Immunogenic compositions and use thereof
12419948 ยท 2025-09-23
Assignee
- The Broad Institute, Inc. (Cambridge, MA)
- President And Fellows Of Harvard College (Cambridge, MA)
- The General Hospital Corporation (Boston, MA)
- Trustees Of Boston University (Boston, MA)
Inventors
- Pardis Sabeti (Cambridge, MA, US)
- Shira Weingarten-Gabbay (Cambridge, MA, US)
- Susan Klaeger (Cambridge, MA, US)
- Jenn Abelin (Cambridge, MA, US)
- Mohsan Saeed (Boston, MA, US)
- Nir HACOHEN (Boston, MA, US)
- Siranush Sarkizova (Cambridge, MA, US)
- Steven Carr (Cambridge, MA, US)
- Karl Clauser (Cambridge, MA, US)
Cpc classification
A61K39/215
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
G01N2500/04
PHYSICS
C12N2770/20034
CHEMISTRY; METALLURGY
International classification
A61K39/215
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
Abstract
Immunogenic compositions comprising one or more polypeptides, wherein the one or more polypeptides: is capable of binding to Major Histocompatibility Complex (MHC) class I, and is derived from one or more proteins of SARS-COV-2. Also provided include methods of treating and preventing diseases using the immunogenic compositions.
Claims
1. An immunogenic composition comprising: one or more vectors each comprising one or more polynucleotides encoding one or more polypeptides, wherein the one or more polypeptides: a. is capable of binding to Major Histocompatibility Complex (MHC) class I, b. is derived from one or more proteins of SARS-COV-2 by expression of an internal out-of-frame open reading frame (ORF) of SARS-COV-2, wherein the internal out-of-frame ORF is S.iORF1 or S.iORF2, and c. wherein at least one polypeptide of the one or more polypeptides derived from expression of S.iORF1 is MLLGSMLYM (SEQ ID NO: 4); or wherein at least one polypeptide of the one or more polypeptides is derived from expression of S.iORF1 or S.iORF2 is GPMVLRGLIT (SEQ ID NO: 6) or GLITLSYHL (SEQ ID NO: 5).
2. The immunogenic composition of claim 1, wherein the MHC class I is Human Leukocyte Antigen class I (HLA-I).
3. The immunogenic composition of claim 2, wherein the HLA-I is encoded by an HLA allele having a prediction rank score ranking cut-off of 0.1% or greater as determined with HLAthena.
4. The immunogenic composition of claim 2, wherein the HLA-1 is encoded by HLA-A*02:01, HLA-A*25:01, HLA-A*30:01, HLA-B*18:01, HLA-B*44:03, HLA-C*12:03, HLA-B*16:01, HLA-A*02:01, HLA-B*07:02, HLA-C*07:02; HLA-A*01:01; HLA-A*02:06; HLA-A*26:01; HLA-A*02:07; HLA-A*29:02; HLA-A*02:03; HLA-A*30:02; HLA-A*32:01; HLA-A*68:02; HLA-A*02:05; HLA-A*02:02; HLA-A*36:01; HLA-A*02:11; HLA-A*02:04; HLA-B*35:01; HLA-B*51:01; HLA-B*40:01; HLA-B*40:02; HLA-B*07:02; HLA-B*07:04; HLA-B*08:01; HLA-B*13:01; HLA-B*46:01; HLA-B*52:01; HLA-B*44:02; HLA-B*40:06; HLA-B*13:02; HLA-B*56:01; HLA-B*54:01; HLA-B*15:02; HLA-B*35:07; HLA-B*27:05; HLA-B*15:03; HLA-B*42:01; HLA-B*55:02; HLA-B*45:01; HLA-B*50:01; HLA-B*35:03; HLA-B*49:01; HLA-B*58:02; HLA-B*15:17; HLA-C*57:02; HLA-C*04:01; HLA-C*03:04; HLA-C*01:02; HLA-C*07:01; HLA-C*06:02; HLA-C*03:03; HLA-C*08:01; HLA-C*15:02; HLA-C*12:02; HLA-C*02:02; HLA-C*05:01; HLA-C*03:02; HLA-C*16:01; HLA-C*08:02; HLA-C*04:03; HLA-C*17:01; or HLA-C*17:04.
5. The immunogenic composition of claim 2, wherein the HLA-1 is encoded by HLA-A*02:01, HLA-A*25:01, HLA-A*30:01, HLA-B*18:01, HLA-B*44:03, HLA-C*12:03, HLA-B*16:01, HLA-A*02:01, HLA-B*07:02, or HLA-C*07:02.
6. The immunogenic composition of claim 1, wherein one or more of the one or more polypeptides is capable of stimulating a T-cell response.
7. The immunogenic composition of claim 1, wherein at least one polypeptide of the one or more polypeptides derived from expression of S.iORF1 or S.iORF2 comprises one or more oxidized methionines.
8. The immunogenic composition of claim 7, wherein the at least one polypeptide is SEQ ID NO: 193 or 204.
9. The immunogenic composition of claim 1, wherein the one or more polypeptides are expressed and/or is bound by MHC-I 0-12, 0-11, 0-10, 0-9, 0-8, 0-7, 0-6, 0-5, 0-4, 0-3, 0-2, or 0-1 hours post infection.
10. The immunogenic composition of claim 1, wherein the immunogenic composition is a synthetic mRNA vaccine.
11. The immunogenic composition of claim 1, further comprising one or more SARS-COV-2 antigenic polypeptides capable of stimulating production of an antibody targeting SARS-COV-2, or one or more polynucleotides encoding the one or more SARS-COV-2 antigenic polypeptides.
12. The composition of claim 11, wherein the one or more SARS-CoV-2 antigenic polypeptides are from a nucleocapsid phosphoprotein of SARS-COV-2, a spike glycoprotein of SARS-COV-2, or a combination thereof.
13. A therapeutic composition comprising: the immunogenic composition of claim 1; one or more SARS-COV-2 antigenic polypeptides capable of stimulating production of an antibody targeting SARS-COV-2, or one or more polynucleotides encoding the one or more SARS-COV-2 antigenic polypeptides; and an anti-viral therapeutic.
14. The composition of claim 13, wherein the immunogenetic composition is formulated as a synthetic mRNA vaccine and wherein one or more polynucleotides encoding the one or more antigenic polypeptides are mRNA.
15. A method of treating or inhibiting a SARS-CoV-2 infection in a subject in need thereof comprising: administering, to the subject in need thereof, the immunogenic composition of claim 1 and one or more antigenic components capable of stimulating production of an antibody targeting SARS-COV-2; and an anti-viral therapeutic.
16. An immunogenic composition comprising: a delivery vehicle comprising: one or more polypeptides, one or more polynucleotides each encoding one or more of the one or more polypeptides, or any combination thereof, wherein the one or more polypeptides: a. is capable of binding to Major Histocompatibility Complex (MHC) class I, and b. is derived from one or more proteins of SARS-COV-2 by expression of an internal out-of-frame open reading frame (ORF) of SARS-COV-2, wherein the internal out-of-frame ORF is S.iORF1 or S.iORF2, and wherein at least one polypeptide of the one or more polypeptides derived from expression of S.iORF1 is MLLGSMLYM (SEQ ID NO: 4); or wherein at least one polypeptide of the one or more polypeptides is derived from expression of S.iORF1 or S.iORF2 is GPMVLRGLIT (SEQ ID NO: 6) or GLITLSYHL (SEQ ID NO: 5).
17. The immunogenic composition of claim 16, wherein the MHC class I is Human Leukocyte Antigen class I (HLA-I).
18. The immunogenic composition of claim 17, wherein the HLA-1 is encoded by HLA-A*02:01, HLA-A*25:01, HLA-A*30:01, HLA-B*18:01, HLA-B*44:03, HLA-C*12:03, HLA-B*16:01, HLA-A*02:01, HLA-B*07:02, HLA-C*07:02; HLA-A*01:01; HLA-A*02:06; HLA-A*26:01; HLA-A*02:07; HLA-A*29:02; HLA-A*02:03; HLA-A*30:02; HLA-A*32:01; HLA-A*68:02; HLA-A*02:05; HLA-A*02:02; HLA-A*36:01; HLA-A*02:11; HLA-A*02:04; HLA-B*35:01; HLA-B*51:01; HLA-B*40:01; HLA-B*40:02; HLA-B*07:02; HLA-B*07:04; HLA-B*08:01; HLA-B*13:01; HLA-B*46:01; HLA-B*52:01; HLA-B*44:02; HLA-B*40:06; HLA-B*13:02; HLA-B*56:01; HLA-B*54:01; HLA-B*15:02; HLA-B*35:07; HLA-B*27:05; HLA-B*15:03; HLA-B*42:01; HLA-B*55:02; HLA-B*45:01; HLA-B*50:01; HLA-B*35:03; HLA-B*49:01; HLA-B*58:02; HLA-B*15:17; HLA-C*57:02; HLA-C*04:01; HLA-C*03:04; HLA-C*01:02; HLA-C*07:01; HLA-C*06:02; HLA-C*03:03; HLA-C*08:01; HLA-C*15:02; HLA-C*12:02; HLA-C*02:02; HLA-C*05:01; HLA-C*03:02; HLA-C*16:01; HLA-C*08:02; HLA-C*04:03; HLA-C*17:01; or HLA-C*17:04.
19. The immunogenic composition of claim 17, wherein the HLA-1 is encoded by HLA-A*02:01, HLA-A*25:01, HLA-A*30:01, HLA-B*18:01, HLA-B*44:03, HLA-C*12:03, HLA-B*16:01, HLA-A*02:01, HLA-B*07:02, or HLA-C*07:02.
20. The immunogenic composition of claim 16, wherein one or more of the one or more polypeptides is capable of stimulating a T-cell response.
21. The immunogenic composition of claim 16, wherein at least one polypeptide of the one or more polypeptides derived from expression of S.iORF1 or S.iORF2 comprises one or more oxidized methionines.
22. The immunogenic composition of claim 21, wherein the at least one polypeptide is SEQ ID NO: 193 or 204.
23. The immunogenic composition of claim 16, further comprising one or more SARS-CoV-2 antigenic polypeptides capable of stimulating production of an antibody targeting SARS-CoV-2, or one or more polynucleotides encoding the one or more SARS-COV-2 antigenic polypeptides.
24. The immunogenic composition of claim 23, wherein the one or more SARS-COV-2 antigenic polypeptides are from a nucleocapsid phosphoprotein of SARS-COV-2, a spike glycoprotein of SARS-COV-2, or a combination thereof.
25. The immunogenic composition of claim 16, wherein the one or more polypeptides are expressed and/or is bound by MHC-I 0-12, 0-11, 0-10, 0-9, 0-8, 0-7, 0-6, 0-5, 0-4, 0-3, 0-2, or 0-1 hours post infection.
26. The immunogenic composition of claim 16, wherein the immunogenic composition is a synthetic mRNA vaccine.
27. The immunogenic composition of claim 26, wherein the immunogenetic composition is formulated as a synthetic mRNA vaccine and wherein one or more polynucleotides encoding the one or more antigenic polypeptides are mRNA.
28. A therapeutic composition comprising: the immunogenic composition of claim 16; one or more SARS-COV-2 antigenic polypeptides capable of stimulating production of an antibody targeting SARS-COV-2, or one or more polynucleotides encoding the one or more SARS-CoV-2 antigenic polypeptides; and an anti-viral therapeutic.
29. A method of treating or inhibiting a SARS-CoV-2 infection in a subject in need thereof comprising: administering, to the subject in need thereof, the immunogenic composition of claim 16 and one or more antigenic components capable of stimulating production of an antibody targeting SARS-COV-2; and an anti-viral therapeutic.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) An understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention may be utilized, and the accompanying drawings of which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21) The figures herein are for illustrative purposes only and are not necessarily drawn to scale.
