes, for example, plant seeds, plant seedlings, and grown plants. The term herbicidally effective amount means the amount of an herbicide that is enough to affect the growth or development of target weeds, for example, preventing or inhibiting the growth or development of the target weeds, or killing the weeds. Advantageously, said herbicidally effective amount does not significantly affect the growth and/or development of a plant seed, plant seedling or plant of the present invention. A person skilled in the art can determine such a herbicidally effective amount through conventional experiments.
(91) The present invention also provides a method for producing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein which retains or enhances the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisate and is significantly less sensitive to HPPD-inhibiting herbicides than a wild-type HPPD, comprising the steps of: mutating a nucleic acid encoding a wild-type HPPD, fusing and ligating consistently the mutated nucleic acid in an expression vector to a nucleic acid reading frame sequence encoding a solubility-enhancing component to form a sequence encoding a fusion protein, transforming the obtained recombinant expression vector into a host cell, expressing the fusion protein under suitable conditions containing the HPPD-inhibiting herbicide and a HPPD enzymatic substrate, and screening out a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein which retains or enhances the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisate and has significantly reduced sensibility to the HPPD-inhibiting herbicide. Preferably, the solubility-enhancing component is preferably selected from NusA, which forms a fusion protein with the mutant HPPD protein of the present invention. More preferably, the expression vector is selected from pET-44a vector. The host cell is selected from a bacterial cell, a fungal cell or a plant cell.
(92) Unless specifically stated or implied, the terms a, an and the used herein mean at least one. All patents, patent applications, and publications mentioned or cited herein are incorporated herein by reference in their entirety, and the citation degree thereof is the same as that of individual citation.
DETAILED EMBODIMENTS OF THE INVENTION
(93) The present invention will be further described in conjunction with the examples below. All of the methods and operations described in the examples are provided by way of exemplifications and should not be construed as limitation. As for methods of DNA manipulation, please see Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel F. M., Greene Publishing Associates and Wiley Interscience, 1989, Molecular Cloning, T. Maniatis et al., 1982, or Sambrook J. and Russell D., 2001, Molecular Cloning: a laboratory manual, version 3.
EXAMPLES
Example 1 Cloning of Rice Hppd (Oshppd) Gene
(94) The rice (Oryza sativa, Japonica Group) 4-hydroxyphenylpyruvate dioxygenase (HPPD) gene is located at a site of second chromosome, Os02g0168100. A coding region DNA (OsHPPD) (General Biosystems, Chuzhou, Anhui Province, China) was directly synthesized according to the corresponding cDNA sequence (NCBI Accession No. XP_015626163.1) and it is used as a PCR template. The primers NusOsF: acgattgatgacgacgacaag ATGCCTCCCACTCCCACCCC and NusOsR: tccacgagctcccggactc TTA CTAGGATCCTTGAACTGTAG were designed and synthesized according to the sequences of the vector pET-44a (Novagen) and XP015626163.1. The PCR amplification was carried out by using these primers, the synthesized template and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA). The amplification was carried out under the following conditions: 98 C. for 2 minutes; then 98 C. for 20 seconds, 65 C. for 30 seconds, and 72 C. for 60 seconds, 35 cycles; and 72 C. for 2 minutes. The amplified fragment was shown to be 1.3 Kb in agarose gel electrophoresis and the DNA concentration thereof was determined by ultraviolet absorption after recovery.
(95) The pET-44a (Novagen) plasmid was digested with BoxI (Thermo Fisher Scientific, Shanghai, China) at 37 C. for 1 hour, and then heated to 65 C. to inactivate BoxI. The OsHPPD DNA fragment was mixed with BoxI linearized pET-44a vector in equal amounts, to which an equal volume of 2 Gibson Assembly Master Mix (Hanbio Biotechnology Co., Ltd., Shanghai, China) was added, mixed, and incubated at 50 C. for one hour; 5 l of the ligation product was used to transform the competent E. coli DH5a, and the bacterial solution was applied to the surface of an LB solid medium plate containing 100 ppm of ampicillin, and cultured overnight at 37 C. On the next day, after correct clones were confirmed by individual bacterial colonies PCR, three correct clones were cultured overnight at 37 C., and sufficient plasmid DNA was extracted and sent to Qingke Biotechnology Co., Ltd. (Beijing, China) for sequencing by Sanger sequencing method. The sequencing results confirmed that the correct full-length rice HPPD coding region DNA was obtained.
Example 2 Saturated Random Mutation of Each Amino Acid in Rice HPPD (OsHPPD) Protein
(96) The rice full-length OsHPPD enzyme has 446 amino acids and its amino acid sequence is set forth in SEQ ID NO: 2, wherein the amino acids 1-50 are considered to constitute a signal peptide which is responsible for directing into chloroplast (Siehl et al. Plant Physiol. 2014 November; 166(3): 1162-1176). Therefore, from the amino acid at the 51-position to the amino acid at the 466-position, a saturated random mutation was made for each amino acid. This was achieved by performing a bridge PCR by using a primer containing a coding sequence of an amino acid to be mutated into NNK and another suitable conventional primer. In NNK, N represented A/T/G/C and K represented G/T, and the NNK codon could encode any one of 20 amino acids or terminators. Accordingly, this was a saturated mutation. Please see: Kille S. Acevedo-Rocha C G, Parra L P, Zhang Z G, Opperman D J, Reetz M T, Acevedo J P (2013) Reducing codon redundancy and screening effort of combinatorial protein libraries created by saturation mutagenesis. ACS Synth Biol 2(2):83-92; Directed Evolution Library Creation: methods and protocols 2nd ed. Edited by Elizabeth M. J. Gillam, Janine N. Copp and David F. Ackerley New York, NY United States: Springer, 2014. doi:10.1007/978-1-4939-1053-3. A large number of mutants would be produced. The mutant was cloned into a linearized pET-44a vector and transformed into E. co/i, which was cultivated by using a 96-well plate in a 2YT culture solution containing an HPPD-inhibiting herbicide (such as 1-2 M tembotrione) and a substrate tyrosine (1 g/L) in a shaker at 28 C. and 150 rpm for 24 hours for expression, and then the mutants were rapidly screened out according to their color browning. By using the method, 10 single amino acid mutants, A103S, H141R, H141 K, H141T, A165V, V191I, R220K, G342D, D370N and K410I, were screened out. The color reaction of these resistant mutants in the presence of tembotrione and the metabolic product of benzuofucaotong relative to that of the wild type was as shown in
(97) The method of the present patent enhanced the solubility of HPPD expressed in bacteria by fusing NusA with the rice HPPD protein, whereby the protein could be expressed and the enzymatic reaction could be performed simultaneously at 28 C., greatly saving screening time and steps.
(98) Similarly, the color reaction of these mutants in the presence of the other three HPPD-inhibiting herbicides huanbifucaotong, topramezone and mesotrione were determined, see
(99) TABLE-US-00003 TABLE 1 Single-site mutants of Rice HPPD and the relative resistance thereof to 5 different HPPD-inhibiting herbicides Wild-type Mutant Benzuofucaotong amino acid amino acid metabolic Site residue residue Tembotrione product Huanbifucaotong Topramezone Mesotrione Wild-type + + + + + 103 A S 2+ 2+ + 2+ 3+ 141 H R; K; T 141R: 6+ 141R: 6+ 141R: 6+ 141R: 2+ 141R: 5+ 165 A V 3+ 3+ 5+ 2+ 5+ 191 V I 2+ 2+ 3+ 2+ 4+ 220 R K 2+ 2+ 3+ 2+ 4+ 342 G D 6+ 6+ 3+ 2+ 2+ 370 D N 2+ 2+ 3+ 2+ 2+ 410 K I 2+ 2+ 2+ 2+ 1+
(100) The entire process was illustrated by the production and screening of the H141R mutant as an example. 1. A PCR amplification was carried out by using the NusOsF and OsHPPD-H141R-R: CACCGCGAGGCCGTGGTCC as primers, the synthesized full-length OsHPPD template and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA) to obtain a former fragment DNA. The amplification was carried out under the conditions are: 98 C./2 minutes: 98 C./20 seconds.fwdarw.65 C./30 seconds.fwdarw.72 C./60 seconds (35 cycles); and 72 C./2 seconds. After detection by agarose gel electrophoresis, the bands with correct size were recovered and the concentrations were determined by ultraviolet absorption. Similarly, A PCR amplification was carried out by the NusOsR and OsHPPD-H141R-F: CACGGCCTCGCGGTGNNKGCCGTGGCGC TGCGCG as primers, the synthesized full-length OsHPPD template and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA) to obtain a latter DNA fragment. 2. The former fragment and the latter fragment has 19 overlapped bases in the middle (OsHPPD-H141R-F and OsHPPD-H141R-R). Accordingly, the two fragments were mixed in equimolar amounts, and an equal volume of 2 Glodstar MasterMix (CornWin Biotechnology Co., Ltd., Beijing) was added thereto, and 10 mol of NusOsF and NusOsR as primers were added thereto to perform a bridge PCR reaction. The amplification was carried out under conditions: 96 C. for 2 minutes; 96 C. for 20 seconds, 65 C. for 30 seconds, and 72 C. for 60 seconds (30 cycles); and 72 C. for 5 minutes. After detection by agarose gel electrophoresis, the bands with correct size (1.3 Kb) were recovered and the concentrations were determined by ultraviolet absorption. 3. The OsHPPDMut DNA fragment was mixed with the above linearized pET-44a vector in equal amounts, to which an equal volume of 2 Gibson Assembly Master Mix (Hanbio Biotechnology Co., Ltd.) was added, and incubated at 50 C. for one hour: 5 l of the ligation product was used to transform the competent E. coli DH5a, and the bacterial solution was applied to the surface of an LB solid medium plate containing 100 ppm of ampicillin, and cultured overnight at 37 C. All the clones (colonies) on the plate were scrapped, plasmids were extracted, and the DNAs were quantified by UV absorption. 100 ng of plasmids were transformed into competent BL21 (DE3), a plate was coated, and the cultivation was performed overnight at 37 C. The plate with the transformed E. coli was temporarily stored at 4 C. for screening mutants. 4. Screening of mutants resistant to HPPD-inhibiting herbicides by color reaction
(101) HPPD-inhibiting herbicides inhibited HPPD enzymatic activity. When tyrosine was converted to 4-hydroxyphenylpyruvate (HPP) under the action of tyrosine transaminase, the inactivated HPPD was unable to oxidize 4-hydroxyphenylpyruvate into homogentisic acid (HGA). HGA was dark brown. Therefore, if an HPPD mutant was resistant to or tolerant to an herbicide, after expressed in E. coli, the mutant could also oxidize 4-hydroxyphenylpyruvate into homogentisic acid, whereby dark brown appeared. Therefore, E. coli was cultured in a 2YT culture medium containing a HPPD-inhibiting herbicide and a substrate tyrosine using a 96-well plate to express HPPD, and these mutants were rapidly screened according to their color changes. (1) Preparation of 2YT culture medium (1 g/L L-Tyr, 0.1 mM IPTG, 0.01 mM MnCl.sub.2 and 100 mg/L ampicillin were added). (2) 0.1 mL of the above medium was added to each well of a 96-well plate, and the expression clones of OsHPPD wild type or mutant (OsHPPD Mut) from the E. coli plate obtained by the above transformation were subjected to liquid culture in the 96-well plate. HPPD inhibitors having a final concentration of 1 M-20 M were added according to different selected agents, for example, the final concentration of tembotrione was 1.7 M while mesotrione was 10 M. After all components were added, a strong gas-permeable sealing film was applied as a cover (Suolaibao Biological Agent Company, Beijing, China). (3) The 96-well plate was incubated on a shaker at 28 C. and 150 rpm for 24 hours. The light absorption at 400 nm of the culture was visualized or detected, and the clones that significantly produce black pigments were picked by using an inoculating loop, and further cultured. The plasmid DNA was extracted, sequenced and for further studies, such as expression, purification and enzyme activity assay of the OsHPPD protein.
