Expansion and differentiation of inner ear supporting cells and methods of use thereof

Abstract

This disclosure relates to methods for expanding inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) and differentiating inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) to inner ear hair cells (e.g., atonal homolog 1 (Atoh1)+ inner ear hair cells) and the use of the inner hear supporting cells and hair cells, e.g., for identifying candidate therapeutic compounds for the treatment of hearing loss and balance loss. Additionally, the methods described herein can be used in the treatment of a subject having hearing loss and balance loss that would benefit from increased proliferation and differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells).

Claims

1. A method of treating a subject having hearing loss or balance loss, the method comprising administering to the subject in need thereof a therapeutically effective amount of a protein degradation inhibitor and a therapeutically effective amount of a Notch signaling inhibitor, wherein the protein degradation inhibitor is not Epigallocatechin-3-gallate.

2. The method of claim 1, wherein the protein degradation inhibitor and the Notch inhibitor are administered systemically or to the ear of the subject, preferably transtympanically to the middle ear of the subject.

3. The method of claim 1, wherein the subject has hearing loss.

4. The method of claim 3, wherein the hearing loss is sensorineural hearing loss.

5. The method of claim 3, wherein the hearing loss is the result of a genetic or congenital defect, trauma, aging, or chemical-induced ototoxicity.

6. The method of claim 1, wherein the subject is a human.

7. The method of claim 1, wherein the protein degradation inhibitor is selected from the group consisting of MG132, MG262, MG115, Z-Leu-Leu-Phe-CHO, N-Acetyl-leucyl-leucyl-norleucinal, N-acetyl-leucyl-leucyl-methional, N-benzyloxycarbonyl-isoleucyl-γ-t-butyl-glutamyl-alanyl-leucinal, N-benzyloxycarbonyl-leucyl-leucyl-leucinal, N-benzyloxycarbonyl-leucyl-leucyl-tyrosyl α-keto aldehyde, N-benzyloxycarbonyl-leucyl-leucyl-phenylalanal, N-benzyloxycarbonyl-leucyl-leucyl-leucyl boronic acid, Bortezomib, Lactacystin, Disulfiram, Salinosporamide A, Carfilzomib, epoxomicin, Ixazomib, ixazomib citrate, VLX1500 (b-AP15), clasto-Lactacystin beta Lactone, Gliotoxin, AM 114 (3,5-Bis-[benzylidene-4-boronic acid]-1-methylpiperidin-4-one), PSI (N-[(Phenylmethoxy)carbonyl]-L-isoleucyl-L-α-glutamyl-tert-butyl ester-N-[(1S)-1-formyl-3-methylbutyl]-alaninamide), Oprozomib, Delanzomib, BI8622, and BI8626.

8. The method of claim 1, wherein the Notch signaling inhibitor is selected from the group consisting of LY411575, L-685458, DBZ (Dibenzazepine), MRK560 (N-[cis-4-[(4-Chlorophenyl)sulfonyl]-4-(2,5-difluorophenyl)cyclohexyl]-1,1,1-trifluoromethanesulfonamide), MRK-003, MK-0752 (3-(((1r,4s)-4-(4-chlorophenylsulfonyl)-4-(2,5-difluorophenyl)cyclohexyl)propanoic acid), Compound W (3,5-Bis(4-nitrophenoxy)benzoic acid), Compound E (GSI-XXI), BMS 2289948, BMS-433796, IN973, Flurbiprofen, JLK2, JLK4, JLK6, JLK7, Begacestat, DFK167, and PF-0308414.

9. The method of claim 2, wherein the protein degradation inhibitor and the Notch inhibitor are administered transtympanically to the middle ear of the subject.

Description

DESCRIPTION OF DRAWINGS

(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

(2) FIG. 1 is a timeline for the screening of Lgr5+ cells for drugs affecting proliferation.

(3) FIG. 2 is a timeline for the screening of Lgr5+ cells for drugs affecting differentiation.

(4) FIG. 3 is a graph depicting the percent of Lgr5-GFP+ cells from a screen for drugs that affect the proliferation of Lgr5-GFP cells. See Table 1 for a key to the compounds (WJM=CHIR 99021 and valproic acid).

(5) FIG. 4 is a graph depicting the number of Lgr5-GFP+ cells from a screen for drugs affecting proliferation of Lgr5-GFP cells. See Table 1 for a key to the compounds (WJM=CHIR 99021 and valproic acid).

(6) FIG. 5 is a graph depicting the percent of Atoh1-GFP+ cells from a screen for drugs that affect the differentiation of Atoh1-GFP+ cells. See Table 1 for a key to the compounds (WJM=CHIR 99021 and valproic acid).

(7) FIG. 6 is a schematic illustration of a plasmid for use in generating transgenic mice, in which mCherry fluorescent protein is under the control of an Atoh1 enhancer.

(8) FIG. 7 is structures of specific screening compounds Compound A (see WO 2009/100438), Compound B (see WO 2009/100438), Compound C (see WO 2009/100438), and BI8622 (from Peter et al., EMBO Mol Med. 2014 December; 6(12): 1525-1541).

DETAILED DESCRIPTION

(9) Hair cells transduce sound via an apical stereociliary bundle that couples vibration-induced displacement to ion-channel gating. Damage and death of cochlear hair cells, which occurs in a high percentage of the population, is a cause of widespread hearing loss due to the lack of a mechanism for hair cell replacement. And damage and death of vestibular hair cells can result in balance loss or impairment.

(10) Lgr5, an epithelial stem cell marker, was recently shown to be expressed in supporting cells of the inner ear (e.g., cochlear supporting cells) that surround the hair cells, and the Lgr5-expressing cells could be induced to proliferate when stimulated by Wnt in the normally post-mitotic cochlear sensory epithelium. Indeed, consistent with a progenitor role, supporting cells that expressed Lgr5 gave rise to new Lgr5-positive cells by propagation and to hair cells that were Lgr5-negative, whereas supporting cells that did not express this receptor did not give rise to hair cells. Consistent with its role in upstream regulation of transcription factor Atoh1, which is a master regulator of hair cell differentiation, upregulation of Wnt also increased hair cell differentiation. This combination of the ability to divide in response to Wnt signaling and the potency to differentiate into hair cells suggested that Lgr5 cells were acting as progenitor cells of the cochlear epithelium. Lgr5+ cells showed a limited capacity to regenerate spontaneously after damage, but their ability to divide and differentiate in response to Wnt stimulation and transdifferentiate in response to Notch inhibition was limited and only observed in neonatal animals.

(11) Although these data supported a role of Lgr5+ cells as inner ear (e.g., cochlear) progenitor cells, and some expansion of the cells could be achieved by propagation as cochlear spheres, the heterogeneous cell populations suggested that other signaling pathways may be involved in stem cell expansion and hair cell differentiation. Furthermore, spontaneous regeneration capacity was lost after the first postnatal week, and changes in gene expression of these progenitors resulted in a loss in sphere-forming capacity in the adult mouse cochlea. Efforts to replace hair cells have concentrated on supporting cell transdifferentiation to hair cells, but regenerating a functional cochlea or vestibule would require both stimulating these cells to divide and differentiating them to hair cells. Here, by employing a screen, we identified pathways and small molecules that promoted the proliferation and/or differentiation of inner ear supporting cells (e.g., Lgr5-expressing inner ear supporting cells of the cochlea or the vestibule). These expanded inner ear cells can be used, e.g., for identifying compounds that can be used to treat hearing loss in mammals. Expanded inner ear cells (e.g., Lgr5+ inner ear cells) from transgenic animals comprising reporter genes for inner ear supporting cell and hair cell markers (e.g., Lgr5 and Atoh1 reporter genes, respectively) are particularly useful.

(12) Compounds that Promote Proliferation and/or Differentiation of Inner Ear Supporting Cells

(13) Examples of compounds that promote the proliferation and expansion of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) include, but are not limited to, a retinoid receptor signaling activator (see, e.g., Table K); a Wnt signaling activator set forth in Table A; a bone morphogenetic protein (BMP) signaling inhibitor set forth in Table B; a cyclin-dependent kinase (CDK) activator set forth in Table C; an E box-dependent transcriptional activator set forth in Table D; a Notch signaling activator set forth in Table E; a histone deacetylase (HDAC) inhibitor set forth in Table F; a protein degradation inhibitor set forth in Table G; a PI3K-Akt signaling inhibitor set forth in Table H; and a cAMP response element binding protein (CREB) activator set forth in Table I.

(14) Examples of compounds that promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., atonal homolog 1 (Atoh1)+ inner ear hair cells) include, but are not limited to, a retinoid receptor signaling activator (see, e.g., Table K); a Wnt signaling activator set forth in Table A; a BMP signaling inhibitor set forth in Table B; a CDK activator set forth in Table C; an E box-dependent transcriptional activator set forth in Table D; an HDAC inhibitor set forth in Table F; a protein degradation inhibitor set forth in Table G; a PI3K-Akt signaling inhibitor set forth in Table H; a CREB activator set forth in Table I; and a Notch signaling inhibitor set forth in Table J.

(15) A number of compounds that support or promote the proliferation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) and/or promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cell) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells) are set forth in Table 1.

(16) A number of compounds that support or promote the proliferation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) are described herein, and include one or more of TTNPB, Compound A, Compound B, Compound C, 1-Azakenpaullone, BIO, WAY-316606, LDN-193189, and Alsterpaullone.

(17) A number of compounds that promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cell) into to inner ear hair cells (e.g., Atoh1+ inner ear hair cells) are described herein, and include one or more of vorinostat, Compound A, Compound B, Compound C, 1-Azakenpaullone, BIO, WAY-262611, NP031112, MG-132, IM-12, Trichostatin A, HLY78, and PF03084014.

(18) In some embodiments of the invention, derivatives of the compounds listed in Tables A-K may also be used to promote the proliferation and/or expansion of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) or to promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells). A derivative of a compound listed in Tables A-K is a small molecule that differs in structure from the parent compound, but retains the ability to promote the proliferation and expansion of to inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) or to promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells). A derivative of a compound may change its interaction with certain other molecules or proteins relative to the parent compound. A derivative of a compound may also include a salt, an adduct, or other variant of the parent compound. In some embodiments of the invention, any derivative of a compound described herein (e.g., any one compound of the compounds listed in Tables A-K) may be used instead of the parent compound. In some embodiments, any derivative of a compound listed in Tables A-I and K may be used in a method of producing an expanded population of inner ear supporting cells. In some embodiments, any derivative of a compound listed in Tables A-D and F-K may be used in a method of promoting differentiation of a population of inner ear supporting cells into a population of inner ear hair cells.

(19) TABLE-US-00001 TABLE A Compound Target CHIR-98023 GSK-3β CHIR-99021 GSK-3β CHIR-99030 GSK-3β Hymenialdisine GSK-3β debromohymeialdisine GSK-3β dibromocantherelline GSK-3β Meridianine A GSK-3β alsterpaullone GSK-3β cazapaullone GSK-3β Aloisine A GSK-3β NSC 693868 GSK-3β (1H-Pyrazolo[3,4-b]quinoxalin-3-amine) Indirubin-3′-oxime GSK-3β (Indirubin-3′-monoxime; 3-[1,3-Dihydro- 3-(hydroxyimino)-2H-indol-2-ylidene]- l,3-dihydro-2H-indol-2-one) A 1070722 GSK-3β (1-(7-Methoxyquinolin-4-yl)-3-[6- (trifluoromethyl)pyridin-2-yl]urea) L803 GSK-3β L803-mts GSK-3β TDZD8 GSK-3β NP00111 GSK-3β HMK-32 GSK-3β Manzamine A GSK-3β Palinurin GSK-3β Tricantin GSK-3β IM-12 GSK-3β (3-(4-Fluorophenylethylamino)-1-methyl- 4-(2-methyl-1H-indol-3-yl)-1H-pyrrole- 2,5-dione) NP031112 GSK-3β NP00111 GSK-3β NP031115 GSK-3β VP 2.51 GSK-3β VP2.54 GSK-3β VP 3.16 GSK-3β VP 3.35 GSK-3β HLY78 Axin (4-Ethyl-5,6-Dihydro-5-methyl- [1,3]dioxolo[4,5-j]phenanthridine, 4- Ethyl-5-methyl-5,6-dihydro- [1,3]dioxolo[4,5-j]phenanthridine) WAY-262611 Dickkopf-1 (DKK1) ((1-(4-(Naphthalen-2-yl)pyrimidin-2- yl)piperidin-4-yl)methanamine)) BHQ880 DKK1 NCI8642 DKK1 gallocyanine dyes DKK1 Compounds 3-8 secreted frizzled-related (Moore et al., J. Med. Chem., 2009; protein 1 (sFRP-1) 52: 105) WAY-316606 sFRP-1