DETAILED DESCRIPTION OF THE EXAMPLE EMBODIMENTS
(22) General Definitions
(23) Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms and techniques in molecular biology may be found in Molecular Cloning: A Laboratory Manual, 2.sup.nd edition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: A Laboratory Manual, 4.sup.th edition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (F. M. Ausubel et al. eds.); the series Methods in Enzymology (Academic Press, Inc.); PCR 2: A Practical Approach (1995) (M. J. MacPherson, B. D. Hames, and G. R. Taylor eds.); Antibodies, A Laboratory Manual (1988) (Harlow and Lane, eds.); Antibodies, A Laboratory Manual, 2.sup.nd edition 2013 (E. A. Greenfield ed.); Animal Cell Culture (1987) (R. I. Freshney, ed.); Benjamin Lewin, Genes IX, published by Jones and Bartlett, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); Singleton et al., Dictionary of Microbiology and Molecular Biology 2.sup.nd ed., J. Wiley & Sons (New York, N.Y. 1994), March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4.sup.th ed., John Wiley & Sons (New York, N.Y. 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2.sup.nd edition (2011).
(24) As used herein, the singular forms a, an, and the include both singular and plural referents unless the context clearly dictates otherwise.
(25) The term optional or optionally means that the subsequent described event, circumstance or substituent may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
(26) The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.
(27) The term about in relation to a reference numerical value and its grammatical equivalents as used herein can include the numerical value itself and a range of values plus or minus 10% from that numerical value. For example, the amount about 10 includes 10 and any amounts from 9 to 11. For example, the term about in relation to a reference numerical value can also include a range of values plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from that value.
(28) As used herein, a biological sample may contain whole cells and/or live cells and/or cell debris. The biological sample may contain (or be derived from) a bodily fluid. The present invention encompasses embodiments wherein the bodily fluid is selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof. Biological samples include cell cultures, bodily fluids, cell cultures from bodily fluids. Bodily fluids may be obtained from a mammal organism, for example by puncture, or other collecting or sampling procedures.
(29) The terms subject, individual, and patient are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
(30) The term exemplary is used herein to mean serving as an example, instance, or illustration. Any aspect or design described herein as exemplary is not necessarily to be construed as preferred or advantageous over other aspects or designs. Rather, use of the word exemplary is intended to present concepts in a concrete fashion.
(31) A protein or nucleic acid derived from a species means that the protein or nucleic acid has a sequence identical to an endogenous protein or nucleic acid or a portion thereof in the species. The protein or nucleic acid derived from the species may be directly obtained from an organism of the species (e.g., by isolation), or may be produced, e.g., by recombination production or chemical synthesis.
(32) Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment(s). Reference throughout this specification to one embodiment, an embodiment, an example embodiment, means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases in one embodiment, in an embodiment, or an example embodiment in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination.
(33) All publications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each individual publication, published patent document, or patent application was specifically and individually indicated as being incorporated by reference.
OVERVIEW
(34) T cell-mediated immunity plays an important role in controlling SARS-COV-2 infection, but the repertoire of naturally processed and presented viral epitopes on class I human leukocyte antigen (HLA-I) remains uncharacterized. Applicants disclose herein the first HLA-I immunopeptidome of SARS-COV-2 in twoo cell lines at different times post infection using mass spectroscopy. Disclosed herein aare HLA-I peptides derived not only from canonical open reading frames (ORFs) but also from internal out-of-frame ORFs in spike and nucleocapsid not captured by existing vaccines. Whole-proteome analysis of infected cells revealed that early expressed viral proteins contribute more to HLA-I presentation and immunogenicity. These discoveries, along with the out-of-frame ORF epitopes, help facilitate selection of peptides for immune monitoring and vaccine use.
(35) Accordingly, the present disclosure provides compositions for activating T cell-mediated immunity targeting cells infected by a virus (e.g., SARS-COV-2) in a subject and the application thereof. In one aspect, the composition comprises one or more polypeptides that are a) capable of binding to Major Histocompatibility Complex (MHC) class I and b) derived from one or more proteins of a virus. In some embodiments, the one or more polypeptides may be derived from internal out-of-frame open reading frames of a nucleic acid in the virus. In some embodiments, the composition may further comprise one or more antigenic components capable of stimulating production of an antibody targeting a virus.
(36) In another aspect, the present disclosure provides methods of immunizing a subject against a virus infection or treating a subject infected by a virus. In some embodiments, the methods comprise administering the compositions herein to a subject, e.g., a subject in need thereof.
(37) In another aspect, the present disclosure provides methods of determining an infection status of a subject. In some embodiments, the methods comprise contacting immune cells derived from the subject with the immunogenic composition; and detecting cross-reactivity of the immune cells to the composition.
(38) In another aspect, the present disclosure provides methods of identifying viral immunogenic peptides comprising: lysing cells having a potential to express the immunogenic peptides of interest with a lysis buffer comprising a cell membrane disrupting detergent; enzymatic shearing of nucleic acids in the lysed cells; isolating MHC-I from the lysed cells, wherein the HLA-I is in complex with one or more polypeptides or proteins from the lysed cells; and determining sequences of the one or more polypeptides or proteins in complex with the HLA-I.
COMPOSITIONS
(39) In one aspect, the present disclosure provides compositions comprising one or more polypeptides for inducing immunity in a subject, e.g., to protect from or treat the infection of a virus. In some cases, the present disclosure includes one or more polynucleotides encoding the one or more polypeptides herein.
(40) In some embodiments, the compositions may comprise immunogenic composition(s). The immunogenic compositions may elicit an immunological response in the host to which the immunogenic compositions are administered. Such immunological response may be a T cell-mediated (e.g., cytotoxic T cell-mediated) immune response to the immunogenic compositions. In certain embodiments, the immunogenic compositions may be combined with one or more antigenic components and/or anti-viral therapeutics. In some examples, such combination may elicit cellular and/or antibody-mediated immune response, e.g., production or activation of antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells and/or gamma-delta T cells.
(41) In some embodiments, the composition may be used to treat viral infection of a subject. For example, the composition may be used to remove infected cells in the subject. Alternatively or additionally, the composition may be used to prevent viral infection or reduce the impact of viral infection on the subject (e.g., clinical signs normally displayed by an infected host, a quicker recovery time and/or a lowered duration of infectivity or lowered pathogen titer in the tissues or body fluids or excretions of the infected subject). In some cases, the subject displays a protective immunological response such that resistance to new infection may be enhanced and/or the clinical severity of the disease may be reduced.
(42) Polypeptides
(43) The immunogenic compositions may comprise one or more polypeptides. The one or more polypeptides is each capable of binding to Major Histocompatibility Complex (MHC) class I and is derived from one or more proteins of a virus. In an embodiment the MHC class I is a Human Leukocyte Anticgen class I (HLA-I). In an aspect, the one or more polypeptides are derived from a virus that related to a viral infection targeted for prevention, treatment or reduction of impact in a subject. The one or more polypeptides may be derived from viral proteins expressed from one or more open reading frames (ORFs) in a viral genome. In an aspect, the one or more polypeptides is derived from a protein of SARS-Co-V-2, and may optionally be derived from expression of internal out-of-frame open reading frame (ORF) of SARS-COV-2.
(44) Major Histocompatibility Complex (MHC) Class I
(45) The polypeptide(s) may bind, or may be capable of binding, to Major Histocompatibility Complex (MHC) class I, e.g., Human Leukocyte Antigen class I. In some cases, after binding, the MHC class I may present the one or more polypeptides to activate cytotoxic T cells. As used herein, MHC refers to protein complexes capable of binding peptides resulting from the proteolytic cleavage of protein antigens and representing potential T-cell epitopes, transporting them to the cell surface and presenting them there to specific cells, in particular cytotoxic T-lymphocytes or T-helper cells.
(46) MHC class I, or MHC-I, function mainly in antigen presentation to CD8+T lymphocytes or cytotoxic T cells and may be heterodimers comprising two polypeptide chains, an alpha chain and 2-microglobulin.
(47) In some embodiments, the MHC class I may be Human Leukocyte Antigen (HLA) class I, which is the MHC class I in human. HLA class I may comprises an alpha chain and 2-microglobulin. The alpha chain may be HLA-A, HLA-B, or HLA-C. In one example, the one or more peptides binds, or is capable of binding, to HLA-A. In another example, the one or more peptides binds, or is capable of binding, to HLA-B. In another example, the one or more peptides binds, or is capable of binding, to HLA-C. In another example, the one or more peptides binds, or is capable of binding, to 2-microglobulin of HLA-1.
(48) HLA Alleles
(49) The one or more peptides may bind, or may be capable of binding, to proteins encoded by certain HLA alleles. HLA genes may be polymorphic and have many different alleles, allowing them to fine-tune the immune system. The nomenclature of HLA genes are well known in the art, e.g., as described in Marsh SGE et al., Nomenclature for factors of the HLA system, 2010, Tissue Antigens. 2010 April; 75 (4): 291-455, which is incorporated by reference in its entirety.
(50) The HLA alleles may encode HLA protein capable of epitope binding. In some cases, the HLA alleles may have a ranking cut-off as determined by a machine learning predictor of HLA (e.g., HLA-I) epitope binding. For example, the HLA alleles may have a ranking cut-off of at least 0.1%, 0 at least 0.5%, or at least 1.0% as determined by HLAthena. Examples of methods for determining the ranking include those described in Sarkizova S. et al., A large peptidome dataset improves HLA class I epitope prediction across most of the human population, Nat Biotechnol. 2020 February; 38 (2): 199-209; and Abelin J G et al., Mass Spectrometry Profiling of HLA-Associated Peptidomes in Mono-allelic Cells Enables More Accurate Epitope Prediction, Immunity. 2017 Feb. 21; 46 (2): 315-326, which are incorporated by reference herein in their entireties.
(51) In some embodiments, the proteins encoded by HLA alleles include HLA proteins encoded by encoded by HLA-A*02:01, HLA-A*25:01, HLA-A*30:01, HLA-B*18:01, HLA-B*44:03, HLA-C*12:03, HLA-B*16:01, HLA-A*02:01, HLA-B*07:02, HLA-C*07:02; HLA-A*01:01; HLA-A*02:06; HLA-A*26:01; HLA-A*02:07; HLA-A*29:02; HLA-A*02:03; HLA-A*30:02; HLA-A*32:01; HLA-A*68:02; HLA-A*02:05; HLA-A*02:02; HLA-A*36:01; HLA-A*02:11; HLA-A*02:04; HLA-B*35:01; HLA-B*51:01; HLA-B*40:01; HLA-B*40:02; HLA-B*07:02; HLA-B*07:04; HLA-B*08:01; HLA-B*13:01; HLA-B*46:01; HLA-B*52:01; HLA-B*44:02; HLA-B*40:06; HLA-B*13:02; HLA-B*56:01; HLA-B*54:01; HLA-B*15:02; HLA-B*35:07; HLA-B*27:05; HLA-B*15:03; HLA-B*42:01; HLA-B*55:02; HLA-B*45:01; HLA-B*50:01; HLA-B*35:03; HLA-B*49:01; HLA-B*58:02; HLA-B*15:17; HLA-C*57:02; HLA-C*04:01; HLA-C*03:04; HLA-C*01:02; HLA-C*07:01; HLA-C*06:02; HLA-C*03:03; HLA-C*08:01; HLA-C*15:02; HLA-C*12:02; HLA-C*02:02; HLA-C*05:01; HLA-C*03:02; HLA-C*16:01; HLA-C*08:02; HLA-C*04:03; HLA-C*17:01; or HLA-C*17:04. In some embodiments, the HLA-1 is encoded by HLA-A*02:01, HLA-A*25:01, HLA-A*30:01, HLA-B*18:01, HLA-B*44:03, HLA-C*12:03, HLA-B*16:01, HLA-A*02:01, HLA-B*07:02, or HLA-C*07:02. In some embodiments, the proteins encoded by HLA alleles include HLA proteins encoded by HLA-A*02:01, HLA-A*25:01, HLA-A*30:01, HLA-B*18:01, HLA-B*44:03, HLA-C*12:03, HLA-B*16:01, HLA-A*02:01, HLA-B*07:02, HLA-C*07:02, or a combination thereof.
