Nitrilase mutant and application thereof in the synthesis of 1-cyanocyclohexyl acetic acid

12428656 ยท 2025-09-30

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a nitrilase mutant and application thereof in the synthesis of 1-cyanocyclohexyl acetic acid, the nitrilase mutant is obtained by mutating one or two of the amino acids at position 180 and 205 of the amino acid sequence shown in SEQ ID No. 2. In the present invention, by semi-rational design and protein molecular modification, the specific enzyme activity of the nitrilase double mutant AcN-G180D/A205C was increased by up to 1.6 folds, and the conversion rate>99%. And the reaction time was shortened to a quarter of the original using the recombinant Escherichia coli containing the nitrilase mutant to hydrolyze 1-cyanocyclohexylacetonitrile at high temperature (50 C.). Therefore, the mutants obtained by the present invention have a good application prospect in efficiently catalyzing 1-cyanocyclohexylacetonitrile to synthesize gabapentin intermediate, 1-cyanocyclohexyl acetic acid.

Claims

1. A nitrilase mutant, wherein the mutant has nitrilase activity of catalyzing the conversion of the substrate dinitrile to a product of monocyano carboxylic acid compound, and the nitrilase mutant comprises the amino acid sequence of SEQ ID NO: 2, except for the substitution G180D, the substitution G180F, the substitution A205C, or the substitutions G180D and A205C.

2. A polynucleotide comprising a nucleotide sequence encoding the nitrilase mutant of claim 1.

3. A recombinant genetically engineered E. coli host cell transformed with the polynucleotide of claim 2.

4. A method for producing 1-cyanocyclohexyl acetic acid, the method comprising: reacting a catalyst and a substrate in a reaction medium to produce a reaction solution comprising 1-cyanocyclohexyl acetic acid, wherein the catalyst is wet cells comprising the nitrilase mutant of claim 2, wherein the wet cells are obtained by fermentation culture of a genetically engineered E. coli cell expressing the nitrilase mutant, immobilized E. coli cells comprising the nitrilase mutant or the nitrilase mutant, wherein the nitrilase mutant is purified, wherein the purified nitrilase is obtained by subjecting the wet cells to ultrasonic breaking and centrifugation, wherein the substrate is 1-cyanocyclohexylacetonitrile, wherein the reaction medium is a pH 7.0, 200 mM disodium hydrogen phosphate-sodium dihyrdrogen phosphate buffer, wherein the reaction is carried out in a constant temperature water bath at 25-50 C., and wherein, after the reaction is completed, the reaction solution is subjected to separation and purification to obtain the 1-cyanocyclohexyl acetic acid.

5. The method of claim 4, wherein the final concentration of the substrate in the reaction medium is 5-1000 mM, and wherein catalyst is wet cells and the concentration of the wet cells in the reaction medium is 10-100 g/L.

6. The method of claim 4, wherein the wet cells are prepared according to the following method: culturing an LB medium with the genetically engineered E. coli host expressing the nitrilase mutant at 37 C. for 10-12 hours to produce an inoculum; inoculating the LB medium with the inoculum with a 1% incubating volume, wherein the LM medium contains 50 mg/L kanamycin and culturing at 37 C.; inducing an expression of the nitrilase mutant by adding isopropyl-p-D-thiogalactopyranoside to a final concentration of 0.1 mM when the OD.sub.600 of the culture reaches 0.6-0.8 and culturing at 28 C. for 10 hours; harvesting cells by centrifugation; and washing the cells with normal saline twice, thereby obtaining the wet cells.

