Production of sterols in modified yeast
11466303 · 2022-10-11
Assignee
Inventors
- Hans-Peter Hohmann (Kaiseraugst, CH)
- Regina Leber (Graz, AT)
- Martin Lehmann (Kaiseraugst, CH)
- Corinna Odar (Graz, AT)
- Barbara Petschacher (Graz, AT)
- Harald Pichler (Graz, AT)
- Birgit Ploier (Graz, AT)
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention is related to production of a sterol mix in a modified yeast cell, wherein the amount of zymosterol present in said mix is dramatically reduced or abolished via modification of sterol acyltransferase activity within said yeast. The modified yeast cell can be used for production of vitamin D3 or derivatives and/or metabolites thereof.
Claims
1. A process for the production of a sterol mix in a yeast cell, said sterol mix comprising 7-dehydrocholesterol (7-DHC) and zymosterol, and said process comprising cultivating said yeast cell under conditions suitable for sterol production, wherein (a) the gene encoding the endogenous C22 sterol desaturase (ERG5) and the gene encoding the endogenous Delta(24)-sterol C-methyltransferase (ERG6) have been inactivated in the yeast cell, (b) the yeast cell comprises a mutation in the gene encoding Acyl-CoA:sterol acyltransferase 2 (ARE2) that reduces the activity of endogenous ARE2, (c) the yeast cell expresses a heterologous enzyme selected from EC 1.3.1.72 having sterol Δ24-reductase activity on lathosterol, zymosterol or trienol, wherein the enzyme EC 1.3.1.72 having sterol Δ24-reductase activity is originated from plant or vertebrate, (d) the amount of zymosterol present in the sterol mix is 3% or less based on the total amount of sterols, and (e) the percentage of 7-DHC within said sterol mix is at least 87% based on total amounts of sterol in said mix.
2. The process of claim 1, wherein the ratio between the 7-DHC and the zymosterol of at least 87 to 2.
3. The process of claim 1, wherein the sterol mix is a vitamin D3-precursor.
4. The process of claim 3, wherein the sterol mix is 7-DHC.
5. The process of claim 1, the yeast cell further comprises a mutation in the gene encoding Acyl-CoA:sterol acyltransferase 1 (ARE1) that reduces the activity of endogenous ARE1.
6. The process of claim 1, wherein the genes encoding endogenous ARE1 and ARE2 have been inactivated in the yeast cell.
Description
FIGURES
(1)
(2)
(3)
(4)
(5)
(6) The following examples are illustrative only and are not intended to limit the scope of the invention in any way.
EXAMPLES
Example 1: Construction of Knock-Out Strains Producing Cholesta-5,7,24-Trienol
(7) A cholesta-5,7,24-trienol producing Saccharomyces cerevisiae strain (erg5 and erg6 knock-out, strain e5e6) with are1 and are2 knock-out (strain a1a2e5e6, see Table 1) and a strain with only are2 knock-out (strain a2e5e6) or are1 knock-out (strain 20B) were isolated by tetrad dissection after sporulation of the diploid strain COS24. The diploid strain COS24 was gained by crossing of the two strains COS23 (are1 are2 knock-out; a1a2) and BP5 (erg5 erg6 knock-out; e5e6), which were constructed by knock-out of the specified genes (see Table 1) with disruption cassettes carrying an auxotrophy marker, or in case of Are2 with a disruption cassette carrying an antibiotic resistance gene. Interesting strains comprising ARE2 or ARE1/2 k.o. were identified by growth characteristics on marker plates. Genomic manipulations were confirmed by cPCR.
(8) Disruption cassettes were amplified by PCR using primers composed of approximately 40 bp at the 5′-end of the primer that are homologous to the up-or downstream region of the gene which is meant to be deleted and 20 bp at the 3′-end of the primer that anneal to the selectable marker gene which is meant to be introduced (Longtine, 1998; Lorenz, 1995). In case of are1 knockout, the disruption cassette flanking regions matched the N- and C-terminal part of the ARE1 gene and the disruption cassette carried a TEF promoter and terminator for expression of the HIS3 gene. For the other three knockouts the promotors of the knocked out genes were used for marker expression. For a summary of the primers for the generation of the disruption cassettes and a list of the corresponding template vectors see Table 7 and Table 2.
(9) The disruption cassettes were transformed into Saccharomyces cerevisiae with the method described below and homologous recombinants were identified by marker prototrophy or antibiotic resistance.
(10) Prior to transformation, all strains were cultivated in YPD at 30° C. in 10 or 50 mL pre-culture overnight. The main culture was inoculated to an OD.sub.600 of 0.05 in 50 mL grown over night until an OD.sub.600 of 1.5-2 units was reached. Transformation of plasmids was performed according to high efficiency LiAc/SS carrier DNA/PEG protocol described by Gietz and Woods (2002). Briefly, cells were harvested at 3000×g for 5 min, washed with 25 mL of sterile water at 3000×g, 5 min and resuspended in 1 mL sterile water. Cells were transferred to a 1.5 mL reaction tube, again centrifuged at 500×g, 1 min, supernatant removed and filled up to final volume of 1 mL with sterile water. Aliquots of 100 μL (≈108 cells) were centrifuged at 500×g, 1 min and supernatant removed. The transformation mix containing 240 μL of PEG 3500 (50%), 36 μL of 1 MLiAc, 50 μL of boiled SS-carrier DNA and 34 μL of 1-2 μg plasmid DNA or linear disruption cassettes were added to the cell pellets, vigorously mixed and incubated at 42° C. for 40 min. After the transformation event, samples were regenerated in 1 mL of YPD for 3.5 h. The suspension was centrifuged for 5 min at 500×g to gently spin down the cells. Cells were plated out on selection plates.
(11) Correct knock-outs were verified in several different colony PCR setups. The ERG5, ERG6, ARE1 and ARE2 genes were replaced by LEU2, TRP1, HIS3 and the loxP-kanMX-loxP disruption cassettes, respectively, as described by Güldener et al. (1996) to finally yield the are1are2erg5erg6 quadruple knock-out strain (strain a1a2e5e6).