(102) The single-site mutants A103S, A165V, V191I, R220K, D370N, K410I and three-site mutant H141R/G342D/D370N were obtained with the primers shown inn Table 2 by using the same method, respectively.
(103) TABLE-US-00004 TABLE2 PrimersusedinthepreparationofHPPDmutants Nameoftheprimer Sequenceoftheprimer(5-3) NusOsF acgattgatgacgacgacaagATGCCTCCCACTCCCACCCC NusOsR tccacgagctcccggactcTTACTAGGATCCTTGAACTGTAG OsHPPD-H141R-F CACGGCCTCGCGGTGNNKGCCGTGGCGCTGCGCG OsHPPD-H141R-R CACCGCGAGGCCGTGGTCC OsHPPD-A103S-F GCGTTCCTCTTCACCNNKCCCTACGGGGGCGACCACG OsHPPD-A103S-R GGTGAAGAGGAACGCGACGGAGGC OsHPPD-A165V-F TCGCGGCCGGTGCGCGCCCGNNKTTCCAGCCCG OsHPPD-A165V-R CGGGCGCGCACCGGCCGCGAC OsHPPD-V1911-F GTCGTGCTCCGCTTCNNKAGCCACCCGG OsHPPD-V1911-R GAAGCGGAGCACGACGTCGCC OsHPPD-R220K-F CGCCGTGGACTACGGCCTCCGCNNKTTCGACCACG OsHPPD-R220K-R GCGGAGGCCGTAGTCCACGGCGC OsHPPD-D370N-F CTCGTGGACAGGGATNNKCAGGGGGTGTTGCTCCAGATC T OsHPPD-D370N-R ATCCCTGTCCACGAGCACCCC OsHPPD-K4101-F TGGGCAGGAGTACCAGNNKGGCGGCTGCGGCG OsHPPD-K4101-R CTGGTACTCCTGCCCACTCTCATCC OsHPPD-H141R/ GGCCTCAACTCGGTGGTGCTCG G342D/D370N-F OsHPPD-H141R/ GCGAGCACCACCGAGTTGAGGC G342D/D370N-R
(104) In addition, some two-site mutants involving a combination of single-site mutations, such as H141R/G342D, H141R/D370N and G342D/D370N, were also prepared by a method similar to bridge PCR.
Example 3 Combinations of Multi-Site Mutations of Rice HPPD (OsHPPD) Proteins
(105) The present invention also tested the color reaction of the H141R, G342D, D370N as well as mutant HPPD proteins comprising a combination thereof to five different HPPD-inhibiting herbicides, e.g., tembotrione, a metabolic product of benzuofucaotong, huanbifucaotong, topramezone and mesotrione at different time and on different 96-well plates. The test results were shown in
(106) TABLE-US-00005 TABLE3 Resistanceofsingle-siteandmulti-sitemutantriceHPPDsto5herbicides metabolicproduct Benzucfucaotong Complexsites Tembotrione metabolicproduct Huanbifucaotong Topramezone Mesotrione Wildtype(WT) + + + + + H141R 2+ 5+ 20+ 15+ 20+ G342D 3+ 5+ 10+ 7+ 20+ D370N 1.5+ 2+ 5+ 5+ 5+ H141R/G342D 10+ 10+ 30+ 25+ 30+ H141R/D370N 3+ 4+ 20+ 20+ 10+ G342D/D370N 2+ 4+ 5+ 5+ 6+ H141R/G342D/D370N 10+ 10+ 30+ 30+ 30+
Example 4 Further Saturation Mutation on the Basis of the Three-Site Mutant H141R-G342D-D370N
(107) 1. In the color reaction of the three-site mutant OsHPPD H141R-G342D-D370N expressed in E. Coll, when the shuangzuocaotong (code 101) was used for the inhibition, a concentration of 120 M was required to have no significant color reaction. Therefore, 120 M of the compound 101 was chosen for initial screening. By using the aforementioned technical route, a pair of primers were designed for each amino acid at the 51-446 amino acid positions (except for 141R, 342D, and 370N sites), respectively, and one of which was represented by NNK at the amino acid site to be subjected to saturation mutation. A series of mutants were produced by PCR amplification, then expressed in E. coli BL21 (DE3), and repeatedly screened with 120 M of the compound 101. After all single-site mutations were screened, 18 new mutation sites were obtained. The new sites were: R93S, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, R346C, R346D, R346H, R346S, R346Y, 1377C, P386T, L390I, M392L, E403G, K418P, G419F, G419L, G419V, N420S, N420T, E430G, Y431 L. Amino acid changes and nucleotides (bases) for these new mutation sites as well as the primers used to produce these new mutation sites were listed in Table 4, and the sequences of the primers were listed in Table 5. To sum up, as shown in
(108) TABLE-US-00006 TABLE4 Allnewlyscreenedmutationsites,aminoacid andbasechangesandprimersused WT Amino Mutation Site acid Base Aminoacid Base Primer 93 R CGC S TCC 93F 93R 226 G GGC H CAC 226F 226R 276 L CTG W TGG 276F 276R 277 P CCG N AAT 277F 277R 336 P CCG D GAT 336F 336R 337 P CCC A GCC 337F 337R 338 N AAC D,S,Y GAC,AGC, 338F TAC 338R 346 R CGC C,H,S,D,Y TGC,CAC, 346F AGC,GAC, 346R TAT 377 ATC C TGC 377F 377R 386 P CCA T ACA 386F 386R 390 L TTG ATT 390F 390R 392 M ATG L CTG 392F 392R 403 E GAG G GGG 403F 403R 418 K AAG P CCG 418F 418R 419 G GGC F,L,V TTC,TTG, 419F GTG 419R 420 N AAC S.T AGC,ACC 420F 420R 430 E GAG G GGG 430F 430R 431 Y TAT L CTG 431F 431R
(109) TABLE-US-00007 TABLE5 Allnewlyscreenedmutationsitesandprimersequencesused Aminoacid position Primerandthesequence(5.fwdarw.3) 93 93-F:CGCACGCCTCCCTCCTCCTCNNKTCCGCCTCCGTCGCGTTCCTC 93-R:GAGGAGGAGGGAGGCGTGCG 226 226-F:GCCGGTTCGACCACGTCGTCNNKAACGTGCCGG 226-R:GACGACGTGGTCGAACCGGC 276 276-F:ACAACGCGGAGACCGTGCTGNNKCCGCTCAACG 276-R:CAGCACGGTCTCCGCGTTGT 277 277-F:ACGCGGAGACCGTGCTGCTGNNKCTCAACGAGCCGGTGCACGG 277-R:CAGCAGCACGGTCTCCGCGTTG 336 336-F:TCGAGTTCTTGGCGCCGCCGNNKCCCAACTACTACGACGGCGTG 336-R:CGGCGGCGCCAAGAACTCGAAG 337 337-F:AGTTCTTGGCGCCGCCGCCGNNKAACTACTACGACGGCGTGCG 337-R:CGGCGGCGGCGCCAAGAACTC 338 338-F:TCTTGGCGCCGCCGCCGCCCNNKTACTACGACGGCGTGCGGCG 338-R:GGGCGGCGGCGGCGCCAAGAAC 346 346-F:ACTACGACGGCGTGCGGCGGNNKGCCGGGGACGTGCTCTCGGAG 346-R:CCGCCGCACGCCGTCGTAGTAG 377 377-F:ACCAGGGGGTGTTGCTCCAGNNKTTCACCAAGC 377-R:CTGGAGCAACACCCCCTGGT 386 386-F:CCAAGCCAGTAGGAGACAGGNNKACCTTTTTCTTGGAGATGATAC 386-R:CCTGTCTCCTACTGGCTTGG 390 390-F:GAGACAGGCCAACCTTTTTCNNKGAGATGATAC 390-R:GAAAAAGGTTGGCCTGTCTC 392 392-F:AGGCCAACCTTTTTCTTGGAGNNKATACAAAGGA 392-R:CTCCAAGAAAAAGGTTGGCCTG 403 403-F:TTGGGTGCATGGAGAAGGATNNKAGTGGGCAGGAGTACCAGAAG 403-R:ATCCTTCTCCATGCACCCAATC 418 418-F:GCGGCTGCGGCGGGTTTGGGNNKGGCAACTTCTCGGAGCTGTTC 418-R:CCCAAACCCGCCGCAGCCGC 419 419-F:GGCTGCGGCGGGTTTGGGAAGNNKAACTTCTCGGAGCTGTTCAAG 419-R:CTTCCCAAACCCGCCGCAGCC 420 420-F:GCGGCGGGTTTGGGAAGGGCNNKTTCTCGGAGCTGTTCAAGTC 420-R:GCCCTTCCCAAACCCGCCGC 430 430-F:AGCTGTTCAAGTCCATTGAGNNKTATGAGAAATCCCTTGAAGC 430-R:CTCAATGGACTTGAACAGCTC 431 431-F:TGTTCAAGTCCATTGAGGAGNNKGAGAAATCCCTTGAAGCCAAG 431-R:CTCCTCAATGGACTTGAACAG
Example 5 Combinations of Mutation Sites
(110) The mutation sites were combined on the basis of the following three principles: the sites were close to facilitate homologous replacement in gene editing, and the editing efficiency was high; the base change was the same as A.fwdarw.G/T.fwdarw.C or C.fwdarw.T/G.fwdarw.A to facilitate base editing; and resistant sites were as small as possible to facilitate editing and avoiding possible negative effects. According to the above principles, the combinations, corresponding primers and prokaryotic expression vectors were designed, and then screened by color reactions to find a highly resistant combination suitable for editing to perform gene editing. (1) A total of 33 combinations were designed according to the principle of close distance, of which 24 combinations had 3 mutation sites and 9 combinations had 4 mutation sites. Table 6 showed these combinations and the primer sequences used.
