Herpesvirus with modified glycoprotein D

Abstract

The present invention is directed to a recombinant herpesvirus comprising a heterologous peptide and optionally polypeptide ligand capable of binding to (a) target molecule(s) and fused to or inserted into glycoprotein D. The recombinant herpesvirus may additionally comprise modifications for detargeting the virus from the natural receptors of gD. This allows the herpesvirus to efficiently target a cell for therapeutic purposes and a cell for virus production. The present invention further comprises a pharmaceutical composition comprising the herpesvirus, the herpesvirus for use in the treatment of a tumor, infection, degenerative disorder or senescence-associated disease, a nucleic acid and a vector coding for the gD, a polypeptide comprising the gD, and a cell comprising the herpesvirus, nucleic acid, vector or polypeptide. Moreover, a method for infecting a cell with the herpesvirus or for producing the herpesvirus is disclosed.

Claims

1. A recombinant herpesvirus comprising a modified glycoprotein D (gD) said modified gD having: a) inactivated HVEM and nectin-1 binding sites, b) a first heterologous polypeptide ligand capable of binding to a target molecule present on a cell suitable for growth of the herpesvirus or a cell approved for herpesvirus growth fused to or inserted therein, and c) a second heterologous polypeptide ligand capable of binding to a target molecule present on a diseased cell fused to or inserted therein, wherein the herpesvirus has the capability of fusing with the membrane of the cell suitable for growth of the herpesvirus or a cell approved for herpesvirus growth and of fusing with the membrane of the diseased cell expressing the target molecule, and entering said cell.

2. The herpesvirus according to claim 1, wherein the first heterologous polypeptide ligand is inserted into one of the HVEM or nectin-1 binding sites and the second heterologous polypeptide ligand is inserted into the other HVEM or nectin-1 binding site.

3. The recombinant herpesvirus according to claim 2, wherein either the first or the second heterologous polypeptide ligand is inserted into the nectin-1 binding site of gD wherein the insertion is within amino acids 35 to 39 or a subset thereof or within amino acids 214 to 223 or a subset thereof of SEQ ID NO:1 or corresponding amino acids of a homologous gD.

4. The recombinant herpesvirus according to claim 2, wherein either the first or the second heterologous polypeptide ligand is inserted into the HVEM binding site of a gD, wherein the insertion is within amino acids 6 and 34 or between amino acids 24 and 25 of SEQ ID NO:1 or corresponding amino acids of a homologous gD.

5. The herpesvirus according to claim 1, wherein the first heterologous polypeptide ligand has a length of 5 to 131 amino acids.

6. The herpesvirus according to claim 5, wherein the first heterologous polypeptide ligand has a length of 5 to 120 amino acids.

7. The herpesvirus according to claim 1, wherein the first heterologous polypeptide ligand comprises a part of the GCN4 yeast transcription factor, an epitope of the GCN4 yeast transcription factor, a GCN4 epitope as identified by SEQ ID NO: 13, a part of the GCN4 yeast transcription factor comprising SEQ ID NO:12, or a peptide that is identified by SEQ ID NO:12.

8. The recombinant herpesvirus according to claim 1, wherein first heterologous polypeptide ligand is an antibody, an antibody derivative of an antibody mimetic, or a single-chain antibody (scFv).

9. The recombinant herpesvirus according to claim 1, wherein the diseased cell is a tumor cell, an infected cell, a degenerative disorder-associated cell, or a senescent cell, and wherein the target molecule is a tumor-associated receptor.

10. The herpesvirus according to claim 1, wherein the herpesvirus further encodes one or more molecules that modulate(s) the host immune response against the diseased cell.

11. A pharmaceutical composition comprising the recombinant herpesvirus according to claim 1 and a pharmaceutically acceptable carrier, optionally additionally comprising one or more molecule(s) that modulate(s) the host immune response against the diseased cell.

12. A cell comprising the recombinant herpesvirus according to claim 1.

13. A modified herpesvirus glycoprotein D (gD) said modified gD having: a) inactivated HVEM and nectin-1 binding sites, b) a first heterologous polypeptide ligand capable of binding to a target molecule present on a cell suitable for growth of the herpesvirus or a cell approved or herpesvirus growth fused to or inserted therein, and c) a second heterologous polypeptide ligand capable of binding to a target molecule present on a diseased cell fused to or inserted therein.

14. A nucleic acid molecule comprising a nucleic acid encoding a modified herpesvirus glycoprotein D (gD) said modified gD having: a) inactivated HVEM and nectin-1 binding sites, b) a first heterologous polypeptide ligand capable of binding to a target molecule present on a cell suitable for growth of the herpesvirus or a cell approved or herpesvirus growth fused to or inserted therein, and c) a second heterologous polypeptide ligand capable of binding to a target molecule present on a diseased cell fused to or inserted therein.

15. A vector comprising the nucleic acid molecule according to claim 14.

16. A cell comprising the nucleic acid molecule according to claim 14.

Description

FIGURES

(1) FIG. 1: Genome organization of R-87, R-89, R-97, R-99 and R-99-2. Sequence arrangement of HSV-1 genome shows the inverted repeat IR sequences as rectangular boxes. The GCN4 peptide, bracketed by upstream and downstream Gly-Ser linkers, is inserted between AA 24 and 25 of gD in R-87 and R-89. The GCN4 peptide, bracketed by upstream and downstream Gly-Ser linkers, is inserted in place of AA 35-39 of gD in R-97, in place of AA 214-223 of gD in R-99, in place of AA 219-223 of gD in R-97, The scFv-HER2 sequence (VL-linker-VH) is inserted in place of AA 35-39 of gD in R-87. The scFv-HER2 sequence (VL-linker-VH) is inserted in place of AA 214-223 of gD in R-89. The scFv-HER2 sequence (VL-linker-VH) is inserted between AA 24 and 25 of gD in R-97, R-99 and R-99-2. All recombinants carry the LOX-P-bracketed p-Belo-BAC and EGFP sequences inserted between UL3-UL4 region.

(2) FIG. 2: Tropism of R-87. R-87 was grown in SK-OV-3 (A) or in Vero-GCN4R (B) cells. J cells express no receptor for wt-HSV. J-HER2, J-nectin-1, J-HVEM only express the indicated receptor. The indicated cells were infected with R-87 and monitored for EGFP by fluorescence microscopy. Cells in panels e, f, g, and h were infected in presence of Herceptin/Trastuzumab at neutralizing dose (28 μg/ml). R-87 infects both the Vero-GCN4R cells (b, f), and the HER2-positive cancer cell line SK-OV-3 (c, g), in addition to the J-HER2 cells (d, h), It also infects wt-Vero cells, which express a simian ortholog of HER2 (a). Herceptin inhibits R-87 infection of wt-Vero, SK-OV-3 and J-HER2 cells (e, g, h), but not of Vero-GCN4R cells (f). R-87 fails to infect J-nectin-1, J-HVEM and -J cells (i, j, k), since it has been detargeted from the gD receptors HVEM and nectin-1.

(3) FIG. 3: Tropism of R-89. R-89 was grown in SK-OV-3 (A) or in Vero-GCN4R (B) cells. J cells express no receptor for wt-HSV. J-HER2, J-nectin-1, J-HVEM only express the indicated receptor. The indicated cells were infected with R-89 and monitored for EGFP by fluorescence microscopy. Cells in panels e, f, g, and h were infected in presence of Herceptin/Trastuzumab at neutralizing dose (28 μg/ml). R-89 infects both the Vero-GCN4R cells (b, f), and the HER2-positive cancer cell line SK-OV-3 (c, g), in addition to the J-HER2 cells (d, h); it infects poorly wt-Vero cells, which express a simian ortholog of HER2 (a). Herceptin inhibits R-89 infection of wt-Vero, SK-OV-3 and J-HER2 cells (e, g, h), but not of Vero-GCN4R cells (f). R-89 fails to infect J-nectin-1, J-HVEM and J cells (i, j, k), since it has been detargeted from the gD receptors HVEM and nectin-1.