(12) TABLE-US-00001 TABLE 1 genotype and mating type of strains used for the present invention. Strain e5e6 carries a k.o. of ERG5 and ERG6, strain a2e5e6 carries k.o. of ERG5, ERG6 and ARE2, strain a1a2e5e6 carries a k.o. of ERG5, ERG6, ARE1 and ARE2. Mating Strain Genotype type BP1 (e5) CEN.PK2 MATα his 3 ura3 alpha MAL2 SUC2 erg5::LEU2 BP10 (e6) CEN.PK2 MATα his 3 ura3 a MAL2 SUC2 erg6::TRP1 BP5 (e5e6) CEN.PK2 MATα his 3 ura3 alpha MAL2 SUC2erg5::LEU2, erg6::TRP1 BP24 (E5e5E6e6) CEN.PK2 ura3/ura3 his3/his3 diploid MAL2/Mal2 SUC2/SUC2 ERG5/erg5::LEU2 ERG6/erg6::TRP1 BP8 (A1a1A2a2E5e5E6e6) CEN.PK2 ura3/ura3 diploid MAL2/Mal2 SUC2/SUC2 ARE1/are1::HIS3 ARE2/are2::kanMX ERG5/erg5::LEU2 ERG6/erg6::TRP1 DSM2 CEN.PK2 ura3/ura3 diploid MAL2/MAL2 SUC2/SUC2 ARE1/are1::HIS3 ARE2/are2::kanMX ERG5/erg5::LEU2 erg6::24DHCR- HPH/erg6::TRP1 2B (a2e5e6) CEN.PK2 MATα his3 ura3 a MAL2 SUC2 are2::kanMX erg5::LEU2 erg6::TRP1 20B (a1e5e6) CEN.PK2 MATα ura3 MAL2 n.d. SUC2 are1::SkHIS3 erg5::LEU2 erg6::TRP1 14C (a1a2e5e6) CEN.PK2 MATα ura3 MAL2 alpha SUC2 are1::HIS3 are2::kanMX erg5::LEU2 erg6::TRP1 e5e6::24R CEN.PK2 MATα his3 ura3 a trp1 MAL2 SUC2 erg5::LEU2, erg6::24DHCR-HPH 4D (a2e5e6: :24R) CEN.PK2 MATα his3 ura3 MAL2 SUC2 are2::TRP1, erg5::LEU2, erg6::24DHCR- HPH 10A (a1a2e5e6: :24R) CEN.PK2 MATα ura3 MAL2 SUC2 are1:: HIS3 are2::TRP1, erg5::LEU2, erg6::24-DHCR- HPH COS6 (e5e6::24R) CEN.PK2 MAT□ his 3 ura3 MAL2 SUC2 erg5::LEU2 erg6::24DHCR-HPH COS23 (a1a2) CEN.PK2 MATα ura3 leu2 trp1 a MAL2 SUC2 are1::SkHIS3 are2::kanMX COS4 (a1a2) CEN.PK2 MATα ura3 leu2 trp1 a MAL2 SUC2 are1::SkHIS3 are2::TRP1 COS 24 CEN.PK2 ura3/ura3 (A1a1A2a2E5e5E6e6) MAL2/MAL2 SUC2/SUC2 ARE1/are1::SkHIS3 ARE2/are2::kanMX ERG5/erg5::LEU2 ERG6/erg6::TRP1 COS3 CEN.PK2 ura3/ura3 diploid (A1a1A2a2E5e5E6e6::24R) MAL2/Mal2 SUC2/SUC2 ARE1/are1::SkHIS3 ARE2/are2::TRP1 ERG5/erg5::LEU2 ERG6/erg6::24-DHCR-HPH COS9 (a1a2e5e6::24R) CEN.PK2 MAT□ ura3 MAL2 alpha SUC2 are1::SkHIS3 are2::TRP1 erg5::LEU2 erg6::24-DHCR-HPH COS7 (a1e5e6::24R) CEN.PK2 MAT□ ura3 MAL2 alpha SUC2 are1::SkHIS3 erg5::LEU2 erg6::24-DHCR- HPH COS8 (a2e5e6::24R) CEN.PK2 MAT□ ura3 MAL2 a SUC2 are2::TRP1 erg5::LEU2 erg6::24-DHCR- HPH “N.d.” means “not determined” (for more explanation see text).
(13) TABLE-US-00002 TABLE 2 plasmids used as templates for markers in disruption cassettes (for more explanation see text). Plasmid Characteristic pRS315 LEU2-f1 ori (Nael)-T7 promoter-lacT/MCS-T3 promoter-pMB1 ori-bla-CEN6-ARSH4 pFA6a TRP1 TRP1-pBR322 ori-T7 promoter-lacT/MCS- ampR-CEN6 pUG6 ampR-loxP-kanMX-TEF2 promoter pFA6a-His3MX6 SkHIS 3
Example 2: GC/MS Analysis or Strains Wherein ARE2 or ARE1/2 have been Knocked-Out
(14) Total sterols of knock-out strains e5e6 (control), a2e5e6 and a1a2e5e6 were analyzed by GC/MS (Table 3).
(15) Strains were cultivated in shake flasks in YPD media for 48 h. 10 OD.sub.600 units of biomass were saponified with KOH/MeOH and extracted with n-heptane.
(16) Absolute amounts [μg] were calculated from peak area of cholesterol peak. As internal standard, 10 μg of cholesterol were added to 10 OD units. With regards to zymosterol, the amount varied from 17.2 μg (e5e6) to 2.5 μg (strain a2e5e6) to 0.41 μg (strain a1a2e5e6). For Cholesta-5,7,24(25)-trienol, the amount varied from 18 μg (e5e6) to 20 μg (a2e5e6) to 19 μg (a1a2e5e6).
(17) TABLE-US-00003 TABLE 3 Total sterol analysis of strains e5e6, a2e5e6 and a1a2e5e6. For more explanation see text. % of total sterols e5e6 a2e5e6 a1a2e5e6 Cholesta-5,8,24(25)-trienol 1.0 2.0 2-0 Zymosterol 43.5 9.5 2.0 Cholesta-5,7,24(25)-trienol 47.5 76.0 86.5 Cholesta-7,24(25)-dienol 7.0 7.0 5.0
(18) Knockout of ARE2 leads to a drastic reduction of zymosterol content (in the range of 4-times) based on total sterols, an additional knockout of ARE1 further reduced zymosterol to 2%. Trienol content increased up to 76% for are2 knock-out and further to around 86% for double knockout.