(111) TABLE-US-00008 TABLE6 Combinationsofmutationsites(3or4mutationsites)designed undertheprincipleofclosedistance Combinationsof3/4 mutationsites Primersandsequences(5.fwdarw.3) P336D/N338D/G342D 1-336D-F1:TCGAGTTCTTGGCGCCGCCGGATCCCGAC TACTACGACGACG 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/N338S/G342D 1-338S-F1:TCTTGGCGCCGCCGGATCCCAGCTACTAC GACGACGTGCGGCG 1-338S-R1:GGGATCCGGCGGCGCCAAG P336D/N338Y/G342D 1-338Y-F2: TCTTGGCGCCGCCGGATCCCTACTACTACGACGACGTGCGGCG 1-338S-R1:GGGATCCGGCGGCGCCAAG N338D/G342D/R346C 346-F-2: CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG 346-R-2:CCGCCGCACGTCGTOGTAG N338D/G342D/R346H 346-F-3: CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG 346-R-2:CCGCCGCACGTCGTCGTAG N338D/G342D/R346S 1-346S-F1: CTACGACGACGTGCGGCGGAGCGCCGGGGACGTGCTCTCG 346-R-2:CCGCCGCACGTCGTCGTAG N338S/G342D/R346C 2-338S-F1: CTTGGCGCCGCCGCCGCCCAGCTACTACGACGACGTGCGGC 2-338S-R1:GGGGGGGGGGGGCGCCAAG N338S/G342D/R346H 2-338S-F1: CTTGGCGCCGCCGCCGCCCAGCTACTACGACGACGTGCGGC 2-338S-R1:GGGGGGGGGGGGCGCCAAG N338S/G342D/R346S 2-338S-F1: CTTGGCGCCGCCGCCGCCCAGCTACTACGACGACGTGCGGC 2-338S-R1:GGGGGGGGGGGGCGCCAAG N338Y/G342D/R346C 2-338Y-F2: CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGTGOGGC 2-338S-R1:GGGCGGCGGCGGCGCCAAG N338Y/G342D/R346H 2-338Y-F2: CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGTGCGGC 2-338S-R1:GGGCGGCGGCGGCGCCAAG N338Y/G342D/R346S 2-338Y-F2: CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGTGCGGC 2-338S-R1:GGGGGGGGGGGGCGCCAAG P336D/G342D/R346C 2-336D-F1: TCGAGTTCTTGGCGCCGCOGGATCCCAACTACTACGACGAC 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/G342D/R346H 2-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCAACTACTACGACGAC 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/G342D/R346S 2-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCAACTACTACGACGAC 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/N338D/R346C 2-346C-F2: CTACGACGGCGTGCGGCGGTGCGCCGGGGACGTGCTCTCGG 2-346C-R2:CCGCCGCACGCCGTCGTAG P336D/N338D/R346H 2-346H-F2: ACTACGACGGCGTGCGGCGGCACGCCGGGGACGTGCTCTCGG 2-346C-R2:CCGCCGCACGCCGTCGTAG P336D/N338D/R346S 2-346S-F2: ACTACGACGGCGTGCGGCGGAGCGCCGGGGACGTGCTCTCGG 2-346C-R2:CCGCCGCACGCCGTCGTAG P336D/N338S/R346C 2-346C-F2: CTACGACGGCGTGCGGCGGTGCGCCGGGGACGTGCTCTCGG 2-346C-R2:CCGCCGCACGCCGTCGTAG P336D/N338S/R346H 2-346H-F2: ACTACGACGGCGTGCGGCGGCACGCCGGGGACGTGCTCTCGG 2-346C-R2:CCGCCGCACGCCGTCGTAG P336D/N338S/R346S 2-346S-F2: ACTACGACGGCGTGCGGCGGAGCGCCGGGGACGTGCTCTCGG 2-346C-R2:CCGCCGCACGCCGTCGTAG P336D/N338Y/R346C 2-346C-F2: CTACGACGGCGTGCGGCGGTGCGCCGGGGACGTGCTCTCGG 2-346C-R2:CCGCCGCACGCCGTCGTAG P336D/N338Y/R346H 2-346H-F2: ACTACGACGGCGTGCGGCGGCACGCCGGGGACGTGCTCTOGG 2-346C-R2:CCGCCGCACGCCGTCGTAG P336D/N338Y/R346S 2-346S-F2: ACTACGACGGCGTGCGGCGGAGCGCCGGGGACGTGCTCTCGG 2-346C-R2:CCGCCGCACGCCGTCGTAG P336D/N338D/G342D/R346C 1-336D-F1:TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTAC GACGACG 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/N338D/G342D/R346H 1-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTACGACGACG 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/N338D/G342D/R346S 1-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTACGACGACG 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/N338S/G342D/R346C 2-336D-F2: TCGAGTTCTTGGCGCCGCCGGATCCCAGCTACTACGACGACG 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/N338S/G342D/R346H 2-336D-F2: TCGAGTTCTTGGCGCCGCCGGATCCCAGCTACTACGACGACG 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/N338S/G342D/R346S 2-336D-F2: TCGAGTTCTTGGOGCCGCCGGATCCCAGCTACTACGACGACG 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/N338Y/G342D/R346C 3-336D-F3: TCGAGTTCTTGGCGCCGCCGGATCCCTACTACTACGACGACG 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/N338Y/G342D/R346H 3-336D-F3: TCGAGTTCTTGGCGCCGCCGGATCCCTACTACTACGACGACG 1-336D-R1:CGGCGGCGCCAAGAACTCG P336D/N338Y/G342D/R346S 3-336D-F3: TCGAGTTCTTGGCGCCGCCGGATCCCTACTACTACGACGACG 1-336D-R1:CGGCGGCGCCAAGAACTCG
(112) As shown in
(113) TABLE-US-00009 TABLE7 Combinationsofmutationsitesdesignedaccordingtotheprinciplefor facilitatingbaseediting Combinationsof mutationsites Primersandsequences(5.fwdarw.3) H141R/N338D/N420S 420-AGC-F:GCGGCGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCAAGTC 420-R:GCCCTTCCCAAACCCGCCGC H141R/N338S/N420S 338-AGC-F:TCTTGGCGCCGCCGCCGCCCAGCTACTACGACGGCGTGCGGCG 338-R:GGGGGGGGGGGGCGCCAAGAAC H141R/N338D 338-GAC-F:TCTTGGCGCCGCCGCCGCCCGACTACTACGACGGCGTGCGGCG 338-R:GGGGGGGGGGGGCGCCAAGAAC H141R/N420S 420-AGC-F:GCGGGGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCAAGTC 420-R:GCCCTTCCCAAACCCGCCGC G342D/R346C 346-F-2:CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG 346-R-2:CCGCCGCACGTCGTCGTAG G342D/R346H 346-F-3:CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG 346-R-2:CCGCCGCACGTCGTCGTAG (3) Other combinations were shown in the Table 8.