(52) In one example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*02:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*25:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*30:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*18:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*44:03. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*12:03. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*16:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*02:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*07:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*07:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*01:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*02:06. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*26:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*02:07. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*29:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*02:03. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*30:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*32:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*68:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*02:05. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*02:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*36:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*02:11. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-A*02:04. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*35:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*51:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*40:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*40:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*07:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*07:04. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*08:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*13:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*46:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*52:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*44:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*40:06. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*13:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*56:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*54:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*15:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*35:07. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*27:05. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*15:03. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*42:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*55:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*45:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*50:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*35:03. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*49:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*58:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-B*15:17. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*57:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*04:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*03:04. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*01:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*07:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*06:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*03:03. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*08:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*15:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*12:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*02:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*05:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*03:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*16:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*08:02. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*04:03. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*17:01. In another example, the one or more polypeptides binds, or is capable of binding, to an HLA protein encoded by HLA-C*17:04. Additional examples of HLA alleles include those described in e.g.,
(53) Viral Proteins
(54) The one or more polypeptides may be derived from one or more proteins of a virus. A polypeptide derived from a protein has an amino acid sequence that is a portion or the full-length of the protein's amino acid sequence. In some examples, the one or more polypeptides may be peptides resulting from digestion or degradation of a viral protein in cells infected by the virus. The virus may be a DNA virus, a RNA virus, or a retrovirus.
(55) The one or more proteins of a virus may be protein(s) of a coronavirus. The coronavirus may be a positive-sense single stranded RNA family of viruses, infecting a variety of animals and humans. In one example, the one or more proteins are protein(s) of SARS-COV-2. SARS-COV is one type of coronavirus infection, as well as MERS-COV. Example sequences of the SARS-COV-2 are available at GISAID accession no. EPI_ISL_402124 and EPI_ISL_402127-402130, and described in DOI: 10.1101/2020.01.22.914952. Further deposits of the example SARS-COV2 are deposited in the GISAID platform include EP_ISL_402119-402121 and EP_ISL 402123-402124; see also GenBank Accession No. MN908947.3.
(56) The one or more polypeptides may be derived from proteins of other viruses. Examples of such viruses include Ebola, measles, SARS, Chikungunya, hepatitis, Marburg, yellow fever, MERS, Dengue, Lassa, influenza, rhabdovirus or HIV. A hepatitis virus may include hepatitis A, hepatitis B, or hepatitis C. An influenza virus may include, for example, influenza A or influenza B. An HIV may include HIV 1 or HIV 2. In certain example embodiments, the viral sequence may be a human respiratory syncytial virus, Sudan ebola virus, Bundibugyo virus, Tai Forest ebola virus, Reston ebola virus, Achimota, Aedes flavivirus, Aguacate virus, Akabane virus, Alethinophid reptarenavirus, Allpahuayo mammarenavirus, Amapari mmarenavirus, Andes virus, Apoi virus, Aravan virus, Aroa virus, Arumwot virus, Atlantic salmon paramyxovirus, Australian bat lyssavirus, Avian bornavirus, Avian metapneumovirus, Avian paramyxoviruses, penguin or Falkland Islands virus, BK polyomavirus, Bagaza virus, Banna virus, Bat herpesvirus, Bat sapovirus, Bear Canon mammarenavirus, Beilong virus, Betacoronavirus, Betapapillomavirus 1-6, Bhanja virus, Bokeloh bat lyssavirus, Borna disease virus, Bourbon virus, Bovine hepacivirus, Bovine parainfluenza virus 3, Bovine respiratory syncytial virus, Brazoran virus, Bunyamwera virus, Caliciviridae virus. California encephalitis virus, Candiru virus, Canine distemper virus, Canine pneumovirus, Cedar virus, Cell fusing agent virus, Cetacean morbillivirus, Chandipura virus, Chaoyang virus, Chapare mammarenavirus, Chikungunya virus, Colobus monkey papillomavirus, Colorado tick fever virus, Cowpox virus, Crimean-Congo hemorrhagic fever virus, Culex flavivirus, Cupixi mammarenavirus, Dengue virus, Dobrava-Belgrade virus, Donggang virus, Dugbe virus, Duvenhage virus, Eastern equine encephalitis virus, Entebbe bat virus, Enterovirus A-D, European bat lyssavirus 1-2, Eyach virus, Feline morbillivirus, Fer-de-Lance paramyxovirus, Fitzroy River virus, Flaviviridae virus, Flexal mammarenavirus, GB virus C, Gairo virus, Gemycircularvirus, Goose paramyxovirus SF02, Great Island virus, Guanarito mammarenavirus, Hantaan virus, Hantavirus Z10, Heartland virus, Hendra virus, Hepatitis A/B/C/E, Hepatitis delta virus, Human bocavirus, Human coronavirus, Human endogenous retrovirus K, Human enteric coronavirus, Human genital-associated circular DNA virus-1, Human herpesvirus 1-8, Human immunodeficiency virus 1/2, Human mastadenovirus A-G, Human papillomavirus, Human parainfluenza virus 1-4, Human parechovirus, Human picornavirus, Human smacovirus, Ikoma lyssavirus, Ilheus virus, Influenza A-C, Ippy mammarenavirus, Irkut virus, J-virus, JC polyomavirus, Japanese encephalitis virus, Junin mammarenavirus, KI polyomavirus, Kadipiro virus, Kamiti River virus, Kedougou virus, Khujand virus, Kokobera virus, Kyasanur forest disease virus, Lagos bat virus, Langat virus, Lassa mammarenavirus, Latino mammarenavirus, Leopards Hill virus, Liao ning virus, Ljungan virus, Lloviu virus, Louping ill virus, Lujo mammarenavirus, Luna mammarenavirus, Lunk virus, Lymphocytic choriomeningitis mammarenavirus, Lyssavirus Ozernoe, MSSI2\0.225 virus, Machupo mammarenavirus, Mamastrovirus 1, Manzanilla virus, Mapuera virus, Marburg virus, Mayaro virus, Measles virus, Menangle virus, Mercadeo virus, Merkel cell polyomavirus, Middle East respiratory syndrome coronavirus, Mobala mammarenavirus, Modoc virus, Mojiang virus, Mokola virus, Monkeypox virus, Montana myotis leukoenchalitis virus, Mopeia lassa virus reassortant 29, Mopeia mammarenavirus, Morogoro virus, Mossman virus, Mumps virus, Murine pneumonia virus, Murray Valley encephalitis virus, Nariva virus, Newcastle disease virus, Nipah virus, Norwalk virus, Norway rat hepacivirus, Ntaya virus, O'nyong-nyong virus, Oliveros mammarenavirus, Omsk hemorrhagic fever virus, Oropouche virus, Parainfluenza virus 5, Parana mammarenavirus, Parramatta River virus, Peste-des-petits-ruminants virus, Pichande mammarenavirus, Picornaviridae virus, Pirital mammarenavirus, Piscihepevirus A, Porcine parainfluenza virus 1, porcine rubulavirus, Powassan virus, Primate T-lymphotropic virus 1-2, Primate erythroparvovirus 1, Punta Toro virus, Puumala virus, Quang Binh virus, Rabies virus, Razdan virus, Reptile bornavirus 1, Rhinovirus A-B, Rift Valley fever virus, Rinderpest virus, Rio Bravo virus, Rodent Torque Teno virus, Rodent hepacivirus, Ross River virus, Rotavirus A-I, Royal Farm virus, Rubella virus, Sabia mammarenavirus, Salem virus, Sandfly fever Naples virus, Sandfly fever Sicilian virus, Sapporo virus, Sathuperi virus, Seal anellovirus, Semliki Forest virus, Sendai virus, Seoul virus, Sepik virus, Severe acute respiratory syndrome-related coronavirus, Severe fever with thrombocytopenia syndrome virus, Shamonda virus, Shimoni bat virus, Shuni virus, Simbu virus, Simian torque teno virus, Simian virus 40-41, Sin Nombre virus, Sindbis virus, Small anellovirus, Sosuga virus, Spanish goat encephalitis virus, Spondweni virus, St. Louis encephalitis virus, Sunshine virus, TTV-like mini virus, Tacaribe mammarenavirus, Taila virus, Tamana bat virus, Tamiami mammarenavirus, Tembusu virus, Thogoto virus, Thottapalayam virus, Tick-borne encephalitis virus, Tioman virus, Togaviridae virus, Torque teno canis virus, Torque teno douroucouli virus, Torque teno felis virus, Torque teno midi virus, Torque teno sus virus, Torque teno tamarin virus, Torque teno virus, Torque teno zalophus virus, Tuhoko virus, Tula virus, Tupaia paramyxovirus, Usutu virus, Uukuniemi virus, Vaccinia virus, Variola virus, Venezuelan equine encephalitis virus, Vesicular stomatitis Indiana virus, WU Polyomavirus, Wesselsbron virus, West Caucasian bat virus, West Nile virus, Western equine encephalitis virus, Whitewater Arroyo mammarenavirus, Yellow fever virus, Yokose virus, Yug Bogdanovac virus, Zaire ebolavirus, Zika virus, or Zygosaccharomyces bailii virus Z viral sequence. Examples of RNA viruses that may be detected include one or more of (or any combination of) Coronaviridae virus, a Picornaviridae virus, a Caliciviridae virus, a Flaviviridae virus, a Togaviridae virus, a Bornaviridae, a Filoviridae, a Paramyxoviridae, a Pneumoviridae, a Rhabdoviridae, an Arenaviridae, a Bunyaviridae, an Orthomyxoviridae, or a Deltavirus. In certain example embodiments, the virus is Coronavirus, SARS, Poliovirus, Rhinovirus, Hepatitis A, Norwalk virus, Yellow fever virus, West Nile virus, Hepatitis C virus, Dengue fever virus, Zika virus, Rubella virus, Ross River virus, Sindbis virus, Chikungunya virus, Borna disease virus, Ebola virus, Marburg virus, Measles virus, Mumps virus, Nipah virus, Hendra virus, Newcastle disease virus, Human respiratory syncytial virus, Rabies virus, Lassa virus, Hantavirus, Crimean-Congo hemorrhagic fever virus, Influenza, or Hepatitis D virus.
(57) Open Reading Frames (ORFs)
(58) The one or more viral proteins may be expressed from one or more open reading frames (ORFs) in a viral genome. An ORF refers to a polynucleotide that encodes a protein, or a portion of a protein. An open reading frame usually begins with a start codon and is read in codon-triplets until the frame ends with a STOP codon.