Example 3: Construction of 7-DHC Producing Strains with Single or Double Knock-Out of ARE1 and ARE2
(19) For the construction of a 7-DHC producing S. cerevisiae strain without acyltransferase activity first a CEN.PK2 MATα erg5 knock-out and a CEN.PK2 MATα erg6 knock-out strain were constructed with the disruption cassettes described in Example 1. These two strains were crossed to give a diploid ERG5/erg5::LEU5 ERG6/erg6::TRP1 strain, into which the disruption cassettes for ARE1 and ARE2 knock-out were transformed. These transformations yielded the diploid strain ARE1/are1::HIS3 ARE2/are2::kanMX ERG5/erg5::LEU2 ERG6/erg6::TRP1. Into this strain a disruption cassette was transformed that contained the gene for a sterol 24-reductase from Danio rerio flanked by a TDH3 promoter and a PGK1 terminator in combination with a gene for hygromycin resistance with TEF1 promoter and terminator (24DHCR-HPH). The disruption cassette was integrated in the ERG6 locus, thereby a CEN.PK2 ARE1/are1::HIS3 ARE2/are2::kanMX ERG5/erg5::LEU2 erg6::24-DHCR-HPH/erg6::TRP1 strain was obtained. After sporulation of this strain and a tetrad dissection an erg5::LEU5 erg6::24DHCR-HPH knock-out strain was isolated. This strain was mated with an are1::HIS3 are2::TRP1 knock-out strain (constructed with disruption cassettes described in Example 9). The resulting diploid strain was sporulated and after a tetrad dissection finally a CEN.PK2 are1::SkHis3 are2::kanMX erg5::LEU5 erg6::24DHC-HPH quadruple knock-out strain expressing a sterol 24-reductase was obtained, which produced 7-DHC as the main sterol. Moreover two strains with only ARE1 (COS7) or ARE2 (COS8) knockout were isolated.
Example 4: GC/MS Analysis of Strains a2e5e6::24R and a1a2e5e6::24R
(20) Total sterols of knock-out strains e5e6::24R (control), a2e5e6::24R and a1a2e5e6::R24 were analyzed by GC/MS (Table 4).
(21) Strains were cultivated in shake flasks in YPD media for 48 h. 10 OD.sub.600 units of biomass were saponified with KOH/MeOH and extracted with n-heptane. Absolute amounts [μg] were calculated from peak area of cholesterol peak. As internal standard, 10 μg of cholesterol were added to 10 OD units. With regards to zymosterol, the amount varied from 17.2 μg (e5e6::24R) to 2.5 μg (a2e5e6::24R) to 0.41 μg (a1a2e5e6::24R).
(22) TABLE-US-00004 TABLE 4 Total sterol analysis of strains e5e6::24R, a2e5e6::24R and a1a2e5e6::24R. For more explanation see text. % of total sterols e5e6::24R a2e5e6::24R a1a2e5e6::24R Cholesta-5,8-dienol 3 3 5 Cholesta-8-enol 10 2 n.d. 7-DHC 44.5 87 92 Cholesta-7-enol 4 2 n.d. Zymosterol 33.5 2 n.d. Cholesta-5,7,24-trienol 3 2 2 The term “n.d.” means “not detectable”.
(23) From the amount of total sterols obtained with strain e5e6::24R around 45% is 7-DHC and 34% of sterols are zymosterol. The amount of 7-DHC was dramatically increased to 87% of the total sterols produced by a strain that possessed a knock-out in ARE2; it was further increased to over 90% in strains that possessed a double k.o. of ARE1/2. Absolute amounts of 7-DHC decreased from 20 μg per 10 OD units to 9 μg in strain a1a2e5e6::24R under the given conditions, but the by-product formation was further decreased as no zymosterol was detected any more.
Example 5: Construction of a Cholesterol Producing S. cerevisiae Strain without Acyltransferase Activity
(24) To generate a new S. cerevisiae CEN.PK strain which stably produces cholesterol instead of ergosterol, dehydrocholesterol reductase DHCR7 originating from Danio rerio (Zebrafish) was integrated into the 7-DHC producing are1are2 knock-out strain 10A (a1a2e5e6::24R, see Example 6). DHC7 saturates 7-DHC at its double bond position C-7 resulting in the final product cholesterol.
(25) DHCR7 gene was amplified by PCR from vector 056662pScript along with Barn HI and Eco RI restriction sites and an additional 5′ Kozak consensus sequence “AAAA” for S. cerevisiae using primers DHCR7-FW and DHCR7-RV (Table 13). This PCR-product was then used as an insert for sticky-end ligation with the vector backbone of p426GPD_ARE2 after Barn HI and Eco RI double digestion. The created vector p426GPD_DHCR7 now contained the DHCR7 gene flanked by the strong pTDH3 and the terminator of iso-1-cytochrome tCYC1. This cassette capable of introducing DHCR7 overexpression was amplified by PCR, using primers HR-TDH3-FW and CYC1t-HR-RV adding the 5′ and 3′ homologous ERG5 regions. All primers are shown in Table 7.
(26) The DHC7 disruption cassette was transformed into strain 10A (a1a2e5e6::24R). As only cholesterol producing strains can stand natamycin, the transformed cells were plated on 40-60 μM natamycin, where only cells with functional 7-DHC reductase expression could survive. Colony PCR results confirmed correct integration of the disruption cassette into the ERG5 locus. GC-MS results showed, that the resulting yeast strain BA-C produced >99% cholesterol in total sterols.
Example 6: Transformation and Isolation of Plasmid DNA Carrying Synthetic Genes for Sterol-O-Acyltransferases (HATs)
(27) Synthetic genes coding for five different HATs from four organisms were ordered at DNA2.0. All gene constructs were optimized for the expression in S. cerevisiae and delivered in a pJ201 vector (Table 5).