(114) TABLE-US-00010 TABLE8 Combinationsoftwo,three,fourormoremutationsites Combinationsof mutationsites Primersandsequences(5.fwdarw.3) H141R/N338D 338-GAC-F:TCTTGGCGCCGCCGCCGCCCGACTACTACGACGGCGTGCGGCG 338-R:GGGCGGCGGCGGCGCCAAGAAC H141R/G342D 342-GAC-F:CGCCGCCCAACTACTACGACGACGTGCGGCGGCGCGCCGGGGAC 342-R:GTCGTAGTAGTTGGGCGGCG N338D/G342D 338-GAC-342-GAC-F:TCTTGGCGCCGCCGCCGCCCGACTACTACGACGACGTGC GGCG 338-R:GGGCGGCGGCGGCGCCAAGAAC K418P/G419F 418-CCG-419-TTC-F:CGGCTGCGGGGGGTTTGGGCCGTTCAACTTCTCGGAGCT GTTCAAG 418-R:CCCAAACCCGCCGCAGCCGC G419F/N420S 419-TTC-420-TCG-F:GCGGCGGGTTTGGGAAGTTCTCGTTCTCGGAGCTGTTCAA G 419-TTC-420-TCG-R:GAACTTCCCAAACCCGCCGC G342D/R346C 346-F-2:CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG 346-R-2:CCGCCGCACGTCGTCGTAG G342D/R346H 346-F-3:CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG 346-R-2:CCGCCGCACGTCGTCGTAG H141R/N420S 420-AGC-F:GCGGCGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCAAGTC 420-R:GCCCTTCCCAAACCCGCCGC G338D/K418P 418-CCG-F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGCTGTTC 418-R:CCCAAACCCGCCGCAGCCGC P277N/N338D 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG 277-R:CAGCAGCACGGTCTCCGCGTTGTTG L276W/P277N 276-TGG-F:CAACGCGGAGACCGTGCTGTGGCCGCTCAACGAGCCGGTGC 276-R:CAGCACGGTCTCCGCGTTGTTGGCG H141R/N338D/ 338-GAC-342-GAC-F:TCTTGGCGCCGCCGCCGCCCGACTACTACGACGACGTGC G342D GGCG 338-R:GGGCGGCGGCGGCGCCAAGAAC H141R/G342D/ 418-CCG-F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGCTGTTC K418P 418-R:CCCAAACCCGCCGCAGCCGC H141R/G342D/ 419-TTC-F:GCTGCGGCGGGTTTGGGAAGTTCAACTTCTCGGAGCTGTTCAAG G419F 419-R:CTTCCCAAACCCGCCGCAGC H141R/G342D/ 338-AAC-F:TCTTGGCGCCGCCGCCGCCCAACTACTACGACGGCGTGCGGCG P386T 338-R:GGGGGGGGGGGGCGCCAAGAAC K418P/G419F/ 418-419-420-ACT-F: N420T GCGGCGGGTTTGGGCCGTTCACTTTCTCGGAGCTGTTCAAGTC 418-419-420-R:GAACGGCCCAAACCCGCCGC K418T/G419F/ 418-419-420-ACT-F: N420T GCGGCGGGTTTGGGCCGTTCACTTTCTCGGAGCTGTTCAAGTC 418-419-420-R:GAACGGCCCAAACCCGCCGC H141R/G342D/ 346-F-2:CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG R346C 346-R-2:CCGCCGCACGTCGTCGTAG H141R/G342D/ 346-F-3:CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG R346H 346-R-2:CCGCCGCACGTCGTCGTAG H141R/G342D/ 420-AGC-F:GCGGCGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCAAGTC N420S 420-R:GCCCTTCCCAAACCCGCCGC H141R/G342D/ 277-AAT-FGCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG P277N 277-R:CAGCAGCACGGTCTCCGCGTTGTTG H141R/G342D/ 336-GAC-F:GAGTTCTTGGCGCCGCCGGATCCCAACTACTACGACGACG P336D 336-R:CGGCGGCGCCAAGAACTCGAAGCCGC H141R/G342D/ 276-TGG-F:CAACGCGGAGACCGTGCTGTGGCCGCTCAACGAGCCGGTGC L276W 276-R:CAGCACGGTCTCCGCGTTGTTGGCG H141R/G342D/ 346-AGC-F:CTACGACGACGTGCGGCGGAGTGCCGGGGACGTGCTCTC R346S 346-R:CCGCCGCACGTCGTCGTAGTAG H141R/G342D/ 390-ATT-F:GAGACAGGCCAACCTTTTTCATTGAGATGATACAAAGGATTGG L3901 390-R:GAAAAAGGTTGGCCTGTCTC H141R/G342D/ 377-TGT-F:ACCAGGGGGTGTTGCTCCAGTGTTTCACCAAGCCAGTAGGAGAC 1377C 377-R:CTGGAGCAACACCCCCTGGTC H141R/G342D/ 392-CTG-F:GGCCAACCTTTTTCTTGGAGCTGATACAAAGGATTGGGTGCATG M392L 392-R:CTCCAAGAAAAAGGTTGGCC H141R/P337A/ 337-GCC-F:AGTTCTTGGCGCCGCCGCCGGCCAACTACTACGACGACGTGCG G342D 337-R:CGGCGGCGGCGCCAAGAACTC H141R/N338S/ 338-AGC-F:TCTTGGCGCCGCCGCCGCCCAGCTACTACGACGGCGTGCGGCG G342D 338-R:GGGCGGCGGCGGCGCCAAGAAC H141R/N338Y/ 338-TAC-F:CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGTGCG G342D 338-R:GGGGGGGGGGGGCGCCAAGAACTCG P277N/N338D/ 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG G342D 277-R:CAGCAGCACGGTCTCCGCGTTGTTG P277N/G342D/ 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG R346C 277-R:CAGCAGCACGGTCTCCGCGTTGTTG P277N/N338D/ 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG N420S 277-R:CAGCAGCACGGTCTCCGCGTTGTTG N338D/G342D/ 418-CCG-F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGCTGTTC K418P 418-R:CCCAAACCCGCCGCAGCCGC H141R/N338D/ 418-CCG-F:GCGGCTGGGGGGGGTTTGGGCCGGGCAACTTCTCGGAGCTGTTC G342D/K418P 418-R:CCCAAACCCGCCGCAGCCGC H141R/N338D/ 419-TTC-F:GCTGCGGGGGGTTTGGGAAGTTCAACTTCTCGGAGCTGTTCAAG G342D/G419F 419-R:CTTCCCAAACCOGCCGCAGC H141R/N338D/ 370-GAC-F:GGGTGCTCGTGGACAGGGATGACCAGGGGGTGTTGCTCCAGATO G342D/P386T 370-R:ATCCCTGTCCACGAGCACCO H141R/N338D/ 346-F-2:CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG G342D/R346C 346-R-2:CCGCCGCACGTCGTOGTAG H141R/N338D/ 346-F-3:CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG G342D/R346H 346-R-2:CCGCCGCACGTCGTCGTAG H141R/G342D/ 418-CCG-419-TTC-F:CGGCTGCGGCGGGTTTGGGCCGTTCAACTTCTCGGAGCT K418P/G419F GTTCAAG 418-R:CCCAAACCCGCCGCAGCCGC H141R/G342D/ 276-TGG-277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCAC L276W/P277N G 276-277-R:CCACAGCACGGTCTCCGCGTTGTTGGC H141R/N338D/ 418-CCG-419-TTC-F:CGGCTGCGGCGGGTTTGGGCCGTTCAACTTCTCGGAGCT G342D/K418P/ GTTCAAG G419F 418-R:CCCAAACCCGCCGCAGCCGC H141R/N338D/ 419-TTC-420-TCG-F:GCGGCGGGTTTGGGAAGTTCTCGTTCTCGGAGCTGTTCAA G342D/G419F/ G N420S 419-TTC-420-TCG-R:GAACTTCCCAAACCCGCCGC H141R/N338D/ 418-419-420-TCG-F:GCGGGGGGTTTGGGCCGTTCTCGTTCTCGGAGCT G342D/K418P/ GTTCAAGTC G419F/N420S 418-419-420-R:GAACGGCCCAAACCCGCCGC H141R/N338D/ 418-419-420-ACT-F:GCGGGGGGTTTGGGCCGTTCACTTTCTCGGAGCTGTTC G342D/K418P/ AAGTC G419F/N420T 418-419-420-R:GAACGGCCCAAACCOGCCGC H141R/N338D/ 346-F-2:CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG G342D/R346C/ 346-R-2:CCGCCGCACGTCGTCGTAG K418P/G419F/ N420S H141R/N338D/ 346-F-3:CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG G342D/R346H/ 346-R-2:CCGCCGCACGTCGTCGTAG K418P/G419F/ N420S P277N/P336D/ 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG N338D/G342D 277-R:CAGCAGCACGGTCTCCGCGTTGTTG P277N/N338D/ 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG G342D/R346C 277-R:CAGCAGCACGGTCTCCGCGTTGTTG P277N/N338D/ 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG K418P/G419F 277-R:CAGCAGCACGGTCTCCGCGTTGTTG H141R/P277N/ 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG N338D/G342D/ 277-R:CAGCAGCACGGTCTCCGCGTTGTTG K418P/G419F/ N420S H141R/P277N/ 1-336D-F1:TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTACGACGACG P336D/N338D/ 1-336D-R1:CGGCGGCGCCAAGAACTCG G342D/K418P/ G419F/N420S H141R/G336D/ 336-GAC-F:GAGTTCTTGGCGCCGCCGGATCCCAACTACTACGACGACG G342D/K418P/ 336-R:CGGCGGCGCCAAGAACTCGAAGCCGC G419F/N420S
(115) After detections, it had been found that the color reaction of the above combinations of two mutation sites was weak macroscopic observation, within 100 M of the compound 101 for all of them; in the combinations of three, four or more sites, the color reaction of H141R/G342D/N338D/R346C, H141R/G342D/N338D/R346H, H141R/G342D/N338D/K418P, H141R/G342D/N338D/G419F and H141R/G342D/N338D/G419F/N420S was strong, and there was color even at the concentration of the compound 101 of 1000-2000 M (as shown in
(116) To sum up, the single-site mutations exhibited resistance at 10-20 M; the combinations of two mutation sites exhibited resistance at around 20-120 m, and the resistance was stronger than that of the single-site mutations, and the color was lighter at 100 M; the combinations of three mutation sites, i.e., H141R/N338D/G342D, H141R/G342D/K418P, H141R/G342D/G419F, 338D/342D/346C/H, H141R/G342D/N420S, H141R/N338D/N420S and the like, exhibited good resistance in order, and there was still light color at up to 1000 M; the combinations of four or more mutation sites, i.e., H141R/N338D/G342D/K418P, H141R/G342D/K418P/G419F, H141R/N338D/G342D/R346C, H141R/N338D/G342D/R346H, H141R/N338D/G342D/K418P/G419F, H141R/N338D/G342D/G419F/N420S, H141R/N338D/G342D/K418P/G419F/N420S and the like, exhibited higher resistance, and the color was still significant at the concentration of the compound 101 up to 2500 M.