7. The method of claim 4, wherein the purified nitrilase is prepared according to the following method: resuspending the wet cells with a pH 7.0, 100 mM NaH.sub.2PO.sub.4Na.sub.2HPO.sub.4 buffer containing 300 mM NaCl; ultrasonically breaking the resuspended wet cells under the conditions of 400 W, 25 min, 1 s breaking and 1 s pause; centrifuging the broken cells at 8000 rpm for 15 min to obtain a supernatant, wherein the supernatant is a crude enzyme solution; applying the crude enzyme solution to a Ni-NTA column that has been washed with an equilibrium buffer, wherein the equilibrium buffer is a pH 8.0, 50 mM NaH.sub.2PO.sub.4 buffer containing 300 mM NaCl, and 50 mM imidazole, pH 8.0; applying a first elution buffer to the Ni-NTA column with the applied crude enzyme solution at a flow rate of 2 mL/min to elute weakly absorbed protein impurities, wherein the first elution buffer is pH 8.0, 50 mM NaH.sub.2PO.sub.4 buffer containing 300 mM NaCl, and 50 mM imidazole; applying a second elution buffer to the Ni-NTA column with the first elution buffer at a flow rate of 2 mL/min to elute and collect the nitrilase mutant, wherein the second elution buffer is pH 8.0, 50 mM NaH.sub.2PO.sub.4 buffer containing 300 mM NaCl, and 50 mM imidazole; and dialyzing the collected nitrilase mutant with with a 20 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a histogram of enzyme activity of the different mutants.

(2) FIG. 2 is an SDS-PAGE of the nitrilase E. coli BL21 (DE3)/pET-28b (+)-AcN and its mutant transformants E. coli BL21 (DE3)/pET-28b (+)-AcN-G180D, E. coli BL21 (DE3)/pET-28b (+)-AcN-G180F, E. coli BL21 (DE3)/pET-28b (+)-AcN-A205C and the double mutant E. coli BL21 (DE3)/pET-28b (+)-SDS-PAGE of AcN-G180D/A205C, wherein lane 1 is AcN crude enzyme solution, lane 2 is G180D/A205C crude enzyme solution, lane 3 is AcN purified enzyme solution, lane 4 is G180D/A205C purified enzyme solution, lane 5 It is G180D crude enzyme solution, lane 6 is G180F crude enzyme solution, lane 7 is A205C crude enzyme solution, lane 8 is G180D purified enzyme solution, lane 9 is G180F purified enzyme solution, and lane 10 is A205C purified enzyme solution.

(3) FIG. 3 is a comparison curve diagram of enzyme activity of the nitrilase and its mutants.

(4) FIG. 4 is a curve diagram of the optimal temperature of the nitrilase double mutant E. coli BL21 (DE3)/pET-28b (+)-AcN-G180D/A205C.

(5) FIG. 5 is a curve diagram of the optimal pH of the nitrilase double mutant E. coli BL21 (DE3)/pET-28b (+)-AcN-G180D/A205C.

(6) FIG. 6 is the reaction process of nitrilase AcN-F168V and its double mutant.

SPECIFIC EMBODIMENT

(7) The present invention is further illustrated below with specific examples, but protection scope of the present invention is not limited to these examples:

Example 1: Site-Directed Mutation and Screening

(8) 1. Selecting Mutation Sites

(9) The present invention used site-directed mutation technology to carry out site-directed mutation at position 168 of the encoding gene of the nitrilase (GenBank Accession no.: AHW42593.1) derived from A. facilis CCTCC NO: M 209044 to obtain E. coli BL21 (DE3)/pET-28b (+)-AcN-F168V (referring to Zhang X H, et al. Activity improvement of a regioselective nitrilase from Acidovorax facilis and its application in the production of 1-(cyanocyclohexyl) acetic acid [J]. Process Biochemistry, 2014.). Based on this, The present invention mainly aimed at the amino acid site on A surface as the mutation site. After successful site-directed mutation by whole-plasmid PCR, the expression vector containing the target gene was transferred into the Escherichia coli host. The positive mutants were screened out by enzyme activity detection method after induced expression, and subjected to second detection to identify the mutants with increased enzyme activity, thereby obtaining mutant proteins which has self-assembly tendency and can efficiently catalyze regioselective hydrolysis of dinitrile to produce monocyanocarboxylic acid compound.