(20) TABLE-US-00002 TABLE B Compound Target A01 SMAD1/5/8 (Cao et al., Scientific Reports, 2014; 4: 4965) A17 SMAD1/5/8 (Cao et al., Scientific Reports, 2014; 4: 4965)

(21) TABLE-US-00003 TABLE C Compound Target Cerivastatin p27Kip1 (Baycol; Lipobay) Alsterpaullone 2-cyanoethyl p27Kip1 SJ403 p27Kip1

(22) TABLE-US-00004 TABLE D Compound Target Compound A (See FIG. 7) Atoh1 Compound B (See FIG. 7) Atoh1 Compound C (See FIG. 7) Atoh1 1-Azakenpaullone Atoh1 (Pyrido[3′,2′:2,3]azepino[4,5-b]indol- 6(5H)-one, 9-bromo-7,12-dihydro-) 2-(N)-benzyl ellipticene Atoh1

(23) TABLE-US-00005 TABLE E Compound Target Delta/Serrate/Lag-2 peptide Notch receptor

(24) TABLE-US-00006 TABLE F Compound Target Vorinostat HDAC class I (HDAC1, 2, (rINN; suberanilohydroxamic acid; suberoylanilide 3, and 8) and HDAC class II hydroxamic acid; SAHA (IIa: HDAC4, 5, 7, and 9; (suberoyl + anilide + hydroxamic acid abbreviated); N- IIb: 6 and 10) Hydroxy-N′-phenyloctanediamide; Zolinza ®) Trichostatin A HDAC class I (HDAC1, 2, (TSA; (2E,4E,6R)-7-(4-(Dimethylammo)phenyl)-N- 3, and 8) and HDAC class II hydroxy-4,6-dimethyl-7-oxo-2,4-heptadienamide) (IIa: HDAC4, 5, 7, and 9; IIb: 6 and 10) belinostat HDAC (PXD101; Beleodaq) Valproic acid HDAC (VPA; sodium valproate; Sodium 2-propylpentanoate) FK 228 HDAC class I (HDAC1, 2, (Depsipeptide; FR 901228; Romidepsin; Cyclo[(2Z)- 3, and 8), HDAC4, and 2-amino-2-butenoyl-L-valyl-(3S,4E)-3-hydroxy-7- HDAC6 mercapto-4-heptenoyl-D-valyl-D-cysteinyl], cyclic (3- 5) disulfide) Sodium butyrate HDAC (Butanoic acid sodium salt; NaB) LMK 235 HDAC4 and HDAC5 (N-[[6-(Hydroxyamino)-6-oxohexyl]oxy]-3,5- dimethylbenzamide) Scriptaid HDAC (N-Hydroxy-1,3-dioxo-1H-benz[de]isoquinoline- 2(3H)-hexanamide) M 344 HDAC (4-(Diethylammo)-N-[7-(hydroxyamino)-7- oxoheptyl]benzamide) SBHA HDAC1 and HDAC3 (N,N′-Dihydroxyoctanediamide; suberic bishydroxamate) CBHA HDAC1 and HDAC3 (m-carboxycinnamic acid bishydroxamide) HMBA HDAC (hexamethylene bisacetamide). Tubacin HDAC6 (N-[4-[(2R,4R,6S)-4-[[(4,5-Diphenyl-2- oxazolyl)thio]methyl]-6-[4-(hydroxymethyl)phenyl]- 1,3-dioxan-2-yl]phenyl]-N′-hydroxyoctanediamide) Sodium 4-phenylbutyrate HDAC (4-PB; sodium pheylbutyrate; 4-Phenylbutyric acid, sodium salt; 4-phenylbutyrate) MC 1568 HDAC class IIa (HDAC4, 5, (3-[5-(3-(3-Fluorophenyl)-3-oxopropen-1-yl)-1- 7, and 9) methyl-1H-pyrrol-2-yl]-N-hydroxy-2-propenamide) Compound 9 HDAC class IIa (HDAC4, 5, (Mai et al., J. Med. Chem., 2005; 48: 3344) 7, and 9) Compound 24 HDAC class IIa (HDAC4, 5, (Mai et al., J. Med. Chem., 2005; 48: 3344) 7, and 9) TC-H 106 HDAC class I (HDAC1, 2, (N1-(2-Aminophenyl)-N7-(4- 3, and 8) methylphenyl)heptanediamide; Pimelic Diphenylamide 106) Pyroxamide HDAC1 (N-Hydroxy-N′-3-pyridinyloctanediamide) NCH 51 HDAC (PTACH; 2-Methylpropanethioic acid S-[7-oxo-7-[(4- phenyl-2-thiazolyl)amino]heptyl] ester) NCH 31 HDAC PCI 34051 HDAC8 (N-Hydroxy-1-[(4-methoxyphenyl)methyl]-1H-indole- 6-carboxamide) thiophene benzamide HDAC1 and HDAC2 KD 5170 HDAC class I (HDAC1, 2, (S-[2-[6-[[[4-[3-(Dimethylamino)propoxy] 3, and 8) and HDAC class II phenyl]sulfonyl]amino]-3-pyridinyl]-2- (IIa: HDAC4, 5, 7, and 9; oxoethyl]ethanethioc acid ester) IIb: 6 and 10) TCS HDAC6 20b HDAC6 (2-Methylpropanethioic acid-S-[(6S)-6-[[(1,1- dimethylethoxy)carbonyl]amino]-7-oxo-7- (tricyclo[3.3.1.1.sup.3, 7]dec-1-ylamino)heptyl] ester) NSC 3852 HDAC (5-Nitroso-8-quinolinol) NSC69603 HDAC NSC86371 HDAC NSC305819 HDAC CI 994 HDAC class I (N-acetyldinaline; Acetyldinaline; 4- (Acetylamino)-N-(2-aminophenyl)benzamide) LAQ824 HDAC class I LBH589 pan-HDAC (panobinostat; Farydak) MS275 HDAC1-3 (SNDX-275; entinostat) MGCD0103 HDAC1-8 and 11 (mocetinostat) UF 010 HDAC1-3 (4-Bromo-N′-butylbenzohydrazide) Cpd60 HDAC1-3 Romidepsin HDAC1 and HDAC2 MS-27-275 HDAC NaBu HDAC (n-butyrate) trapoxin HDAC Apicidin HDAC (Cyclo[(2S)-2-Amino-8-oxodecanoyl-1-methoxy-L- tryptophyl-L-isoleucyl-(2R)-2-piperidinecarbonyl]) depudesin HDAC EX 527 SIRT1 (6-Chloro-2,3,4,9-tetrahydro-1H-carbazole-1- carboxamide) AGK 2 SIRT2 (2-Cyano-3-[[5-(2,5-dichlorophenyl)-2-furanyl]-N-5- quinolinyl-2-propenamide) AK 7 SIRT2 (N-(3-Bromophenyl)-3-[(hexahydro-1H-azepin-1- yl)sulfonyl]benzamide) SirReal2 SIRT2 (2-[(4,6-Dimethyl-2-pyrimidinyl)thio]-N-[5-(1- naphthalenylmethyl)-2-thiazolyl]acetamide) Salermide SIRT1 and SIRT2 (N-[3-[[(2-Hydroxy-1-naphthalenyl) methylene]amino]phenyl]-α-methylbenzeneacetamide) Splitomicin Sir2p (yeast form of SIRT1) (1,2-Dihydro-3H-naphtho[2,1-b]pyran-3-one)

(25) TABLE-US-00007 TABLE G Compound Target MG132 proteasome (Z-LLL-al, Z-Leu-Leu-Leu-CHO; N- [(Phenylmethoxy)carbonyl]-L-leucyl-N-[(1S)-1- formyl-3-methylbutyl]-L-leucinamide) MG262 proteasome (Z-Leu-Leu-Leu-B(OH)2) MG115 proteasome (Z-Leu-Leu-Nva-CHO) Z-Leu-Leu-Phe-CHO proteasome (Z-LLF-CHO) N-Acetyl-leucyl-leucyl-norleucinal proteasome (Ac-Leu-Leu-Nle-CHO) N-acetyl-leucyl-leucyl-methional proteasome (Ac-Leu-Leu-Met-CHO) N-benzyloxycarbonyl-isoleucyl-γ-t-butyl-glutamyl- proteasome alanyl-leucinal (Z-Ile-Glu(OtBu)-Ala-Leu-CHO) N-benzyloxycarbonyl-leucyl-leucyl-leucinal proteasome (Z-Leu-Leu-Leu-CHO), N-benzyloxycarbonyl-leucyl-leucyl-tyrosyl α-keto proteasome aldehyde (Z-Leu-Leu-Tyr-COCHO) N-benzyloxycarbonyl-leucyl-leucyl-phenylalanal proteasome (Z-Leu-Leu-Phe-CHO) N-benzyloxycarbonyl-leucyl-leucyl-leucyl boronic proteasome acid (Z-Leu-Leu-Leu-B(OH).sub.2) Bortezomib proteasome (PS-341; Velcade; Neomib; Bortecad) Lactacystin proteasome ((2R,3S,4R)-3-Hydroxy-2-[(1S)-1-hydroxy-2- methylpropyl]-4-methyl-5-oxo-2-pyrrolidinecarboxy- N-acetyl-L-cysteine thioester) Disulfiram proteasome (Antabuse and Antabus) Epigallocatechin-3-gallate proteasome (Epigallocatechin gallate; EGCG) Salinosporamide A proteasome Carfilzomib proteasome (Kyprolis).sub.— epoxomicin proteasome Ixazomib proteasome (Ninlaro; MLN2238) ixazomib citrate proteasome (MLN9708) PS-341 proteasome VLX1500 proteasome (b-AP15) clasto-Lactacystin beta Lactone proteasome Gliotoxin proteasome (Aspergillin; (3R,5aS,6S,10aR)-2,3,5a,6-Tetrahydro-6- hydroxy-3-(hydroxymethyl)-2-methyl-10H-3,10a- epidithiopyrazino[1,2-a]indole-1,4-dione) AM 114 proteasome (3,5-Bis-[benzylidene-4-boronic acid]-1- methylpiperidin-4-one) PSI proteasome (N-[(Phenylmethoxy)carbonyl]-L-isoleucyl-L-α- glutamyl-tert-butyl ester-N-[(1S)-1-formyl-3- methylbutyl]-L-alaninamide) Oprozomib proteasome (ONX 0912) Delanzomib proteasome (CEP-18770) BI8622 Huwe1 (E3 ubiquitin ligase) BI8626 Huwe1 (E3 ubiquitin ligase)

(26) TABLE-US-00008 TABLE H Compound Target MLN4929 Akt (Pevonedistat) API-2 Akt (Triciribine; NSC 154020; TCN; 1,5-Dihydro-5- methyl-1-β-D-ribofuranosyl-1,4,5,6,8- pentaazaacenaphthylen-3-amine; Akt/protein kinase B signaling inhibitor-2) API-1 Akt (4-Amino-5,8-dihydro-5-oxo-8-β-D-ribofuranosyl- pyrido[2,3-d]pyrimidine-6-carboxamide) GSK 690693 Akt (4-[2-(4-Amino-1,2,5-oxadiazol-3-yl)-1-ethyl-7-[(3S)- 3-piperidinylmethoxy)-1H-imidazo[4,5-c]pyridin-4- yl]-2-methyl-3-butyn-2-ol) 10-DEBC hydrochloride Akt (10-[4′-(N,N-Diethylamino)butyl]-2- chlorophenoxazine hydrochloride) FPA124 Akt (Dichloro[(2Z)-2-[(4-oxo-4H-1-benzopyran-3- yl)methylene] hydrazinecarbothioamide copper complex) SC66 Akt ((2E,6E)-2,6-Bis(4- pyridinylmethylene)cyclohexanone) LY 294002 hydrochloride PI3K (2-(4-Morpholinyl)-8-phenyl-4H-1-benzopyran-4-one hydrochloride) wortmannin PI3K PI 103 PI3K Quercetin PI3K and PKC (2-(3,4-Dihydroxyphenyl)-3,5,7-trihydroxy-4H-1- benzopyran-4-one) PHT 427 Akt and PDK1 (4-Dodecyl-N-1,3,4-thiadiazol-2-yl- benzenesulfonamide) GSK 2334470 PDK1 ((3S,6R)-1-[6-(3-Amino-1H-indazol-6-yl)-2- (methylamino)-4-pyrimidinyl]-N-cyclohexyl-6- methyl-3-piperidinecarboxamide) Fisetin PI3K, Akt (2-(3,4-Dihydroxyphenyl)-3,7-dihydroxy-4H-1- benzopyran-4-one) OSU 03012 Akt and PDK1 (2-Amino-N-[4-[5-(2-phenanthrenyl)-3- (trifluoromethyl)-1H-pyrazol-1-yl]phenyl)acetamide) PIT 1 Akt (N-[[(3-Chloro-2-hydroxy-5-nitrophenyl) amino]thioxomethyl]benzamide)