Example 6 Expression, Isolation and Purification of OsHPPD Protein
(117) The rice OsHPPD protein and homogentisate 1,2-dioxygenase (HGD) were obtained by heterologously expressed in E. coli wherein the gene was inserted into the pET 15b expression vector and expressed in the BL21 (DE3) expression strain, and purified by the Ni-NTA resin. (1) The HPPD open reading frame (ORF) of the positive clone was cloned into the pET-15b vector to form a 6His-HPPD expression vector, and transformed into the BL21 (DE3) cell. The expression strain was inoculated in 10 mL of 2YT culture medium, and cultivated overnight on a shaker at 37 C. and 200 rpm. The 10 mL of the culture was inoculated in 1 L of 2YT culture medium and cultivated until the OD.sub.600 reached 0.6-0.8, cooled to a temperature of 16 C., and subjected to induced-expression with 0.2 mM IPTG (isopropyl thiogalactoside) overnight. The strains were collected by centrifugation at 2800g. (2) The collected strains were re-suspended with the buffer A (50 mM Tris pH 8.0, 500 mM NaCl, 20 mM imidazole), to which PMSF (phenylmethanesulfonyl fluoride) at the final concentration of 1 mM and 250 L of a protease inhibitor cocktail (i.e., a mixture of multiple protease inhibitors), and mixed. The cells were broken by ultrasound in ice-bath (40% total power, work for 3 seconds/6 seconds interval, 230 minutes (Ningbo Scientz Biotechnology Co., Ltd., Ningbo, China)), and centrifuged at 12000 rpm at 4 C. for 30 minutes; and the supernatant was filtered with a 0.22 m filter membrane. (3) Purification with the Ni-NTA column: the supernatant was in contact with the Ni-NTA resin, then rinsed with a buffer A containing 50 mM imidazole to remove the impurities, and finally, eluted with an elution buffer containing 400 mM imidazole. (4) The approximate purity of the protein of interest was analyzed by SDS-PAGE. The eluates containing of the protein of interest were combined and concentrated by an ultrafiltration device (10 kDa molecular weight cut-off, Amicon Ultra). The solution was replaced with a solution containing 20 mM Tris-HCl and having a pH of 7.5 for at least 3 times to desalt. The total protein concentration was determined by the BCA method. All expressed and purified rice HPPD wild type and various mutants thereof were shown in Table 9.
(118) TABLE-US-00011 TABLE9 RiceHPPDWTandvariouscombinations ofmutationsites No. Mutant 1 WT 2 H141R/G342D/G419F 3 H141R/N338D/G342D 4 H141R/G342D/K418P 5 H141R/N338D/G342D/P386T 6 N338D/G342D/R346C 7 N338D/G342D/R346H 8 H141R/N338D/G342D/R346C 9 H141R/N338D/G342D/R346H 10 H141R/N338D/G342D/K418P 11 H141R/N338D/G342D/K418P/G419F/N420S 12 H141R/G342D/P277N 13 N338D/G342D 14 G342D/R346C 15 H141R/N338D/N420S (5) Dialysis or passing through desalination column: the buffer was replaced with a stock solution of 50 mM Tris pH 8.0 and 500 mM NaCl. The concentration was determined by the BCA method. After packaged and quickly frozen with liquid nitrogen, the eluate was stored in a 80 C. refrigerator.
Example 7 Determination of the Effect of Compounds on Various Enzymatic Parameters of OsHPPD Proteins
(119) 1. The activity of a HPPD enzyme was determined by detecting the conversion of 4-hydroxyphenylpyruvate (4-HPP) to homogentisic acid (HGA) catalyzed by the HPPD enzyme and the conversion of HGA to maleylacetoacetate (MAA) catalyzed by homogentisate dioxygenase. The maleylacetoacetate had a maximum absorption at 318 nm and an absorption constant of 14.7 OD M.sup.1.Math.cm.sup.1. 2. 6 l of 4-hydroxyphenylpyruvate (4-HPP) having a concentration that was as 50 times as the final concentration of the substrate were added to to an ELSA plate, and then 294 L of hydroxyethylpiperazine ethanesulfonic acid (HEPES) with a final concentration of 25 mM and pH of 7, 2 mM of Vitamin C, 10 mM FeSO.sub.4, 50 nM homogentisate dioxygenase and 5 to 240 nM HPPD enzyme were added thereto at one time. The final concentration of reaction substrate 4-HPP usually ranged from 1 to 100 M. 3. The absorbance changes of the reaction wells at 318 nm were continuously monitored by a UV ELISA detector (ReadMax 1900 photoabsorption type full-wavelength microplate reader) (Shanghai). 4. Determination of K.sub.m, K.sub.cat and K.sub.cat/K.sub.m of OsHPPDs
(120) V.sub.max is the maximum catalytic reaction rate achievable by enzymatic catalysis. The Michaelis constant K.sub.m is the concentration of a substrate required when the enzyme catalyzed the reaction to achieve half of the maximum rate (V.sub.max). The K.sub.m value is a constant and independent of the enzyme concentration, and altered as substrate type, reaction temperature, pH, and ionic strength changed. Kit is a catalytic constant of an enzyme and referred to the number of substrate molecules that could be catalyzed by an enzyme molecule or enzyme active center per second. K.sub.Cat/K.sub.m represents the catalytic efficiency of enzyme. The enzymatic parameters of wild-type rice HPPD (WT) and various mutants were determined, as shown in Table 10. It could be seen from the data in the table that the catalytic efficiency of most HPPD mutants was enhanced.
(121) TABLE-US-00012 TABLE10 Determinationofmaximumreactionrate V.sub.maxandMichaelisconstantK.sub.m. OsHPPD K.sub.cat K.sub.m K.sub.cal/K.sub.m WT 914 6.7 136 H141R/G342D/D370N 1596 10.9 146 H141R/G342D/G419F 3211 7.9 406 H141R/N338D/G342D 2730 6.3 433 H141R/G342D/K418P 2999 30.6 98 H141R/N338D/G342D/P386T 3018 9.7 311 N338D/G342D/R346C 980 9.5 103 N338D/G342D/R346H 941 6.3 149 H141R/N338D/G342D/R346C 1739 7.4 235 H141R/N338D/G342D/R346H 2151 7.6 283 H141R/N338D/G342D/K418P 2001 18.8 106 H141R/N338D/G342D/K418P/ 935 23 41 G419F/N420S H141R/G342D/P277N 186 1.1 169 N338D/G342D 206 2.1 98 G342D/R346C 220 5.9 37 H141R/N338D/N420S 823 5.1 161 5. Determination of inhibitory activity (IC.sub.50) of the herbicide 101 and huanbifucaotong against OsHPPD proteins
(122) Inhibitory activity of the metabolic product of shuangcaozuotong and huanbifucaotong against rice wild-type (WT) and various mutant OsHPPD proteins was determined, as shown in
(123) TABLE-US-00013 TABLE11 ICsovaluesofHPPDinhibitora101andhuanbifucaotong forWTandvariousmutantOsHPPDs IC.sub.50 101 OsHPPDs (M) Multiple Huanbifucaotong Multiple WT 7.6 1.0 1.1 1.0 H141R/G342D/D370N 41 5.4 8.7 7.9 H141R/G342D/G419F 43 5.7 4.1 3.7 H141R/N338D/G342D 24 3.2 4.9 4.5 H141R/G342D/K418P 72 9.5 13 11.8 H141R/N338D/G342D/P386T 51 6.7 14 12.7 N338D/G342D/R346C 50 6.6 5.9 5.4 N338D/G342D/R346H 85 11.2 8.7 7.9 H141R/N338D/G342D/R346C 57 7.5 4.8 4.4 H141R/N338D/G342D/R346H 72 9.5 6.8 6.2 H141R/N338D/G342D/K418P 93 12.2 6.0 5.5 H141R/N338D/G342D/K418P/G419F/N420S 104 13.7 2.0 1.8 H141R/G342D/P277N 93 12.2 27.0 24.5 N338D/G342D 122 16.1 15.0 13.6 G342D/R346C 44 5.8 3.1 2.8 H141R/N338D/N420S 18 2.4 1.0 0.9 6. Determination of enzyme fitness of OsHPPD proteins to inhibitors
(124) Enzyme fitness is an indicator of the adaptability of an enzyme to an inhibitor, and the higher the value is, the stronger the resistance of the enzyme to the inhibitor is. Since the concentration of a substrate during the reaction is much larger than the K.sub.m value and the reaction conditions of the different OsHPPD mutants are the same, the K.sub.cat could be replaced by the V.sub.max achieved by catalysis at the same concentration of enzyme (500 nM). Enzyme fitness=K.sub.cat*K.sub.m.sup.1*Ki, Ki=IC.sub.50/(1+S/K.sub.m) (inhibition constant). The inhibition constants of herbicide compounds 101 and huanbifucaotong against rice HPPD WT and various mutants and corresponding enzyme fitness thereto were detected to further evaluate the tolerance of these mutants to the herbicides. The mentioned results in Table 12 indicate that the enzyme fitness of the mutants all have different levels of enhancement relative to WT, confirming their enhanced tolerance.