(10) 2. Single Mutation

(11) The plasmid pET-28b (+)-AcN-F168V containing the nitrilase gene AcN-F168V (the nucleotide sequence shown in SEQ ID No. 1, and the amino acid sequence shown in SEQ ID No. 2) derived from A. facilis CCTCC NO: M 209044 was used as a template, and the site-directed mutation was carried out by whole-plasmid amplification. The PCR system (50 L) was as follows: 0.5-20 ng of the template, 10-15 pmol of each primer (G180-f and A205-f, whose sequences is seen in in table 1), 5PrimeSTAR Buffer (Mg2+plus), 0.2 mM dNTP, and 1.25 U PrimeSTAR HS DNA Polymerase. The PCR program was as follows: (1) pre-denaturation at 98 C. for 3 min; (2) denaturation at 98 C. for 10 s; (3) anneal at 55 C. for 5 s; (4) extension at 72 C. for 6.5 min, wherein steps (2)(4) were cycled 30 times; and (5) finally, extension at 72 C. for 5 min, preservation at 4 C. The PCR product was identified by agarose gel electrophoresis, digested with DpnI, and then introduced into the host strain E. coli BL21 (DE3) which was then plated on a LB plate containing 50 g/mL kanamycin to obtain monoclones. A total of 23 single mutants obtained by the site-directed mutation were subjected to enzyme activity test, the method of the enzyme activity test was the same as that in example 4, and the result of the enzyme activity is shown in FIG. 1. Finally, the mutation transformants E. coli BL21 (DE3)/pET-28b (+)-AcN-G180F (written as G180F), E. coli BL21 (DE3)/pET-28b (+)-AcN-G180D (written as G180D) and E. coli BL21 (DE3)/pET-28b (+)-AcN-A205C (written as A205C) with increased enzyme activity were screened out.

(12) TABLE-US-00001 TABLE1 primerdesigntable Substi- Mutant Sequences tution G180F 5ATGTACTCCCTGTTTGAACAGGTACAC3 GGTtoTTT (SEQIDNo:11) G180L 5ATGTACTCCCTGCTTGAACAGGTACAC3 GGTtoCTT (SEQIDNo:12) G180I 5ATGTACTCCCTGATTGAACAGGTACAC3 GGTtoATT (SEQIDNo:13) G180V 5ATGTACTCCCTGGTTGAACAGGTACAC3 GGTtoGTT (SEQIDNo:14) G180Y 5ATGTACTCCCTGTATGAACAGGTACAC3 GGTtoTAT (SEQIDNo:15) G180H 5ATGTACTCCCTGCATGAACAGGTACAC3 GGTtoCAT (SEQIDNo:16) G180N 5ATGTACTCCCTGAATTAACAGGTACAC3 GGTtoAAT (SEQIDNo:17) G180D 5ATGTACTCCCTGGATGAACAGGTACAC3 GGTtoGAT (SEQIDNo:18) G180C 5ATGTACTCCCTGTGTGAACAGGTACAC3 GGTtoTGT (SEQIDNo:19) G180R 5ATGTACTCCCTGCGTGAACAGGTACAC3 GGTtoCGT (SEQIDNo:20) G180S 5ATGTACTCCCTGAGTGAACAGGTACAC3 GGTtoAGT (SEQIDNo:21) A205F 5ACCTCCATCGAGTTCAATGCGACCGTA3 GCTtoTTC (SEQIDNo:22) A205L 5ACCTCCATCGAGTTGAATGCGACCGTA3 GCTtoTTG (SEQIDNo:23) A205I 5ACCTCCATCGAGATAAATGCGACCGTA3 GCTtoATA (SEQIDNo:24) A205V 5ACCTCCATCGAGGTTAATGCGACCGTA3 GCTtoGTT (SEQIDNo:25) A205Y 5ACCTCCATCGAGTATAATGCGACCGTA3 GCTtoTAT (SEQIDNo:26) A205H 5ACCTCCATCGAGCATAATGCGACCGTA3 GCTtoCAT (SEQIDNo:27) A205N 5ACCTCCATCGAGAATAATGCGACCGTA3 GCTtoAAT (SEQIDNo:28) A205D 5ACCTCCATCGAGGATAATGCGACCGTA3 GCTtoGAT (SEQIDNo:29) A205C 5ACCTCCATCGAGTGTAATGCGACCGTA3 GCTtoTGT (SEQIDNo:30) A205R 5ACCTCCATCGAGCGTAATGCGACCGTA3 GCTtoCGT (SEQIDNo:31) A205S 5ACCTCCATCGAGTCTAATGCGACCGTA3 GCTtoTCT (SEQIDNo:32) A205G 5ACCTCCATCGAGGGTAATGCGACCGTA3 GCTtoGGT (SEQIDNo:33)
3. Combinatorial Mutation