(28) TABLE-US-00005 TABLE 5 Selection of HATs including the designation of the vectors (based on DNA 2.0 vector pJ201), detailed list of proteins, source organism and NCBI accession numbers. NCBI Accession Vector Sterol-o-acyltransferase Organism number pHYD-0120 sterol O-acyltransferase Pan troglodytes XP_514030 1 (Pt1) pHYD-0121 sterol O-acyltransferase Rattus norvegicus EDL86862.1 2 (Rn2) pHYD-0122 sterol O-acyltransferase Rattus norvegicus EDM09484.1 1, isoform CRA_a (Rn1) pHYD-0123 hypothetical protein Candida albicans XP_714838 CaO19.2248 SC5314 (Ca2) pHYD-0124 sterol O-acyltransferase, Toxoplasma gondii EEE27951.1 putative VEG (Tg1)
(29) The plasmids pHYD-0120-0124 and the p426GPD vector (Mumberg, 1995) were transformed into electro-competent E. coli TOP10F′ cells, regenerated in SOC medium for 1 h at 37° C. and plated on LB-Kanamycin (50 μg/mL) agar plates for pHYD transformations and on LB-Ampicillin (100 μg/mL) for p426GPD transformation. The plates were incubated at 37° C. overnight. Media composition is given in Table 6.
(30) TABLE-US-00006 TABLE 6 Composition of cultivation media. For liquid media, agar is omitted. Medium Composition LB 10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl, 20 g/L agar SOC 20 g/L bacto tryptone, 0.58 g/L NaCl, 5 g/L bacto yeast extract, 2 g/L MgCl.sub.2, 0.16 g/L KC, 2.46 g/L MgSO4, 3.46 g/L dextrose
(31) Single colonies from the transformation plates were streaked on LB-Kanamycin (50 μg/mL) agar plates and grown overnight at 37° C. Plasmids were isolated from cell material taken from the agar plates with the Gene Jet Plasmid Miniprep Kit (Fermentas Thermo Fisher Scientific Inc.) according to the manual.
Example 7: Amplification of the ARE1 and ARE2 Gene from Chromosomal DNA of Saccharomyces cerevisiae CEN.PK2 and Cloning into Vector pJet1.2
(32) Genomic DNA isolation was done according to the “Bust n′ Grab” method (Harju, 2004). 1.5 ml of an overnight culture (OD.sub.600 12) of EUROSCARF strain Saccharomyces cerevisiae CEN.PK2-1D (MATα, ura3-52, trp1-289, leu2-3_112, his301, MAL2-8c, SUC2) were transferred into a microfuge tube and pelleted at 13,000×g for 5 min. The pellet was resuspended in 200 μL of lysis buffer (2% Triton X-100,1% SDS, 100 mM NaCl, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0) and placed in a −80° C. freezer until completely frozen. The mixture was quickly thawed in a thermomixer at 95° C. This procedure was repeated twice before vortexing the sample for 30 s. After adding 200 μL of chloroform, the tubes were vortexed for 2 min and centrifuged for 3 min at room temperature and maximum speed. For DNA precipitation, the upper aqueous phase was transferred to a microcentrifuge tube containing 400 μL of ice-cold 100% ethanol and mixed by inversion. To increase the yield, samples were incubated at −20° C. for 5-10 min and centrifuged for 5 min at 16,100×g. The supernatant was removed and the pellet was washed with 0.5 mL 70% ice-cold ethanol. After centrifugation at 16,000×g for 5 min the supernatant was removed with a micropipette and the pellet was dried in an incubator at 30° C. before dissolving it in 20 μL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8).
(33) To amplify ARE1 and ARE2, genomic DNA of CEN.PK2 was used as template in a two-step PCR. The primers provided overhangs with restrictions sites (BamHI and EcoRI) for cloning (see Table 7).
(34) TABLE-US-00007 TABLE 7 Primers for the amplification/cloning of ARE1 and ARE2 (for more details see text). SEQ ID Primer Sequence (5′ to 3′) NO are1-fw CTATATGGATCCAAAATGACGGAGACT 1 AAGGATTTGTTGC are1-rv GACTGCGAATTCTCATAAGGTCAGGTA 2 CAACGTCATAATG are1_c1332a_rv GTGGCGGGTATCCAGCCGCCGAAG 3 are1_c1332a_fw CTTCGGCGGCTGGATACCCGCCAC 4 are2-fw CTATATGGATCCAAAATGGACAAGAAG 5 AAGGATCTACTGG are2-rv GACTGCGAATTCTTAGAATGTCAAGTA 6 CAACGTACACATG E6Trp1 CATAATTTAAAAAAACAAGAATAAAAT 7 AATAATATAGTAGGCAGCATAAGATGT CTGTTATTAATTTCACAGG E6Trp2 ATAGGTATATATCGTGCGCTTTATTTG 8 AATCTTATTGATCTAGTGAATTTCTAT TTCTTAGCATTTTTGACG E5Leu1 AAAACATCACATTTTGCTATTCCAATA 9 GACAATAAATACCTTTTAACAAAATGT CTGCCCCTAAGAAGATC E5Leu2 TAATGAAGTAAATATGATTTATTGTCT 10 GGACAAAGTTCTGTTTTTCCCCATTAA GCAAGGATTTTCTTAACTTC FW_A2lox CTATAAAGATTTAATAGCTCCACAGAA 11 CAGTTGCAGGATGCCGCATAGGCCACT AGTGGATCTG RV_A2lox CTATAAAGATTTAATAGCTCCACAGAA 12 CAGTTGCAGGATGCCGCATAGGCCACT AGTGGATCTG ARE3His3_fw ATGACGGAGACTAAGGATTTGTTGCAA 13 GACGAAGAGTTTCTTAAAGCTTGCCTC GTCCCCGCC ARE3His3_rv TCATAAGGTCAGGTACAACGTCATAAT 14 GATACTGGGCCCTGAACTGGATGGCGG