(125) TABLE-US-00014 TABLE12 DeterminationofenzymefitnessofOsHPPDstodifferentcompounds. EnzymeFitness Ki Huanbi OsHPPD K.sub.cat K.sub.m K.sub.cal/K.sub.m 101 Huanbifucaotong 101 Fucaotong WT 914 6.7 136 0.25 0.036 34 4.9 H141R/G342D/D370N 1596 10.9 146 2.12 0.450 310 66 H141R/G342D/G419F 3211 7.9 406 1.63 0.156 664 63 H141R/N338D/G342D 2730 6.3 433 0.73 0.150 318 65 H141R/G342D/K418P 2999 30.6 98 9.55 1.725 936 169 H141R/N338D/G342D/P386T 3018 9.7 311 2.36 0.648 734 20 N338D/G342D/R346C 980 9.5 103 2.27 0.268 234 28 N338D/G342D/R346H 941 6.3 149 2.60 0.266 388 40 H141R/N338D/G342D/R346C 1739 7.4 235 2.03 0.171 478 40 H141R/N338D/G342D/R346H 2151 7.6 283 2.64 0.249 746 70 H141R/N338D/G342D/K418P 2001 18.8 106 7.99 0.516 851 55 H141R/N338D/G342D/K418P/G419F/ 935 23 41 10.73 0.206 436 8.4 N420S H141R/G342D/P277N 186 1.1 169 0.25 0.036 86.0 25.0 N338D/G342D 206 2.1 98 0.51 0.148 124.4 15.3 G342D/R346C 220 5.9 37 1.27 0.156 47.0 3.3 H141R/N338D/N420S 823 5.1 161 1.26 0.089 72.2 4.0
(126) In summary, a series of enzymatic tests confirmed that the tolerance of rice OsHPPD mutants to the herbicides was improved compared with wild type WT. Among them, the quadruple-site mutant H141R/N338D/G342D/K418P, which showed the strongest resistance in the color reaction, also exhibited higher resistance in in vitro enzyme activity experiments. Moreover, the results showed that the mutants having the K418P mutation exhibited greatly improved resistance but reduced affinity to substrate (K.sub.m). The mutant H141R/G342D/P277N and the mutant H141R/N338D/G342D/K418P had comparable resistance and the affinity thereof to substrate (K.sub.m) was not reduced. In addition, the triple-site mutant H141R/N338D/G342D and quadruple-site mutant H141R/N338D/G342D/P386T also had relatively high resistance, and the K.sub.m thereof was not reduced. The shortest triple mutant N338D/G342D/R346H also exhibited good resistance and was easy to be edited.
(127) N338D/G342D/R346H (the shortest, suitable for homologous replacement HDR), H141R/N338D/G342D (shorter, also suitable for homologous replacement) and H141R/N338D/N420S (suitable for base editing, stronger resistance) were preferentially considered for further tests. After subjected to transgenosis and gene editing, plants were detected for tolerance changes thereof.
Example 8 Overexpression of the Triple-Site Mutant OsHPPD3M in Transgenic Rice
(128) 1. Construction of overexpression vector 1) Primers: primers were designed according to the selected restriction sites and the nucleotide sequence of the gene itself to amplify the three-site mutant HPPD (H141R/G342D/D370N) (OsHPPD3M). The designed primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.: HPPD-F, GATAGCCGGTACGGGTTCGAGCCACC ATGCCTCCCACT CCCACCC, HPPD-R, CATCTTTGTAATCGGGGTACCTAGGATCCTTGAACTGTAGG GGC. 2) PCR amplification: the gene of interest was amplified by using the synthesized primer and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA). The amplified product was assayed by agarose gel electrophoresis, and the product was recovered according to operational instructions of the TIANquick Midi Purification kit. After the completion of the recovery, the concentration of extracted DNA was determined by Nanodrop. 3) Construction of a rice overexpression vector: the rice overexpression vector pCAMBIA1301-OsHPPD3M was constructed with the recovered HPPD fragments and plasmid pCAMBIA1301 digested by KpnI and HindIII by using the HB-in Fusions seamless cloning kit of HanBio Biotechnology Co., Ltd., (Shanghai), and then transformed into the competent E. coli DH5 to obtain a positive clone; the positive clone was transformed into Agrobacterium after sequencing and restriction endonuclease digestion. 2. Rice calli infected with transformed Agrobacterium and occurrence of transgenic event 1) The rice overexpression vector pCAMBIA1301-OsHPPD3M and the empty vector pCAMBIA1301 which only expressed mCherry (a marker gene of fluorescent protein) were added in 1 g for each to the competent Agrobacterium EH105, respectively, placed on ice for 5 minutes, rapidly frozen by immersing in liquid nitrogen for 5 minutes, stood at 37 C. for 5 minutes and finally placed on ice for 5 minutes; to which 500 l of YEB solution culture (antibiotic-free) was added, and cultivated on a shaker at 28 C. and 200 rpm for 2-3 hours; the cells were collected by centrifugation at 3500 rpm, and the collected cells were applied on the YEB (kalamycin+rifampicin) plate and cultivated for 2 days in a 28 C. incubator; the single clones were picked out, cultivated in a liquid medium and stored at 80 C. 2) Cultivation of agrobacterium: the transformed monoclonal Agrobacterium was picked out and cultured in the YEB liquid medium (caramycin+rifampicin) at 28 C. until the OD.sub.600 was of 0.5, the colonies were collected at 3500 rpm, diluted with equal amount of AAM (1 ml AAM+1 l 1000AS) liquid medium, and used to infect a callus. 3) Induction of callus of rice variety Zhonghua 11: prior to the preparation of Agrobacterium, rice callus was prepared at first. Rice seeds were peeled, washed with sterile water until the washing water became clear without limiting washing times, disinfected with 70% alcohol for 30 seconds and then with 5% sodium hypochlorite, then cultivated in a horizontal shaker for 20 minutes, disinfected with sodium hypochlorite and washed with sterile water for 5 times, placed on a sterile absorbent paper to air-dry the water of surface of the seeds, and inoculated in an induction medium to cultivate the callus at 28 C. 4) Infection of rice callus with the agrobacterium: the calli of Huaidao No. 5 with a diameter of 3 mm were selected and sub-cultured for 10 days, and the calli were collected into a 50 ml centrifuge tube. A bacterial solution of Agrobacterium with a modulated concentration was added to the centrifuge tube containing the calli, and the centrifuge tube was placed on a shaker at 28 C. and 200 rpm to infect for 20 minutes; after the infection was completed, the bacterial solution was discharged, and the calli were placed on a sterile filter paper and air-dried for about 20 minutes and co-cultivated on a co-culture plate on which an sterile filter paper wetted with an AAM (1 ml AAM+30 l 1000AS) liquid culture was covered; after 3 days of infestation, Agrobacterium was washed and removed (i.e., washed with sterile water for 5 times and then washed with 500 mg/L of cephalosporin antibiotic for 20 minutes), and the calli were cultivated in 50 mg/L of a hygromycin screening medium. 5) Screening, differentiation and rooting of resistant calli: the co-cultured calli were transferred to a screening medium for the first round of screening (2 weeks); after the first round of screening, the newly grown calli were transferred to a screening medium (containing 50 mg/L hygromycin) for the second round of screening (2 weeks); after the screening was completed, blond calli with a good growth state were picked out for differentiation, and 1 M-5 M of tembotrione was added to a differentiation medium for the screening of herbicide resistance. After 3 to 4 weeks, seedlings of about 1 cm were obtained. The differentiated seedlings were transferred to a rooting medium for rooting culture; the rooted seedlings were subjected to an acclimatization treatment, and then transferred to a pot containing soil for cultivation in a greenhouse; and 55 OsHPPD3M seedlings or events were obtained. 3. Preliminary detection of herbicide resistance of transgenic seedlings (TO generation): 1-5 M of tembotrione was added a differentiation medium, and the results showed that seedlings with empty vector control were not tolerant to tembotrione, while transformed seedlings overexpressing the triple-site mutant HPPD (H141R/G342D/D370N) were tolerant to 3 M of tembotrione, as shown in
(129) Results of resistance detection: on the 5.sup.th day after the spraying (16 g/mu) and the 7.sup.th day after the spraying (8 g/mu), the non-transgenic rice seedlings began to become bleached, but the overexpressed transgenic mutants, Event 1, Event 2, Event 3 and Event 4, were green. After 32 days of the spraying, the non-transgenic seedlings sprayed with the herbicide were almost nearly dead, but the overexpressed transgenic mutants, which were treated with the herbicide in 8 g/mu or 16 g/mu, were still green, grew normally, and began to earing (as shown in
(130) In conclusion, overexpressed triple-site mutant OsHPPD3M (H141R/G342D/D370N) could enhance the resistance of transgenic rice varieties to the HPPD-inhibiting herbicide by a resistance multiple of at least 4. From the preliminary observation of the growth, development, flowering and fruiting of TO generation and T1 generation, it could be seen that most of the plants were normal.