(59) In some embodiments, the ORFs are canonical ORFs. A canonical ORF is an ORF that is most prevalent, most similar to orthologous sequences found in other species, by virtue of its length or amino acid composition, allows for the clearest description of domains, isoforms, polymorphisms, post-translational modifications, or in the absence of other information is the longest sequence. In some examples, the ORFs are canonical ORFs of SARS-COV-2, such as of nsp1, nsp2, nsp3, nsp5, nsp8, nsp10, nsp14, ORF7a, S protein, or M protein. In one example, the ORF is nsp1 ORF. In another example, the ORF is nsp2 ORF. In another example the ORF is nsp3 ORF. In another example, the ORF is nsp5 ORF. In another example, the ORF is nsp8 ORF. In another example the ORF is nsp10 ORF. In another example, the ORF is nsp14 ORF. In another example, the ORF is ORF7a. In another example, the ORF is spike(S) protein ORF. In another example, the ORF is membrane (M) protein ORF. In another example, the ORF is nucleocapsid (N) protein ORF. In other example embodiments, polypeptides are derived from non-canonical translation of ORF, such as via internal ribosome entry, leaky scanning, non-AUD initiation, ribosome shunting, reinitiation, ribosomal frameshifting and stop-codon readthrough.
(60) In some embodiments, the ORFs are alternative ORFs of a SARS-COV-2 genome. In some embodiments, alternative ORFs can be identified using in silico 6-frame translation analysis. In some embodiments, the alternative ORF is F3 R196, F2 R32, F6 R325, or F3 R683.
(61) In some embodiments, the ORFs are out-of-frame ORFs. As used herein, the term out-of-frame ORF refers to ORFs that are out of frame with a canonical ORF. In certain example embodiments, the out-of-frame ORF is an internal out-of-frame ORF, which is an ORF found within a canonical ORF but out of frame with the canonical ORF. In some examples, the ORFs are internal out-of-frame ORFs of SARS-COV-2, such as ORFORF9b, ORFS.iORF1, or ORFS.iORF2. In one example, the ORF is ORFORF9b. In another example, the ORF is ORFS.iORF1. In another example, the ORF is ORFS.iORF2.
(62) Other examples of the ORFs include those described in Finkel Y et al., The coding capacity of SARS-COV-2, doi: doi.org/10.1101/2020.05.07.082909, which is incorporated by reference in its entirety.
(63) In some embodiments, the sequence, ORFs, and other annotations are based on the sequence of 2019-nCOV/USA-WA1/2020 isolate (NCBI accession number: MN985325) of SARS-COV-2.
(64) Examples of Polypeptides
(65) In some embodiments, the one or more polypeptides comprises GPMVLRGLIT (SEQ ID NO: 6), GLITLSYHL (SEQ ID NO: 5), SLEDKAFQL (SEQ ID NO: 7), ELPDEFVVVTV (SEQ ID NO: 8), LEDKAFQL (SEQ ID NO: 10), DEFVVVTV (SEQ ID NO: 11), or a combination thereof. In one example, the one or more polypeptides comprises GPMVLRGLIT (SEQ ID NO: 6). In another example, the one or more polypeptides comprises GLITLSYHL (SEQ ID NO: 5). In another example, the one or more polypeptides comprises SLEDKAFQL (SEQ ID NO: 7). In another example, the one or more polypeptides comprises ELPDEFVVVTV (SEQ ID NO: 8). In another example, the one or more polypeptides comprises LEDKAFQL (SEQ ID NO: 10). In another example, the one or more polypeptides comprises DEFVVVTV (SEQ ID NO: 11).
(66) In some embodiments, the one or more polypeptides comprises KRVDWTIEY (SEQ ID NO: 29), FASEAARVV (SEQ ID NO: 17), or a combination thereof. In one example, the one or more polypeptides comprises KRVDWTIEY (SEQ ID NO: 29). In another example, the one or more polypeptides comprises FASEAARVV (SEQ ID NO: 17).
(67) In certain examples, the polypeptide derived from S.iORF1 is MLLGSMLYM (SEQ ID NO: 4). In certain example embodiments, the polypeptide is derived from both S.iORF1 and S.iORF2 and has a sequence of GPMVLRGLIT (SEQ ID NO: 6) or GLITLSYHL (SEQ ID NO: 5). In certain examples, the polypeptide derived from ORF9b is SLEDKAFQL (SEQ ID NO: 7), ELPDEFVVVTV (SEQ ID NO: 8), LEDKAFQL (SEQ ID NO: 10), DEFVVVTV (SEQ ID NO: 11), ELPDEFVVV (SEQ ID NO: 12), KAFQLTPIAV (SEQ ID NO: 13), or a combination thereof. In certain examples, the polypeptide derived from nsp1 is APHGHVMVEL (SEQ ID NO: 14). In certain examples, the polypeptide derived from nsp2 is EIKESVQTF (SEQ ID NO: 15), FASEAARVV (SEQ ID NO: 17), TAQNSVRVL (SEQ ID NO: 18), LATNNLVVM (SEQ ID NO: 16), or STSAFVETV (SEQ ID NO: 19). In certain examples, the polypeptide derived from nsp3 is EEFEPSTQYEY (SEQ ID NO: 20), TTTIKPVTY (SEQ ID NO: 21), TVIEVQGY (SEQ ID NO: 22), FGDDTVIEV (SEQ ID NO: 23), YLNSTNVTI (SEQ ID NO: 24), or YLFDESGEFKL (SEQ ID NO: 25). In some embodiments, the polypeptide derived from nsp5 is AGTDTTITV (SEQ ID NO: 26). In certain examples, the polypeptide derived from nsp8 is SEFSSLPSY (SEQ ID NO: 27). In certain examples, the polypeptide derived from nsp10 is FAVDAAKAY (SEQ ID NO: 28). In certain examples, the polypeptide derived from nsp14 is KRVDWTIEY (SEQ ID NO: 29). In some embodiments, the polypeptide derived from nsp15 is SVVSKVVKV (SEQ ID NO: 30). In certain examples, the polypeptide derived from ORF7a is IRQEEVQEL (SEQ ID NO: 31). In certain examples, the polypeptide derived from S is EILDITPcSF (SEQ ID NO: 32) (cysteinylated Cys), EILDITPCSF (SEQ ID NO: 33), EILDITPcSFG (SEQ ID NO: 34) (cysteinylated Cys), HADQLTPTW (SEQ ID NO: 35), KNIDGYFKIY (SEQ ID NO: 36), NATNVVIKV (SEQ ID NO: 37), QLTPTWRVY (SEQ ID NO: 38), VGYLQPRTF (SEQ ID NO: 39) or a combination thereof. In certain examples, the polypeptide derived from M is VATSRTLSY (SEQ ID NO: 41). In certain examples, the polypeptide derived from N protein is APRITFGGP (SEQ ID NO: 42).
(68) In some embodiments, the polypeptide is derived from an alternative ORF. In some embodiments, the alternative ORF is F3 R196, F2 R32, F6 R325, or F3 R683. In some embodiments, the alternative ORF produces a peptide. In some embodiments, the F3 R196 alternative ORF produces an R196 peptide. In some embodiments, the F2 R32 alternative ORF produces R32 peptide. In some embodiments the F6 R325 alternative ORF produces R325 peptide. In some embodiments, the F3 R683 alternative ORF produces R683 peptide.
(69) In these notations above and elsewhere herein, the indications of F3 R196, F2 R32, F6 R325, F3 R683, and the like refer to the translation frame (designated with F such that F3 refers to frame 3, F6 refers to frame 6 and the like) and the position of the chromosome of the alternative ORF from which the peptide is derived (i.e., the transition position of the chromosome). Thus, F3 R196 indicates that the peptide is derived from position 10695-10727 on the (+) strand, F2 R32 indicates that the peptide is derived from position 14666-14692 on the (+) strand, F6 R325 is derived from position 12370-12402 on the () strand, and F3 R683 is derived from position 25788-25814 on the (+) strand.
(70) In some embodiments, the polypeptide is or is derived from F3 R196 peptide/ORF. In some embodiments, the polypeptide that is or is derived from F3 R196 peptide/ORF is METGGFSIDLP (SEQ ID NO: 43). In some embodiments, the polypeptide that is or is derived from F2 R32 peptide/ORF. In some embodiments, the polypeptide that is or is derived from F2 R32 peptide/ORF is LSNPVILTK (SEQ ID NO: 44). In some embodiments, the polypeptide is or is derived from F6 R325 peptide/ORF. In some embodiments, the polypeptide that is or is derived from F6 R325 peptide/ORF is LSASLSNFLSI (SEQ ID NO: 45). In some embodiments, the polypeptide is or is derived from F3 R683 peptide/ORF. In some embodiments, the polypeptide that is or is derived from F3 R683 peptide/ORF is MPFQKPITL (SEQ ID NO: 46).
(71) In one example embodiment at least one of the one or more the polypeptides is derived from expression of an alternative ORF. In one example embodiment, the alternative ORF is F3 R196, F2 R32, F6 R325, or F3 683. In one example embodiment, the one or more polypeptides derived from alternative ORF F3 R196 is METGGFSIDLP (SEQ ID NO: 43). In one example embodiment, the one or more polypeptides derived from alternative ORF F2 R32 is LSNPVILTK (SEQ ID NO: 44). In one example embodiment, the one or more polypeptides derived from alternative ORF F6 R325 is LSASLSNFLSI (SEQ ID NO: 45). In one example embodiment, the one or more polypeptides derived from alternative ORF F3 R683 is MPFQKPITL (SEQ ID NO: 46). In some embodiments, the polypeptide is derived from F3 R196 peptide. In some embodiments, the polypeptide derived from F3 R196 peptide is METGGFSIDLP (SEQ ID NO: 43). In some embodiments, the polypeptide is derived from F2 R32 peptide. In some embodiments, the polypeptide derived from F2 R32 peptide is LSNPVILTK (SEQ ID NO: 44). In some embodiments, the polypeptide is derived from F6 R325 peptide. In some embodiments, the polypeptide derived from F6 R325 peptide is LSASLSNFLSI (SEQ ID NO: 45). In some embodiments, the polypeptide is derived from F3 R683 peptide. In some embodiments, the polypeptide derived from F3 R683 peptide is MPFQKPITL (SEQ ID NO: 46).
(72) As is demonstrated in the Working Examples below, in some embodiments, one or more of the polypeptides is expressed and/or bound with an MHC-I molecule almost immediately post infection. In some embodiments, these early expressed and/or MHC-I presented/bound polypeptides are more highly expressed within about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 hours post infection as compared to a later time point (e.g., after 12 hours post infection). In one example embodiment, the one or more polypeptides are expressed and/or is bound by MHC-I 0-12, 0-11, 0-10, 0-9, 0-8, 0-7, 0-6, 0-5, 0-4, 0-3, 0-2, or 0-1 hours post infection.
(73) The one or more polypeptides include those in Table 1 Table 2, Table 4, Tables 8A-8B, and/or Tables 9A, 9B, or 9C. In some examples, the one or more polypeptides include at least 2, at least 4, at least 6, at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20, at least 22, at least 24, at least 26, or at least 28, polypeptides in Table 1 Table 2, Table 4, Tables 8A-8B, and/or Tables 9A, 9B, or 9C.