(4) FIG. 4: Tropism of R-97. R-97 was grown in SK-OV-3 cells. J cells express no receptor for wt-HSV. J-HER2, J-nectin-1, J-HVEM only express the indicated receptor. The indicated cells were infected with R-97 and monitored for EGFP by fluorescence microscopy. Cells in panels e, f, g, and h were infected in presence of Herceptin/Trastuzumab at neutralizing dose (28 μg/ml). R-97 infects both the Vero-GCN4R cells (b, f), and the HER2-positive cancer cell line SK-OV-3 (c, g), in addition to the J-HER2 cells (d, h); it also infects wt-Vero cells, which express a simian ortholog of HER2 (a). Herceptin inhibits R-97 infection of wt-Vero, SK-OV-3 and J-HER2 cells (e, g, h), but not of Vero-GCN4R cells (f). R-97 fails to infect J-nectin-1, J-HVEM and J cells (i, j, k), since it has been detargeted from gD receptors HVEM and nectin-1.

(5) FIG. 5: Tropism of R-99. R-99 was grown in SK-OV-3 (A) or in Vero-GCN4R (B) cells. J cells express no receptor for wt-HSV. J-HER2, J-nectin-1, J-HVEM only express the indicated receptor. The indicated cells were infected with R-99 and monitored for EGFP by fluorescence microscopy. Cells in panels e, f, g, and h were infected in presence of Herceptin/Trastuzumab at neutralizing dose (28 μg/ml). R-99 infects both the Vero-GCN4R cells (b, f), and the HER2-positive cancer cell line SK-OV-3 (c, g), in addition to the J-HER2 cells (d, h); it also infects wt-Vero cells, which express a simian ortholog of HER2 (a). Herceptin inhibits R-99 infection of wt-Vero, SK-OV-3 and J-HER2 cells (e, g, h), but not of Vero-GCN4R cells (f). R-99 fails to infect J-nectin-1, J-HVEM and J cells (i, j, k), since it has been detargeted from gD receptors HVEM and nectin-1.

(6) FIG. 6: Tropism of R-99-2. R-99-2 was grown in SK-OV-3 cells. J cells express no receptor for wt-HSV. J-HER2, J-nectin-1, J-HVEM only express the indicated receptor. The indicated cells were infected with R-99-2 and monitored for EGFP by fluorescence microscopy. Cells in panels e, f, g, and h were infected in presence of Herceptin/Trastuzumab at neutralizing dose (28 μg/ml). R-99-2 infects both the Vero-GCN4R cells (b, f), and the HER2-positive cancer cell line SK-OV-3 (c, g), in addition to the J-HER2 cells (d, h); it also infects wt-Vero cells, which express a simian ortholog of HER2 (a). Herceptin inhibits R-99-2 infection of wt-Vero, SK-OV-3 and J-HER2 cells (e, g, h), but not of Vero-GCN4R cells (f). R-99-2 fails to infect J-nectin-1, J-HVEM and J cells (i, j, k), since it has been detargeted from gD receptors HVEM and nectin-1.

(7) FIG. 7: Yield of recombinants R-87, R-89, R-99, and of R-LM113, in SK-OV-3 cells (A) and in Vero-GCN4R cells (B), and release of progeny virus to the extracellular medium (C, D). The extent of R-87, R-89 and R-99 replication in Vero-GCN4R, or in SK-OV-3 cells was compared to that of R-LM113 virus. Cells were infected with the indicated viruses at MOI 0.1 PFU/cell (inoculum titrated in Vero-GCN4R for replication in Vero-GCN4R, and in SK-OV-3 cells for replication in SK-OV-3 cells). Samples were collected at 24 and 48 hours post infection and progeny virus was titrated in SK-OV-3 cells (A, B). SK-OV-3 (C), or Vero-GCN4R (D) cells were infected with R-87, R-89, R-99 and R-LM113 at MOI 0.1 PFU/cell as in panel A (inoculum was titrated in SK-OV-3 cells). Samples were collected at 48 hours post infection and progeny virions released in the extracellular medium (extra), present in the cell-associated fraction (intra), or cell-associated plus medium (intra+extra) were titrated.

(8) FIG. 8: Plaque size and plating efficiency of R-87, R-89, R-97, R-99 and R-99-2 in different cell lines. (A) Replicate aliquots of R-87, R-89, R-97, R-99, R-99-2 and R-LM113 for comparison, were plated in Vero-GCN4R, wt-Vero, and SK-OV-3 cells. Plaques were scored 3 days later at fluorescence microscope. (B) Relative plating efficiency of R-87, R-89, R-97, R-99, R-99-2 and R-LM113 in different cell lines. The number of scored plaques is expressed as percentage of the plaques scored in SK-OV-3 cells.

(9) FIG. 9: Cytotoxicity caused by R-87, R-89, R-99, and R-LM113, to SK-OV-3 (A) and Vero-GCN4R cells (B). Cells were infected with the indicated viruses (3 PFU/cell). Cytotoxicity was measured through Alamar-blue assay at the indicated days after infection. It can be seen that all viruses caused cytotoxicity to SK-OV-3 and to Vero-GCN4R, except for R-LM113 in Vero-GCN4R cells, consistent with the fact that this virus is not retargeted to the GCN4R.

SEQUENCES

(10) SEQ ID NO: 1: amino acid sequence of HSV-1 gD wild type, precursor (Human herpesvirus 1 strain F, GenBank accession number: GU734771.1; gD encoded by positions 138281 to 139465).

(11) SEQ ID NO: 2: Nucleotide sequence of chimeric gD-GCN4, scFv HER2 of R-87

(12) SEQ ID NO: 3: Amino acid sequence of the precursor of gD (SEQ ID NO: 1) having inserted the GCN4 peptide between amino acids 24 and 25 of mature gD, after cleavage of the signal sequence (formed by amino acids 1-25), and scFv to HER2 receptor in replacement of amino acids 35 to 39 of mature gD, as encoded by the construct R-87. The GCN4 peptide is flanked by a Ser-Gly linker.

(13) SEQ ID NO: 4: Nucleotide sequence of chimeric gD-GCN4, scFv HER2 of R-89

(14) SEQ ID NO: 5: Amino acid sequence of the precursor of gD (SEQ ID NO: 1) having inserted the GCN4 peptide between amino acids 24 and 25 of mature gD, and scFv to HER2 receptor in replacement of amino acids 214-223 of mature gD, as encoded by the construct R-89. The GCN4 peptide is flanked by a Ser-Gly linker.

(15) SEQ ID NO: 6: Nucleotide sequence of chimeric gD-GCN4, scFv HER2 of R-97

(16) SEQ ID NO: 7: Amino acid sequence of the precursor of gD (SEQ ID NO: 1) having inserted the scFv to HER2 receptor between amino acids 24 and 25 of mature gD, and the GCN4 peptide in replacement of amino acids 35 to 39 of mature gD, as encoded by the construct R-97. The GCN4 peptide is flanked by a Ser-Gly linker.

(17) SEQ ID NO: 8: Nucleotide sequence of chimeric gD-GCN4, scFv HER2 of R-99

(18) SEQ ID NO: 9: Amino acid sequence of the precursor of gD (SEQ ID NO: 1) having inserted the scFv to HER2 receptor between amino acids 24 and 25 of mature gD, and the GCN4 peptide in replacement of amino acids 214 to 223 of mature gD, as encoded by the construct R-99. The GCN4 peptide is flanked by a Ser-Gly linker.