(27) TABLE-US-00009 TABLE I Compound Target AC102 CREB (6-fluoro-9-methyl-β-carboline; 6F9MβC

(28) TABLE-US-00010 TABLE J Compound Target LY411575 γ-secretase (LSN-411575; Compound 5; benzeneacetamide; N- [(1s)-2-[[(7s)-6,7-dihydro-5-methyl-6-oxo-5H- dibenz[b,d]azepin-7-yl]amino]-1-methyl-2-oxoethyl]- 3,5-difluoro-α-hyroxy-(αS)-); N2-[(2S)-2-(3,5- Difluorophenyl)-2-hydroxyethanoyl]-N1-[(7S)-5- methyl-6-oxo-6,7-dihydro-5H-dibenzo[b,d]azepin-7- yl]-L-alaninamide) L-685458 γ-secretase ((5S)-(tert-Butoxycarbonylamino)-6-phenyl-(4R)- hydroxy-(2R)-benzylhexanoyl)-L-leucy-L- phenylalaninamide; LY-685458; GSI-X) DBZ γ-secretase (Dibenzazepine; YO-01027; GSI-XX, deshydroxy LY- 411575; N-[(1S)-2-[[(7S)-6,7-Dihydro-5-methyl-6-oxo- 5H-dibenz[b,d]azepin-7-yl]amino]-1-methyl-2- oxoethyl]-3,5-difluorobenzeneacetamide) MRK560 γ-secretase (N-[cis-4-[(4-Chlorophenyl)sulfonyl]-4-(2,5- difluorophenyl)cyclohexyl]-1,1,1- trifluoromethanesulfonamide) MRK-003 γ-secretase MK-0752 γ-secretase Compound W γ-secretase (CW; 3,5-Bis(4-nitrophenoxy)benzoic acid) (Okochi et al., J.Biol.Chem., 2006; 281: 7890; Ford et al., J Neurosci Meth., 2008; 168: 465-474) Compound E γ-secretase (GSI-XXI) (Olsauskas-Kuprys et al., Onco Targets Ther., 2013; 6: 943) BMS 2289948 γ-secretase (4-chloro-N-(2,5-difluorophenyl)-N-((1R)-{4-fluoro-2- [3-(1H-imidazol-1- yl)propyl]phenyl}ethyl)benzenesulfonamide hydrochloride) BMS-433796 γ-secretase ((S)-2-((S)-2-(3,5-difluorophenyl)-2- hydroxyacetamido)-N-((S,Z)-3-methyl-4-oxo-4,5- dihydro-3H-benzo[d][1,2]diazepin-5-yl)propanamide) IN973 γ-secretase Flurbiprofen γ-secretase bi((R)-Flurbiprofen; tarenflurbil; Flurizan; (R)-2- Fluoro-α-methyl[1,1′-biphenyl]-4-acetic acid) JLK2, JLK4, JLK6, JLK7 γ-secretase (7-Amino-4-chloro-3-methoxy-1H-2-benzopyran) Begacestat γ-secretase (GSI-953; 5-Chloro-N-[(1S)-3,3,3-trifluoro-1- (hydroxymethyl)-2-(trifluoromethyl)propyl]-2- thiophenesulfonamide) DFK167 γ-secretase PF-0308414 γ-secretase

(29) TABLE-US-00011 TABLE K Compound Target TTNBP RAR (RO 13-7410, arotinoid acid, AGN 191183) ATRA RAR 9-cis RA RAR CD271 RAR (6-(4-Methoxy-3-tricyclo[3.3.1.13,7]dec-1-ylphenyl)-2- naphthalenecarboxylic acid) CD336 RAR CD-394 RAR CD437 RAR (6-3-(1-adamantyl)-4-hydroXyphenyl)-2 naphthanoic acid) (6-(4-Hydroxy-3-tricyclo[3.3.1.13,7]dec-1-ylphenyl)-2- naphthalenecarboxylic acid) CD666 RAR ((E)-4-(1-hydroXy-1-(5,6,7,8-tetrahydro-5,5,8,8 tetramethyl- 2-naphthyl)-2-propenyl)benzoic acid) CD1530 (4-(6-Hydroxy-7-tricyclo[3.3.1.13,7]dec-1-yl-2- RAR naphthalenyl)benzoic acid) CD2019 RAR (6-(3-(1-methylcycloheXyl)-4-methoXyphenyl)-2 naphthanoic acid) CD2247 RAR CD2081 RAR CD2314 RAR CD2325 RAR (4-[(E)-2-(3-(1-adamantyl)-4-hydroXyphenyl)-1 propenyl]benZoic acid) CD2425 RAR CD2503 RAR CD2665 RAR BMS-270394 (enantiomer of BMS-189961) RAR (3-Fluoro-4-[(R)-2-hydroxy-2-(5,5,8,8-tetramethyl-5,6,7,8- tetrahydro-naphthalen-2-yl)-acetylaminol-benzoic acid) BMS-189961 RAR (3-Fluoro-4-[2-hydroxy-2-(5,5,8,8-tetramethyl-5,6,7,8- tetrahydro-naphthalen-2-yl)-acetylamino]-benzoic acid) 6-[3-(adamantan-1-yl)-4-(prop-2- RAR ynyloxy)phenyl]naphthalene-2-carboxylic acid 5-[(E)-3-oxo-3-(5,5,8,8-tetrahydronaphthalene-2- RAR yl)propenyl]thiophene-2-carboxylic acid Palovarotene RAR (4[(1E)-2-[5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-3-(1H- pyrazol-1-ylmethyl)-2-naphthalenyl]-ethenyl]-benzoic acid; R667; CLM-001, RG667) CH-55 RAR (4-[(E)-3-(3,5-Di-tert-butyl-phenyl)-3-oxo-propenyl]-benzoic acid) Docosahexaenoic acid RXR (DHA; (4Z,7Z,10Z,13Z,16Z,19Z)-4,7,10,13,16,19- Docosahexaenoic acid) CD 3254 RXR (3-[4-Hydroxy-3-(5,6,7,8-tetrahydro-3,5,5,8,8-pentamethyl-2- naphthalenyl)phenyl]-2-propenoic acid) 9 cis-RA RXR 3-cis-retinoic acid RXR (Accutane; isotretinoin; 13-cis-Retinoic acid) LG 100754 RXR ((2E,4E,6Z)-3-Methyl-7-(5,6,7,8-tetrahydro-5,5,8,8- tetramethyl-3-propoxy-3-naphthalenyl)-2,4,6-octatrienoic acid) SR 11237 RXR (BMS 649; 4-[2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2- naphthalenyl)-1,3-dioxolan-2-yl]-benzoic acid) Fluorobexarotene RXR (2-Fluoro-4-[1-(5-,6,7,8-tetrahydro-3,5,5,8,8-pentamethyl-2- naphthalenyl)ethenyl]benzoic acid) LGD1069 RXR (4-[1-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2- naphthyl)ethenyl] acid) LG100268 RXR (6-[1-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydronaphthalen-2- yl)cyclopropyl]nicotinic acid) LG100754 RXR (2E,4E,6Z)-3-Methyl-7-(5,6,7,8-tetrahydro-5,5,8,8- tetramethyl-3-propoxy-2-naphthalenyl)-2,4,6-Octatrienoic acid) Compounds 1-11 RXR (Wagner et al., J. Med. Chem., 2009; 52: 5950) HX 630 RXR (4-(7,8,9,10-Tetrahydro-7,7,10,10- tetramethylbenzo[b]naphtho[2,3-f][1,4]thiazepin-12-yl- benzoic acid) HX 640 RXR HX 600 RXR TZ335 RXR Adapalene RXR (6-(4-Methoxy-3-tricyclo[3.3.1.1.sup.3, 7]dec-1-ylphenyl)-2- naphthalenecarboxylic acid, 6-[3-(1-Adamantyl)-4- methoxyphenyl]-2-naphthoic acid; CD-271; Differin) Bexarotene RXR (4-[1-(5,6,7,8-Tetrahydro-3,5,5,8,8-pentamethyl-2- naphthalenyl)ethenyl]benzoic acid, LGD-1069; SR-11247; targretin; TRG) Retinoic acid RXR (ATRA; Tretinoin; Vitamin A acid; all-trans-Retinoic acid) 4-[N-methanesulfonyl-N-(5,5,8,8-tetramethyl-5,6,7,8- RXR tetrahydro-2-naphthyl)amino]benzoic acid 6-[N-ethyl-N-(3-isopropoxy-4- RXR isopropylphenyl)amino]nicotinic acid (NEt-3IP) 6-[N-ethyl-N-(3-isobutoxy-4-isopropylphenyl)amino]nicotinic RXR acid (NEt-3IB PA024 RXR AGN 194204 RXR CNX-013-B2 RXR UAB30 RXR IRX4204 RXR

(30) In some embodiments, the one or more agents used to promote the proliferation and expansion of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) or to promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells) include a combination of agents, in which the agents target two or more (e.g., three, four, five, or more) of the following pathways, proteins, and DNA response elements: the retinoid receptor signaling pathway, the Wnt signaling pathway, the BMP signaling pathway, the CDK signaling pathway, the Notch signaling pathway, the protein degradation pathway, the PI3K-Akt signaling pathway, the cAMP-dependent pathway, histone deacetylase (HDAC), and/or E box DNA response element.

(31) In some embodiments, the one or more agents used to promote the proliferation and expansion of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) or to promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells) include a combination of agents (e.g., a combination two agents each selected from the compounds set forth in Tables A-K, wherein the two agents are different from each other; a combination of three agents each selected from the compounds set forth in Tables A-K, wherein the three agents are different from each other; a combination of four agents each selected from the compounds set forth in Tables A-K, wherein the four agents are different from each other; and a combination of five agents each selected from the compounds set forth in Tables A-K, wherein the five agents are different from each other).

(32) For example, if a combination of two agents each selected from the compounds set forth in Tables A-K is used to promote the proliferation and expansion of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) or to promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells), the two agents in the combination may be selected based on the combinations listed in Table L.

(33) TABLE-US-00012 TABLE L Agent 1 Agent 2 chosen chosen Combination from from 1 Table A Table A 2 Table A Table B 3 Table A Table C 4 Table A Table D 5 Table A Table E 6 Table A Table F 7 Table A Table G 8 Table A Table H 9 Table A Table I 10 Table A Table J 11 Table A Table K 12 Table B Table B 13 Table B Table C 14 Table B Table D 15 Table B Table E 16 Table B Table F 17 Table B Table G 18 Table B Table H 19 Table B Table I 20 Table B Table J 21 Table B Table K 22 Table C Table C 23 Table C Table D 24 Table C Table E 25 Table C Table F 26 Table C Table G 27 Table C Table H 28 Table C Table I 29 Table C Table J 30 Table C Table K 31 Table D Table D 32 Table D Table E 33 Table D Table F 34 Table D Table G 35 Table D Table H 36 Table D Table I 37 Table D Table J 38 Table D Table K 39 Table E Table E 40 Table E Table F 41 Table E Table G 42 Table E Table H 43 Table E Table I 44 Table E Table J 45 Table E Table K 46 Table F Table F 47 Table F Table G 48 Table F Table H 49 Table F Table I 50 Table F Table J 51 Table F Table K 52 Table G Table G 53 Table G Table H 54 Table G Table I 55 Table G Table J 56 Table G Table K 57 Table H Table H 58 Table H Table I 59 Table H Table J 60 Table H Table K 61 Table I Table I 62 Table I Table J 63 Table I Table K 64 Table J Table J 65 Table J Table K 66 Table K Table K

(34) Alternatively, the invention also contemplates methods that use one or more proteins involved in the retinoid receptor signaling pathway, the Wnt signaling pathway, the BMP signaling pathway, the CDK signaling pathway, the Notch signaling pathway, the protein degradation pathway, the PI3K-Akt signaling pathway, and/or the cAMP-dependent pathway to down-regulate or up-regulate the pathway to promote the proliferation and expansion of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) or to promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells).

(35) In some embodiments of the methods, RAR and/or RXR may be used to up-regulate retinoid receptor signaling,

(36) In some embodiments of the methods, RSPO, Norrin, Wnt3a, and/or Wnt5a may be used to up-regulate the Wnt signaling pathway.

(37) In some embodiments of the methods, Noggin and/or Chordin may be used to down-regulate the BMP signaling pathway.

(38) In some embodiments of the methods, CDKs and/or cyclins may be used to up-regulate the CDK signaling pathway.

(39) In some embodiments of the methods, Delta/Serrate/Lag-2 peptide and/or Notch receptors may be used to up-regulate the Notch signaling pathway.

(40) In some embodiments of the methods, the level of ubiquitin may be decreased to down-regulate the protein degradation pathway.