(74) The one or more polypeptides include one or more of those in
(75) In one example embodiment, the one or more polypeptides comprises FAVDAAKAY (SEQ ID NO: 28). In another example embodiment, the one or more polypeptides comprises EIKESVQTF (SEQ ID NO: 15). In another example, the one or more polypeptides comprises FASEAARVV (SEQ ID NO: 17). In another example embodiment, the one or more polypeptides comprises EEFEPSTQYEY (SEQ ID NO: 20). In another example embodiment, the one or more polypeptides comprises SEFSSLPSY (SEQ ID NO: 27). In another example embodiment, the one or more polypeptides comprises DEFVVVTV (SEQ ID NO: 11). In another example embodiment, the one or more polypeptides comprises LEDKAFQL (SEQ ID NO: 10). In another example embodiment, the one or more polypeptides comprises EILDITPCSF (SEQ ID NO: 33). In certain example embodiment, the C is cysteinylated. In another example, the one or more polypeptides comprises EILDITPCSFG (SEQ ID NO: 47). In one example embodiment, the C is cysteinylated. In another example, the one or more polypeptides comprises HADQLTPTW (SEQ ID NO: 35). In another example embodiment, the one or more polypeptides comprises KNIDGYFKIY (SEQ ID NO: 36). In another example embodiment, the one or more polypeptides comprises NATNVVIKV (SEQ ID NO: 37). In another example embodiment, the one or more polypeptides comprises QLTPTWRVY (SEQ ID NO: 38). In another example embodiment, the one or more polypeptides comprises VATSRTLSY (SEQ ID NO: 41). In another example embodiment, the one or more polypeptides comprises VGYLQPRTF (SEQ ID NO: 39). In another example embodiment, the one or more polypeptides comprises APHGHVMVEL (SEQ ID NO: 14). In one example embodiment, the M is oxidized. In another example embodiment, the one or more polypeptides comprises STSAFVETV (SEQ ID NO: 19). In another example embodiment, the one or more polypeptides comprises KRVDWTIEY (SEQ ID NO: 29). In another example embodiment, the one or more polypeptides comprises FGDDTVIEV (SEQ ID NO: 23). In another example embodiment, the one or more polypeptides comprises IRQEEVQEL (SEQ ID NO: 31). In another example embodiment, the one or more polypeptides comprises APRITFGGP (SEQ ID NO: 42). In another example embodiment, the one or more polypeptides comprises ELPDEFVVV (SEQ ID NO: 12). In another example embodiment, the one or more polypeptides comprises KAFQLTPIAV (SEQ ID NO: 13). In another example embodiment, the one or more polypeptides comprises SLEDKAFQL (SEQ ID NO: 7). In another example embodiment, the one or more polypeptides comprises GLITLSYHL (SEQ ID NO: 5). In another example embodiment, the one or more polypeptides comprises GPMVLRGLIT (SEQ ID NO: 6). In another example embodiment, the one or more polypeptides comprises MLLGSMLYM (SEQ ID NO: 4). In another example embodiment, the one or more polypeptides comprises YLNSTNVTI (SEQ ID NO: 24). In certain example embodiments, the one or more polypeptides comprises TAQNSVRVL (SEQ ID NO: 18). In one example embodiment, the one or more polypeptides comprises TTTIKPVTY (SEQ ID NO: 21). In one example embodiment, the one or more polypeptides comprises TVIEVQGY (SEQ ID NO: 22). In one example embodiment, the one or more polypeptides comprises METGGFSIDLP (SEQ ID NO: 43). In one example embodiment, the one or more polypeptides comprises LSNPVILTK (SEQ ID NO: 44). In one example embodiment, the one or more polypeptides comprises LATNNLVVM (SEQ ID NO: 16). In one example embodiment, the one or more polypeptides comprises YLFDESGEFKL (SEQ ID NO: 25). In one example embodiment, the one or more polypeptides comprises AGTDTTITV (SEQ ID NO: 26). In one example embodiment, the one or more polypeptides comprises SVVSKVVKV (SEQ ID NO: 30). In one example embodiment, the one or more polypeptides comprises ELPDEFVVTV (SEQ ID NO: 9). In one example embodiment, the one or more polypeptides comprises NLNESLIDL (SEQ ID NO: 40). In one example embodiment, the one or more polypeptides comprises LSASLSNFLSI (SEQ ID NO: 45). In one example embodiment, the one or more polypeptides comprises MPFQKPITL (SEQ ID NO: 46). In the embodiments disclsoed herein, one or more Ms may be oxidized and/or the Ns deaminated.
(76) The polypeptides herein may also include those have homology with the exemplary polypeptides herein. For example, the polypeptides may include those have at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the exemplary polypeptides. The terms percent (%) sequence identity, and the like, generally refer to the degree of identity or correspondence between different nucleotide sequences of nucleic acid molecules or amino acid sequences of polypeptides that may or may not share a common evolutionary origin (see Reeck et al., supra). Sequence identity can be determined using any of a number of publicly available sequence comparison algorithms, such as BLAST, FASTA, DNA Strider, GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wis.), etc.
(77) In some cases, the one or more polypeptides comprises a motif of XN.sub.1XXXXXXN.sub.2 (SEQ ID NO: 1), where N.sub.1 is E, A, V, L, or P; N.sub.2 is F, Y, L, or V; and X is any amino acid (the X amino acids in the motif can be the same or different). In some embodiments, the one or more peptides comprises a motif of XN.sub.1XXXXXXN.sub.2 (SEQ ID NO: 2), wherein in some embodiments N.sub.1 is E, A, V, L, T, S, I, M, G, R, Y, K, D, Q, F, or P, wherein in some embodiments N.sub.2 is F, Y, L, W, I, K, A, M, or V, and wherein X is any amino acid (each X can be independently selected from any amino acid and can be the same or different). In one example, the one or more polypeptides comprises a sequence of XEXXXXXXF (SEQ ID NO: 48). In another example, the one or more polypeptides comprises a sequence of XEXXXXXXY (SEQ ID NO: 49). In another example, the one or more polypeptides comprises a sequence of XEXXXXXXL (SEQ ID NO: 50). In another example, the one or more polypeptides comprises a sequence of XEXXXXXXV (SEQ ID NO: 51). In another example, the one or more polypeptides comprises a sequence of XEXXXXXXW (SEQ ID NO: 52). In another example, the one or more polypeptides comprises a sequence of XEXXXXXXI (SEQ ID NO: 53). In another example, the one or more polypeptides comprises a sequence of XEXXXXXXK (SEQ ID NO: 54). In another example, the one or more polypeptides comprises a sequence of XEXXXXXXA (SEQ ID NO: 55). In another example, the one or more polypeptides comprises a sequence of XEXXXXXXM (SEQ ID NO: 56). In another example, the one or more polypeptides comprises a sequence of XAXXXXXXF (SEQ ID NO: 57). In another example, the one or more polypeptides comprises a sequence of XAXXXXXXY (SEQ ID NO: 58). In another example, the one or more polypeptides comprises a sequence of XAXXXXXXL (SEQ ID NO: 59). In another example, the one or more polypeptides comprises a sequence of XAXXXXXXV (SEQ ID NO: 60). In another example, the one or more polypeptides comprises a sequence of XAXXXXXXW (SEQ ID NO: 61). In another example, the one or more polypeptides comprises a sequence of XAXXXXXXI (SEQ ID NO: 62). In another example, the one or more polypeptides comprises a sequence of XAXXXXXXK (SEQ ID NO: 63). In another example, the one or more polypeptides comprises a sequence of XAXXXXXXA (SEQ ID NO: 64). In another example, the one or more polypeptides comprises a sequence of XAXXXXXXM (SEQ ID NO: 65). In another example, the one or more polypeptides comprises a sequence of XVXXXXXXF (SEQ ID NO: 66). In another example, the one or more polypeptides comprises a sequence of XVXXXXXXY (SEQ ID NO: 67). In another example, the one or more polypeptides comprises a sequence of XVXXXXXXL (SEQ ID NO: 68). In another example, the one or more polypeptides comprises a sequence of XVXXXXXXV (SEQ ID NO: 69). In another example, the one or more polypeptides comprises a sequence of XVXXXXXXW (SEQ ID NO: 70). In another example, the one or more polypeptides comprises a sequence of XVXXXXXXI (SEQ ID NO: 71). In another example, the one or more polypeptides comprises a sequence of XVXXXXXXK (SEQ ID NO: 72). In another example, the one or more polypeptides comprises a sequence of XVXXXXXXA (SEQ ID NO: 73). In another example, the one or more polypeptides comprises a sequence of XVXXXXXXM (SEQ ID NO: 74). In another example, the one or more polypeptides comprises a sequence of XLXXXXXXF (SEQ ID NO: 75). In another example, the one or more polypeptides comprises a sequence of XLXXXXXXY (SEQ ID NO: 76). In another example, the one or more polypeptides comprises a sequence of XLXXXXXXL (SEQ ID NO: 77). In another example, the one or more polypeptides comprises a sequence of XLXXXXXXV (SEQ ID NO: 78). In another example, the one or more polypeptides comprises a sequence of XLXXXXXXW (SEQ ID NO: 79). In another example, the one or more polypeptides comprises a sequence of XLXXXXXXI (SEQ ID NO: 80). In another example, the one or more polypeptides comprises a sequence of XLXXXXXXK (SEQ ID NO: 81). In another example, the one or more polypeptides comprises a sequence of XLXXXXXXA (SEQ ID NO: 82). In another example, the one or more polypeptides comprises a sequence of XLXXXXXXM (SEQ ID NO: 83). In another example, the one or more polypeptides comprises a sequence of XPXXXXXXF (SEQ ID NO: 84). In another example, the one or more polypeptides comprises a sequence of XPXXXXXXY (SEQ ID NO: 85). In another example, the one or more polypeptides comprises a sequence of XPXXXXXXL (SEQ ID NO: 86). In another example, the one or more polypeptides comprises a sequence of XPXXXXXXV (SEQ ID NO: 87). In another example, the one or more polypeptides comprises a sequence of XPXXXXXXW (SEQ ID NO: 88). In another example, the one or more polypeptides comprises a sequence of XPXXXXXXI (SEQ ID NO: 89). In another example, the one or more polypeptides comprises a sequence of XPXXXXXXK (SEQ ID NO: 90). In another example, the one or more polypeptides comprises a sequence of XPXXXXXXA (SEQ ID NO: 91). In another example, the one or more polypeptides comprises a sequence of XPXXXXXXM (SEQ ID NO: 92).
(78) In another example, the one or more polypeptides comprises a sequence of XTXXXXXXF (SEQ ID NO: 93). In another example, the one or more polypeptides comprises a sequence of XTXXXXXXY (SEQ ID NO: 94). In another example, the one or more polypeptides comprises a sequence of XTXXXXXXL (SEQ ID NO: 95). In another example, the one or more polypeptides comprises a sequence of XTXXXXXXV (SEQ ID NO: 96). In another example, the one or more polypeptides comprises a sequence of XTXXXXXXW (SEQ ID NO: 97). In another example, the one or more polypeptides comprises a sequence of XTXXXXXXI (SEQ ID NO: 98). In another example, the one or more polypeptides comprises a sequence of XTXXXXXXK (SEQ ID NO: 99). In another example, the one or more polypeptides comprises a sequence of XTXXXXXXA (SEQ ID NO: 100). In another example, the one or more polypeptides comprises a sequence of XTXXXXXXM (SEQ ID NO: 101).
(79) In another example, the one or more polypeptides comprises a sequence of XSXXXXXXF (SEQ ID NO: 102). In another example, the one or more polypeptides comprises a sequence of XSXXXXXXY (SEQ ID NO: 103). In another example, the one or more polypeptides comprises a sequence of XSXXXXXXL (SEQ ID NO: 104). In another example, the one or more polypeptides comprises a sequence of XSXXXXXXV (SEQ ID NO: 105). In another example, the one or more polypeptides comprises a sequence of XSXXXXXXW (SEQ ID NO: 106). In another example, the one or more polypeptides comprises a sequence of XSXXXXXXI (SEQ ID NO: 107). In another example, the one or more polypeptides comprises a sequence of XSXXXXXXK (SEQ ID NO: 108). In another example, the one or more polypeptides comprises a sequence of XSXXXXXXA (SEQ ID NO: 109). In another example, the one or more polypeptides comprises a sequence of XSXXXXXXM (SEQ ID NO: 110).