(19) SEQ ID NO: 10: Nucleotide sequence of chimeric gD-GCN4, scFv HER2 of R-99-2

(20) SEQ ID NO: 11: Amino acid sequence of the precursor of gD (SEQ ID NO: 1) having inserted the scFv to HER2 receptor between amino acids 24 and 25 of mature gD, and the GCN4 peptide in replacement of amino acids 219 to 223 of mature gD, as encoded by the construct R-99-2. The GCN4 peptide is flanked by a Ser-Gly linker.

(21) SEQ ID NO: 12: GCN4 peptide—Amino acid sequence of GCN4 peptide including bracketing upstream and downstream GS linkers. The GCN4 epitope is YHLENEVARLKK.

(22) SEQ ID NO: 13: GCN4 epitope

(23) SEQ ID NO: 14: Amino acid sequence of the GCN4 yeast transcription factor UniProtKB-P03069

(24) SEQ ID NO: 15: Genbank accession number AJ585687.1 (gene encoding the GCN4 yeast transcription factor)

(25) SEQ ID NO: 16: Amino acid sequence of scFv HER2 cassette, flanked by two linkers, EN and SSGGGSGSGGS (SEQ ID NO: 54).

(26) SEQ ID NO: 17: amino acid sequence of scFv to GCN4 peptide comprising an N-terminal leader peptide, an HA tag sequence, a short GA linker, and the scFv sequence

(27) SEQ ID NO: 18: amino acid sequence encoded by SEQ ID NO: 19; amino acid sequence of the scFv capable of binding to the GCN4 peptide comprising an N-terminal leader peptide, an HA tag sequence, a short GA linker, the scFv sequence from amino acids 33 to 275, a short GSGA linker, and human nectin-1 (PVRL1) residues Met143 to Val517

(28) SEQ ID NO: 19: nucleotide sequence encoding scFv-GCN4-nectin-1 chimera

(29) SEQ ID NO: 20: Primer gD24_galK_f

(30) SEQ ID NO: 21: Primer gD25_galK_r

(31) SEQ ID NO: 22: Primer galK_827_f

(32) SEQ ID NO: 23: Primer galK_1142_r

(33) SEQ ID NO: 24: GCN4 peptide cassette—Nucleotide sequence of GCN4 peptide including bracketing upstream and downstream GS linkers (ggatcc and ggcagc)

(34) SEQ ID NO: 25: Primer gD24_GCN4 JB

(35) SEQ ID NO: 26: Primer gD25_GCN4_rB

(36) SEQ ID NO: 27: Nucleotide sequence of chimeric gD-GCN4 of R-81

(37) SEQ ID NO: 28: Amino acid sequence of the precursor of gD (SEQ ID NO: 1) having inserted the GCN4 peptide between amino acids 24 and 25 of mature gD, as encoded by the construct R-81. The GCN4 peptide is flanked by a Ser-Gly linker.

(38) SEQ ID NO: 29: Primer gD_ext_f

(39) SEQ ID NO: 30: Primer gD_ext_r

(40) SEQ ID NO: 31: Primer galK_gD35_F

(41) SEQ ID NO: 32: Primer galK_gD39_R

(42) SEQ ID NO: 33: Nucleotide sequence of scFv HER2 cassette

(43) SEQ ID NO: 34: Primer gD-34-scFvHER2-F

(44) SEQ ID NO: 35: Primer gD-40-scFvHER2-R

(45) SEQ ID NO: 36: Primer scFv_456_r

(46) SEQ ID NO: 37: Primer galK_gD214_F

(47) SEQ ID NO: 38: Primer galK_gD223_R

(48) SEQ ID NO: 39: Primer gD213-scFvHER2f

(49) SEQ ID NO: 40: Primer gD224-scFvHER2r

(50) SEQ ID NO: 41: Primer gDintforw

(51) SEQ ID NO: 42: Primer gD24-scFvHer2-F

(52) SEQ ID NO: 43: Primer gD25-scFvHer2-R

(53) SEQ ID NO: 44: Primer gD213-GCN4-F

(54) SEQ ID NO: 45: Primer gD224-GCN4-R

(55) SEQ ID NO: 46: Primer HSV 139688 r

(56) SEQ ID NO: 47: primer gD35-galK-F

(57) SEQ ID NO: 48: primer gD39-galK-R

(58) SEQ ID NO: 49: primer gD35-GCN4-F

(59) SEQ ID NO: 50: primer gD39-GCN4-R

(60) SEQ ID NO: 51: primer scFv4D5 651_f

(61) SEQ ID NO: 52: primer gDintrev

(62) SEQ ID NO: 53: primer gD219-GCN4-F

EXAMPLES

Example 1

(63) Construction of HSV recombinants R-87, R-89, R-97, R-99, R-99-2

(64) expressing genetically modified forms of gD, carrying (i) a GCN4 peptide inserted between AA 24 and 25 of gD (R-87 and R-89), or in place of AA 35-39 (R-97), or in place of AA 214-223 (R-99), or in place of AA 219-223 (R-99-2); (ii) a deletion of gD encompassing AA 35-39 (R-87), a deletion of gD encompassing AA 214-223 (R-89, and R-99), a deletion of gD encompassing AA 219-223 (R-99-2); (iii) the replacement of AA 35-39 deleted sequences (R-87) and the replacement of AA 214-223 deleted sequences (R-89) with scFv to HER2; (iv) an scFv to HER2 inserted between AA 24 and 25 of gD (R-97, R-99 and R-99-2).

(65) A) As a preliminary step to the engineering of R-87 and R-89, the invertors constructed R-81, carrying the insertion of GCN4 peptide between AA 24 and 25 of HSV gD.

(66) The inventors engineered R-81 by insertion of the sequence encoding the GCN4 peptide between AA 24 and 25 of mature gD, corresponding to AA 49 and 50 of precursor gD, prior to cleavage of the signal sequence, which encompasses AA 1 to 25.