(13) The plasmid pET-28b (+)-AcN-G180D containing the mutation transformant G180D (the nucleotide sequence shown in SEQ ID No. 3) was used as a template, and site-directed mutation was carried out by whole-plasmid amplification. The PCR system was the same as that in the single mutation system. The PCR product was identified by agarose gel electrophoresis, digested with DpnI, introduced into the host strain E. coli BL21 (DE3) and then plated on a LB plate containing 50 g/mL kanamycin, thereby obtaining the double mutation transformant which is the combinatorial mutant E. coli BL21 (DE3)/pET-28b (+)-AcN-G180D/A205C (written as G180D/A205C).

Example 2: Expression of the Nitrilase Mutant

(14) The plasmid pET-28b (+)-AcN-F168V containing the nitrilase gene AcN-F168V (shown in SEQ ID No. 1) of Acidovorax facilis CCTCC NO: M 209044 was constructed. The constructed expression vector pET-28b (+)-AcN-F168V was transferred into E. coli BL21 (DE3) for overexpression. The plasmids were subjected to site-directed saturation mutation and recombination with expression vector pET-28b (+), and then the recombinant plasmids were transformed into E. coli BL21 (DE3) for constructing the mutants, E. coli BL21 (DE3)/pET-28b (+)-AcN-G180F, E. coli BL21 (DE3)/pET-28b (+)-AcN-G180D, E. coli BL21 (DE3)/pET-28b (+)-AcN-A205C, the combinatorial mutant E. coli BL21 (DE3)/pET-28b (+)-AcN-G180D/A205C and the original strain E. coli BL21 (DE3)/pET-28b (+)-AcN-F168V (according to Zhang X H, et al. Activity improvement of a regioselective nitrilase from Acidovorax facilis and its application in the production of 1-(cyanocyclohexyl) acetic acid [J]. Process Biochemistry, 2014.). The obtained strains were respectively inoculated to LB medium and cultured at 37 C. for 10-12 h, the resulting inocula were respectively inoculated to LB medium containing kanamycin (with the final concentration of 50 mg/L) with 1% incubating volume, amplified and cultured at 37 C. and 150 rpm. When OD600 of the culture medium reached 0.6-0.8, isopropyl-B-D-thiogalactopyranoside (IPTG) was added with the final concentration of 0.1 mM to carry out induced expression at 28 C. for 10 hours. The wet cells were harvested by centrifugation and washed with normal saline twice. The immobilized cells were obtained by subjecting the wet cells to immobilization (according to the immobilization method in CN107177576A), and the purified nitrilase was obtained by subjecting the wet cells to ultrasonic breaking and then purification (according to the purification process in example 3).

Example 3: Purification of the Nitrilase and its Mutants

(15) (1) Binding buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH 8.0) was added to the wet cells obtained in example 2, the cells were resuspended, ultrasonic broken (400 W, 20 min, 1 s breaking, 1 s pause) and centrifuged (8000 rpm, 15 min). The supernatant was a crude enzyme solution for separation and purification. (2) After pre-filling a 10 mL Ni-NTA affinity column, a binding buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH 8.0) was used to wash the column at a flow rate of 2 mL/min. (3) After the Ni-NTA column was washed with 8-10 column volume, the obtained crude enzyme solution was applied onto the Ni-NTA column at a flow rate of 1 mL/min, and the target protein bound to the column. After loading, a large amount of unbound protein impurities which did not bind to the resin would be directly removed. (4) The weakly adsorbed protein impurities were eluted with an equilibrium buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 50 mM imidazole, pH 8.0) at a flow rate of 2 mL/min. (5) The target protein was eluted with a protein elution buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 500 mM imidazole, pH 8.0) at a flow rate of 2 mL/min and collected. (6) The collected target protein was dialyzed (the MWCO of the dialysis bag is 30 KDa) with a 20 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer as the dialysate, and the retention was the purified nitrilase. (7) The purified proteins were analyzed by SDS-PAGE, and the results of protein electrophoresis are shown in FIG. 2.