(41) In some embodiments of the methods, the level of Akt, PI 3-kinase, and/or PDK1 may be decreased to down-regulate the PI3K-Akt signaling pathway.

(42) In some embodiments of the methods, the level of CREB protein may be increased to up-regulate cAMP-dependent pathway.

(43) In some embodiments of the methods, the level of one or more transcription factors that bind to the E box DNA response element may be increased to up-regulate E box-dependent transcription.

(44) In some embodiments of the methods, the level of histone deacetylase (HDAC) may be decreased to down-regulate HDAC activity.

(45) Alternatively, the invention also contemplates methods that use one or more growth factors to down-regulate or up-regulate one or more of the following pathways: retinoid receptor signaling pathway, the Wnt signaling pathway, the BMP signaling pathway, the CDK signaling pathway, the Notch signaling pathway, the protein degradation pathway, the PI3K-Akt signaling pathway, and/or the cAMP-dependent pathway, in order to promote the proliferation and expansion of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) or to promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells).

(46) In some embodiments of the methods, the growth factors include, but are not limited to, epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), and/or insulin-like growth factor (IGF1).

(47) Transgenic Animals and Methods of Use

(48) In one aspect, the invention provides non-human transgenic animals having two or more (e.g., two, three, or four or more) recombinant nucleic acid molecules stably integrated into their genome. The two or more recombinant nucleic acid molecules include at least a first recombinant nucleic acid molecule that comprises a first reporter gene (e.g., a fluorescent marker) under the control of a regulatory element of an inner ear supporting cell marker selected from the group consisting of Lgr5, Sox2, p27, Prox1, FGFR3, Glast, and Lfng (e.g., Lgr5), and a second recombinant nucleic acid molecule that comprises a second reporter gene under the control of a regulatory element of an inner ear hair cell marker selected from the group consisting of Atoh1, Myo7a, Cdh23, Pcdh15, Myo6, Myo1c, Tmc1, and Cav1.3 (e.g., Atoh1), wherein the first reporter gene is different from the second reporter gene.

(49) The invention also contemplates using various genetic engineering techniques to generate one or more reporters in a cell or a transgenic animal. In some embodiments, various genetic engineering techniques can be used to generate two or more reporters in a cell or a transgenic animal. Examples of genetic engineering techniques include, but are not limited to, techniques that use the CRISPR/Cas system, techniques that use the Cre recombinase-loxP recombination system, techniques that use the Cre-Lox recombination syste, techniques that use the Flp-FRT recombination system, and techniques that use the RMCE (recombinase-mediated cassette exchange) system.

(50) In some embodiments, the inner ear supporting cell marker is Lgr5 and the inner ear hair cell marker is Atoh1. In some embodiments, the regulatory element of an inner ear supporting cell marker is an Lgr5 promoter. In some embodiments, the regulatory element of an inner ear hair cell marker is an Atoh1 enhancer. In some embodiments, the Atoh1 enhancer is operably linked to an SV40 promoter or a globin promoter.

(51) In some embodiments, the first reporter gene encodes a first fluorescent protein and the second reporter gene encodes a second fluorescent protein, in which the first fluorescent protein is different from the second fluorescent protein.

(52) In some embodiments, the expression of Lgr5 results in expression of the first fluorescent marker (Lgr5 reporter transgene). In some embodiments, the expression of Atoh1 results in expression of the second fluorescent marker (Atoh1 reporter transgene). In preferred embodiments a mouse is obtained that contains the Lgr5 reporter protein and Atoh1 reporter protein transgenes in all of its somatic and germ cells. The first and second markers should be distinguishable from each other. In some embodiments, the first and second markers produce green and red fluorescence in the cells. Although fluorescent markers are exemplified herein, other markers (reporter genes) can also be used; Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; examples of bioluminescent materials include luciferase, luciferin, and aequorin. Numerous others are known in the art. In some embodiments, one of the markers is green fluorescent protein or a derivative thereof, fluorescent proteins (e.g., green fluorescent protein (GFP), cyan fluorescent protein (CFP), red fluorescent protein (RFP), mCherry, Tag-RFP, etc.), luciferase which is a luminescent reporter (Ranella, Firefly, etc.), chomogenic (beta-Gal, etc.), etc. See e.g., Pollock et al., Trends in Cell Biology 9:57 (1999). Useful fluorescent proteins also include mutants and spectral variants of these proteins which retain the ability to fluoresce. See e.g., Shaner et al., Nat. Biotech. 22:1567 (2004), Tag-RFP (Shaner, N. C. et al., 2008 Nature Methods, 5(6), 545-551), Other fluorescent proteins that can be used in the methods described include, but are not limited to, AcGFP, AcGFP1, AmCyan, copGFP, CyPet, dKeima-Tandem, DsRed, dsRed-Express, DsRed-Monomer, DsRed2, AmCyan1, AQ143, AsRed2, Azami Green, Azurite, BFP, Cerulean, CFP, CGFP, Citrine, dTomato, dTomato-Tandem, EBFP, EBFP2, ECFP, EGFP, Emerald, EosFP, EYFP, GFP, mBanana, mCerulean, mCFP, mCherry, mCitrine, mECFP, mEmerald, mGrape1, mGrape2, mHoneydew, Midori-Ishi Cyan, mKeima, mKO, mOrange, mOrange2, mPlum, mRaspberry, mRFP1, mRuby, mStrawberry, mTagBFP, mTangerine, mTeal, mTomato, mTurquoise, mWasabi, PhiYFP, ReAsH, Sapphire, Superfolder GFP, T-HcRed-Tandem, HcRedl, JRed, Katuska, Kusabira Orange, Kusabira Orange2, mApple, Sapphire, TagCFP, TagGFP, TagRFP, TagRFP-T, TagYFP, tdTomato, Topaz, TurboGFP, Venus, YFP, YPet, ZsGreen, and ZsYellowl, all of which are known in the art, e.g., described in the literature or otherwise commercially available.

(53) A “transgenic animal” is a non-human animal, such as a mammal, generally a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene as described herein. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, and the like. A “transgene” is exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and thus remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. Knock-in animals, which include a gene insertion, are included in the definition of transgenic animals.

(54) A “Lgr5 reporter transgene” or “Atoh1 reporter transgene” as used herein refers to a construct that features a coding sequence for a reporter protein inserted downstream of an Lgr5 or Atoh1 promoter, so as to result in expression of the reporter protein in cells expressing Lgr5 or Atoh1. The promoter drives expression of the reporter protein, and transcription is stopped by a polyadenylation signal. The transgene is generally integrated into or occurs in the genome of the cells of a transgenic animal. Thus an Lgr5/Atoh1 transgenic animal as described herein is one in which at least one copy of an Lgr5 reporter transgene and at least one copy of an Atoh1 reporter transgene have been introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal. A line of transgenic animals (e.g., mice, rats, guinea pigs, hamsters, rabbits, or other mammals) can be produced bearing an Lgr5 reporter transgene and an Atoh1 reporter transgene in some or (preferably) all of their cells. Methods known in the art for generating such transgenic animals would be used, e.g., as described below.

(55) Methods known in the art for producing transgenic animals can be used to generate an animal, e.g., a mouse, which bears an Lgr5 reporter transgene or an Atoh1 reporter transgene (see, e.g., Barker et al., Nature. 2007 Oct. 25; 449(7165):1003 and Lumpkin et al., Gene Expr Patterns. 2003 August; 3(4):389, both of which are incorporated herein in their entirety). Such animals can be crossed to produce offspring that are homozygous for both the Lgr5 reporter transgene and Atoh1 reporter transgene, i.e., that have the Lgr5 reporter transgene and Atoh1 reporter transgene integrated into the genome.

(56) For example, in one embodiment, a suitable vector including a sequence encoding the Lgr5 reporter transgene or Atoh1 reporter transgene is introduced into a cell, e.g., a fertilized oocyte or an embryonic stem cell. Such cells can then be used to create non-human transgenic animals in which said sequences have been introduced into their genome. These animals can then in turn be bred with other transgenic animals that express a recombinase, e.g., under the control of an Lgr5 or Atoh1 promoter that will turn on expression of the reporter protein in a specific cell or tissue, or at a specific time in development.

(57) Methods for generating transgenic animals, particularly animals such as mice, via embryo manipulation and electroporation or microinjection of pluripotent stem cells or oocytes, are known in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009, 4,873,191, U.S. Ser. No. 10/006,611, “Transgenic Mouse Methods and Protocols (Methods in Molecular Biology),” Hofker and van Deursen, Editors (Humana Press, Totowa, N.J., 2002); and in “Manipulating the Mouse Embryo,” Nagy et al., Editors (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2002), which are incorporated herein by reference in their entirety. Methods similar to those used to create transgenic mice can be used for production of other transgenic animals.

(58) In general, in the present methods, a transgenic mouse as described herein is made by injecting a vector made as described herein into the pronucleus of a fertilized mouse oocyte (e.g., an oocyte from a mouse with an Lgr5 reporter gene knocked in, see Barker et al., Nature. 2007 Oct. 25; 449(7165):1003) and used for generation of a transgenic mouse with the Lgr5 reporter gene and Atoh1 reporter transgene expressed in all cells, using standard transgenic techniques, e.g., as described in “Transgenic Mouse Methods and Protocols (Methods in Molecular Biology),” Hofker and van Deursen, Editors (Humana Press, Totowa, N.J., 2002); U.S. Pat. Nos. 4,736,866 and 4,870,009, 4,873,191 and 6,791,006, and in Hogan, “Manipulating the Mouse Embryo,” Nagy et al., Editors (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2002). The reporter genes can be maintained and expressed in all cells, e.g., on plasmids or stably integrated into the genome, using standard molecular techniques.

(59) A transgenic founder Lgr5/Atoh1 animal can be identified based upon the presence of the Lgr5 reporter transgene and Atoh1 reporter transgene in its genome, for example by detecting the presence or expression of the reporter sequences or proteins in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying the Lgr5 reporter transgene and Atoh1 reporter transgene can further be bred to other transgenic animals carrying other transgenes.

(60) Vectors

(61) The mice described herein can be made using vectors, e.g., expression vectors, containing a nucleic acid encoding the Lgr5 reporter transgene or Atoh1 reporter transgene as described herein. As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked and can include a plasmid, cosmid or viral vector. The vector can be capable of autonomous replication or it can integrate into a host DNA. Viral vectors include, e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses.

(62) A vector can include a nucleic acid encoding a Lgr5 reporter protein or Atoh1 reporter protein in a form suitable for expression of the nucleic acid in a host cell. Preferably the recombinant expression vector includes one or more regulatory sequences operatively linked to the nucleic acid sequence to be expressed. The term “regulatory sequence” includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence, as well as tissue-specific regulatory and/or inducible sequences. The design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. The expression vectors of the invention can be introduced into host cells to thereby produce the Lgr5 reporter and Atoh1 reporter, encoded by nucleic acids as described herein.

(63) The recombinant expression vectors described herein can be designed for expression of the Lgr5 reporter and Atoh1 reporter proteins in prokaryotic or eukaryotic cells. For example, polypeptides of the invention can be expressed in E. coli, insect cells (e.g., using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, “Gene Expression Technology: Methods in Enzymology 185,” Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

(64) In some embodiments, the Atoh1 enhancer described in Example 5 is used to drive expression of a reporter gene.

(65) Cells

(66) In another aspect, the invention provides isolated cells that include a nucleic acid molecule as described herein, e.g., a nucleic acid molecule encoding an Lgr5 reporter protein or Atoh1 reporter protein within a recombinant expression vector, or a nucleic acid molecule containing sequences that allow it to homologously recombine into a specific site of the host cell's genome. The terms “host cell” and “recombinant host cell” are used interchangeably herein. Such terms refer not only to the particular subject cell that was contacted with a nucleic acid molecule (e.g., a vector as described herein), but to the progeny or potential progeny of such a cell that also contain the nucleic acid molecule. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein so long as they also contain the nucleic acid molecule.

(67) A host cell can be any prokaryotic or eukaryotic cell. For example, the cell can be a bacterial cell such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO), HEK, or COS cells). Other suitable host cells are known to those skilled in the art. Where the vector is a viral vector that can be produced from recombinant cells, e.g., retroviral vectors, the cells can be those that produce the viral vector.

(68) Vector DNA can be introduced into host cells via conventional transformation or transfection techniques. As used herein, the terms “transformation” and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. In some embodiments, naked DNA is simply applied to a cell. Where the vector is a viral vector, known infection protocols can be used.

(69) For example, retroviral vectors can be used, e.g., as described in Robertson et al., Nature 323:445-448 (1986). Retroviruses generally integrate into the host genome with no rearrangements of flanking sequences, which is not always the case when DNA is introduced by microinjection or other methods.

(70) Cells of the present invention also include those cells obtained from the transgenic animals described herein, e.g., cells from the tissues of those animals, that contain the nucleic acid molecule.