(67) The starting genome was the BAC LM55, which carries LOX-P-bracketed pBeloBAC11 and eGFP sequences inserted between U.sub.L3 and U.sub.L4 of HSV-1 genome (Menotti et al., 2008). The engineering was performed by means of galK recombineering. Briefly, in order to insert the GCN4 peptide in gD, the galK cassette with homology arms to gD was amplified by means of primers gD24_galK_f CTCTCAAGATGGCCGACCCCAATCGCTTTCGCGGCAAAGACCTTCCGGTCCCT GTTGACAATTAATCATCGGCA (SEQ ID NO: 20) and gD25_galK_r TGGATGTGGTACACGCGCCGGACCCCCGGAGGGTCGGTCAGCTGGTCCAGTC AGCACTGTCCTGCTCCTT (SEQ ID NO: 21) using pGalK as template. This cassette was electroporated in SW102 bacteria carrying the BAC LM55 BG. The recombinant clones carrying the galK cassette were selected on plates containing M63 medium (15 mM (NH.sub.4).sub.2SO.sub.4, 100 mM KH.sub.2PO.sub.4, 1.8 μg FeSO.sub.4.H.sub.2O, adjusted to pH7) supplemented with 1 mg/L D-biotin, 0.2% galactose, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. In order to exclude galK false positive bacterial colonies, they were streaked also on MacConkey agar base plates supplemented with 1% galactose and 12 μg/ml chloramphenicol and checked by colony PCR with primer galK_827_f GCGTGATGTCACCATTGAAG (SEQ ID NO: 22) and galK_1142_r TATTGTTCAGCGACAGCTTG (SEQ ID NO: 23). Next, the GCN4 peptide cassette (SEQ ID NO: 24, encoding SEQ ID NO: 12) with the downstream and upstream Ser-Gly linkers and bracketed by homology arms to gD was generated through the annealing and extension of primers gD24_GCN4 JB CTCTCAAGATGGCCGACCCCAATCGCTTTCGCGGCAAAGACCTTCCGGTCGGA TCCAAGAACTACCACCTGGAGAACGAGGTGGCCAGACTGAAGAAGCTGGTGGG CAGC (SEQ ID NO: 25) and gD25_GCN4_rB TGGATGTGGTACACGCGCCGGACCCCCGGAGGGTCGGTCAGCTGGTCCAGGC TGCCCACCAGCTTCTTCAGTCTGGCCACCTCGTTCTCCAGGTGGTAGTTCTTGG ATCC (SEQ ID NO: 26) which introduce a silent restriction site for the BamHI endonuclease, useful for screening of colonies by means of restriction analysis. The recombinant genome (SEQ ID NO: 27) encodes the chimeric gD (SEQ ID NO: 28), which carries the GCN4 peptide including one downstream and one upstream Ser-Gly linker with the sequence GS. The recombinant clones carrying the excision of the galK cassette and the insertion of the sequence of choice, GCN4 peptide, were selected on plates containing M63 medium (see above) supplemented with 1 mg/L D-biotin, 0.2% deoxy-2-galactose, 0.2% glycerol, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. Bacterial colonies were checked for the presence of sequence of choice by means of colony PCR with primers gD_ext_f TCCATACCGACCACACCGACGAATCCC (SEQ ID NO: 29) and gD_ext_r GAGTTTGATACCAGACTGACCGTG (SEQ ID NO: 30).

(68) B) R-87

(69) Insertion of GCN4 peptide between AA 24 and 25 of HSV gD, deletion of AA 35-39, replaced by scFv to HER2 receptor.

(70) The inventors engineered R-87 (FIG. 1) by insertion of the sequence encoding the GCN4 peptide between AA 24 and 25 of mature gD, corresponding to AA 49 and 50 of precursor gD, prior to cleavage of the signal sequence, which encompasses AA 1-25, and by deletion of AA 35-39, replaced by scFv.

(71) The starting genome was the BAC 81, which carries GCN4 peptide between AA 24 and 25 of HSV gD, LOX-P-bracketed pBeloBAC11 and EGFP sequences inserted between U.sub.L3 and U.sub.L4 of HSV-1 genome, as described above. The engineering was performed by means of galK recombineering. Briefly, in order to insert the scFv in gD Δ AA 35-39, the galK cassette with homology arms to gD was amplified by means of primers galK_gD35_F TGAAGAAGCTGGTGGGCAGCCTGGACCAGCTGACCGACCCTCCGGGGGTCCC TGTTGACAATTAATCATCGGCA (SEQ ID NO: 31) and galK_gD39_R GTGATCGGGAGGCTGGGGGGCTGGAACGGGTCTGGTAGGCCCGCCTGGATTC AGCACTGTCCTGCTCCTT (SEQ ID NO: 32) using pGalK as template. This cassette was electroporated in SW102 bacteria carrying the BAC 81 BG. The recombinant clones carrying the galK cassette were selected on plates containing M63 medium (15 mM (NH.sub.4).sub.250.sub.4, 100 mM KH.sub.2PO.sub.4, 1.8 μg FeSO.sub.4.H.sub.2O, adjusted to pH7) supplemented with 1 mg/L D-biotin, 0.2% galactose, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. In order to exclude galK false positive bacterial colonies, they were streaked also on MacConkey agar base plates supplemented with 1% galactose and 12 μg/ml chloramphenicol and checked by colony PCR with primer galK_827_f GCGTGATGTCACCATTGAAG (SEQ ID NO: 22) and galK_1142_r TATTGTTCAGCGACAGCTTG (SEQ ID NO: 23). Next, the scFv HER2 cassette (SEQ ID NO: 33, encoding SEQ ID NO: 16) bracketed by homology arms to gD was amplified by means of primers gD-34-scFvHER2-F TGAAGAAGCTGGTGGGCAGCCTGGACCAGCTGACCGACCCTCCGGGGGTCGA GAATTCCGATATCCAGAT (SEQ ID NO: 34) and gD-40-scFvHER2-R GTGATCGGGAGGCTGGGGGGCTGGAACGGGTCTGGTAGGCCCGCCTGGATGG ATCCACCGGAACCAGAGC (SEQ ID NO: 35). The recombinant genome (SEQ ID NO: 2) encodes the chimeric gD (SEQ ID NO: 3), which carries the GCN4 peptide including one downstream and one upstream Ser-Gly linker with the sequence GS in position 24 to 25 and the scFv to HER2 receptor in replacement of AA 35 to 39. The recombinant clones carrying the excision of the galK cassette and the insertion of the sequence of choice were selected on plates containing M63 medium (see above) supplemented with 1 mg/L D-biotin, 0.2% deoxy-2-galactose, 0.2% glycerol, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. Bacterial colonies were checked for the presence of sequence of choice by means of colony PCR with primers gD_ext_f TCCATACCGACCACACCGACGAATCCC (SEQ ID NO: 29) and scFv_456_r AGCTGCACAGGACAAACGGAGTGAGCCCCC (SEQ ID NO: 36).

(72) To reconstitute the recombinant virus R-87, 500 ng of recombinant BAC DNA was transfected into the Vero-GCN4R cell line and SK-OV-3 cell line by means of Lipofectamine 2000 (Life Technologies), and then grown in these cells. Virus growth was monitored by green fluorescence. The structure of the recombinants was verified by sequencing the entire gD. Virus stocks were generated in Vero-GCN4R cells and titrated in Vero-GCN4R and SK-OV-3.

(73) C) R-89

(74) Insertion of GCN4 peptide between AA 24 and 25 of HSV gD, deletion of AA 214 to 223, replaced by scFv to HER2 receptor.

(75) The inventors engineered R-89 (FIG. 1) by insertion of the sequence encoding the GCN4 peptide between AA 24 and 25 of mature gD, corresponding to AA 49 and 50 of precursor gD, prior to cleavage of the signal sequence, which encompasses AA 1-25, and by deletion of AA 214-223, replaced by scFv to HER2.