CGTTAGTATCG DHCR7-FW GTTGTTGGATCCAAAAATGATGGCTTC 15 AGATAGAGTTAGAAAAAGAC DHCR7-RV CAACAAGAATTCTCATCAGAAAATATT 16 TGGCAATAATCTATAAG HR-TDH3-FW AAAACATCACATTTTGCTATTCCAATA 17 GACAATAAATACCTTTTAACAAAAGTT TATCATTATCAATACTCGCCATTTCAA AGAATACG CYC1t-HR-RV TAATGAAGTAAATATGATTTATTGTCT 18 GGACAAAGTTCTGTTTTTCCCCAGGCC GCAAATTAAAGCCTTCGAG 120FLAGfw GCGGGATCCATGGACTACAAAGACGAT 19 GACGATAAAGTCGGAGAGGAAAAGATG TCCCTGAC 120FLAGrev GCGGAATTCTCAGAAAACGTAACGACA 20 AGTCCATGATCTAGGCCTAACGTAATC CAGAAAGG 121FLAGfw GCGGGATCCATGGACTACAAAGACGAT 21 GACGATAAAGAACCAAAAGCTCCACAA TTACGTCG 121FLAGrev GCGGAATTCTCAAGGATGACAACTCCA 22 GGATCTAGGTGTTACAAGTTCCCAAAA TGTTGGTTGTGGTAATG 122FLAGfw GCGGGATCCATGGACTACAAAGACGAT 23 GACGATAAAGGATCCAAAATGGTAGGC GAGGAAATG 122FLAGrev GCGGAATTCTCAAAACACATATCTACA 24 AGTCCATGTACGTGGTCTGACGTAATC AAGGAAAGTAGGGTTTTTCAATGG 123FLAGfw GCGGGATCCATGGACTACAAAGACGAT 25 GACGATAAAGGCAGAACTAACACTTCT GATCAGC 123FLAGrev GCGGAATTCTCAAAAGACCAGGTACAG 26 AGTACAGATAATGGAAGGGCCAGAGAT GAAACCGAACCAACAAATGATGTTACC 124FLAGfw GCGGGATCCATGGACTACAAAGACGAT 27 GACGATAAATTAGATGATCCTTTGTCT AAAACTAG 124FLAGrev GCGGAATTCTCTCAAAACAATCTTAAA 28 GGTTGATGATCGGCATGAGCATTGTAA AAGTGTATTTGTGCCC ScARE1FLAGfwd GCGGGATCCAAAATGGACTACAAAGAC 29 GATGACGATAAAACGGAGACTAAGGAT TTGTTG ScARE1FLAGrev GCTGAATTCTCATAAGGTCAGGTACAA 30 CGTCATAATGATACTGGGCCCTGAACA GACAC ARE2FLAGfwd GCGGGATCCATGGACTACAAAGACGAT 31 GACGATAAAGACAAGAAGAAGGATCTA CTGGAG ARE2FLAGrev GCGGAATTCTTAGAATGTCAAGTACAA 32 CGTACACATGACACTTGGTCCCATGCA GATACC p426GPD_URAfw AACACTACATATGCGTATATATACCAA 33 TCTAAG p426GPD_URArv GGTGGTGCGGCCGCCACAGATGCGTAA 34 GGAGAAAATACC Ndel TEFp_fw GGTGGTCATATGAGCTTGCCTCGTCCC 35 CG Notl TEFt_rv GGTGGTGCGGCCGCGGATGGCGGCGTT 36 AGTATCG Kozak-FLAG CGCGGATCCGCGAAAATGGACTACAAA 37 GACGATGACGATA
(35) PCR was carried out under following conditions: 50 μL total volume, 200 μM of each dNTP, 0.5 μM of each primer, approximately 200 ng of genomic DNA from S. cerevisiae CEN.PK2-1D, 0.03 U/μL Phusion Hot Start Polymerase in according buffer (Finnzymes Thermo Fisher Scientific Inc.). Cycling conditions were as follows: 98° C. for 1 min; 5 cycles of 98° C. for 10 s, 67.8° C. for 50 s, 72° C. for 58 s; 30 cycles of 98° C. for 10 s, 78° C. for 50 s, 72° C. for 59 s; 72° C. for 10 min, finally kept at 4° C.
(36) Amplified DNA was purified by a preparative gel (Wizard SV Gel Slice and PCR Product Preparation by Promega) and cloned into pJet1.2 vector with the Clone Jet™ PCR Cloning Kit (Fermentas Thermo Fisher Scientific Inc.) according to the supplier's manual to get vector pJet1.2_ARE1 or pJet1.2_ARE2. Vectors pJet1.2_ARE1 and pJet1.2_ARE2 were transformed into E. coli TOP10F′. Cell material from an overnight cultivated streak out from a single transformant was used for plasmid isolation with Fermentas GeneJet Plasmid Miniprep Kit (Fermentas Thermo Fisher Scientific Inc.) according to the supplier's manual. The correct integration of ARE1 or ARE2 in pJET1.2 was checked by Sanger sequencing.
Example 8: Cloning of ARE1 and ARE2 Gene into Vector p426GPD
(37) The ARE1 sequence from CEN.PK2 contains a BamHI restriction site, which was removed by mutation. Therefore, the ARE1 gene was amplified in two fragments with the primers indicated in Table 7. Primer are1_c1332a_fw and are1_c1332a_rv contained the intended mutation C1332A. For amplification of fragment 1 primer set are1_fw and are1_c1332a_rv was used, for amplification of fragment 2 primer set are1_c1332a_fw and are1_rv was used. The PCR mixture contained in 50 μL total volume 200 μM of each dNTP, 0.2 μM of each primer, 13 ng of pJET1.2_ARE1, 0.02 U/μL Phusion Polymerase in according buffer (Finnzymes Thermo Fisher Scientific Inc.). The PCR program used was: 98° C. for 30 s; 30 cycles of 98° C. for 10 s, 60° C. for 30 s, 72° C. for 60 s; 72° C. for 7 min, finally kept at 4° C. The two fragments were gel purified and merged in an overlap extension PCR reconstituting the whole ARE1 gene with mutated BamHI restriction site. The reaction mixture for the overlap extension PCR contained in 50 μL total volume 200 μM of each dNTP, 10 ng of fragment 1, 7 ng of fragment 2, 0.02 U/μL Phusion Polymerase in appropriate buffer (Finnzymes Thermo Fisher Scientific Inc.). The PCR program used was: 98° C. for 30 s; 15 cycles of 98° C. for 10 s, 60° C. for 20 s, 72° C. for 90 s; 72° C. for 7 min, finally kept at 4° C. The PCR product (mutated ARE1 gene flanked by BamHI and EcoRI restriction sites) was gel purified and used as insert for further cloning steps.