(71) Identity of Sequences

(72) To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90%, 95% or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

(73) The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For the present methods, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48:444-453) algorithm, which has been incorporated into the GAP program in the GCG software package (available on the world wide web at gcg.com), using the default parameters, i.e., a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

(74) Methods for constructing transgenes useful in the present methods are known in the art; see, e.g., Sambrook and Russell, “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory Press; 3rd Labman edition (Jan. 15, 2001); and Ausubel et al., Eds., “Short Protocols in Molecular Biology,” Current Protocols; 5 edition (Nov. 5, 2002). In some embodiments, commercially-available vectors can be used in constructing the nucleic acid molecules described herein, e.g., pC4M-Fv2E (available from Ariad Pharmaceuticals, Cambridge, Mass.).

(75) Methods of Screening

(76) Included herein are methods for screening test compounds, such as polypeptides, polynucleotides, inorganic or organic large or small molecule test compounds (e.g., compounds listed in Tables A-K) to identify agents useful in the treatment of hearing loss associated with a loss of cochlear hair cells (e.g., cochlear hair cells in the inner ear).

(77) The present disclosure provides a method for identifying a candidate agent for the treatment of hearing loss or balance loss associated with a loss of cochlear or vestibular hair cells, in which the method includes: (a) isolating a population of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) from the transgenic mouse described herein; (b) maintaining the population of inner ear supporting cells under conditions sufficient to produce an expanded population of inner ear supporting cells; (c) administering a test compound to the expanded population of inner ear supporting cells; (d) detecting the expression levels of the first reporter gene and the second reporter gene in the expanded population of inner ear supporting cells in the presence of the test compound; and (e) selecting as a candidate agent for the treatment of hearing loss or balance loss a test compound that increases the expression level of the first reporter gene compared to the expression level of the first reporter gene in the absence of the test compound, and/or increases the expression level of the second reporter gene compared to the expression level of the second reporter gene in the absence of the test compound.

(78) In some embodiments, the conditions sufficient to produce an expanded population of inner ear supporting cells comprise one or more agents set forth in Table 1.

(79) The present disclosure also provides a method for identifying a candidate agent for the treatment of hearing loss or balance loss associated with a loss of cochlear or vestibular hair cells, in which the method includes: (a) providing a population of inner ear supporting cells having a stably integrated recombinant nucleic acid molecule that comprises a reporter gene under the control of a regulatory element of an inner ear supporting cell marker selected from the group consisting of Lgr5, Sox2, p27, Prox1, FGFR3, Glast, and Lfng; (b) maintaining the population of inner ear supporting cells under conditions sufficient to produce an expanded population of inner ear supporting cells, wherein the conditions comprise one or more agents selected from the group consisting of: (i) a retinoid receptor signaling activator, (ii) a Wnt signaling activator set forth in Table A, (iii) a BMP signaling inhibitor set forth in Table B, (iv) a CDK activator set forth in Table C, (v) an E box-dependent transcriptional activator set forth in Table D, (vi) a Notch signaling activator set forth in Table E, (vii) an HDAC inhibitor set forth in Table F, (viii) a protein degradation inhibitor set forth in Table G, (ix) a PI3K-Akt signaling inhibitor set forth in Table H, and (x) a CREB activator set forth in Table I; (c) administering a test compound to the expanded population of inner ear supporting cells; (d) detecting the expression level of the reporter gene in the expanded population of inner ear supporting cells in the presence of the test compound; and (e) selecting as a candidate agent for the treatment of hearing loss or balance loss a test compound that increases the expression level of the reporter gene compared to the expression level of the reporter gene in the absence of the test compound.

(80) The present disclosure also provides a method for identifying a candidate agent for the treatment of hearing loss or balance loss associated with a loss of cochlear or vestibular hair cells, in which the method includes: (a) providing a population of inner ear supporting cells having a stably integrated recombinant nucleic acid molecule that comprises a reporter gene under the control of a regulatory element of an inner ear hair cell marker selected from the group consisting of Atoh1, Myo7a, Cdh23, Pcdh15, Myo6, Myo1c, Tmc1, and Cav1.3; (b) maintaining the population of inner ear supporting cells under conditions sufficient to produce an expanded population of inner ear supporting cells, wherein the conditions comprise one or more agents selected from the group consisting of: (i) a retinoid receptor signaling activator, (ii) a Wnt signaling activator set forth in Table A, (iii) a BMP signaling inhibitor set forth in Table B, (iv) a CDK activator set forth in Table C, (v) an E box-dependent transcriptional activator set forth in Table D, (vi) a Notch signaling activator set forth in Table E, (vii) an HDAC inhibitor set forth in Table F, (viii) a protein degradation inhibitor set forth in Table G, (ix) a PI3K-Akt signaling inhibitor set forth in Table H, and (x) a CREB activator set forth in Table I; (c) administering a test compound to the expanded population of inner ear supporting cells; (d) detecting the expression level of the reporter gene in the expanded population of inner ear cells in the presence of the test compound; and (e) selecting as a candidate agent for the treatment of hearing loss or balance loss a test compound that increases the expression level of the reporter gene compared to the expression level of the reporter gene in the absence of the test compound.

(81) The present disclosure also provides methods of using hair cells to screen for ototoxins. The present disclosure also provides methods of identifying one or more compounds (e.g., compounds listed in Tables A-K) that exhibit protective properties against hair cell damage caused by ototoxins. In some embodiments, ototoxins include therapeutic drugs including antineoplastic agents, salicylates, quinines, and aminoglycoside antibiotics, contaminants in foods or medicinals, and environmental or industrial pollutants. The present disclosure also provides methods of using hair cells to identify synaptic connectivity. In some embodiments, the hair cells (e.g., Atoh1+ inner ear hair cells) used in these methods may be isolated from a mammal (e.g., a mouse or a human). In some embodiments, the hair cells (e.g., Atoh1+ inner ear hair cells) used in these methods may be differentiated from inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells), as described by the methods provided herein.

(82) As used herein, “small molecules” refers to small organic or inorganic molecules of molecular weight below about 3,000 Daltons. In general, small molecules useful for the invention have a molecular weight of less than 3,000 Daltons (Da). The small molecules can be, e.g., from at least about 100 Da to about 3,000 Da (e.g., between about 100 to about 3,000 Da, about 100 to about 2500 Da, about 100 to about 2,000 Da, about 100 to about 1,750 Da, about 100 to about 1,500 Da, about 100 to about 1,250 Da, about 100 to about 1,000 Da, about 100 to about 750 Da, about 100 to about 500 Da, about 200 to about 1500, about 500 to about 1000, about 300 to about 1000 Da, or about 100 to about 250 Da).

(83) The test compounds (e.g., compounds listed in Tables A-K and Table 1) can be, e.g., natural products or members of a combinatorial chemistry library. A set of diverse molecules should be used to cover a variety of functions such as charge, aromaticity, hydrogen bonding, flexibility, size, length of side chain, hydrophobicity, and rigidity. Combinatorial techniques suitable for synthesizing small molecules are known in the art, e.g., as exemplified by Obrecht and Villalgordo, Solid-Supported Combinatorial and Parallel Synthesis of Small-Molecular-Weight Compound Libraries, Pergamon-Elsevier Science Limited (1998), and include those such as the “split and pool” or “parallel” synthesis techniques, solid-phase and solution-phase techniques, and encoding techniques (see, for example, Czarnik, Curr. Opin. Chem. Bio. 1:60-6 (1997)). In addition, a number of small molecule libraries are commercially available. A number of suitable small molecule test compounds are listed in U.S. Pat. No. 6,503,713, incorporated herein by reference in its entirety.

(84) Libraries screened using the methods of the present invention can comprise a variety of types of test compounds (e.g., compounds listed in Tables A-K and Table 1). A given library can comprise a set of structurally related or unrelated test compounds. In some embodiments, the test compounds are peptide or peptidomimetic molecules. In some embodiments, the test compounds are nucleic acids.

(85) In some embodiments, the test compounds and libraries thereof can be obtained by systematically altering the structure of a first test compound, e.g., a first test compound that is structurally similar to a known natural binding partner of the target polypeptide, or a first small molecule identified as capable of binding the target polypeptide, e.g., using methods known in the art or the methods described herein, and correlating that structure to a resulting biological activity, e.g., a structure-activity relationship study. As one of skill in the art will appreciate, there are a variety of standard methods for creating such a structure-activity relationship. Thus, in some instances, the work may be largely empirical, and in others, the three-dimensional structure of an endogenous polypeptide or portion thereof can be used as a starting point for the rational design of a small molecule compound or compounds. For example, in one embodiment, a general library of small molecules is screened, e.g., using the methods described herein.

(86) In some embodiments, a test compound (e.g., a compound listed in Tables A-K and Table 1) is applied to a test sample, e.g., a cell or living tissue or organ, e.g., an eye, and one or more effects of the test compound is evaluated. In a cultured or primary cell for example, the ability of the test compound to increase expression of a supporting cell marker (e.g., Lgr5) and/or a hair cell marker (e.g., Atoh1).

(87) In some embodiments, the test sample is, or is derived from (e.g., a sample taken from) an in vivo model of a disorder as described herein. For example, an animal model, e.g., a rodent such as a rat, can be used.

(88) Methods for evaluating each of these effects are known in the art. For example, ability to modulate expression of a protein can be evaluated at the gene or protein level, e.g., using quantitative PCR or immunoassay methods. In some embodiments, high throughput methods, e.g., protein or gene chips as are known in the art (see, e.g., Ch. 12, Genomics, in Griffiths et al., Eds. Modern genetic Analysis, 1999, W. H. Freeman and Company; Ekins and Chu, Trends in Biotechnology, 1999, 17:217-218; MacBeath and Schreiber, Science 2000, 289(5485):1760-1763; Simpson, Proteins and Proteomics: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 2002; Hardiman, Microarrays Methods and Applications: Nuts & Bolts, DNA Press, 2003), can be used to detect an effect on expression of a supporting cell marker (e.g., Lgr5) and/or a hair cell marker (e.g., Atoh1).

(89) A test compound (e.g., a compound listed in Tables A-K and Table 1) that has been screened by a method described herein and determined to increase expression of Lgr5 and/or Atoh1 can be considered a candidate compound. A candidate compound that has been screened, e.g., in an in vivo model of a disorder, e.g., an animal model of hearing loss, and determined to have a desirable effect on the disorder, e.g., on one or more symptoms of the disorder or on number of hair cells, can be considered a candidate therapeutic agent. Candidate therapeutic agents, once screened in a clinical setting, are therapeutic agents. Candidate compounds, candidate therapeutic agents, and therapeutic agents can be optionally optimized and/or derivatized, and formulated with physiologically acceptable excipients to form pharmaceutical compositions.

(90) Thus, test compounds identified as “hits” (e.g., test compounds that increase expression of Lgr5 and/or Atoh1) in a first screen can be selected and systematically altered, e.g., using rational design, to optimize binding affinity, avidity, specificity, or other parameter. Such optimization can also be screened for using the methods described herein. Thus, in one embodiment, the invention includes screening a first library of compounds using a method known in the art and/or described herein, identifying one or more hits in that library, subjecting those hits to systematic structural alteration to create a second library of compounds structurally related to the hit, and screening the second library using the methods described herein.

(91) Test compounds identified as hits can be considered candidate therapeutic compounds, useful in treating disorders associated with loss of cochlear hair cells (e.g., cochlear hair cells in the inner ear), as described herein, e.g., hearing loss. A variety of techniques useful for determining the structures of “hits” can be used in the methods described herein, e.g., NMR, mass spectrometry, gas chromatography equipped with electron capture detectors, fluorescence and absorption spectroscopy. Thus, the invention also includes compounds identified as “hits” by the methods described herein, and methods for their administration and use in the treatment, prevention, or delay of development or progression of a disorder described herein.

(92) Test compounds identified as candidate therapeutic compounds can be further screened by administration to an animal model of a disorder associated with loss of cochlear hair cells (e.g., cochlear hair cells in the inner ear), as described herein. The animal can be monitored for a change in the disorder, e.g., for an improvement in a parameter of the disorder, e.g., a parameter related to clinical outcome. In some embodiments, the parameter is hearing ability, and an improvement would be improved hearing response. In some embodiments, the subject is a human, e.g., a human with hearing loss, and the parameter is improved hearing.

(93) Methods of Treatment

(94) In some embodiments, the present disclosure provides novel therapeutic strategies for treating hearing loss or balance loss associated with a loss of cochlear hair cells (e.g., cochlear hair cells in the inner ear) or vestibular hair cells, respectively (i.e., conditions that would benefit from an increased proliferation and differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells)). In some embodiments, such strategies can promote an increase in the proliferation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) and/or an increase in the differentiation of the inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells), thereby promoting the expansion and differentiation of a target cell into a mature cell of the inner ear, e.g., an auditory hair cell. In some embodiments, the methods and compositions described herein promote differentiation of target cells (e.g., inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells)) to or towards mature cells of the inner ear, e.g., auditory hair cells (e.g., inner ear hair cells (e.g., Atoh1+ inner ear hair cells)) without promoting substantial cellular proliferation. In some embodiments, the methods and compositions described herein promote proliferation of target cells (e.g., inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells)) without promoting substantial cellular proliferation.