Example 9 Determination of HPPD Copy Number Overexpressed in Transgenic Rice
(131) Hygromycin resistant gene: the rice hppd (Oshppd) gene had a high GC content, which affected the efficiency of PCR amplification. In addition, there is an endogenous copy of hppd in rice. Therefore, the selective marker gene hygromycin resistant gene hyg was chosen as an exogenous gene and sucrose phosphate synthase (SPS) gene was chosen as an endogenous reference gene to estimate copy number. SPS gene was a rice-specific gene and was a single copy that could serve as an endogenous reference gene for rice (Ding Jiayu, Jia Junwei, Yang Li tao et al. Validation of a rice specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes [J]. J. Agric. Food Chem., 2004, 52: 3372-7). The copy number of overexpressed hppd could be estimated indirectly by determining the copy number of the selective marker gene hygromycin resistant gene (hyg) of transgenic rice.
(132) Genome DNA: the genomic DNA of rice leaf was extracted and purified by using a plant genomic DNA extraction kit of Tian'gen Biotech (Beijing) Co., Ltd., and the content and purity of DNA were detected by a Nanodrop nucleic acid analyzer (Nanodrop). When the ratio of 0D260/0D280 was in the range of 1.8-2.0 and the purity was believed to be good when the ratio of OD260/OD230 was about 2.0.
(133) Primers: two pairs of primer were designed: Hyg-F: 5-GTACACAAATCGCCCGCAG-3 and Hyg-R: 5-TCTATTTCTTTGCCCTCGGAC-3 were used to amplify an 111 bp fragment of the hygromycin resistant gene in length; Sps-F: 5-GTACACAAATCGCCCGCAG-3 and Sps-R: 5-TCTATTTCTTTGCCCTCGGAC-3 were used to amplify a 170 bp fragment of sucrose phosphate synthase (SPS) gene.
(134) Quantitative PCR reaction system: the reaction solution (20 L) was prepared in accordance with the SYBR Premix ExTaq II system for real-time fluorescent quantitative PCR. PCR amplification procedure: pre-denaturation at 95 C./30S, then 95 C./5S.fwdarw.55 C./30S.fwdarw.72 C./30S, 40 cycles.
(135) Drawing of standard curve: a 400 bp sequence of the SPS or of HYG gene which contained the quantitatively PCR-amplified fragment was selected, respectively, and they were ligated together by homologous recombination and then ligated into the pClone007 vector. The constructed standard product plasmid containing the HYG gene and SPS gene was digested with the restriction endonuclease PshaI into linearized DNAs, measured with a nucleic acid protein detector for concentration thereof, and diluted with gradient ddH.sub.2O to 10.sup.6 copies/L, 10.sup.5 copies/L, 10.sup.4 copies/L, 10.sup.3 copies/L and 10.sup.2 copies/L. The five standard samples with different dilutions and a control were simultaneously amplified, and three technical replicates were set for each sample. PCR amplification was carried out as described above. Conversion formula between concentration and copy number was: copy number (copy/mL)=(6.0210.sup.23 copies/mol)(DNA concentration g/ml)/(MW g/mol). Average molecular weight (MW g/mol): dsDNA=(number of bases)(660 dalton/bp).
(136) Calculation of transgene copy number: each sample tested had a cycle number Ct when it reached the threshold value. The Ct value was substituted into the standard curve to obtain the amount of initial template in the sample, the ratio of the amount of initial templates of gene of interest to the amount of initial templates of the endogenous gene of the initial template number was the copy number of the gene of interest. The data obtained from the experiments were exported by software and analyzed by Excel.
(137) Real time fluorescence quantification PCR: the expression levels of relevant genes in transgenic rice were analyzed by using qRT-PCR method to validate the efficiency of gene overexpression. The UBQ5 gene of rice was used as an endogenous reference gene. A reaction solution was prepared for real time fluorescence quantification PCR. The reaction liquid (20 L) was prepared according to SYBR Premix ExTaq II system. The qRT-PCR amplification procedure was below: pre-denaturation at 95 C. for 30 s; denaturation at 95 C. for 5 s; annealing at 60 C. for 30 s; extension at 65 C. for min, with a total of 40 cycles. The data obtained from the experiment were exported by software and analyzed by Excel. The relative expression levels of genes were calculated by FACT. Three independent biological replicates were set for all samples.
(138) In this test, 54 positive-PCR plants and 4 non-transgenic plants as controls were selected, and a genomic DNA was extracted by a plant genomic DNA extraction kit. Each sample had three replicates for quantitative PCR reaction to obtain amplification curve, wherein the fluorescence threshold was set in the same manner for drawing the gene standard curve. The Ct value of a sample to be tested was obtained, and the number of initial templates of the HYG gene of the sample was calculated by the equation: HYG.sub.0=10.sup.(0.260CT+10.442), and the number of initial templates of the Sps gene of this sample was calculated by the equation: SPS.sub.0=10.sup.(0.260CT+10.172). Since the rice endogenous reference gene Sps was a homozygous diploid, and the probability that the exogenous gene of a transgenic plant was a homozygote was very small, the copy number of the gene of interest in the rice genome was equal to a value obtained by multiplying the data obtained by dividing the number of initial templates of HYG by the number of initial templates of SPS by 2. The number of initial templates of the gene of interest Hyg was compared the number of initial templates of rice endogenous reference gene Sps, and the results in Table 13 showed that, among the 54 transgenic plants, 36 plants had a copy number of 1, 13 plants had a copy number of 2, 4 plants had a copy number of 3, and 1 plant had a copy number of 4, while the copy number of negative control was 0.
(139) TABLE-US-00015 TABLE13 Estimationofcopynumberofgeneofinterest intransgenicplants Geneof interest copy Line SPS.sub.0 HYG.sub.0 2HYG.sub.0/SPS.sub.0 number Zhonghua 314808.9 13585.07 0.086 0 11 WT-4 794343.5 5099.921 0.013 0 WT-7 82126.33 4772.3 0.116 0 WT-8 107315 3540.487 0.066 0 2-1 86158.95 70975.65 1.648 2 2-2 116048.5 97043.28 1.672 2 2-3 98298.14 52089.59 1.060 1 2-4 95761.67 48540.84 1.014 1 2-5 99197.34 49539.5 0.999 1 2-6 114053.7 180145.4 3.159 3 2-8 126539 105285.7 1.664 2 2-9 98094.43 98837.9 2.015 2 2-10 87087.68 116834.4 2.683 3 2-11 92351.87 144727.1 3.134 3 2-12 78140.72 83886.76 2.147 2 2-13 158780.3 113069.3 1.424 1 2-14 192380.3 58948.64 0.613 1 2-15 238932 74397.84 0.623 1 2-16 161045.9 85497.1 1.062 1 2-17 35298.61 17620.82 0.998 1 2-18 213886.9 61843.61 0.578 1 2-19 176775.1 57200.14 0.647 1 2-20 621936.9 368999.1 1.187 1 2-21 594530.9 305098.9 1.026 1 2-22 224816.7 117195.8 1.043 1 2-23 77450.64 40664.82 1.050 1 2-24 269156.5 150371.3 1.117 1 2-25 208228.7 75186.45 0.722 1 2-26 169627 60077.38 0.708 1 2-27 56297.91 34315.9 1.219 1 2-28 653765.2 400797.1 1.226 1 2-29 80636.42 39719.64 0.985 1 2-30 82451.61 36849.85 0.894 1 2-31 201228.8 71250.85 0.708 1 2-32 101126.2 45752.07 0.905 1 2-33 278596 162471.6 1.166 1 2-34 114698 91280.03 1.592 2 2-35 116576.8 52873.89 0.907 1 2-36 82680.12 37455.65 0.906 1 2-37 568452.8 344492.4 1.212 1 2-38 69154.81 85884.22 2.484 2 2-39 105306.9 87417.86 1.660 2 2-40 239703.1 371019.4 3.096 3 2-41 278420.5 545540.6 3.919 4 2-42 238414.5 124542.9 1.045 1 2-43 228641.5 127467.9 1.115 1 2-44 231265.5 119998.8 1.038 1 2-45 274609.7 136861.8 0.997 1 2-46 188432.1 99115.91 1.052 1 2-47 240136.8 197426.1 1.644 2 2-48 221332.8 230365.3 2.082 2 2-49 236717.4 131366 1.110 1 2-50 167319.1 77703.63 0.929 1 2-51 170851.6 197936.8 2.317 2 2-52 149266.1 132152.6 1.771 2 2-53 139016 135037 1.943 2 2-54 183699.9 77684.4 0.846 1 2-55 182604.6 98325.76 1.077 1
(140) Note: HYG.sub.0 and SPS.sub.0 represented the number of initial templates of Hyg and of Sps gene in PCR reaction, respectively.
Example 10 Rice Varieties Tolerant to HPPD-Inhibiting Herbicides Obtained by Gene Editing
(141) Rice HPPD gene was mutated and screened, three mutation sites 141, 342 and 370 and combinations thereof were obtained, and tolerance in vitro to HPPD-inhibiting herbicides was tested. Based on this, a combined mutant OsHPPD3M (H141R/G342D1D370N) was overexpressed in a transgenic rice to confirm that the mutant was highly tolerant to HPPD-inhibiting herbicides. Then, the HPPD gene was gene-edited to obtain non-transgenic rice varieties tolerant to HPPD-inhibiting herbicides obtained by gene editing. First of all, the three sites corresponding to the amino acid position 141, 342 or 370 were subjected to base editing, respectively, and the three sites corresponding to the amino acid positions 141, 342 and 370 were subjected to homologous replacement. The gene editing process and results were as follows. (1) Base editing is a gene editing method that utilized the CRISPR/Cas9 system to target deaminase to a specific site in the genome to modify the specific base. This method had been successfully applied in rice. For example: Yan F., Kuang Y., Ren B., Wang J., Zhang D., Lin H., Yang B., Zhou X., and Zhou H. (2018). High-efficient A-T to G-C base editing by Cas9n-guided tRNA adenosine deaminase in rice. Mol. Plant. doi: 10.10161j.molp.2018.02.008.