(80) In another example, the one or more polypeptides comprises a sequence of XIXXXXXXF (SEQ ID NO: 111). In another example, the one or more polypeptides comprises a sequence of XIXXXXXXY (SEQ ID NO: 112). In another example, the one or more polypeptides comprises a sequence of XIXXXXXXL (SEQ ID NO: 113). In another example, the one or more polypeptides comprises a sequence of XIXXXXXXV (SEQ ID NO: 114). In another example, the one or more polypeptides comprises a sequence of XIXXXXXXW (SEQ ID NO: 115). In another example, the one or more polypeptides comprises a sequence of XIXXXXXXI (SEQ ID NO: 116). In another example, the one or more polypeptides comprises a sequence of XIXXXXXXK (SEQ ID NO: 117). In another example, the one or more polypeptides comprises a sequence of XIXXXXXXA (SEQ ID NO: 118). In another example, the one or more polypeptides comprises a sequence of XIXXXXXXM (SEQ ID NO: 119).
(81) In another example, the one or more polypeptides comprises a sequence of XMXXXXXXF (SEQ ID NO: 120). In another example, the one or more polypeptides comprises a sequence of XMXXXXXXY (SEQ ID NO: 121). In another example, the one or more polypeptides comprises a sequence of XMXXXXXXL (SEQ ID NO: 122). In another example, the one or more polypeptides comprises a sequence of XMXXXXXXV (SEQ ID NO: 123). In another example, the one or more polypeptides comprises a sequence of XMXXXXXXW (SEQ ID NO: 124). In another example, the one or more polypeptides comprises a sequence of XMXXXXXXI (SEQ ID NO: 125). In another example, the one or more polypeptides comprises a sequence of XMXXXXXXK (SEQ ID NO: 126). In another example, the one or more polypeptides comprises a sequence of XMXXXXXXA (SEQ ID NO: 127). In another example, the one or more polypeptides comprises a sequence of XMXXXXXXM (SEQ ID NO: 128).
(82) In another example, the one or more polypeptides comprises a sequence of XGXXXXXXF (SEQ ID NO: 129). In another example, the one or more polypeptides comprises a sequence of XGXXXXXXY (SEQ ID NO: 130). In another example, the one or more polypeptides comprises a sequence of XGXXXXXXL (SEQ ID NO: 131). In another example, the one or more polypeptides comprises a sequence of XGXXXXXXV (SEQ ID NO: 132). In another example, the one or more polypeptides comprises a sequence of XGXXXXXXW (SEQ ID NO: 133). In another example, the one or more polypeptides comprises a sequence of XGXXXXXXI (SEQ ID NO: 134). In another example, the one or more polypeptides comprises a sequence of XGXXXXXXK (SEQ ID NO: 135). In another example, the one or more polypeptides comprises a sequence of XGXXXXXXA (SEQ ID NO: 136). In another example, the one or more polypeptides comprises a sequence of XGXXXXXXM (SEQ ID NO: 137).
(83) In another example, the one or more polypeptides comprises a sequence of XRXXXXXXF (SEQ ID NO: 138). In another example, the one or more polypeptides comprises a sequence of XRXXXXXXY (SEQ ID NO: 139). In another example, the one or more polypeptides comprises a sequence of XRXXXXXXL (SEQ ID NO: 140). In another example, the one or more polypeptides comprises a sequence of XRXXXXXXV (SEQ ID NO: 141). In another example, the one or more polypeptides comprises a sequence of XRXXXXXXW (SEQ ID NO: 142). In another example, the one or more polypeptides comprises a sequence of XRXXXXXXI (SEQ ID NO: 143). In another example, the one or more polypeptides comprises a sequence of XRXXXXXXK (SEQ ID NO: 144). In another example, the one or more polypeptides comprises a sequence of XRXXXXXXA (SEQ ID NO: 145). In another example, the one or more polypeptides comprises a sequence of XRXXXXXXM (SEQ ID NO: 146).
(84) In another example, the one or more polypeptides comprises a sequence of XYXXXXXXF (SEQ ID NO: 147). In another example, the one or more polypeptides comprises a sequence of XYXXXXXXY (SEQ ID NO: 148). In another example, the one or more polypeptides comprises a sequence of XYXXXXXXL (SEQ ID NO: 149). In another example, the one or more polypeptides comprises a sequence of XYXXXXXXV (SEQ ID NO: 150). In another example, the one or more polypeptides comprises a sequence of XYXXXXXXW (SEQ ID NO: 151). In another example, the one or more polypeptides comprises a sequence of XXXXXXXXI (SEQ ID NO: 152). In another example, the one or more polypeptides comprises a sequence of XYXXXXXXK (SEQ ID NO: 153). In another example, the one or more polypeptides comprises a sequence of XYXXXXXXA (SEQ ID NO: 154). In another example, the one or more polypeptides comprises a sequence of XYXXXXXXM (SEQ ID NO: 155).
(85) In another example, the one or more polypeptides comprises a sequence of XKXXXXXXF (SEQ ID NO: 156). In another example, the one or more polypeptides comprises a sequence of XKXXXXXXY (SEQ ID NO: 157). In another example, the one or more polypeptides comprises a sequence of XKXXXXXXL (SEQ ID NO: 158). In another example, the one or more polypeptides comprises a sequence of XKXXXXXXV (SEQ ID NO: 159). In another example, the one or more polypeptides comprises a sequence of XKXXXXXXW (SEQ ID NO: 160). In another example, the one or more polypeptides comprises a sequence of XKXXXXXXI (SEQ ID NO: 161). In another example, the one or more polypeptides comprises a sequence of XKXXXXXXK (SEQ ID NO: 162). In another example, the one or more polypeptides comprises a sequence of XKXXXXXXA (SEQ ID NO: 163). In another example, the one or more polypeptides comprises a sequence of XKXXXXXXM (SEQ ID NO: 164).
(86) In another example, the one or more polypeptides comprises a sequence of XDXXXXXXF (SEQ ID NO: 165). In another example, the one or more polypeptides comprises a sequence of XDXXXXXXY (SEQ ID NO: 166). In another example, the one or more polypeptides comprises a sequence of XDXXXXXXL (SEQ ID NO: 167). In another example, the one or more polypeptides comprises a sequence of XDXXXXXXV (SEQ ID NO: 168). In another example, the one or more polypeptides comprises a sequence of XDXXXXXXW (SEQ ID NO: 169). In another example, the one or more polypeptides comprises a sequence of XDXXXXXXI (SEQ ID NO: 170). In another example, the one or more polypeptides comprises a sequence of XDXXXXXXK (SEQ ID NO: 171). In another example, the one or more polypeptides comprises a sequence of XDXXXXXXA (SEQ ID NO: 172). In another example, the one or more polypeptides comprises a sequence of XDXXXXXXM (SEQ ID NO: 173).
(87) In another example, the one or more polypeptides comprises a sequence of XQXXXXXXF (SEQ ID NO: 174). In another example, the one or more polypeptides comprises a sequence of XQXXXXXXY (SEQ ID NO: 175). In another example, the one or more polypeptides comprises a sequence of XQXXXXXXL (SEQ ID NO: 176). In another example, the one or more polypeptides comprises a sequence of XQXXXXXXV (SEQ ID NO: 177). In another example, the one or more polypeptides comprises a sequence of XQXXXXXXW (SEQ ID NO: 178). In another example, the one or more polypeptides comprises a sequence of XQXXXXXXI (SEQ ID NO: 179). In another example, the one or more polypeptides comprises a sequence of XQXXXXXXK (SEQ ID NO: 180). In another example, the one or more polypeptides comprises a sequence of XQXXXXXXA (SEQ ID NO: 181). In another example, the one or more polypeptides comprises a sequence of XQXXXXXXM (SEQ ID NO: 182).
(88) In another example, the one or more polypeptides comprises a sequence of XFXXXXXXF (SEQ ID NO: 183). In another example, the one or more polypeptides comprises a sequence of XFXXXXXXY (SEQ ID NO: 184). In another example, the one or more polypeptides comprises a sequence of XFXXXXXXL (SEQ ID NO: 185). In another example, the one or more polypeptides comprises a sequence of XFXXXXXXV (SEQ ID NO: 186). In another example, the one or more polypeptides comprises a sequence of XFXXXXXXW (SEQ ID NO: 187). In another example, the one or more polypeptides comprises a sequence of XFXXXXXXI (SEQ ID NO: 188). In another example, the one or more polypeptides comprises a sequence of XFXXXXXXK (SEQ ID NO: 189). In another example, the one or more polypeptides comprises a sequence of XFXXXXXXA (SEQ ID NO: 190). In another example, the one or more polypeptides comprises a sequence of XFXXXXXXM (SEQ ID NO: 191).
(89) In one example embodiment, the one or more polypeptides comprises a motif of N.sub.3N.sub.1N.sub.4N.sub.5N.sub.6N.sub.7N.sub.8N.sub.9N.sub.2 (SEQ ID NO: 3), wherein N.sub.1 is optionally E, A, V, L, T, S, I, M, G, R, Y, K, D, Q, F, or P, wherein N.sub.2 is optionally F, Y, L, W, I, K, A, M, T, or V, wherein N.sub.3 is optionally E, D, K, R, N, S, G, L, V, T, F, N, Y, M, or A, wherein N.sub.4 is optionally I, V, A, K, R, F, H, L, D, T, S, Q, N, Y, P, or G, wherein N.sub.5 is optionally E, D, G, S, P, K, N, A, Q, L, H, or A, wherein N.sub.6 is optionally R, P, G, K, A, L, Y, W, F, T, E, S, or V, wherein N.sub.7 is optionally I, L, V, Y, F, T, S, P, G, E, A, H, or V, wherein N.sub.8 is optionally S, L, P, I, V, Q, H, E, A, K, R, Y, W, N or M, and wherein No is optionally S, G, E, A, T, K, Q, N, R, V, D, F, or L.
(90) Modifications on Polypeptides
(91) The polypeptides herein may comprise one or more modifications (e.g., post-translational modifications). In some cases, the polypeptides may comprise cysteinylated Cysteine. Examples of such modified polypeptide include EILDITPcSF (SEQ ID NO: 32) and EILDITPcSFG (SEQ ID NO: 34) where the underlined cysteine residues are cysteinylated. In certain cases, the polypeptides may comprise oxidized methionine. Examples of such modified polypeptides include APHGHVmVEL (SEQ ID NO: 192), GPmVLRGLIT (SEQ ID NO: 193), mLLGSMLYM (SEQ ID NO: 194), MLLGSmLYM (SEQ ID NO: 195), and MLLGSMLYm (SEQ ID NO: 196), where the underlined methionine residues are oxidized.
(92) Other examples of modifications include ubiquitination, phosphorylation, sulfonation, glycosylation, acetylation, methylation, ADP-ribosylation, methionine oxidation, cysteine oxidation, cysteine lipidation, farnesylation, geranylation, pyroglutamation, and deamidation.
(93) In some embodiments, the polypeptide comprises a motif (e.g., XN.sub.1XXXXXXN.sub.2 (SEQ ID NO: 1 or SEQ ID NO: 2) and/or N.sub.3N.sub.1N.sub.4N.sub.5N.sub.6N.sub.7N.sub.8N.sub.9N.sub.2 (SEQ ID NO: 3)) as previously described and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9) of the amino acids in the motif is/are each independently modified with an ubiquitination, phosphorylation, sulfonation, glycosylation, acetylation, methylation, ADP-ribosylation, methionine oxidation, cysteine oxidation, cysteine lipidation, farnesylation, geranylation, pyroglutamation, or deamidation.
(94) Sizes of Polypeptides
(95) The polypeptides may be any length that is reasonable for an epitope. For example, the polypeptides may have a size of from 5 to 30, e.g., from 5 to 25, from 5 to 20, from 5 to 15, from 5 to 10, from 6 to 10, from 7 to 9, or from 8 to 9 amino acids. For example, the polypeptides may have 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids. In some embodiments, the optimal length of a polypeptide may be determined based the immunogenicity of the polypeptides of different lengths when introduced to a cell or subject.