(76) The starting genome was the BAC 81, which carries GCN4 peptide between AA 24 and 25 of HSV gD, LOX-P-bracketed pBeloBAC11 and EGFP sequences inserted between U.sub.L3 and U.sub.L4 of HSV-1 genome, as described above. The engineering was performed by means of galK recombineering. Briefly, in order to insert the scFv in gD ΔAA 214-223, the galK cassette with homology arms to gD was amplified by means of primers galK_gD214_F CCTACCAGCAGGGGGTGACGGTGGACAGCATCGGGATGCTGCCCCGCTTCCC TGTTGACAATTAATCATCGGCA (SEQ ID NO: 37) and galK_gD223_R CTCGTGTATGGGGCCTTGGGCCCGTGCCACCCGGCGATCTTCAAGCTGTATCA GCACTGTCCTGCTCCTT (SEQ ID NO: 38) using pGalK as template. This cassette was electroporated in SW102 bacteria carrying the BAC 81 BG. The recombinant clones carrying the galK cassette were selected on plates containing M63 medium (15 mM (NH.sub.4).sub.250.sub.4, 100 mM KH.sub.2PO.sub.4, 1.8 μg FeSO.sub.4.H.sub.2O, adjusted to pH7) supplemented with 1 mg/L D-biotin, 0.2% galactose, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. In order to exclude galK false positive bacterial colonies, they were streaked also on MacConkey agar base plates supplemented with 1% galactose and 12 μg/ml chloramphenicol and checked by colony PCR with primer galK_827_f GCGTGATGTCACCATTGAAG (SEQ ID NO: 22) and galK_1142_r TATTGTTCAGCGACAGCTTG (SEQ ID NO: 23). Next, the scFv HER2 cassette (SEQ ID NO: 33, encoding SEQ ID NO: 16) bracketed by homology arms to gD was amplified by means of primers gD213-scFvHER2f CCTACCAGCAGGGGGTGACGGTGGACAGCATCGGGATGCTGCCCCGCTTCGA GAATTCCGATATCCAGAT (SEQ ID NO: 39) and gD224-scFvHER2r CTCGTGTATGGGGCCTTGGGCCCGTGCCACCCGGCGATCTTCAAGCTGTAGGA TCCACCGGAACCAGAGC (SEQ ID NO: 40). The recombinant genome (SEQ ID NO: 4) encodes the chimeric gD (SEQ ID NO: 5), which carries the GCN4 peptide including one downstream and one upstream Ser-Gly linker with the sequence GS between positions 24 to 25 and the scFv to HER2 receptor in replacement of AA 214 to 223. The recombinant clones carrying the excision of the galK cassette and the insertion of the sequence of choice were selected on plates containing M63 medium (see above) supplemented with 1 mg/L D-biotin, 0.2% deoxy-2-galactose, 0.2% glycerol, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. Bacterial colonies were checked for the presence of sequence of choice by means of colony PCR with primers gDintforw CCCTACAACCTGACCATCGCTTGG (SEQ ID NO: 41) and scFv_456_r AGCTGCACAGGACAAACGGAGTGAGCCCCC (SEQ ID NO: 36).

(77) To reconstitute the recombinant virus R-89, 500 ng of recombinant BAC DNA was transfected into the Vero-GCN4R cell line and SK-OV-3 cell line by means of Lipofectamine 2000 (Life Technologies), and then grown in these cells. Virus growth was monitored by green fluorescence. The structure of the recombinants was verified by sequencing the entire gD. Virus stocks were generated in Vero-GCN4R cells and titrated in Vero-GCN4R and SK-OV-3.

(78) D) R-97

(79) Insertion of scFv to HER2 receptor between AA 24 and 25 of HSV gD, deletion of AA 35-39, replaced by GCN4 peptide.

(80) The inventors engineered R-97 (FIG. 1) by insertion of the sequence encoding the scFv to HER2 receptor between AA 24 and 25 of mature gD, corresponding to AA 49 and 50 of precursor gD, prior to cleavage of the signal sequence, which encompasses AA 1-25, and by deletion of AA 35-39, replaced by GCN4 peptide.

(81) The starting genome was the BAC LM55, which carries LOX-P-bracketed pBeloBAC11 and EGFP sequences inserted between U.sub.L3 and U.sub.L4 of HSV-1 genome (Menotti et al., 2008). The engineering was performed by means of galK recombineering. Briefly, in order to insert the scFv in gD, the galK cassette was inserted between AA 24 and 25, as described above in R-81. Next, the scFv HER2 cassette (SEQ ID NO: 33, encoding SEQ ID NO: 16) bracketed by homology arms to gD was amplified by means of primers gD24-scFvHer2-F CTCTCAAGATGGCCGACCCCAATCGCTTTCGCGGCAAAGACCTTCCGGTCGAG AATTCCGATATCCAGATG (SEQ ID NO: 42) and gD25-scFvHer2-R TGGATGTGGTACACGCGCCGGACCCCCGGAGGGTCGGTCAGCTGGTCCAGGG ATCCACCGGAACCAGAGC (SEQ ID NO: 43). The recombinant genome (BAC 91) encodes the chimeric gD, which carries the scFv to HER2 receptor between AA 24 to 25. The recombinant clones carrying the excision of the galK cassette and the insertion of the sequence of choice were selected on plates containing M63 medium (see above) supplemented with 1 mg/L D-biotin, 0.2% deoxy-2-galactose, 0.2% glycerol, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. Bacterial colonies were checked for the presence of sequence of choice by means of colony PCR with primers gD_ext_f TCCATACCGACCACACCGACGAATCCC (SEQ ID NO: 29) and scFv_456_r AGCTGCACAGGACAAACGGAGTGAGCCCCC (SEQ ID NO: 36).

(82) Then, in order to insert the GCN4 peptide in gD Δ AA 35-39, the galK cassette with homology arms to gD was amplified by means of primers gD35-galK-F GCTCTGGTTCCGGTgGaTCCCTGGACCAGCTGACCGACCCTCCGGGGGTCCCT GTTGACAATTAATCATCGGCA (SEQ ID NO: 47) and gD39-galK-R GTGATCGGGAGGCTGGGGGGCTGGAACGGGTCTGGTAGGCCCGCCTGGATTC AGCACTGTCCTGCTCCTT (SEQ ID NO: 48) using pGalK as template. This cassette was electroporated in SW102 bacteria carrying the BAC 91 BG. The recombinant clones carrying the galK cassette were selected on plates containing M63 medium (15 mM (NH.sub.4).sub.250.sub.4, 100 mM KH.sub.2PO.sub.4, 1.8 μg FeSO.sub.4.H.sub.2O, adjusted to pH7) supplemented with 1 mg/L D-biotin, 0.2% galactose, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. In order to exclude galK false positive bacterial colonies, they were streaked also on MacConkey agar base plates supplemented with 1% galactose and 12 μg/ml chloramphenicol and checked by colony PCR with primer galK_827_f GCGTGATGTCACCATTGAAG (SEQ ID NO: 22) and galK_1142_r TATTGTTCAGCGACAGCTTG (SEQ ID NO: 23). Next, the GCN4 peptide cassette (SEQ ID NO: 24, encoding SEQ ID NO: 12) with the downstream and upstream Ser-Gly linkers bracketed by homology arms to gD was amplified by means of primers gD35-GCN4-F GCTCTGGTTCCGGTgGaTCCCTGGACCAGCTGACCGACCCTCCGGGGGTCGGA TCCAAGAACTACCACCTGGAGAACGAGGTGGCCAGACTGAAGAAGCTGGTGGG CAGC (SEQ ID NO: 49) and gD39-GCN4-R GTGATCGGGAGGCTGGGGGGCTGGAACGGGTCTGGTAGGCCCGCCTGGATGC TGCCCACCAGCTTCTTCAGTCTGGCCACCTCGTTCTCCAGGTGGTAGTTCTTGG ATCC (SEQ ID NO: 50). The recombinant genome (SEQ ID NO: 6) encodes the chimeric gD (SEQ ID NO: 7), which carries the scFv to HER2 receptor between AA 24 to 25 and the GCN4 peptide including one downstream and one upstream Ser-Gly linker with the sequence GS in replacement of AA 35 to 39. The recombinant clones carrying the excision of the galK cassette and the insertion of the sequence of choice were selected on plates containing M63 medium (see above) supplemented with 1 mg/L D-biotin, 0.2% deoxy-2-galactose, 0.2% glycerol, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. Bacterial colonies were checked for the presence of sequence of choice by means of colony PCR with primers scFv4D5 651_f GGACACTGCCGTCTATTATTGTAGCCGCT (SEQ ID NO: 51) and primer gDintrev CCAGTCGTTTATCTTCACGAGCCG (SEQ ID NO: 52). To reconstitute the recombinant virus R-97, 500 ng of recombinant BAC DNA was transfected into the Vero-GCN4R cell line and SK-OV-3 cell line by means of Lipofectamine 2000 (Life Technologies), and then grown in these cells. Virus growth was monitored by green fluorescence. The structure of the recombinants was verified by sequencing the entire gD.