(38) For insert preparation for cloning of mutated ARE1 and ARE2 into p426GPD the amplified ARE1 gene (see above) or pJet1.2_ARE2 and p426GPD were restricted with BamHI and EcoRI (Fermentas Thermo Fisher Scientific Inc.). The ARE2 insert and p426GPD vector backbone were purified by a preparative gel, the ARE1 insert was purified via the GeneJET PCR Purification Kit (Fermentas Thermo Fisher Scientific Inc.). Insert and backbone were ligated with T4 DNA ligase (Fermentas Thermo Fisher Scientific Inc.). Before transformation into electrocompetent E. coli Top10F′ cells, ligation mixtures were desalted with MF Membrane filters. Single colonies from the transformation plates were streaked on LB-Ampicillin (100 μg/mL) agar plates and grown overnight at 37° C. Plasmids (p426GPD_ARE1 and p426GPD_ARE2) were isolated from cell material taken from the agar plates with the Gene Jet Plasmid Miniprep Kit (Fermentas Thermo Fisher Scientific Inc.) according to the manual.
Example 9: Addition of a FLAG-Tag to the HAT-Genes and Cloning into Vector p42GPD
(39) In order to add an N-terminal FLAG-tag to the HAT-genes, the genes were amplified from the pHYD-plasmids (heterologous acyltransferases) or p426GPD_ARE1 or p426GPD_ARE2 with the primers listed in Table 7.
(40) PCR products were purified via a preparative agarose gel. After restriction with enzymes BamHI and EcoRI, the PCR-products were ligated with vector backbone of p426GPD and transformed into E. coli TOP10F′-cells. Plasmids were isolated from single colony streak outs and correct insertion of the Flag-tagged acyltransferase genes was confirmed by Sanger sequencing.
Example 10: Cloning of kanMX Marker Gene into Vector p426GPD_ScARE2 Instead of URA3 Marker and Recloning of all Flag-Tagged Acyltransferase Genes into p42kanMXGPD Vector with a Kozak Sequence
(41) To amplify the vector backbone of p426GPD_ScARE2 (vector sequence without URA3 marker), primer p426GPD_URAfw (Table 7) carrying an overhang with a restriction site for NdeI and primer p426GPD_URArv carrying an overhang with a restriction site for NotI were used. To amplify the kanMX marker gene of plasmid pFA6a_kanMX6, primer NdeI TEFp_fw and primer NotI TEFt_rv were used.
(42) PCR was carried out under following conditions: 50 μL total volume, 200 μM of each dNTP, 0.5 μM of each primer, 50 ng template plasmid DNA, 1 unit Phusion Polymerase (Finnzymes, F-530L) in according Phusion HF Reaction Buffer. Cycling conditions were as follows: 98° C. for 30 s; 30 cycles of 98° C. for 10 s, 61° C. for 30 s, 72° C. for 2:15 min (vector backbone: approx. 7500 bp)/45 s (kanMX marker: approx. 1400 bp); 72° C. for 10 min, finally kept at 4° C.
(43) Amplified DNAs were purified by a preparative agarose gel (Wizard SV Gel and PCR Clean-up System by Promega) and the concentrations were determined after elution. The purified DNA solutions (˜45 μL) were digested with FastDigest NotI and FastDigest NdeI (Fermentas Thermo Fisher Scientific Inc.) in respective buffer. After the restriction cut the vector backbone (p42GPD_ScARE2) was dephosphorylated with FastAP Thermosensitive Alkaline Phosphatase. NdeI and NotI digested kanMX marker insert and p426GPD_ScARE2 backbone were purified via SV Minicolumn (Wizard SV Gel and PCR Clean-up System by Promega). For ligation, 100 ng of vector backbone p426GPD_ScARE2 were ligated with kanMX insert using a molar ratio of 1:3 vector to insert with 1 U/μL T4 DNA Ligase (Fermentas Thermo Fisher Scientific Inc.) in appropriate buffer for 1.5 hat room temperature.
(44) The ligation reaction was transformed into electrocompetent E. coli Top 10 F′ cells. After regeneration in SOC medium the transformation mixture was plated on LB-Ampicillin (100 μg/mL) agar plates. Single colonies from the transformation plates were streaked on LB-Ampicillin (100 μg/mL) agar plates and grown overnight at 37° C. Plasmids were isolated from cell material taken from the agar plates with the Gene Jet Plasmid Miniprep Kit (Fermentas Thermo Fisher Scientific Inc.) according to the manual. The sizes of the plasmids were checked after a control cut with NdeI and NotI on an agarose gel and plasmids showing correct fragment sizes were sent for sequencing to confirm the correct sequence.
(45) For the resulting p42kanMXGPD_ScARE2 vector, the correct sequence of the kanMX6 marker, the 2 p origin, the GAP promoter, and the ARE2 gene was determined.
(46) In order to add a Kozak-sequence (AAA) to the flag-tagged acyltransferase genes (120-124, ARE2) the coding sequences were amplified from the p426GPD_FLAG-ACAT plasmids with the forward primer Kozak-FLAG and the respective reverse primers as shown in Table 7.
(47) The PCR-products were ligated with p426kanMXGPD vector backbone after restriction with enzymes BamHI and EcoRI and transformed into TOP10F′-cells. Plasmids were isolated from single colony streak outs and correct insertion of the acyltransferase genes was confirmed by Sanger-Sequencing. The final constructs, i.e. 2p plasmids, for acyl transferase expression in S. cerevisiae are listed below:
(48) P42kanMX_GPD_Sc1
(49) P42kanMX_GPD_Sc2
(50) P42kanMX_GPD_Ca2
(51) P42kanMX_GPD_Tg1
(52) P42kanMX_GPD_Rn1
(53) P42kanMX_GPD_Rn2
(54) P42kanMX_GPD_Pt1
(55) P42kanMX_GPD
Example 11: Transformation of Acyltransferase Vectors into Ergosterol, 7-DHC or Cholesterol Producing S. cerevisiae are1 are2 Knock-Out Strains
(56) Ergosterol producing are1 are2 knock-out strain COS5 (same genotype as COS4 in Table 1 except of matingtype, COS5 is Mata) was transformed with the set of p42kanMX-GPD vectors carrying the homologous and heterologous acyltransferase genes. Transformation was done with the protocol described in Example 9. The same set of vectors was also transformed into the 7-DHC producing are 1 are2 knock-out strain (see Example 3) and the cholesterol producing are 1 are2 knock-out strain (see Example 5). Table 8 gives an overview over the available acyltransferase expressing yeast strains.