(142) In this example, the site of the rice HPPD gene located in the Os02g0168100 locus of the second chromosome a corresponding to the amino acid position 141, 342 or 370 was edited, respectively. The amino acid residue histidine (codon CAC) at the 141-position of in rice HPPD was edited into arginine (codon CGC; the original A was changed to G) by base editing. Similarly, the amino acid residue glycine (codon GGC) at position 342 was edited to aspartic acid (codon GAC; the original G was changed to A); the amino acid residue aspartic acid (Codon GAC) at the position-370 was edited to asparagine (codon AAC; the original G was changed to A). A mutant protein xCas9(3.7)-ABE of Cas9 protein with a broader PAM compatibility was selected as an editing tool (Hu, J. H. et al. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature http://dx.doi.org/10.1038/nature26155 (2018)).
(143) A sgRNA target site was designed according to the DNA sequence of rice HPPD gene near site correspond to the amino acid position 141: GGTGCaCGCCGTGGCGCTGC-GCG, wherein a represented the action site of ABE so as to realize the edition of G from A. The PAM of this sgRNA was GCG that meted with the requirements of xCas9 (3.7).
(144) Similarly, a sgRNA target site was designed according to the DNA sequence of rice HPPD gene near site correspond to the amino acid position 342: GCACGcCGTCGTAGTAGTTG GGC, wherein c represented the action site of CBE so as to realize the edition of T from C. The PAM of this sgRNA was GGC that meted with the requirements of xCas9 (3.7).
(145) The DNA sequence of rice HPPD gene near site correspond to the amino acid position 370 was analyzed to design a sgRNA target site: CCTGGTcATCCCTGTCCACG AGC, wherein c represents the action site of CBE, so as to realize the edition of T from C. The PAM of this sgRNA was GGC that meted with the requirements of xCas9 (3.7).
(146) Accordingly, three pairs of primers: 141 GE-F: ggcgGTGCaCGCCGTGGCGCTGC and 141 GE-R: aaacGCAGCGCCACGGCGtGCAC; 342GE-F: ggcgCACGcCGTCGTAGTAGTTG and 342GE-R: aaacCAACTACTACGACGgCGTG; 370GE-F: ggcgCCTGGTcATCCCTGTCCACG and 370GE-R: aaacCGTGGACAGGGATgACCAGG, were synthesized, then diluted to 10 M with ultrapure water, and mixed in equal amounts; the mixture was placed in a boiling-water bath, and cooled naturally to room temperature for ready. 1 g of pQY000140 vector was cleaved by BsaI enzyme at 37 C. for one hour; after detection by agarose gel electrophoresis, the target fragment was recovered, then determined by ultraviolet absorption for concentration, mixed with an annealed fragment at a ratio of 1:10 and ligated with T4 DNA ligase (NEB, New England Biolabs, Boston, USA) at 16 C. for 2 hours, and transformed into the Trans5a competent cells (TransGen Biotech., Beijing). The transformed cells were cultivated at 37 C. overnight. Monoclonal component was sequenced by Sanger sequencing method to confirm whether the sequence of single-base edited vector was correct. The constructed vector pQY000141 was shown in
(147) The calli of Huaidao No. 5 (at least 3000 callis) were infected according to the aforesaid method for infecting rice callis with Agrobacterium. After being infected with Agrobacterium, the infected calli were transferred to a 50 mg/L hyg screening medium for screening culture. After three rounds (15 days3) of screening, the blond calli with good growth state were picked out to differentiate in a differentiation medium, and 0.2 M tembotrione was added during the differentiation process for screening. After for 3-4 weeks, about 1,500 seedlings with around 1 cm were obtained. As to the about 1,500 differentiated seedlings, the vast majority of which had been bleached, and only 4 seedlings remained normal green. The 4 seedlings were transplanted to a rooting medium containing 0.4 M tembotrione and cultivated for 2 weeks, wherein two seedlings had been bleached, while the other two seedlings remained green (
(148) The sequencing results showed that: both of the two green seedlings (QY000141-1 and QY000141-2) were successfully edited (
(149) After the triple-site mutant H141R/G342D/D370N overexpressed in transgenic event was obtained, the combination of the three mutation sites were subjected to homologous replacement in order to obtain non-transgenic rice with herbicide resistance.
(150) The rice hppd gene has two exons and one intron. The three target sites H141, G342 and 0370 are located at the first exon.
(151) Design of gRNA: at least one gRNA was designed upstream of H141 and downstream of 0370, respectively, and cleaved for once; and the three sites were simultaneously replaced by means of homologous replacement. The sequence of the exon 1 was input in http://crispor.tefor.net/to evaluate all possible gRNAs. According to the principles that specific scoring value is greater than 90 (Hsu P D, Scott D A, Weinstein J A, Ran F A, Konermann S, Agarwala V, Li Y, Fine E J, Wu X, Shalem O, Cradick T J, Marraffini L A, Bao G, Zhang F. Nat Biotechnol. 2013 September; 31(9):827-32. doi: 10.1038/nbt.2647. Epub 2013 Jul. 21), off-target effect is avoided and the length is shorten as far as possible, the following two gRNAs were selected: OshppdgRNA-PAM1-2: 5-GGAACGCGAGCGCCTGGAAC CGG-3 (GC=70%) (bottom strand); and OshppdgRNA-PAM2-1 (GC=39%): 5-CACCTCTTTCATGATGAAAA TGG-3(top strand), wherein the underlined was the PAM sequence and the bolded G meant that that when a template DNA to be replaced is designed, this G will be changed to other bases on the replacement template to destroy the PAMs and avoid re-cutting after replacement.
(152) The distribution of the two gRNA1-2 and gRNA2-1 in the rice genomic DNA was as shown in
(153) The design of template donor DNA was as shown in
(154) Editing vector: the gRNA1-2 and gRNA2-1 were expressed respectively by rice U3 promoter. The two gRNA expression cassettes were ligated together with a template and sent to GenScript (Nanjing) Co., Ltd. for synthesis. The synthesized DNA fragment was ligated to a skeleton vector pCXUN-Cas9 at KpnI by using seamless cloning technique (from Huazhong Agricultural University and Dr. Yu Bing, Mol Plant. 2016 Apr. 4; 9(4): 628-31. doi: 10.1016/J.molp.2016.01.001. Epub 2016 Jan. 6) to generate an editing vector.
(155) Transformation by gene gun, screening, differentiation, rooting and soil cultivation of seedlings: the above constructed editing vector was confirmed by sequencing and multi-enzyme cleavages, and was mixed with the free template donor DNA generated by PCR amplification at 20:1 (molar ratio of free repair template: editing vector, molar ratio), and Huaidao No. 5 calli were transformed by gene gun. About 3000 calli were transformed, and transferred to a 50 mg/L hyg screening medium for screening culture to obtain transgenic plants. After three rounds (15 days3) of screening, the blond calli with good growth state were picked out to differentiate in a differentiation medium, and 0.2 M tembotrione was added during the differentiation process for screening. After for 3-4 weeks, about 1000 seedlings with around 1 cm were obtained. As to the about 1000 differentiated seedlings, the vast majority of which had been bleached, and only 21 seedlings remained green. The 21 seedlings were transplanted to a rooting medium containing 0.4 M tembotrione and continuously cultivated so as to promote growth of roots. Two weeks later, 19 seedlings become bleached. The remaining 2 green seedlings (AW2 and AW3) were transplanted to a pot and cultivated in the greenhouse. The photos of the green seedlings taken before transplantation were as shown in
(156) Identification of the hppd genotype of edited seedlings: in order to identify the genotype, three pairs of PCR primers were designed to amplify the region of 342-370 mutation sites, the 342-370 region plus a part of the downstream genomic DNA sequence and the 141 single-site, respectively. These primer pairs were: 290-F: AGATACAGACGTACCTGGACCACCA and 1553-R: GCCGGCAAAAAGGAACTGGG (the region of 342-370 mutation sites); 90-F: AGATACAGACGTACCTGGACCACCA and donor-out-R: AGTGATTGTACCATCATTTGTC (342-370 region plus a part of the downstream genomic DNA sequences); and 54-F: TTCCACCACGTCGAGCTC and 356-R: GGTGAACCCGGAGATGTACG (141 single-site).
(157) The identification results showed that: the two green seedlings were successfully edited (
(158) At the same time, it has been found by many tests that the introduction of the gene of the present invention into a model plant such as Arabidopsis thaliana and Brachypodium distachyon leads to improved corresponding herbicide resistance. The edition of the above mutation sites and combinations thereof by CRISPR/Cpf1 system is also applied. Consequently, when the transgenic technology or gene editing technique was applied in the above plants, such as food crops, legume crops, oil crops, fiber crops, fruit crops, rhizome crops, vegetable crops, flower crops, medicinal crops, industrial crops, pasture crops, sugar crops, beverage crops, lawn plants, tree crops, nut crops and the like, corresponding resistance traits will be obtained, having good industrial values.
(159) All publications and patent applications mentioned in the specification are hereby incorporated herein by reference, just as each publication or patent application is separately or particularly incorporated by reference into herein.
(160) Although the foregoing invention has been described in detail through illustrations and examples for clear understanding, obviously some changes and modifications can be implemented within the scope of claims attached. Such changes and modifications are within the scope of the present invention.