(83) E) R-99

(84) Insertion of scFv to HER2 receptor between AA 24 and 25 of HSV gD, deletion of AA 214-223, replaced by GCN4 peptide.

(85) The inventors engineered R-99 (FIG. 1) by insertion of the sequence encoding the scFv to HER2 receptor between AA 24 and 25 of mature gD, corresponding to AA 49 and 50 of precursor gD, prior to cleavage of the signal sequence, which encompasses AA 1-25, and by deletion of AA 214-223, replaced by GCN4 peptide.

(86) The starting genome was the BAC 91, which carries the scFv to HER2 receptor between AA 24 to 25 of gD, LOX-P-bracketed pBeloBAC11 and EGFP sequences inserted between U.sub.L3 and U.sub.L4 of HSV-1 genome, whose construction was described above. In order to insert the GCN4 peptide in gD Δ AA 214-223, the galK cassette with homology arms to gD was amplified by means of primers galK_gD214_F CCTACCAGCAGGGGGTGACGGTGGACAGCATCGGGATGCTGCCCCGCTTCCC TGTTGACAATTAATCATCGGCA (SEQ ID NO: 37) and galK_gD223_R CTCGTGTATGGGGCCTTGGGCCCGTGCCACCCGGCGATCTTCAAGCTGTATCA GCACTGTCCTGCTCCTT (SEQ ID NO: 38) using pGalK as template. This cassette was electroporated in SW102 bacteria carrying the BAC 91 BG. The recombinant clones carrying the galK cassette were selected on plates containing M63 medium (15 mM (NH.sub.4).sub.250.sub.4, 100 mM KH.sub.2PO.sub.4, 1.8 μg FeSO.sub.4.H.sub.2O, adjusted to pH7) supplemented with 1 mg/L D-biotin, 0.2% galactose, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. In order to exclude galK false positive bacterial colonies, they were streaked also on MacConkey agar base plates supplemented with 1% galactose and 12 μg/ml chloramphenicol and checked by colony PCR with primer galK_827_f GCGTGATGTCACCATTGAAG (SEQ ID NO: 22) and galK_1142_r TATTGTTCAGCGACAGCTTG (SEQ ID NO: 23). Next, the GCN4 peptide cassette (SEQ ID NO: 24, encoding SEQ ID NO: 12) with the downstream and upstream Ser-Gly linkers bracketed by homology arms to gD was amplified by means of primers gD213-GCN4-F CCTACCAGCAGGGGGTGACGGTGGACAGCATCGGGATGCTGCCCCGCTTCGG ATCCAAGAACTACCACCTGGAGAACGAGGTGGCCAGACTGAAGAAGCTGGTGG GCAGC (SEQ ID NO: 44) and gD224-GCN4-R CTCGTGTATGGGGCCTTGGGCCCGTGCCACCCGGCGATCTTCAAGCTGTAGCT GCCCACCAGCTTCTTCAGTCTGGCCACCTCGTTCTCCAGGTGGTAGTTCTTGGA TCC (SEQ ID NO: 45). The recombinant genome (SEQ ID NO: 8) encodes the chimeric gD (SEQ ID NO: 9), which carries the scFv to HER2 receptor between AA 24 to 25 and the GCN4 peptide including one downstream and one upstream Ser-Gly linker with the sequence GS in replacement of AA 214 to 223. The recombinant clones carrying the excision of the galK cassette and the insertion of the sequence of choice were selected on plates containing M63 medium (see above) supplemented with 1 mg/L D-biotin, 0.2% deoxy-2-galactose, 0.2% glycerol, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. Bacterial colonies were checked for the presence of sequence of choice by means of colony PCR with primers gDintforw CCCTACAACCTGACCATCGCTTGG (SEQ ID NO: 41) and HSV_139688_r CCGACTTATCGACTGTCCACCTTTCCC (SEQ ID NO: 46).

(87) To reconstitute the recombinant virus R-99, 500 ng of recombinant BAC DNA was transfected into the Vero-GCN4R cell line and SK-OV-3 cell line by means of Lipofectamine 2000 (Life Technologies), and then grown in these cells. Virus growth was monitored by green fluorescence. The structure of the recombinants was verified by sequencing the entire gD. Virus stocks were generated in Vero-GCN4R cells and titrated in Vero-GCN4R and SK-OV-3.

(88) F) R-99-2

(89) Insertion of scFv to HER2 receptor between AA 24 and 25 of HSV gD, deletion of AA 219-223, replaced by GCN4 peptide.

(90) The inventors engineered R-99-2 (FIG. 1) by insertion of the sequence encoding the scFv to HER2 receptor between AA 24 and 25 of mature gD, corresponding to AA 49 and 50 of precursor gD, prior to cleavage of the signal sequence, which encompasses AA 1-25, and by deletion of AA 219-223, replaced by GCN4 peptide.

(91) The starting genome was the BAC 91, which carries the scFv to HER2 receptor between AA 24 to 25 of gD, LOX-P-bracketed pBeloBAC11 and EGFP sequences inserted between U.sub.L3 and U.sub.L4 of HSV-1 genome, whose construction was described above. In order to insert the GCN4 peptide in gD Δ AA 219-223, the galK cassette with homology arms to gD was amplified by means of primers galK_gD214_F CCTACCAGCAGGGGGTGACGGTGGACAGCATCGGGATGCTGCCCCGCTTCCC TGTTGACAATTAATCATCGGCA (SEQ ID NO: 37) and galK_gD223_R CTCGTGTATGGGGCCTTGGGCCCGTGCCACCCGGCGATCTTCAAGCTGTATCA GCACTGTCCTGCTCCTT (SEQ ID NO: 38) using pGalK as template. This cassette was electroporated in SW102 bacteria carrying the BAC 91 BG. The recombinant clones carrying the galK cassette were selected on plates containing M63 medium (15 mM (NH.sub.4).sub.250.sub.4, 100 mM KH.sub.2PO.sub.4, 1.8 μg FeSO.sub.4.H.sub.2O, adjusted to pH7) supplemented with 1 mg/L D-biotin, 0.2% galactose, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. In order to exclude galK false positive bacterial colonies, they were streaked also on MacConkey agar base plates supplemented with 1% galactose and 12 μg/ml chloramphenicol and checked by colony PCR with primer galK_827_f GCGTGATGTCACCATTGAAG (SEQ ID NO: 22) and galK_1142_r TATTGTTCAGCGACAGCTTG (SEQ ID NO: 23). Next, the GCN4 peptide cassette (SEQ ID NO: 24, encoding SEQ ID NO: 12) with the downstream and upstream Ser-Gly linkers bracketed by homology arms to gD was amplified by means of primers gD219-GCN4-F CCTACCAGCAGGGGGTGACGGTGGACAGCATCGGGATGCTGCCCCGCTTCATC CCCGAGAACCAGCGCGGATCCAAGAACTACCACCTGGAGAACGAGGTGGCCA GACTGAAGAAGCTGG (SEQ ID NO: 53) and gD224-GCN4-R CTCGTGTATGGGGCCTTGGGCCCGTGCCACCCGGCGATCTTCAAGCTGTAGCT GCCCACCAGCTTCTTCAGTCTGGCCACCTCGTTCTCCAGGTGGTAGTTCTTGGA TCC (SEQ ID NO: 45). The recombinant genome (SEQ ID NO: 10) encodes the chimeric gD (SEQ ID NO: 11), which carries the scFv to HER2 receptor between AA 24 to 25 and the GCN4 peptide including one downstream and one upstream Ser-Gly linker with the sequence GS in replacement of AA 219 to 223. The recombinant clones carrying the excision of the galK cassette and the insertion of the sequence of choice were selected on plates containing M63 medium (see above) supplemented with 1 mg/L D-biotin, 0.2% deoxy-2-galactose, 0.2% glycerol, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. Bacterial colonies were checked for the presence of sequence of choice by means of colony PCR with primers gDintforw CCCTACAACCTGACCATCGCTTGG (SEQ ID NO: 41) and HSV_139688_r CCGACTTATCGACTGTCCACCTTTCCC (SEQ ID NO: 46)

(92) To reconstitute the recombinant virus R-99-2, 500 ng of recombinant BAC DNA was transfected into the Vero-GCN4R cell line and SK-OV-3 cell line by means of Lipofectamine 2000 (Life Technologies), and then grown in these cells. Virus growth was monitored by green fluorescence. The structure of the recombinants was verified by sequencing the entire gD.