(57) TABLE-US-00008 TABLE 8 Set of acyltransferase expression strains in strain backgrounds with varying sterol compositions. Strain background Plasmid with acyl transferase Ergosterol producing are1 are2 (COSS) P42kanMX_GPD_Sc1 P42kanMX_GPD_Sc2 P42kanMX_GPD_Ca2 P42kanMX_GPD_Tg1 P42kanMX_GPD_Rn1 P42kanMX_GPD_Rn2 P42kanMX_GPD_Pt1 P42kanMX_GPD 7-DHC producing are1 are2 (10A) P42kanMX_GPD_Sc1 P42kanMX_GPD_Sc2 P42kanMX_GPD_Ca2 P42kanMX_GPD_Tg1 P42kanMX_GPD_Rn1 P42kanMX_GPD_Rn2 P42kanMX_GPD_Pt1 P42kanMX_GPD Cholesterol producing are1 are2 (BA-C) P42kanMX_GPD_Sc1 P42kanMX_GPD_Sc2 P42kanMX_GPD_Ca2 P42kanMX_GPD_Tg1 P42kanMX_GPD_Rn1 P42kanMX_GPD_Rn2 P42kanMX_GPD_Pt1 P42kanMX_GPD
Example 12: Cultivation of Acyltransferase Expressing S. cerevisiae Strains
(58) Acyltransferase expression strains in 7-DHC- and cholesterol producing-strain background (see Table 8) were cultivated at 28° C. in 250 mL baffled shake flasks for 65 h. 50 mL YPD media containing 100 μM geneticin were inoculated from a preculture to an OD.sub.600 of 0.1. Cell cultures were fed with 5 mL glucose (20%) after 40 h and again 5 mL after 52 h incubation time. Ergosterol strains were cultivated in the same way but only for 48 h with feeding after 25 and 32 h. For all strains the final OD.sub.600/mL was measured and samples were taken in volumes containing 10, 20 and 200 OD units of cells. Suspensions were centrifuged at 1500×g for 5 min and cell pellets frozen at −20° C. for further analyses.
Example 13: Gas Chromatography/Mass Spectrometry (GC/MS) Analysis of S. cerevisiae Strains with Altered Sterol Pathway with Homologous or Heterologous Acyltransferase Expression from Plasmid
(59) The procedure for GC/MS sample preparation and extraction of sterols from whole yeast cells was adapted from Quail and Kelly (1996) and Müllner et al. (2005). Frozen samples of 10 OD.sub.600 units derived from yeast cultivation were transferred to Pyrex tubes and centrifuged for 5 min at 2500×g subsequently removing the supernatant. Solvent consisting of 0.6 mL methanol, 0.4 mL of 0.5% pyrogallol dissolved in methanol and 0.4 mL of 60% aqueous KOH was added to samples together with 5 μL cholesterol or ergosterol [2 mg/mL] dissolved in ethanol as an internal standard. Suspension was mixed by vortexing and incubated for 2 h at 90° C. in a sand bath or a water bath. Lipids were extracted three times with 1 mL n-heptane upon shaking for 3 min using a Vibrax at 1500 rpm and centrifuged 3 min at 1500 g. Combined extracts were transferred into a second Pyrex tube and taken to dryness under a stream of nitrogen. (Optional: Lipids stored at −20° C.). Lipids were dissolved in 10 μL of pyridine and incubated 30 min for derivatization after adding 10 μL of N,O-bis(trimethylsilyl)-trifluoroacetamide. Samples were diluted with 200 μL of ethyl acetate and transferred to crimp-top vials with micro-inlay.
(60) GC/MS analysis of sialylated sterols was performed with an Agilent 19091S-433 column HP 5-MS (cross-linked 5% phenyl methyl siloxane; dimensions 30 m×0.25 mm×0.25 μm film thickness). Aliquots of 1 μl (syringe size=10 μL) were injected in the split-less mode at 270° C. injection temperature with helium as carrier gas at a flow rate of 0.9 ml/min in constant flow mode for a total run time of 38.67 min. The following temperature program was used: 1 min at 100° C., 10° C./min to 250° C., 3° C./min to 300° C., and 10° C./min to 310° C. Mass spectra were acquired in scan mode. Sterols were identified based on their mass fragmentation pattern, their retention time relative to cholesterol and sterol standards.
(61) Total sterol contents of acyltransferase expressing S. cerevisiae strains (see Example 11) after cultivation as described in Example 12 were analyzed by GC/MS, results are given in Table 9, wherein a Quantitative measurement of the total cellular sterols identified by GC-MS detection upon silylation of lipid extracts. Summarized sterol amounts (TOTAL) include precursor molecule squalene (SQL).