(95) In some embodiments, the present invention can be used to treat hair cell loss and any disorder that arises as a consequence of cell loss in the ear, such as hearing impairments, deafness, and vestibular disorders, for example, by promoting differentiation (e.g., complete or partial differentiation) of one or more cells (e.g., inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells)) into one or more cells capable of functioning as sensory cells of the ear, e.g., hair cells (e.g., inner ear hair cells (e.g., Atoh1+ inner ear hair cells)).

(96) In some embodiments, the hearing loss is sensorineural hearing loss, which can result from damage or malfunction of the cochlea, e.g., loss of or damage to the sensory epithelium resulting in loss of hair cells.

(97) In some embodiments, the hearing loss can be for any reason, or as a result of any type of event. For example, because of a genetic or congenital defect; for example, a human subject can have been deaf since birth, or can be deaf or hard-of-hearing as a result of a gradual loss of hearing due to a genetic or congenital defect. In another example, the hearing loss can be a result of a traumatic event, such as a physical trauma to a structure of the ear, or a sudden loud noise, or a prolonged exposure to loud noises. For example, prolonged exposures to concert venues, airport runways, and construction areas can cause inner ear damage and subsequent hearing loss.

(98) In some embodiments, hearing loss can be due to chemical-induced ototoxicity, wherein ototoxins include therapeutic drugs including antineoplastic agents, salicylates, quinines, and aminoglycoside antibiotics, contaminants in foods or medicinals, and environmental or industrial pollutants. In some embodiments, hearing loss can result from aging.

(99) In some embodiments, the present disclosure provides methods of treating a subject having hearing loss or balance loss, in which:

(100) (a) a therapeutically effective amount of one or more agents that promote proliferation of inner ear supporting cells selected from the group consisting of: (i) a retinoid receptor signaling activator; (ii) a Wnt signaling activator set forth in Table A; (iii) a BMP signaling inhibitor set forth in Table B; (iv) a CDK activator set forth in Table C; (v) an E box-dependent transcriptional activator set forth in Table D; (vi) a Notch signaling activator set forth in Table E; (vii) an HDAC inhibitor set forth in Table F; (viii) a protein degradation inhibitor set forth in Table G; (ix) a PI3K-Akt signaling inhibitor set forth in Table H; and (x) a CREB activator set forth in Table I; and/or

(101) (b) a therapeutically effective amount of one or more agents that promote differentiation of inner ear supporting cells into inner ear hair cells selected from the group consisting of: (i) a retinoid receptor signaling activator; (ii) a Wnt signaling activator set forth in Table A; (iii) a BMP signaling inhibitor set forth in Table B; (iv) a CDK activator set forth in Table C; (v) an E box-dependent transcriptional activator set forth in Table D; (vi) an HDAC inhibitor set forth in Table F; (vii) a protein degradation inhibitor set forth in Table G; (viii) a PI3K-Akt signaling inhibitor set forth in Table H; (ix) a CREB activator set forth in Table I; and (x) a Notch signaling inhibitor set forth in Table J, are administered to the subject, e.g., to the ear of a subject, to promote inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) proliferation and/or differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells) (direct therapy).

(102) In some embodiments, the disclosure provides methods of treating a subject having hearing loss or balance loss, in which:

(103) (a) a therapeutically effective amount of one or more agents that promote proliferation of inner ear supporting cells selected from the group consisting of: (i) a retinoid receptor signaling activator; (ii) a Wnt signaling activator set forth in Table A; (iii) a BMP signaling inhibitor set forth in Table B; (iv) a CDK activator set forth in Table C; and (v) an E box-dependent transcriptional activator set forth in Table D; and/or

(104) (b) a therapeutically effective amount of one or more agents that promote differentiation of inner ear supporting cells into inner ear hair cells selected from the group consisting of: (i) a Wnt signaling activator set forth in Table A; (ii) an E box-dependent transcriptional activator set forth in Table D; (iii) an HDAC inhibitor set forth in Table F; (iv) a protein degradation inhibitor set forth in Table G; and (v) a Notch signaling inhibitor set forth in Table J, are administered to the subject, e.g., to the ear of a subject, to promote inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) proliferation and/or differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells).

(105) In some embodiments of the methods of treating a subject having hearing loss or balance loss, the one or more agents are administered systemically or to the ear of the subject, e.g., transtympanically to the middle ear of the subject. In some embodiments, the one or more agents that promote proliferation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) are administered prior to the one or more agents that promote differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells).

(106) The present disclosure also provides methods of treating a subject having hearing loss or balance loss by:

(107) (a) contacting one or more inner ear supporting cells, e.g., in vitro, with one or more agents that promote proliferation of inner ear supporting cells selected from the group consisting of: (i) a retinoid receptor signaling activator; (ii) a Wnt signaling activator set forth in Table A; (iii) a BMP signaling inhibitor set forth in Table B; (iv) a CDK activator set forth in Table C; (v) an E box-dependent transcriptional activator set forth in Table D; (vi) a Notch signaling activator set forth in Table E; (vii) an HDAC inhibitor set forth in Table F; (viii) a protein degradation inhibitor set forth in Table G; (ix) a PI3K-Akt signaling inhibitor set forth in Table H; and (x) a CREB activator set forth in Table I;

(108) (b) optionally contacting the expanded population of inner ear supporting cells with one or more agents that promote differentiation of inner ear supporting cells into inner ear hair cells selected from the group consisting of: (i) a retinoid receptor signaling activator; (ii) a Wnt signaling activator set forth in Table A; (iii) a BMP signaling inhibitor set forth in Table B; (iv) a CDK activator set forth in Table C; (v) an E box-dependent transcriptional activator set forth in Table D; (vi) an HDAC inhibitor set forth in Table F; (vii) a protein degradation inhibitor set forth in Table G; (viii) a PI3K-Akt signaling inhibitor set forth in Table H; (ix) a CREB activator set forth in Table I; and (x) a Notch signaling inhibitor set forth in Table J; and

(109) (c) administering the inner ear hair cells to the ear (e.g., the inner ear) of the subject.

(110) The present disclosure also provides methods of treating a subject having hearing loss or balance loss by:

(111) (a) contacting one or more inner ear supporting cells, e.g., in vitro, with one or more agents that promote proliferation of inner ear supporting cells selected from the group consisting of: (i) a retinoid receptor signaling activator; (ii) a Wnt signaling activator set forth in Table A; (iii) a BMP signaling inhibitor set forth in Table B; (iv) a CDK activator set forth in Table C; (v) an E box-dependent transcriptional activator set forth in Table D; (vi) a Notch signaling activator set forth in Table E; (vii) an HDAC inhibitor set forth in Table F; (viii) a protein degradation inhibitor set forth in Table G; (ix) a PI3K-Akt signaling inhibitor set forth in Table H; and (x) a CREB activator set forth in Table I; and

(112) (b) administering the expanded population of inner ear supporting cells to the ear (e.g., the inner ear) of the subject in combination with, e.g., concurrently with or prior to administration of, one or more agents that promote differentiation of inner ear supporting cells into inner ear hair cells selected from the group consisting of: (i) a retinoid receptor signaling activator; (ii) a Wnt signaling activator set forth in Table A; (iii) a BMP signaling inhibitor set forth in Table B; (iv) a CDK activator set forth in Table C; (v) an E box-dependent transcriptional activator set forth in Table D; (vi) an HDAC inhibitor set forth in Table F; (vii) a protein degradation inhibitor set forth in Table G; (viii) a PI3K-Akt signaling inhibitor set forth in Table H; (ix) a CREB activator set forth in Table I; and (x) a Notch signaling inhibitor set forth in Table J.

(113) In some embodiments of the methods of treating a subject having a hearing loss or a balance loss described herein, (a) the one or more agents that promote proliferation of inner ear supporting cells is selected from the group consisting of: (i) a retinoid receptor signaling activator; (ii) a Wnt signaling activator set forth in Table A; (iii) a BMP signaling inhibitor set forth in Table B; (iv) a CDK activator set forth in Table C; and (v) an E box-dependent transcriptional activator set forth in Table D; and (b) the one or more agents that promote differentiation of inner ear supporting cells into inner ear hair cells is selected from the group consisting of: (i) a Wnt signaling activator set forth in Table A; (ii) an E box-dependent transcriptional activator set forth in Table D; (iii) an HDAC inhibitor set forth in Table F; (iv) a protein degradation inhibitor set forth in Table G; and (v) a Notch signaling inhibitor set forth in Table J.

(114) In some embodiments, the retinoid receptor signaling activator is an RAR agonist set forth in Table K or an RXR agonist set forth in Table K. In some embodiments, the inner ear supporting cells are Lgr5+ inner ear supporting cells. In some embodiments, the inner ear hair cells are Atoh1+ inner ear hair cells.

(115) In some embodiments of the methods of treating a subject described herein, the subject has a balanced loss. In some embodiments of the methods of treating a subject described herein, the subject has hearing loss (e.g., sensorineural hearing loss). In some embodiments, the hearing loss is the result of a genetic or congenital defect, trauma, aging, or chemical-induced ototoxicity.

(116) In some embodiments of the methods of treating a subject described herein, the subject is a human.

(117) In general, compounds and methods described herein can be used to generate hair cell growth (e.g., Atoh1+ inner ear hair cell growth) in the ear and/or to increase the number of hair cells in the ear (e.g., in the inner, middle, and/or outer ear). For example, the number of hair cells in the ear can be increased about 2-, 3-, 4-, 6-, 8-, or 10-fold, or more, as compared to the number of hair cells before treatment. This new hair cell growth can effectively restore or establish at least a partial improvement in the subject's ability to hear. For example, administration of an agent can improve hearing loss by about 5, 10, 15, 20, 40, 60, 80, 100% or more.

(118) A number of compounds that support or promote the proliferation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) and/or promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cell) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells) are set forth in Table 1.

(119) A number of compounds that support or promote the proliferation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) are described herein, and include one or more of TTNPB, Compound A, Compound B, Compound C, 1-Azakenpaullone, BIO, WAY-316606, LDN-193189, and Alsterpaullone.

(120) A number of compounds that promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cell) into to inner ear hair cells (e.g., Atoh1+ inner ear hair cells) are described herein, and include one or more of vorinostat, Compound A, Compound B, Compound C, 1-Azakenpaullone, BIO, WAY-262611, NP031112, MG-132, IM-12, Trichostatin A, HLY78, and PF03084014.

(121) Other examples of compounds that promote the proliferation and expansion of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) include, but are not limited to, a retinoid receptor signaling activator (see, e.g., Table K); a Wnt signaling activator set forth in Table A; a bone morphogenetic protein (BMP) signaling inhibitor set forth in Table B; a cyclin-dependent kinase (CDK) activator set forth in Table C; an E box-dependent transcriptional activator set forth in Table D; a Notch signaling activator set forth in Table E; a histone deacetylase (HDAC) inhibitor set forth in Table F; a protein degradation inhibitor set forth in Table G; a PI3K-Akt signaling inhibitor set forth in Table H; and a cAMP response element binding protein (CREB) activator set forth in Table I.

(122) Other examples of compounds that promote the differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) into inner ear hair cells (e.g., Atoh1+ inner ear hair cells) include, but are not limited to, a retinoid receptor signaling activator (see, e.g., Table K); a Wnt signaling activator set forth in Table A; a BMP signaling inhibitor set forth in Table B; a CDK activator set forth in Table C; an E box-dependent transcriptional activator set forth in Table D; an HDAC inhibitor set forth in Table F; a protein degradation inhibitor set forth in Table G; a PI3K-Akt signaling inhibitor set forth in Table H; a CREB activator set forth in Table I; and a Notch signaling inhibitor set forth in Table J.

(123) Where appropriate, following treatment, a human can be tested for an improvement in hearing or in other symptoms related to inner ear disorders. Methods for measuring hearing are well-known and include pure tone audiometry, air conduction, and bone conduction tests. These exams measure the limits of loudness (intensity) and pitch (frequency) that a human can hear. Hearing tests in humans include behavioral observation audiometry (for infants to seven months), visual reinforcement orientation audiometry (for children 7 months to 3 years) and play audiometry for children older than 3 years. Oto-acoustic emission testing can be used to test the functioning of the cochlea hair cells, and electro-cochleography provides information about the functioning of the cochlea and the first part of the nerve pathway to the brain. In some embodiments, treatment can be continued with or without modification or can be stopped.