Example 2. Double Tropism of R-87 for Vero-GCN4R and for the HER-2 Positive SK-OV-3 and J-HER2 Cells

(93) It has previously been shown that the insertion of scFv-HER2 in gD confers to the recombinant virus R-LM113 the ability to enter cells through the HER2 receptor, and that R-LM113 is detargeted from the natural gD receptors nectin-1 and HVEM, because of the deletion of the gD region between AA 6-38.

(94) To verify whether the insertion of the GCN4 peptide between AA 24 and 25 of gD enables R-87 to infect the Vero-GCN4R cells, the inventors made use of Vero-GCN4R cell line and, for comparison, its wt counterpart, wt-Vero. To verify that R-87 is able to infect through the HER2 receptor, the inventors made use of the J-HER2 cells, which express HER2 as the sole receptor, and of the HER2-positive cancer cells, SK-OV-3 cells. To verify that R-87 is detargeted from nectin-1 and HVEM, the inventors made use of J-nectin-1 and J-HVEM, which express only the indicated receptor. Cells were infected with R-87 grown in SK-OV-3 (FIG. 2 A) or in Vero-GCN4R (FIG. 2 B) cells. Where indicated, infection was carried out in the presence of MAb to HER2, named Herceptin, at the concentration of 28 μg/ml. Infection was carried out at 1 PFU/cell, and was monitored 24 hours later by fluorescence microscopy. As shown in FIGS. 2 A and B, R-87 infected Vero-GCN4R, J-HER2, and SK-OV-3 cells. R-87 also infected the wt-Vero cells, as expected given that these cells express the simian ortholog of HER-2. Infection of J-HER2, SK-OV-3, wt-Vero was inhibited by Herceptin, indicating that it occurred through HER2. By contrast infection of Vero-GCN4R was not inhibited by Herceptin, indicating that it occurred through the GCN4 peptide and not through HER2. The pattern of infection was undistinguishable whether the R-87 was grown in SK-OV-3 or Vero-GCN4R cells, clearly demonstrating that infection specificities of R-87 was not modified depending on whether it was grown in either one or the other cell line.

Example 3. Double Tropism of R-89 for Vero-GCN4R and for the HER-2 Positive SK-OV-3 and J-HER2 Cells

(95) To verify whether the insertion of the GCN4 peptide between AA 24 and 25 of gD enables R-89 to infect the Vero-GCN4R cells, the inventors made use of Vero-GCN4R cell line and, for comparison, its wt counterpart, wt-Vero. To verify that R-89 is able to infect through the HER2 receptor, the inventors made use of the J-HER2 cells, which express HER2 as the sole receptor, and of the HER2-positive cancer cells, SK-OV-3 cells. To verify that R-89 is detargeted from nectin-1 and HVEM, the inventors made use of J-nectin-1 and J-HVEM, which express only the indicated receptor. Cells were infected with R-89 grown in SK-OV-3 (FIG. 3 A) or in Vero-GCN4R (FIG. 3 B) cells. Where indicated, infection was carried out in the presence of MAb to HER2, named Herceptin, at the concentration of 28 μg/ml. Infection was carried out at 1 PFU/cell, and was monitored 24 hours later by fluorescence microscopy. As shown in FIGS. 3 A and B, R-89 infected Vero-GCN4R, J-HER2, and SK-OV-3 cells. R-89 infected poorly the wt-Vero cells and J-HER2. Infection of SK-OV-3, wt-Vero and J-HER2 was inhibited by Herceptin, indicating that it occurred through HER2. By contrast infection of Vero-GCN4R was not inhibited by Herceptin, indicating that it occurred through the GCN4 peptide and not through HER2. The pattern of infection was undistinguishable whether the R-89 was grown in SK-OV-3 or Vero-GCN4R cells, clearly demonstrating that infection specificities of R-89 was not modified depending on whether it was grown in either one or the other cell line.

Example 4. Double Tropism of R-97 for Vero-GCN4R and for the HER-2 Positive SK-OV-3 and J-HER2 Cells

(96) To verify whether the insertion of the GCN4 peptide instead of AA 35-39 of gD enables R-97 to infect the Vero-GCN4R cells, the inventors made use of Vero-GCN4R cell line and, for comparison, its wt counterpart, wt-Vero. To verify that R-97 is able to infect through the HER2 receptor, the inventors made use of the J-HER2 cells, which express HER2 as the sole receptor, and of the HER2-positive cancer cells, SK-OV-3 cells. To verify that R-97 is detargeted from nectin-1 and HVEM, the inventors made use of J-nectin-1 and J-HVEM, which express only the indicated receptor. Cells were infected with R-97 grown in SK-OV-3 cells. Where indicated, infection was carried out in the presence of MAb to HER2, named Herceptin, at the concentration of 28 μg/ml. Infection was carried out at 1 PFU/cell, and was monitored 24 hours later by fluorescence microscopy. As shown in FIG. 4, R-97 infected Vero-GCN4R, J-HER2, and SK-OV-3 cells. R-97 also infected the wt-Vero cells, as expected given that these cells express the simian ortholog of HER-2. Infection of J-HER2, SK-OV-3, wt-Vero was inhibited by Herceptin, indicating that it occurred through HER2. By contrast infection of Vero-GCN4R was not inhibited by Herceptin, indicating that it occurred through the GCN4 peptide and not through HER2.

Example 5. Double Tropism of R-99 for Vero-GCN4R and for the HER-2 Positive SK-OV-3 and J-HER2 Cells

(97) To verify whether the insertion of the GCN4 peptide instead of AA 214-223 of gD enables R-99 to infect the Vero-GCN4R cells, the inventors made use of Vero-GCN4R cell line and, for comparison, its wt counterpart, wt-Vero. To verify that R-99 is able to infect through the HER2 receptor, the inventors made use of the J-HER2 cells, which express HER2 as the sole receptor, and of the HER2-positive cancer cells, SK-OV-3 cells. To verify that R-99 is detargeted from nectin-1 and HVEM, the inventors made use of J-nectin-1 and J-HVEM, which express only the indicated receptor. Cells were infected with R-99 grown in SK-OV-3 (FIG. 5 A) or in Vero-GCN4R (FIG. 5 B) cells. Where indicated, infection was carried out in the presence of MAb to HER2, named Herceptin, at the concentration of 28 μg/ml. Infection was carried out at 1 PFU/cell, and was monitored 24 hours later by fluorescence microscopy. As shown in FIG. 5 A, R-99 infected Vero-GCN4R, J-HER2, and SK-OV-3 cells. R-99 also infected the wt-Vero cells, as expected given that these cells express the simian ortholog of HER-2. Infection of J-HER2, SK-OV-3, wt-Vero was inhibited by Herceptin, indicating that it occurred through HER2. By contrast infection of Vero-GCN4R was not inhibited by Herceptin, indicating that it occurred through the GCN4 peptide and not through HER2.