(96) Polynucleotides and Vectors
(97) The present disclosure also includes one or more polynucleotides comprising coding sequences of the polypeptide(s) described herein. As used herein, a polynucleotide may be DNA, RNA, or a hybrid thereof, including without limitation, cDNA, mRNA, genomic DNA, mitochondrial DNA, sgRNA, siRNA, shRNA, miRNA, tRNA, IRNA, snRNA, lncRNA, and synthetic (such as chemically synthesized) DNA or RNA or hybrids thereof. In some examples, a nucleic acid is mRNA. The nucleic acid may be double-stranded or single-stranded. Where single-stranded, the nucleic acid may be the sense strand or the antisense strand. Nucleic acids can include natural nucleotides (such as A, T/U, C, and G), modified nucleotides, analogs of natural nucleotides, such as labeled nucleotides, or any combination thereof.
(98) In certain embodiments, the polynucleotide sequence is recombinant DNA. In further embodiments, the polynucleotide sequence further comprises additional sequences as described elsewhere herein. In certain embodiments, the nucleic acid sequence is synthesized in vitro.
(99) Synthetic mRNA
(100) In some embodiments, the polynucleotide is mRNA, e.g., synthetic mRNA. The mRNA may comprise coding sequence(s) for one or more polypeptides herein. A synthetic mRNA may be an mRNA produced through an in vitro transcription reaction or through artificial (non-natural) chemical synthesis or through a combination thereof. In some embodiments, the synthetic mRNA further comprises a poly A tail, a Kozak sequence, a 3 untranslated region, a 5 untranslated region, or any combination thereof. Poly A tails in particular can be added to a synthetic RNA using a variety of art-recognized techniques, e.g., using poly A polymerase, using transcription directly from PCR products, or by ligating to the 3 end of a synthetic RNA with RNA ligase.
(101) The mRNA may comprise one or more stabilizing elements that maintain or enhance the stabilities of mRNA, e.g., reducing or preventing degradation of the mRNA. Examples of stabilizing elements include untranslated regions (UTR) at their 5-end (5UTR) and/or at their 3-end (3UTR), in addition to other structural features, such as a 5-cap structure or a 3-poly(A) tail. The stabilizing elements may be a histone stem-loop, e.g., a histone stem loop added by a stem-loop binding protein (SLBP).
(102) Vectors
(103) The polynucleotides herein may be in a vector. In some cases, a vector comprises a polynucleotide, the polynucleotide comprising a sequence encoding a barcoding construct operably linked to a first promoter that is an antisense promoter, wherein the barcoding construct comprises a trans-splicing element and a barcode sequence.
(104) The vector may be used for delivering the polynucleotide to cells and/or control the expression of the polynucleotide. A vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. A vector may be a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a vector is capable of replication when associated with the proper control elements. Examples of vectors include nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g., circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. A vector may be a plasmid, e.g., a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
(105) Certain vectors may be capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as expression vectors. Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. A vector may be a recombinant expression vector that comprises a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. As used herein, operably linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
(106) Regulatory Elements
(107) A polynucleotide or vector herein may comprise one or more regulatory elements (or sequences encoding thereof), such as transcription control sequences, e.g., sequences which control the initiation, elongation and termination of transcription. The regulatory element(s) may be operably linked to coding sequences of the engineered proteins. The term operably linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
(108) Exemplary regulatory elements include transcription control sequences, e.g., sequences that control transcription initiation, such as promoter, enhancer, operator and repressor sequences. In some cases, a regulatory element may be a transcription terminator or a sequence encoding thereof. A transcription terminator may comprise a section of nucleic acid sequence that marks the end of a gene or operon in genomic DNA during transcription. This sequence may mediate transcriptional termination by providing signals in the newly synthesized transcript RNA that trigger processes which release the transcript RNA from the transcriptional complex. A regulatory element may be an antisense sequence. In certain case, a regulatory element may be a sense sequence.
(109) Promoters
(110) In some cases, the promoter may be a constitutive promoter, e.g., U6 and H1 promoters, retroviral Rous sarcoma virus (RSV) LTR promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, -actin promoter, phosphoglycerol kinase (PGK) promoter, ubiquitin C, U5 snRNA, U7 snRNA, tRNA promoters or EF1 promoter. In certain cases, the promoter may be a tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g., liver, pancreas), or particular cell types (e.g. lymphocytes). Examples of tissue-specific promoters include Ick, myogenin, or thyl promoters. In some embodiments, the promoter may direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. In certain cases, the promoter may be an inducible promoter, e.g., can be activated by a chemical such as doxycycline.
(111) Codon Optimization
(112) In some embodiments, the polynucleotides herein may be codon optimized, e.g., for expression in a eukaryotic cells such as a mammalian cell or a plant cell. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g., about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the Codon Usage Database available at www.kazusa.orjp/codon/and these tables can be adapted in a number of ways. See Nakamura, Y., et al. Codon usage tabulated from the international DNA sequence databases: status for the year 2000 Nucl. Acids Res. 28:292 (2000). Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, PA), are also available. In some embodiments, one or more codons (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons) in a sequence encoding a DNA/RNA-targeting Cas protein corresponds to the most frequently used codon for a particular amino acid. In certain embodiments, the polynucleotides are not codon optimized.
(113) Codon optimization a canonical ORF may be guided by the information of internal out-of-frame ORFs of the canonical ORF, e.g., information of the sequences, positions, and expression products of internal out-of-frame ORFs, as well as their functions and activities of the expression products. For example, a canonical ORF of a polynucleotides may be codon optimized in a way that the internal out-of-frame ORF(s) of the canonical ORF is not interrupted, so that the expression of the internal out-of-frame ORFs is maintained. In certain cases, the codon optimization may be performed so that both the canonical ORF and the internal out-of-frame ORF(s) are optimized. In some cases, the present disclosure provides a method of designing an immunogenic composition, comprising: identifying immunogenic peptides derived from expression of out-of-frame ORFs; and codon optimizing nucleic-acid based vaccines directed to immunogenic peptides derived from in-frame ORFs such that expression of immunogenic peptides derived from out-of-frame ORFs is maintained.
(114) Antigenic Components
(115) The composition herein may further comprise one or more antigenic components. Antigenic components include components that specifically trigger the immune response against the antigen or antigens from which the antigenic components are derived. Examples of the antigenic components include whole virions (e.g., live attenuated or inactive forms), proteins (such as, but not limited to, envelope and capsid proteins), carbohydrates and lipids derived therefrom, polynucleotides encoding such proteins, as well as combinations thereof, and fragments of the same which are capable of eliciting an immune response in a host. Examples of the antigenic components also include non-replicating viral vector, replicating viral vector, proteins or peptides derived from one or more proteins of the virus, virus-like particles, DNA, and RNA molecules, e.g., DNA or RNA molecules encoding antigenic peptides. In one example, the antigenic components may be capable of stimulating production of an antibody targeting SARS-COV-2.
(116) In some examples, the antigenic components are one or more components in a vaccine against SARS-COV-2, e.g., LNP-encapsulated mRNA vaccine encoding S protein (e.g., mRNA-1273), Adenovirus type 5 vector that expresses S protein (e.g., Ad5-nCOV), DNA plasmid encoding S protein delivered by electroporation (e.g., INO-4800), DCs modified with lentiviral vector expressing synthetic minigene based on domains of selected viral proteins (e.g., LV-SMENP-DC), aAPCs modified with lentiviral vector expressing synthetic minigene based on domains of selected viral proteins (e.g., Pathogenspecific aAPC). Other examples of the antigenic components include those described in Le T T et al., The COVID-19 vaccine development landscape, Nature Reviews Drug Discovery 19, 305-306 (2020), which is incorporated herein in its entirety. In some embodiments, the antigenic components antigenic polypeptides from a nucleocapsid phosphoprotein of SARS-COV-2, a spike glycoprotein of SARS-COV-2, or a combination thereof, or one or more polynucleotides encoding the one or more antigenic polypeptides.
(117) Therapeutic Agents
(118) In some embodiments, the compositions may further comprise one or more therapeutic agents such as anti-viral therapeutics. Such agents may be used together with the immunogenic composition herein for treating virus infection and related health problems. In some cases, the therapeutic agent(s) are drug(s) for treating SARS-COV-2 and related diseases. Examples of such therapeutic agents include nucleoside analogues (e.g., Remdesivir, Favipiravir, Ribavirin), HIV protease inhibitors (e.g., Kaletra (lopinavir/ritonavir)), agents targeting proinflammatory hypercytokinemia (e.g., Tocilizumab and leronlimab), IFN, Antiparasitics (e.g., Ivermectin), antimalarial drugs (e.g., Chloroquine and hydroxychloroquine), agents targeting cardioprotective derivatives (e.g., Colchicine), agents targeting angiotensin-converting enzyme 2 (ACE2), Nicotine, Vitamin D, and Spironolactone. Additional examples of therapeutic agents can be included in the composition include those described in Konstantinidou S K et al., Repurposing current therapeutic regimens against SARS-COV-2 (Review), Exp Ther Med. 2020 September; 20 (3): 1845-1855, which is incorporated herein in its entirety.
(119) Pharmaceutical Formulations
(120) In another aspect, the present disclosure provides pharmaceutical formulations comprising the compositions, or one or more components of the compositions. A pharmaceutical composition may further comprise one or more excipients, such as pharmaceutically acceptable carriers suitable for administration to cells or to a subject. In some examples, the pharmaceutical composition is a vaccine, which elicit protective immunity to a recipient.
(121) As used herein, carrier or excipient includes any and all solvents, diluents, buffers (such as, e.g., neutral buffered saline or phosphate buffered saline), solubilisers, colloids, dispersion media, vehicles, fillers, chelating agents (such as, e.g., EDTA or glutathione), amino acids (such as, e.g., glycine), proteins, disintegrants, binders, lubricants, wetting agents, emulsifiers, sweeteners, colorants, flavourings, aromatisers, thickeners, agents for achieving a depot effect, coatings, antifungal agents, preservatives, stabilisers, antioxidants, tonicity controlling agents, absorption delaying agents, and the like. Examples of solvents are e.g. water, alcohols, vegetable or marine oils (e.g. edible oils like almond oil, castor oil, cacao butter, coconut oil, corn oil, cottonseed oil, linseed oil, olive oil, palm oil, peanut oil, poppy seed oil, rapeseed oil, sesame oil, soybean oil, sunflower oil, and tea seed oil), mineral oils, fatty oils, liquid paraffin, polyethylene glycols, propylene glycols, glycerol, liquid polyalkylsiloxanes, and mixtures thereof. Examples of buffering agents are e.g. citric acid, acetic acid, tartaric acid, lactic acid, hydrogenphosphoric acid, diethyl amine etc. Suitable examples of preservatives for use in compositions are parabenes, such as methyl, ethyl, propyl p-hydroxybenzoate, butylparaben, isobutylparaben, isopropylparaben, potassium sorbate, sorbic acid, benzoic acid, methyl benzoate, phenoxyethanol, bronopol, bronidox, MDM hydantoin, iodopropynyl butylcarbamate, EDTA, benzalkonium chloride, and benzylalcohol, or mixtures of preservatives. The term pharmaceutically acceptable as used throughout this specification is consistent with the art and means compatible with the other ingredients of a pharmaceutical composition and not deleterious to the recipient thereof.