(124) Pharmaceutical Compositions

(125) In some embodiments, one or more compounds for the promotion of proliferation and/or differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) as described herein can be formulated as a pharmaceutical composition. Pharmaceutical compositions containing one or more compounds as described herein can be formulated according to the intended method of administration.

(126) One or more compounds for the promotion of proliferation and/or differentiation of inner ear supporting cells (e.g., Lgr5+ inner ear supporting cells) as described herein can be formulated as pharmaceutical compositions for direct administration to a subject. Pharmaceutical compositions containing one or more compounds can be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. For example, a pharmaceutical composition can be formulated for local or systemic administration, e.g., administration by drops (e.g., otic drops) or injection into the ear, insufflation (such as into the ear), intravenous, topical, or oral administration.

(127) The nature of the pharmaceutical compositions for administration is dependent on the mode of administration and can readily be determined by one of ordinary skill in the art. In some embodiments, the pharmaceutical composition is sterile or sterilizable. The therapeutic compositions featured in the invention can contain carriers or excipients, many of which are known to skilled artisans. Excipients that can be used include buffers (for example, citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, polypeptides (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, water, and glycerol. The nucleic acids, polypeptides, small molecules, and other modulatory compounds featured in the invention can be administered by any standard route of administration. For example, administration can be parenteral, intravenous, subcutaneous, or oral.

(128) A pharmaceutical composition can be formulated in various ways, according to the corresponding route of administration. For example, liquid solutions can be made for administration by drops into the ear, for injection, or for ingestion; gels or powders can be made for ingestion or topical application. Methods for making such formulations are well known and can be found in, for example, Remington: The Science and Practice of Pharmacy, 22.sup.nd Ed., Allen, ed., Mack Publishing Co., Easton, Pa., 2012.

(129) One or more of the compounds can be administered, e.g., as a pharmaceutical composition, directly and/or locally by injection or through surgical placement, e.g., to the inner ear. The amount of the pharmaceutical composition may be described as the effective amount or the amount of a cell-based composition may be described as a therapeutically effective amount. Where application over a period of time is advisable or desirable, the compositions of the invention can be placed in sustained released formulations or implantable devices (e.g., a pump).

(130) Alternatively or in addition, the pharmaceutical compositions can be formulated for systemic parenteral administration by injection, for example, by bolus injection or continuous infusion. Such formulations can be presented in unit dosage form, for example, in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use.

(131) In addition to the formulations described previously, the compositions can also be formulated as a depot preparation. Such long acting formulations can be administered by implantation (e.g., subcutaneously). Thus, for example, the compositions can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

(132) Pharmaceutical compositions formulated for systemic oral administration can take the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (for example, pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (for example, lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (for example, magnesium stearate, talc or silica); disintegrants (for example, potato starch or sodium starch glycolate); or wetting agents (for example, sodium lauryl sulphate). The tablets can be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (for example, sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (for example, lecithin or acacia); non-aqueous vehicles (for example, almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (for example, methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate. Preparations for oral administration may be suitably formulated to give controlled release of the active compound.

(133) In some embodiments, the pharmaceutical compositions described herein can include one or more of the compounds formulated according to any of the methods described above, and one or more cells obtained to the methods described herein.

EXAMPLES

(134) The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

Example 1. Drug Screening for Agents that Promote Proliferation and Differentiation

(135) Two mouse strains were used to develop a screen for agents that promote the proliferation or differentiation of Lgr5-expressing cells. Each strain contained a fluorescent marker for the either the detection of Lgr5 expressing cells or Atoh1 expressing hair cells. Lgr5-EGFP-IRES-Cre-ER mice were used to monitor the proliferation of Lgr5+ cells (Barker, N. et al. Identification of stem cells in small intestine and colon by marker gene Lgf5. Nature 449, 1003-1007 (2007)). This strain was then crossed with Rosa26-td-Tomato reporter mice (Madisen, L. et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci 13, 133-140 (2010)) to create a mouse line that enabled lineage tracing of the cells that resulted from differentiated Lgr5-expressing cells. Atoh1-nGFP mice were used to identify differentiated hair cells (Lumpkin, E. A. et al. Math1-driven GFP expression in the developing nervous system of transgenic mice. Gene Expr Patterns 3, 389-395 (2003)).

(136) Lgr5+ cells from both the Lgr5-GFP+ and Atoh1-GFP+ reporter mice were obtained as follows. Cochleae from neonatal mice (postnatal days 1-3) were dissected in HBSS and the organ of Corti was separated from the stria vascularis and the modiolus. The organs of Corti were then treated with Cell Recovery Solution (Corning) for 1 hour to separate cochlear epithelium from the underlying mesenchyme. Epithelia were then collected and treated with TrypLE (Life Technologies) for 15-20 minutes at 37° C. Single cells obtained by mechanical trituration were filtered (40 μm) and suspended in Matrigel for 3D culture. Matrigel is a reconstituted basement membrane preparation extracted from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma, a tumor rich in extracellular matrix proteins, and is approximately 60% laminin, 30% collagen IV, and 8% entactin. The resulting cells were separately cultured in 24 well plates for 5 days at a concentration of 1 cochlea per well using 1:1 mixture of DMEM and F12, supplemented with Glutamax (GIBCO), N2, B27 (Invitrogen), EGF (50 ng/mL; Chemicon), bFGF (50 ng/mL; Chemicon), IGF1 (50 ng/mL; Chemicon) and small molecules including CHIR99021 (3 μM; LC Labs), VPA (1 mM; Sigma), pVc (100 μg/ml; Sigma), and 616452 (2 μM; Calbiochem). Media were changed every other day.

(137) To assess the degree of proliferation of the Lgr5+ cells, 200 μl of cell dissociation solution was then added to each well of the Lgr5-GFP+ cells and incubated for 45 minutes and then TrypleE for 20 minutes. Cell cultures were then transferred to a 15 ml falcon tube for centrifugation. Supernatant was then removed and the cell culture was re-suspended in matrigel once again. Cells were distributed into a 96 well plate with approximately 5000 cells per well. The Lgr5-GFP+ cultures were then treated with DMEM/F12 media containing from nanomolar to micromolar concentrations, e.g., 0.001, 0.005 μM, 0.01 μM, 0.1 μM, 1 μM, 10 μM, 50 μM, or 100 μM, of a candidate drug for an additional 5 days (See FIG. 1). At that point the Lgr5-GFP+ cells were sorted using FACS and the fluorescence was measured (See FIGS. 3 and 4).

(138) To assess the degree of differentiation of the Lgr5+ cells into hair cells, the Atoh1-nGFP cells were cultured for 2 more days (a total of 7 days) in the DMEM/F12 media containing EGF, bFGF, IGF, pVc, VPA, and CHIR99021 (as above, a 1:1 mixture of DMEM and F12, supplemented with Glutamax (GIBCO), N2, B27 (Invitrogen), EGF (50 ng/mL; Chemicon), bFGF (50 ng/mL; Chemicon), IGF1 (50 ng/mL; Chemicon) and small molecules including CHIR99021 (3 μM), VPA (1 mM), pVc (100 μg/ml), and 616452 (2 μM). Media were changed every other day. 4-hydroxytamoxifen (20 ng/ml) was added to cultures on day 0 for lineage tracing studies) (See FIG. 2). After the 7-day incubation, 200 μl of cell dissociation solution was added to each well and incubated for 45 minutes and then TrypleE for 20 minutes. Cell cultures were then transferred to a 15 ml falcon tube for centrifugation. Supernatant was then removed and the cell culture was re-suspended in matrigel once again. Cells were distributed into a 96 well plate with approximately 5000 cells per well. The cells were then treated with DMEM/F12 media containing the candidate drug. After 10 days of incubating with the candidate drug, the cells were sorted by FACS and the fluorescence levels of the Atoh1-nGFP cells were measured (see FIG. 5). CHIR99021, a GSK-3β inhibitor of the Wnt pathway, and LY411575 a γ-secretase inhibitor of the Notch pathway were used as positive controls for this screen (see WO2014159356 and FIG. 5). This method of screening was used to screen drugs, compounds, genes, and growth factors (see Table 1).

(139) TABLE-US-00013 TABLE 1 Screening agents Name Target CHIR-99021 (6-(2-(4-(2,4-dichlorophenyl)-5- Wnt (GSK3β) (4-methyl-1H-imidazol-2-yl)pyrimidin-2- ylamino)ethylamino)nicotinonitrile hydrochloride) LY411575 (Benzeneacetamide, N-[(1S)-2- Notch (γ-Secretase) [[(7S)-6,7-dihydro-5-methyl-6-oxo-5H- dibenz[b,d]azepin-7-yl]amino]-1-methyl-2- oxoethyl]-3,5-difluoro-α-hydroxy-,(αS)-) Vorinostat (N1-hydroxy-N8-phenyl- pan-HDAC octanediamide) TTNPB (Ro 13-7410) (Arotinoid Acid) RAR Cerivastatin (sodium salt) (3R,5S,6E)-7-[4-(4- P27 fluorophenyl)-5-(methoxymethyl)-2,6- bis(propan-2-yl)pyridin-3-yl]-3,5- dihydroxyhept-6-enoic acid) Compound A (See FIG. 7) ATOH1 Compound B (See FIG. 7) ATOH1 Compound C (See FIG. 7) ATOH1 1-Azakenpaullone ATOH1 (Pyrido[3′,2′:2,3]azepino[4,5-b]indol-6(5H)- one,9-bromo-7,12-dihydro-) (2′Z,3′E)-6-Bromoindirubin-3′-oxime (BIO) Wnt (GSK3β) MK-0752 (3-((1r,4s)-4-(4- Notch (γ-Secretase) chlorophenylsulfonyl)-4-(2,5- difluorophenyl)cyclohexyl)propanoic acid) WAY-262611 ((1-(4-(Naphthalen-2- Wnt (β-catenin) yl)pyrimidin-2-yl)piperidin-4-yl)methanamine) NP031112 (Tideglusib) (4-benzyl-2- Wnt (GSK3β) naphthalen-1-yl-1,2,4-thiadiazolidine-3,5- dione) WAY-316606 (5-(benzenesulfonyl)-N- Wnt (sFRP-1) piperidin-4-yl-2- (trifluoromethyl)benzenesulfonamide) LDN-193189 (4-(6-(4-(piperazin-1- BMP receptor yl)phenyl)pyrazolo[1,5-a]pyrimidin-3- yl)quinoline) Alsterpaullone, 2 Cyanoethyl (3-(9-nitro-6-oxo- P27 (Kip1) 7,12-dihydro-5H-indolo[3,2-d][1]benzazepin-2- yl)propanenitrile) MLN4924 (pevonedistat) ([(1S,2S,4R)-4-[4- AKT [[(1S)-2,3-dihydro-1H-inden-1- yl]amino]pyrrolo[2,3-d]pyrimidin-7-yl]-2- hydroxycyclopentyl]methyl sulfamate) MG 132 (Carbobenzoxy-L-leucyl-L-leucyl-L- Proteosome Inhibitor leucinal) IM-12 (3-(4-Fluorophenylethylamino)-1- Wnt (GSK3β) methyl-4-(2-methyl-1H-indol-3-yl)-1H-pyrrole- 2,5-dione) Trichostatin A ((2E,4E,6R)-7-[4- pan-HDAC (dimethylamino)phenyl]-N-hydroxy-4,6- dimethyl-7-oxohepta-2,4-dienamide) HLY78 (4-Ethyl-5,6-Dihydro-5-methyl- Wnt [1,3]dioxolo[4,5-j]phenanthridine,4-Ethyl-5- methyl-5,6-dihydro-[1,3]dioxolo[4,5- j]phenanthridine) DMHI (4-(6-(4- BMP1 isopropoxyphenyl)pyrazolo[1,5-a]pyrimidin-3- yl)quinoline) 2-(N)-benzyl ellipticene ATOH1 AC102 (6-Fluor-9-methyl-β-carbolin, see PKC/CREB WO2015044434) BI8622 (See FIG. 7) HUWE1 PF-03084014 ((S)-2-(((S)-6,8-difluoro-1,2,3,4- Notch (γ-Secretase) tetrahydronaphthalen-2-yl)amino)-N-(1-(2- methyl-1-(neopentylamino)propan-2-yl)-1H- imidazol-4-yl)pentanamide)

(140) The results, shown in FIGS. 3-5 showed that a number of compounds screened were able to effectively induce proliferation or differentiation. Tables 2 and 3 list the top compounds for proliferation and differentiation, respectively.