Example 4 Activity Determination of the Nitrilases

(16) The activity of the purified nitrilases from example 3 was determined. A reaction system (10 mL) for nitrilase activity assay was as follows: a 100 mM, pH 7.0 sodium dihydrogen phosphate-disodium hydrogen phosphate buffer, 200 mM 1-cyanocyclohexylacetonitrile, and 30 mg of the purified nitrilase. The reaction solution was preheated at 45 C. for 10 min and then reacted at 150 rpm for 10 min. 500 L of the supernatant was sampled, and 500 L of 2 M HCl was added to terminate the reaction, and the conversion rate of 1-cyanocyclohexyl acetic acid was determined by liquid chromatography (Agilent) external standard method. The column was J&K Scientific C18-H column (4.6250 mm, 5 m, 120 ), and the mobile phase was a buffer (0.58 g/L diammonium phosphate, 1.8375 g/L sodium perchlorate, pH was adjusted to 1.8 by perchloric acid, the solvent is deionized water and acetonitrile in a ratio of 76:24 (v/v), the flow rate was 1 mL/min, the ultraviolet detection wavelength was 215 nm, and the column temperature was 40 C. The results of relative enzyme activity of each mutant are shown in FIG. 3.

(17) Enzyme activity definition (U): the amount of enzyme required to catalyze the formation of 1 mol of 1-cyanocyclohexyl acetic acid per minute at 45 C., in a pH 7.0, 100 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer was defined as 1 U.

Example 5: Determination of Kinetic Parameters of the Nitrilase and its Mutants

(18) The kinetic parameters of the purified protein in example 3 were determined, using 1-cyanocyclohexylacetonitrile as the substrate and the pure enzyme solutions of AcN-F168V, G180D, A205C, G180F, and G180D/A205C as the catalyst.

(19) 10 mL of the reaction system was as follows: the purified enzyme solution (165 U/g) was diluted 10 times with a pH 7.0, 20 mM phosphate buffer and the final concentration of the purified nitrilase was 0.2 mg/mL. The resulting enzyme solution was put into a reaction container, added with the substrate at final concentrations of 6.75-40.49 mM (6.75, 13.50, 20.24, 26.99, 33.74 and 40.49 mM, respectively) and added with a pH 7.0, 20 mM phosphate buffer as the reaction medium up to 10 mL, the reaction solution was reacted at 45 C. and 600 rpm for 5 min, 500 L of the sample was taken out, 500 L of 2 M HCl was added to terminate the reaction, and the concentration of 1-cyanocyclohexyl acetic acid in the reaction solution was determined by HPLC (The detection and analysis conditions are the same as that in example 4).

(20) Collected test data was used to conduct nonlinear fitting by Origin, thereby obtaining the K.sub.m value and K.sub.cat value of the nitrilase E. coli BL21 (DE3)/pET-28b (+)-AcN-F168V and its combinatorial mutants E. coli BL21 (DE3)/pET-28b (+)-AcN-G180D, E. coli BL21 (DE3)/pET-28b (+)-AcN-G180F, E. coli BL21 (DE3)/pET-28b (+)-AcN-A205C and E. coli BL21 (DE3)/pET-28b (+)-AcN-G180D/A205C as shown in table 2. It can be found that the K.sub.cat of the double mutants is significantly improved compared with that of AcN, which indicates that the activity of the modified nitrilase is indeed increased, and their K.sub.m reflects a slight decrease in the affinity of the modified enzyme to the substrate.

(21) TABLE-US-00002 TABLE 2 Kinetic parameters of the nitrilase mutants Enzyme K.sub.m[mM] V.sub.max[mmolmg.sup.1min.sup.1] K.sub.cat[s.sup.1] K.sub.cat/K.sub.m[mM.sup.1h.sup.1] AcN-F168V 16.25 5.37 1.53 0.19 5573s.sup.1 342.95 G180D 3.21 1.41 1.98 0.13 6624s.sup.1 2063.55 G180F 5.88 1.58 2.35 0.14 7612s.sup.1 1294.56 A205C 3.40 0.78 1.63 0.059 8317s.sup.1 2446.18 G180D/A205C 19.65 7.40 4.78 0.73 24139s.sup.1 1228.45

Example 6: Determination of Optimal Temperature of Nitrilase and its Mutants

(22) The optimal temperature of the purified protein in example 3 were determined, using 1-cyanocyclohexylacetonitrile as the substrate and the pure enzyme solution of nitrilase AcN-F168V (whose specific enzyme activity was 104 U/g calculated by the weight of the wet cells) or the nitrilase combinatorial mutant G180D/A205C (whose specific enzyme activity was 165 U/g calculated by the weight of the wet cells) as the catalyst.