(62) TABLE-US-00009 TABLE 9 Cellular sterol composition of acyltransferase expression strains. Values are calculated in μg/OD600 relative to cholesterol (ERG- and 7DHC-strains) or ergosterol (CLR-strain) as an internal standard. Percentage values of sterols are relative to TOTAL sterols. Mean values of duplicate measurement (*single). For more explanation, see text. sc1 Sc2 Ca2 Rn1 Rn2 Pt1 Tg1 ev ERG-strain TOTAL 2.6 ± 0.2 2.9 ± 0.1 2.2 ± 0.1 2.3 ± 0.1 1.7 ± 0.0 2.1 ± 0.1 3.2 ± 0.2 2.0 ± 0.1 (μg/OD.sub.600) ERG (%) 50.5 ± 2.6 58.0 ± 2.7 57.8 ± 0.3 61.1 ± 0.9 60.9 ± 1.3 60.9 ± 0.6 54.0 ± 0.7 59.5 ± 1.4 ZYM (%) 4.3 ± 0.1 3.4 ± 0.0 3.0 ± 0.1 LAN (%) 7.6 ± 3.0 1.3 ± 1.8 2.4 ± 0.1 1.0 ± 1.4 1.1 ± 1.6 0.7 ± 1.0 3.8 ± 1.4 4.6 ± 3.1 SQL (%) 5.6 ± 0.0 6.0 ± 0.2 6.2 ± 0.1 11.3 ± 0.2 9.1 ± 0.3 11.3 ± 0.3 11.8 ± 0.2 12.5 ± 0.4 Other (%) 32.0 ± 0.3 31.3 ± 1.2 30.5 ± 0.2 26.6 ± 0.3 28.9 ± 0.6 27.0 ± 0.0 30.5 ± 0.9 23.4 ± 4.9 7DHC-strain TOTAL 3.2 ± 0.0 2.7 ± 0.1 2.2 ± 0.1 1.7 ± 0.3 2.3 ± 0.1 2.4 ± 0.3 2.9 ± 0.2 2.0 ± 0.2 (μg/OD.sub.600) 7DHC (%) 85.5 ± 1.2 75.9 ± 0.8 74.1 ± 9.3 26.9 ± 3.1 90.0 ± 0.4 90.1 ± 0.3 90.5 ± 0.1 91.5 ± 0.6 ZYM (%) 5.1 ± 0.1 8.2 ± 0.1 14.1 ± 6.3 1.3 ± 0.2 LAN (%) 0.4 ± 0.6 0.6 ± 0.9 0.4 ± 0.0 SQL (%) 1.2 ± 0.3 2.7 ± 0.5 1.3 ± 0.4 1.1 ± 0.4 1.2 ± 0.2 0.9 ± 1.2 0.7 ± 0.0 2.4 ± 0.7 Other (%) 7.8 ± 0.2 13.2 ± 0.2 9.9 ± 1.7 70.7 ± 3.7 8.7 ± 0.2 9.0 ± 1.6 8.4 ± 0.1 6.1 ± 0.1 CLR-strain TOTAL 4.7 ± 1.1 5.3 ± 0.3 6.4 ± 1.7 3.8 ± 0.2 6.0 ± 0.1 3.6* 6.3 ± 0.7 4.2 ± 0.5 (μg/OD.sub.600) CLR (%) 96.4 ± 0.0 98.5 ± 0.0 94.2 ± 0.4 99.4 ± 0.8 96.9 ± 0.3 98.3* 95.4 ± 0.1 99.4 ± 0.9 ZYM (%) 3.7 ± 0.5 LAN (%) SQL (%) Other (%) 3.6 ± 0.0 1.5 ± 0.0 2.1 ± 0.1 0.6 ± 0.8 3.1 ± 0.3 1.7* 4.6 ± 0.1 0.6 ± 0.9
Example 14: HPLC Analysis of S cerevisiae Strains with Altered Sterol Pathway with Homologous or Heterologous Acyltransferase Expression from Plasmid
(63) Biomass pellets of 200 OD units stored at −20° C. in 15 mL Greiner tubes were used for an extraction process: Samples were thawed at room temperature (RT), resuspended in 1 mL zymolyase solution (5 mg/mL in 50 mM KP.sub.i with 1 M D-sorbit) and incubated for 15 min at 37° C. After centrifugation at 3000×g for 5 min, the supernatant was discarded and the pellet was resuspended in 1 mL 100% EtOH. 2.8 mL 100% EtOH and 200 μL internal standard (e.g. 2 mg/mL cholesterylacetate solved in EtOH) was added and mixed in tightly closed tubes at 70° C. with 750 rpm for 1 h. Cooled to RT, tubes were centrifuged at 3000×g for 5 min and subsequently 3 mL of supernatant were transferred to Pyrex glass tubes. The extracts were brought to dryness under N2 and taken up in 200 μL ethyl acetate. Samples were shaken at 40° C. for 15 min to solve lipids, then, unsolved particles were centrifuged at 3000×g for 5 min and the supernatant was transferred to GC vials with inlay. HPLC measurement was performed with a mobile phase containing 80% EtOH 20% MeOH and 0.1% trifluoracetic acid at a flow of 0.6 mL/min. A volume of 10 μL sample was injected at 40° C. Compounds were separated in a YMC-Pack Pro C18 RS column at 20° C. and detected with an UV detector at 210 nm for aromatic structures/sterols in general, 280 nm for sterols with conjugated double bonds such as 7-DHC and ergosterol; alternatively with a MS detector in scan mode and positive SIM at sterol specific masses minus the OH-group (−17). Analysis of HPLC data was done by integrating sterol peaks and normalizing against an internal cholesteryl acetate standard to account for any losses during extraction and, if necessary, data was normalized again to an external cholesteryl acetate standard to adjust results for comparing data of different runs. Free sterol and sterol ester concentrations were both calculated using calibration with free sterol standards.
(64) Free and esterified sterol content of acyltransferase expressing S. cerevisiae strains with altered sterol pathway (see Example 11) after cultivation as described in Example 12 were analyzed by HPLC, results are given in
Example 15: Sterol Pattern of CEN.PK2 Erg5 Erg6 Knock-Out Strain with Our without Expression of 24-Reductase in Combination with ARE1 and/or ARE2 Knock Outs
(65) Sterol production in an ergosterol producing CEN.PK2 strain was compared to cholesta-5,7,24 trienol (see Example 1 and 2) or 7-DHC producing strains (see Example 5) with different combinations of are1 and are2 knock-outs. Strains S. cerevisiae CEN.PK2, 20B, 2B, 14C (see example 1), COS7, COS8, COS9 (see example 5) were cultivated in triplicates in shake flasks for three days with additional glucose feeding. In order to analyze free sterols and the sterol ester composition of the variants by HPLC ethanolic extracts of 200 OD units were prepared as described in Example 14. Extracts were analyzed by HPLC with UV detection at two wavelengths (210 and 280 nm). Zymosterol compounds were detected by 210 nm UV light, 7-DHC compounds were measured at 280 nm. Concentrations were calculated by relating peak areas to areas detected for 0.5-2 mg/mL standard solutions of zymosterol and 7-DHC. Cholesteryl acetate was used as internal standard to normalize for possible differences within the extraction procedure. For details of HPLC method see Example 14. The sterol composition of the analyzed strains as measured by HPLC analysis is shown in
(66) Two main types of sterol esters can be detected which will be esterification products of palmitoleic acid (ester 1) and oleic acid (ester2), the two main fatty acids in yeasts as reported by Zweytick et al. (2000).
(67) GC analysis was done from extracts of the same biomass as for HPLC analysis (see