Example 6. Double Tropism of R-99-2 for Vero-GCN4R and for the HER-2 Positive SK-OV-3 and J-HER2 Cells

(98) To verify whether the insertion of the GCN4 peptide instead of AA 219-223 of gD enables R-99-2 to infect the Vero-GCN4R cells, the inventors made use of Vero-GCN4R cell line and, for comparison, its wt counterpart, wt-Vero. To verify that R-99-2 is able to infect through the HER2 receptor, the inventors made use of the J-HER2 cells, which express HER2 as the sole receptor, and of the HER2-positive cancer cells, SK-OV-3 cells. To verify that R-99-2 is detargeted from nectin-1 and HVEM, the inventors made use of J-nectin-1 and J-HVEM, which express only the indicated receptor. Cells were infected with R-99-2 grown in SK-OV-3 cells (FIG. 6). Where indicated, infection was carried out in the presence of MAb to HER2, named Herceptin, at the concentration of 28 μg/ml. Infection was carried out at 1 PFU/cell, and was monitored 24 hours later by fluorescence microscopy. As shown in FIG. 6, R-99-2 infected Vero-GCN4R, J-HER2, and SK-OV-3 cells. R-99-2 also infected the wt-Vero cells, as expected given that these cells express the simian ortholog of HER-2. Infection of J-HER2, SK-OV-3, wt-Vero was inhibited by Herceptin, indicating that it occurred through HER2. By contrast infection of Vero-GCN4R was not inhibited by Herceptin, indicating that it occurred through the GCN4 peptide and not through HER2.

Example 7. Extent of R-87, R-89, and R-99 Replication in SK-OV-3 (A) and in Vero-GCN4R (B) Cells, as Compared to that of the Recombinant R-LM113 which Carries the scFv to HER2 in gD, in Place of Deletion Between AA 6-38

(99) The inventors compared the extent of replication of R-87, and R-89, R-99 to that of R-LM113 in SK-OV-3 (FIG. 7 A) or in Vero-GCN4R cells (FIG. 7 B). R-LM113 virus carries the scFv-HER2 inserted in gD in place of sequences 6-38 and does not carry the GCN4 peptide. SK-OV-3 (A) or Vero-GCN4R (B) cells were infected at MOI 0.1 PFU/cell, with the indicated viruses (inoculum titrated in the respective cell line), for 90 min at 37° C. Unabsorbed virus was inactivated by means of an acidic wash (40 mM citric acid, 10 mM KCl, 135 mM NaCl [pH 3]). Replicate cultures were frozen at the indicated times (24 and 48 h) after infection, and the progeny was titrated in SK-OV-3 cells. It can be seen from FIGS. 7 A and B that R-87 grew to similar titers as R-LM113. In contrast, R-89 grew about one-two log less than R-87 at 24 h. R-99 grew at intermediate levels.

(100) The inventors measured the extent of progeny virus release to the extracellular medium of SK-OV-3 (C) or Vero-GCN4R (D) cells, infected at 0.1 PFU/cell as experiment shown in panels A and B, respectively. At 48 h after infection, replicate cultures were frozen as whole lysates plus medium (intra+extra). Alternatively, medium (extra) and cell-associated (intra) fractions were separated and frozen. Progeny virus was titrated in SK-OV-3 cells. It can be seen that the efficiency of progeny release in the extracellular medium was similar for all three viruses.

Example 8. Plating Efficiency of R-87, R-89, R-97, R-99 and R-99-2 in Different Cell Lines

(101) The inventors compared the ability of R-87, R-89, R-97, R-99 and R-99-2 to form plaques in different cell lines, with respect to plaque size (FIG. 8 A), and to number of plaques (FIG. 8 B). (A) Replicate aliquots of R-87, R-89, R-97, R-99 and R-99-2 were plated in Vero-GCN4R, wt-Vero, SK-OV-3 cells. Typical examples of relative plaque size of R-87, R-89, R-97, R-99 and R-99-2 in different cells are shown. By this parameter R-87 and R-89 exhibited the largest plaques size in Vero-GCN4R, as well as in SK-OV-3 cells. (B) Replicate aliquots of R-87, R-89, R-97, R-99 and R-99-2 were plated in Vero-GCN4R, wt-Vero, SK-OV-3 cells. The number of plaques was scored 3 days later. For each virus, the number of plaques scored in a given cell line was expressed relative to the number of plaques scored in SK-OV-3 cells, made equal to 100. It can be seen that R-87, R-89, R-97, R-99 and R-99-2 exhibited a high number of plaques in Vero-GCN4R cells.

Example 9

(102) The SK-OV-3 (A) and Vero-GCN4R (B) were seeded in 96 well plates 8×10.sup.3 cells/well, and exposed to R-87, R-89, R-99, and R-LM113 for comparison, or mock-infected for 90 min at 37° C. The input multiplicity of infection (as titrated in the correspondent cell line) was 3 PFU/cell for the SK-OV-3 and Vero-GCN4R. Alamar-Blue (10 μl/well, Life Technologies) was added to the culture media at the indicated days after infection, and incubated for 4 h at 37° C. prior to plates reading. Plates were read at 560 and 600 nm with GloMax Discover System (Promega). For each time point, cell viability was expressed as the percentage of Alamar-Blue reduction in infected versus uninfected cells, excluding for each samples the contribution of medium alone. All viruses caused similar cytotoxicity to SK-OV-3 and to Vero-GCN4R cells, except for R-LM113 which was much less cytotoxic to Vero-GCN4R cells, in agreement with its lack of retargeting to this cell.

REFERENCES

(103) Arndt K. and Fin G. R., PNAS 1986, 83, 8516-8520 Douglas J. T. et al., Nat Biotechnol, 1999, 17, 470-475 Florence G. et al., Virology: A Laboratory Manual, 1992, ISBN-13: 978-0121447304 Gatta V. et al., PLOS Pathogens, 2015, DOI: 10.1371/journal.ppat.1004907 Hope I. A and Struhl K., EMBO J, 1987, 6, 2781-2784 Josan J. S. et al., Bioconjug Chem, 2011, 22, 1270-1278; Karlin S. and Altschul S. F., PNAS, 1990, 87, 2264-2268 Karlin S. and Altschul S. F., PNAS, 1993, 90, 5873-5877 Liu B. L. et al., Gene Ther, 2003, 10, 292-303 Menotti L et al. J Virol. 2008, 82, 10153-10161, DOI: 10.1128/JVI.01133-08. Epub 2008 Aug. 6 Nakamura T. et al., Nat Biotechnol, 2005, 23, 209-214. Epub 2005 Jan. 30 Needleman S. B. and Wunsch C. D., J Mol Biol, 1970, 48, 443-453 Pearson W. R. and Lipman D. J., PNAS, 1988, 85, 2444-2448 Peterson R. B. and Goyal S. M., Comp Immunol Microbiol Infect Dis. 1988, 11, 93-98 Shallal H. M. et al., Bioconjug Chem, 2014, 25, 393-405 Sandri-Goldin R. M. et al., Alpha Herpesviruses: Molecular and Cellular Biology, Caister Academic Press, 2006 Smith T. F. and Waterman M. S., Add APL Math, 1981, 2, 482-489 Uchida et al, Mol Ther 2013, 21, 561-569 Xhou G and Roizman, B, J Virol, 2005, 79, 5272-77 Xu L. et al., PNAS, 2012, 109, 21295-21300