(23) 10 mL of the reaction system was as follows: the collected purified nitrilase (165 U/g) was diluted 10 times with a pH 7.0, 20 mM phosphate buffer and the final concentration of the purified nitrilase was 0.2 mg/mL. The resulting enzyme solution was put into a reaction container, added with the substrate at a final concentration of 200 mM and added with a pH 7.0, 20 mM phosphate buffer as the reaction medium up to 10 mL, the reaction solution was reacted at 600 rpm for 10 min, the reaction temperature is 20-60 C. (20, 25, 30, 35, 40, 45, 50, 55 and 60 C., respectively), 500 L of the sample was taken out, 500 L of 2 M HCl was added to terminate the reaction, and the concentration of 1-cyanocyclohexyl acetic acid in the reaction solution was determined by HPLC. The results are shown in FIG. 4, and the optimal temperature of the double mutant is 50 C. Under the same conditions, the optimal temperature of the nitrilase AcN-F168V is 50 C.

Example 7: Determination of the Optimal pH of the Nitrilase and its Mutants

(24) The optimal temperature of the purified protein in example 3 were determined, using 1-cyanocyclohexylacetonitrile as the substrate and the pure enzyme solution of nitrilase AcN-F168V (whose specific enzyme activity was 104 U/g calculated by the weight of the wet cells) or the nitrilase combinatorial mutant G180D/A205C (whose specific enzyme activity was 165 U/g calculated by the weight of the wet cells) as the catalyst.

(25) 10 mL of the reaction system was as follows: the purified enzyme solution of G180D/A205C (165 U/g) was diluted 10 times with a pH 7.0, 20 mM phosphate buffer and the final concentration of the purified nitrilase was 0.2 mg/mL. The resulting enzyme solution was put into a reaction container, added with the substrate at a final concentration of 200 mM and added with a 100 mM phosphate buffer as the reaction medium up to 10 mL, and the pH of the phosphate buffer was 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10 and 10.5, respectively. The reaction solution was reacted at 45 C. and 600 rpm for 10 min, 500 L of the sample was taken out, 500 L of 2 M HCl was added to terminate the reaction, and the concentration of 1-cyanocyclohexyl acetic acid in the reaction solution was determined by HPLC. The results are shown in FIG. 5, and the optimal pH of the double mutant is 8.5. Under the same conditions, the optimal pH of the nitrilase AcN-F168V is 7.

Example 8: Converting 200 mM Cyanocyclohexylacetonitrile by the Nitrilase and its Mutants

(26) The reaction process of the purified nitrilase and its mutants in example 3 were determined, using 1-cyanocyclohexylacetonitrile as the substrate and the pure enzyme solution of the nitrilase AcN-F168V (whose specific enzyme activity was 104 U/g calculated by the weight of the wet cells) or the nitrilase combinatorial mutant G180D/A205C (whose specific enzyme activity was 165 U/g calculated by the weight of the wet cells) as the catalyst.

(27) 10 mL of the reaction system was as follows: the collected purified enzyme solution was diluted 10 times with a pH 7.0, 20 mM phosphate buffer and the final concentration of the purified nitrilase was 0.2 mg/mL. The resulting enzyme solution was put into a reaction container, added with the substrate at a final concentration of 200 mM, and added with a pH 7.0, 20 mM phosphate buffer as the reaction medium up to 10 mL, the reaction solution was reacted at 45 C. and 600 rpm, 500 L of the sample was taken out at different time, 500 L of 2 M HCl was added to terminate the reaction, and the concentration of 1-cyanocyclohexyl acetic acid in the reaction solution was determined by HPLC. The reaction process of the nitrilase AcN-F168V and its mutant is shown in FIG. 6, and the conversion rate was over 99%. As shown in FIG. 6, the double mutant G180D/A205C could completely hydrolyze the substrate within 60 min, which is shorter than the nitrilase AcN-F168V.