(141) TABLE-US-00014 TABLE 2 Compounds selected for ability to enhance proliferation of Lgr5+ cells CHIR99021 GSK3β inhibitor TTNPB retinoid acid receptor agonist Compound A Atoh1 stimulating compound Compound B Atoh1 stimulating compound Compound C Atoh1 stimulating compound 1-Azakenpaullone Atoh1 stimulating compound BIO GSK-3β inhibitor WAY-316606 sFRP-1 (secreted frizzled-related 1) inhibitor LDN-193189 BMP receptor inhibitor Alsterpaullone, 2 Cyanoethyl p27 Kip1 inhibitor

(142) TABLE-US-00015 TABLE 3 Compounds selected for ability to enhance differentiation of Lgr5+ cells into Atoh1+ cells CHIR99021 GSK3β inhibitor LY411575 gamma-secretase inhibitor vorinostat class I, II and IV HDAc inhibitor Compound A Atoh1 stimulating compound Compound B Atoh1 stimulating compound Compound C Atoh1 stimulating compound 1-Azakenpaullone Atoh1 stimulating compound BIO GSK-3β inhibitor WAY-262611 dickopf inhibitor NP031112 GSK3β inhibitor MG-132 proteasome inhibitor IM-12 GSK3β inhibitor Trichostatin A class I and II HDAC inhibitor HLY78 Wnt signal transduction activator PF03084014 gamma-secretase inhibitor

Example 2. Drug Screening for Agents for the Treatment of Hearing Loss Associated with the Loss of Cochlear Hair Cells

(143) A novel transgenic mouse is made that contains two florescent reporters stably integrated into the genome of the mouse (Lgr5/Atoh1 reporter mice). The Lgr5/Atoh1 reporter mice are made by starting with oocytes from a transgenic mouse that has GFP under the control of a Lgr5 promoter (Barker et al., supra) and adding a plasmid comprising mCherry under the control of an Atoh1 enhancer and a promoter (e.g., an SV40 or globin minimal promoter) (see FIG. 6).

(144) The sequence of the Atoh1 enhancer used in these constructs is as follows:

(145) TABLE-US-00016 (SEQ ID NO: 1) TCCAAGGTCCGGCAATGAAGTTTGCATAACAAACGTTTGGCAGCTCCCTC TCTCACACCCCATTAACAAGCTGTAACATATAGCTGCAGGTTGCTATAAT CTCATTAATATTTTGGAAACTTGAATATTGAGTATTTCTGAGCGCTCATT CCCCATATGCCAGACCACTCCTGCCATGCTGACTGGTTCCTTTCTCTCCA TTATTAGCAATTAGCTTCTACCTTCCAAAGTCAGATCCAAGTATCTAAGA TACTACCAAAGGCATCAACTATGTATGCAAGTTAGGCATGCTTAATATCA CCCAAACAAACAAAGAGTCAGCACTTCTTAAAGTAATGAAGATAGATAAA TCGGGTTAGTTCTTTGGGACACCGCTGTTGTTTTCCAGAGTTTTTCTATA CTTTAAGCAGCTTGTTTTATATTCTGTCTTTGCCCTCAGCCAGCTAACAT TTTATTTGTTGAGGGTTTTGGCTCACCACACTTTTGGAAACTTATTTGAT TTCACGGGGAGCTGAAGGAAGATTGTTTTTGGCAACAGGCAAGTTTAACA CGTTCTTCATGGGGCATTGCGAATGGCACATCTACCAGAAAGGGAGGGGG AGTAACTTCCTCGTGCTGAACCAGCAGGAGACCAGAGCTTTCCTGAGGTC TTCCTATTGATTTTAAAGATTTAAAACTGAGCCCCAAAGTTGTAATGTTA TTGAAGTTTGTCTTGGAATATACATCTCCTCTGCTAACTTAAAAGTTCAA GAAAGGAAAGGAAAGAAATAGAACCCCTTGCTAACTACAACCTAGACTGA GAGGTGAAGATCGCGGGCAAAGACAGGTGGTCACTGAAACGTTTGCAGTT CTTTTCTTCCGAAGGCTTAGGACACAGGGTAAGGAGGAGCTAAAATAAAG CCGAGTGTACGTTTAGTCTTCTCTGCACCCCAGGCCTAGTGTCTCCCCAG GCAAGGAGTCACCCCCTTTGCTTCTGGCTCCTAACTGAAAAAGGCAAAAG GGAGTGGAGAATGGGTTAAATCCCAGGACACAGGGGAGAGGCAGGGGAGG AGAGAAGTCGGAGGAAGATAAAGGAAAGGACAGGAACCAAGAAGCGTGGG GGTAGTTTGCCGTAATGTGAGTGTTTCTTAATTAGAGAGCGGCTGACAAT AGAGGGGCTGGCAGAGGCTCCTGGCCCCGGTGCGGAGCGTCTGGAGCGGA GCACGCGCTGTCAGCTGGTGAGCGCACTCGCTTTCAGGCCGCTCCCCGGG GAGCTGAGCGGCCACATTTAACACCGTCGTCACCCTCCCCGGCCTCCTCA ACATCGGCCTCCTCCTCGTAGACAGCCTTGCTCGGCCCCCCACCGGCAGA GTTTACAGAAGCCAGAGCCTCTCGCCGTTCCCCCGCATTCGCCCGGG

(146) The sequence of the Atoh1-mCherry plasmid is as follows:

(147) TABLE-US-00017 (SEQ ID NO: 2) GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTTCCAAGGTC CGGCAATGAAGTTTGCATAACAAACGTTTGGCAGCTCCCTCTCTCACACC CCATTAACAAGCTGTAACATATAGCTGCAGGTTGCTATAATCTCATTAAT ATTTTGGAAACTTGAATATTGAGTATTTCTGAGCGCTCATTCCCCATATG CCAGACCACTCCTGCCATGCTGACTGGTTCCTTTCTCTCCATTATTAGCA ATTAGCTTCTACCTTCCAAAGTCAGATCCAAGTATCTAAGATACTACCAA AGGCATCAACTATGTATGCAAGTTAGGCATGCTTAATATCACCCAAACAA ACAAAGAGTCAGCACTTCTTAAAGTAATGAAGATAGATAAATCGGGTTAG TTCTTTGGGACACCGCTGTTGTTTTCCAGAGTTTTTCTATACTTTAAGCA GCTTGTTTTATATTCTGTCTTTGCCCTCAGCCAGCTAACATTTTATTTGT TGAGGGTTTTGGCTCACCACACTTTTGGAAACTTATTTGATTTCACGGGG AGCTGAAGGAAGATTGTTTTTGGCAACAGGCAAGTTTAACACGTTCTTCA TGGGGCATTGCGAATGGCACATCTACCAGAAAGGGAGGGGGAGTAACTTC CTCGTGCTGAACCAGCAGGAGACCAGAGCTTTCCTGAGGTCTTCCTATTG ATTTTAAAGATTTAAAACTGAGCCCCAAAGTTGTAATGTTATTGAAGTTT GTCTTGGAATATACATCTCCTCTGCTAACTTAAAAGTTCAAGAAAGGAAA GGAAAGAAATAGAACCCCTTGCTAACTACAACCTAGACTGAGAGGTGAAG ATCGCGGGCAAAGACAGGTGGTCACTGAAACGTTTGCAGTTCTTTTCTTC CGAAGGCTTAGGACACAGGGTAAGGAGGAGCTAAAATAAAGCCGAGTGTA CGTTTAGTCTTCTCTGCACCCCAGGCCTAGTGTCTCCCCAGGCAAGGAGT CACCCCCTTTGCTTCTGGCTCCTAACTGAAAAAGGCAAAAGGGAGTGGAG AATGGGTTAAATCCCAGGACACAGGGGAGAGGCAGGGGAGGAGAGAAGTC GGAGGAAGATAAAGGAAAGGACAGGAACCAAGAAGCGTGGGGGTAGTTTG CCGTAATGTGAGTGTTTCTTAATTAGAGAGCGGCTGACAATAGAGGGGCT GGCAGAGGCTCCTGGCCCCGGTGCGGAGCGTCTGGAGCGGAGCACGCGCT GTCAGCTGGTGAGCGCACTCGCTTTCAGGCCGCTCCCCGGGGAGCTGAGC GGCCACATTTAACACCGTCGTCACCCTCCCCGGCCTCCTCAACATCGGCC TCCTCCTCGTAGACAGCCTTGCTCGGCCCCCCACCGGCAGAGTTTACAGA AGCCAGAGCCTCTCGCCGTTCCCCCGCATTCGCCCGGGTCTAGAATGGTG AGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTT CAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGG GCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAG GTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCA GTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCG ACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATG AACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCA GGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCT CCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCC GAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAG GCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCT ACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATC AAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTA CGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACA AGTAATCTAGAGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGATAAGAT ACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGC TTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAG CTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGG TTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAA TGTGGTAAAATCGATAAGGATCCGTCGACCGATGCCCTTGAGAGCCTTCA ACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCA CTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGC GCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGA ATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGG CCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGC CCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAA CCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG TGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCT CAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCC CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCC AACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAG GATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGT GGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTG CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAA ACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTA CGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGG TCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAG ATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTT TTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAA TGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATC CATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCT TACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCG GCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAG AAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCC GGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT GCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTC ATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGT TGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGT AAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTC TCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACT CAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC CCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGT GCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTAC CGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCT TCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAG GCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATAC TCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGG GGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCG GCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACA CTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCT CGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTT TAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGAT TAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCG CCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAA CTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGG ATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAA ATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTGCCATTCGC CATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCG CTATTACGCCAGCCCAAGCTACCATGATAAGTAAGTAATATTAAGGTACG GGAGGTACTTGGAGCGGCCGCAATAAAATATCTTTATTTTCATTACATCT GTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATC AAAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCA AGTGCAGGTGCCAGAACATTTCTCTATCGATACATA

(148) Stem cells from this mouse are isolated from the inner ear, suspended in matrigel and cultured in DMEM/F12 media containing EFG, bFGF, IGF, pVc and VPACHIR in a 24 well plate for up to 5 days. After 5 days, 200 μl of cell dissociation solution is added to each well and incubated for 45 minutes and then TrypleE for 20 minutes. Cell cultures are then transferred to a 15 ml falcon tube for centrifugation. Supernatant is then removed and the cell culture is re-suspended in matrigel once again. Cells are then distributed into a 96 well plate with approximately 5000 cells per well.

(149) The cell culture is then treated with DMEM/F12 media containing a candidate drug for an addition 5-7 days. At that point the cells are sorted using FACS and the fluorescence of both markers is measured. Those candidate drugs that increase the fluorescence of both markers in the transgenic mouse cells when compared to an untreated transgenic control cell are selected as candidate agents for the treatment of hearing loss associated with the loss of cochlear hair cells (e.g., cochlear hair cells in the inner ear). This method of screening is used to screen drugs, compounds, genes, or growth factors.

REFERENCES

(150) 1. Cox, B. C. et al. Spontaneous hair cell regeneration in the neonatal mouse cochlea in vivo. Development 141, 816-829 (2014). 2. Fujioka, M., Okano, H. & Edge, A. S. Manipulating cell fate in the cochlea: a feasible therapy for hearing loss. Trends Neurosci (2015). 3. Davis, A. C. Hearing disorders in the population: first phase findings of the MRC National Study of Hearing. Hearing science and hearing disorders 35 (1983). 4. Chai, R. et al. Wnt signaling induces proliferation of sensory precursors in the postnatal mouse cochlea. Proc Natl Acad Sci USA 109, 8167-8172 (2012). 5. Shi, F., Kempfle, J. S. & Edge, A. S. Wnt-responsive lgr5-expressing stem cells are hair cell progenitors in the cochlea. J Neurosci 32, 9639-9648 (2012). 6. Shi, F., Hu, L. & Edge, A. S. Generation of hair cells in neonatal mice by beta-catenin overexpression in Lgr5-positive cochlear progenitors. Proc Natl Acad Sci USA 110, 13851-13856 (2013). 7. Shi, F., Cheng, Y. F., Wang, X. L. & Edge, A. S. Beta-catenin up-regulates Atoh1 expression in neural progenitor cells by interaction with an Atoh1 3′ enhancer. J Biol Chem 285, 392-400 (2010). 8. Edge, A. S. & Chen, Z. Y. Hair cell regeneration. Curr Opin Neurobiol 18, 377-382 (2008). 9. Kelley, M. W. Regulation of cell fate in the sensory epithelia of the inner ear. Nat Rev Neurosci 7, 837-849 (2006). 10. Bramhall, N. F., Shi, F., Arnold, K., Hochedlinger, K. & Edge, A. S. Lgr5-positive supporting cells generate new hair cells in the postnatal cochlea. Stem Cell Reports 2, 311-322 (2014). 11. Oshima, K. et al. Differential distribution of stem cells in the auditory and vestibular organs of the inner ear. J Assoc Res Otolaryngol 8, 18-31 (2007). 12. Mizutari, K. et al. Notch inhibition induces cochlear hair cell regeneration and recovery of hearing after acoustic trauma. Neuron 77, 58-69 (2013).

Other Embodiments

(151) It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.