(122) The precise nature of the carrier or excipient or other material will depend on the route of administration. For example, the composition may be in the form of a parenterally acceptable aqueous solution, which is pyrogen-free and has suitable pH, isotonicity and stability. For general principles in medicinal formulation, the reader is referred to Cell Therapy: Stem Cell Transplantation, Gene Therapy, and Cellular Immunotherapy, by G. Morstyn & W. Sheridan eds., Cambridge University Press, 1996; and Hematopoietic Stem Cell Therapy, E. D. Ball, J. Lister & P. Law, Churchill Livingstone, 2000.
(123) The pharmaceutical compositions can be applied parenterally, rectally, orally or topically. For example, the pharmaceutical composition may be used for intravenous, intramuscular, subcutaneous, peritoneal, peridural, rectal, nasal, pulmonary, mucosal, or oral application. In a preferred embodiment, the pharmaceutical composition according to the invention is intended to be used as an infuse. The skilled person will understand that compositions which are to be administered orally or topically will usually not comprise cells, although it may be envisioned for oral compositions to also comprise cells, for example when gastro-intestinal tract indications are treated. The compositions herein may be administered by the same route or may be administered by a different route. By means of example, and without limitation, cells may be administered parenterally, and other active components may be administered orally. In some cases, the composition or pharmaceutical composition may be intramuscular injection. In some cases, the composition or pharmaceutical composition may be intravascular injection.
(124) Liquid pharmaceutical compositions may generally include a liquid carrier such as water or a pharmaceutically acceptable aqueous solution. For example, physiological saline solution, tissue or cell culture media, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
(125) The composition may include one or more cell protective molecules, cell regenerative molecules, growth factors, anti-apoptotic factors or factors that regulate gene expression in the cells. Such substances may render the cells independent of their environment.
(126) Such pharmaceutical compositions may contain further components ensuring the viability of the cells therein. For example, the compositions may comprise a suitable buffer system (e.g., phosphate or carbonate buffer system) to achieve desirable pH, more usually near neutral pH, and may comprise sufficient salt to ensure isosmotic conditions for the cells to prevent osmotic stress. For example, suitable solution for these purposes may be phosphate-buffered saline (PBS), sodium chloride solution, Ringer's Injection or Lactated Ringer's Injection, as known in the art. Further, the composition may comprise a carrier protein, e.g., albumin (e.g., bovine or human albumin), which may increase the viability of the cells.
(127) Further examples of suitably pharmaceutically acceptable carriers or additives include proteins such as collagen or gelatine, carbohydrates such as starch, polysaccharides, sugars (dextrose, glucose and sucrose), cellulose derivatives like sodium or calcium carboxymethylcellulose, hydroxypropyl cellulose or hydroxypropylmethyl cellulose, pregelatinized starches, pectin agar, carrageenan, clays, hydrophilic gums (acacia gum, guar gum, arabic gum and xanthan gum), alginic acid, alginates, hyaluronic acid, polyglycolic and polylactic acid, dextran, pectins, synthetic polymers such as water-soluble acrylic polymer or polyvinylpyrrolidone, proteoglycans, calcium phosphate and the like.
(128) If desired, cell preparation can be administered on a support, scaffold, matrix or material to provide improved tissue regeneration. For example, the material can be a granular ceramic, or a biopolymer such as gelatine, collagen, or fibrinogen. Porous matrices can be synthesized according to standard techniques (e.g., Mikos et al., Biomaterials 14:323, 1993; Mikos et al., Polymer 35:1068, 1994; Cook et al., J. Biomed. Mater. Res. 35:513, 1997). Such support, scaffold, matrix or material may be biodegradable or non-biodegradable. Hence, the cells may be transferred to and/or cultured on suitable substrate, such as porous or non-porous substrate, to provide for implants.
(129) The pharmaceutical compositions may comprise one or more pharmaceutically acceptable salts. The term pharmaceutically acceptable salts refers to salts prepared from pharmaceutically acceptable non-toxic bases or acids including inorganic or organic bases and inorganic or organic acids. Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc, and the like. Particularly preferred are the ammonium, calcium, magnesium, potassium, and sodium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as arginine, betaine, caffeine, choline, N,N-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethyl-morpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine, tripropylamine, tromethamine, and the like. The term pharmaceutically acceptable salt further includes all acceptable salts such as acetate, lactobionate, benzenesulfonate, laurate, benzoate, malate, bicarbonate, maleate, bisulfate, mandelate, bitartrate, mesylate, borate, methylbromide, bromide, methylnitrate, calcium edetate, methylsulfate, camsylate, mucate, carbonate, napsylate, chloride, nitrate, clavulanate, N-methylglucamine, citrate, ammonium salt, dihydrochloride, oleate, edetate, oxalate, edisylate, pamoate (embonate), estolate, palmitate, esylate, pantothenate, fumarate, phosphate/diphosphate, gluceptate, polygalacturonate, gluconate, salicylate, glutamate, stearate, glycollylarsanilate, sulfate, hexylresorcinate, subacetate, hydrabamine, succinate, hydrobromide, tannate, hydrochloride, tartrate, hydroxynaphthoate, teoclate, iodide, tosylate, isothionate, triethiodide, lactate, pamoate, valerate, and the like which can be used as a dosage form for modifying the solubility or hydrolysis characteristics or can be used in sustained release or pro-drug formulations. It will be understood that, as used herein, references to specific agents (e.g., neuromedin U receptor agonists or antagonists), also include the pharmaceutically acceptable salts thereof.
(130) The pharmaceutical composition may be provided in a dosage form that is suitable for administration. Thus, the medicament may be in form of, e.g., tablets, capsules, pills, powders, granulates, suspensions, emulsions, solutions, gels including hydrogels, pastes, ointments, creams, plasters, drenches, delivery devices, injectables, implants, sprays, or aerosols.
(131) In some embodiments, the pharmaceutical compositions further comprise one or more adjuvants. Adjuvants may be molecules or compounds that have intrinsic immunomodulatory properties and, when administered in conjunction with an antigen, effectively potentiate the host antigen-specific immune responses compared to responses raised when antigen is given alone. Examples of adjuvants include aluminum hydroxide and aluminum phosphate, saponins e.g., QUIL-A (commercially available from Brenntag Biosector A/S), QS-21 (Cambridge Biotech Inc., Cambridge Mass.), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, Ala.), water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion. The emulsion may be based in particular on light liquid paraffin oil (European Pharmacopea type); isoprenoid oil such as squalane or squalene; oil resulting from the oligomerization of alkenes, in particular of isobutene or decene; esters of acids or of alcohols containing a linear alkyl group, more particularly plant oils, ethyl oleate, propylene glycol di-(caprylate/caprate), glyceryl tri-(caprylate/caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearic acid esters. The oil is used in combination with emulsifiers to form the emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, of mannide (e.g. anhydromannitol oleate), of glycol, of polyglycerol, of propylene glycol and of oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks. Other examples of adjuvants include Detox-PC, MPL-SE, MoGM-CSF, TiterMax-G, CRL-1005, GERBU, TERamide, PSC97B, Adjumer, PG-026, GSK-I, GcMAF, B-alethine, MPC-026, Adjuvax, CpG ODN, Betafectin, Aluminium salts (e.g. AdjuPhos), Adjuplex, and MF59, lectins, growth factors, cytokines and lymphokines such as alpha-interferon, gamma interferon, platelet derived growth factor (PDGF), granulocyte-colony stimulating factor (gCSF), granulocyte macrophage colony stimulating factor (gMCSF), tumor necrosis factor (TNF), epidermal growth factor (EGF), IL-I, IL-2, IL-4, IL-6, IL-8, IL-IO, and IL-12 or encoding nucleic acids thereof.
(132) Various delivery systems are known and can be used to administer the pharmacological compositions including encapsulation in liposomes, microparticles, microcapsules; minicells; polymers; capsules; tablets; and the like. In one embodiment, the agent may be delivered in a vesicle, in particular a liposome. In a liposome, the agent is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in aqueous solution. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Pat. Nos. 4,837,028 and 4,737,323. In yet another embodiment, the pharmacological compositions can be delivered in a controlled release system including, but not limited to: a delivery pump (See, for example, Saudek, et al., New Engl. J. Med. 321:574 (1989) and a semi-permeable polymeric material (See, for example, Howard, et al., J. Neurosurg. 71:105 (1989)). Additionally, the controlled release system can be placed in proximity of the therapeutic target (e.g., a tumor or infected tissue), thus requiring only a fraction of the systemic dose. See, for example, Goodson, In: Medical Applications of Controlled Release, 1984. (CRC Press, Boca Raton, Fla.).
(133) Cells and Organisms
(134) In another aspect, the present disclosure provides cells and organisms comprising the compositions herein. The cells may be in tissue, organ, or isolated cells. Such cells may be of a unique type of cells or a group of different types of cells such as cultured cell lines, primary cells and proliferative cells. The cells may be prokaryotic cells, lower eukaryotic cells such as yeast, and other eukaryotic cells such as insect cells, plant and mammalian (e.g., human or non-human) cells as well as cells capable of producing the vector of the invention (e.g. 293, HER96, PERC.6 cells, Vero, HeLa, CEF, duck cell lines, etc.). The cells may include cells which can be or has been the recipient of the vector described herein as well as progeny of such cells. Host cells can be cultured in conventional fermentation bioreactors, flasks, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a given cell. No attempts will be made here to describe in detail the various prokaryote and eukaryotic host cells and methods known for the production of the polypeptides and vectors herein.
METHODS OF TREATMENTS AND PROPHYLAXIS
(135) In another aspect, the present disclosure provides methods of treating and/or preventing (e.g., immunizing) an infection (e.g., viral infection) in a subject, and/or disease and conditions related to the infection. Generally, the methods may comprise administering a pharmaceutically effective (e.g., therapeutically effective amount or prophylactically effective amount)) amount of the composition herein to a subject, e.g., a subject in need thereof. In some cases, the method comprise administering the composition(s), the polynucleotide(s), and/or the vector(s) herein to a subject. A pharmaceutically effective amount refers to an amount which can elicit a biological, medicinal, or immunological response in a tissue, system, or subject (e.g., animal or human) that can prevent or alleviate one or more of the local or systemic symptoms or features of a disease or condition being treated.
(136) In certain examples, the methods may be used to induce a T cell response and/or antibody response to SARS-COV-2 in a subject. In some cases, the methods may comprise administering the polypeptides and antigenic agents, and/or anti-viral therapeutics, or polynucleotides encoding thereof to a subject (e.g., a subject in need thereof).
(137) Methods of administrating to a subject include, but are not limited to, intradermal, intrathecal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, by inhalation, and oral routes. The compositions can be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (for example, oral mucosa, rectal and intestinal mucosa, and the like), ocular, and the like and can be administered together with other biologically-active agents. Administration can be systemic or local. In addition, it may be advantageous to administer the composition into the central nervous system by any suitable route, including intraventricular and intrathecal injection. Pulmonary administration may also be employed by use of an inhaler or nebulizer, and formulation with an aerosolizing agent. It may also be desirable to administer the agent locally to the area in need of treatment and prophylaxis; this may be achieved by, for example, local infusion during surgery, topical application, by injection, by means of a catheter, by means of a suppository, or by means of an implant.
(138) The term subject or patient is intended to include mammalian organisms. Examples of subjects/patients include humans and non-human mammals, e.g., non-human primates, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. In specific embodiments of the invention, the subject is a human.
(139) In some cases, the methods comprise administering to a subject the pharmaceutical compositions alone or in concert with other therapeutic agents at appropriate dosages defined by routine testing in order to obtain optimal efficacy while minimizing any potential toxicity. The dosage regimen utilizing a pharmaceutical composition may be selected in accordance with a variety of factors including type, species, age, weight, sex, medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular pharmaceutical composition employed.
(140) Optimal precision in achieving concentrations of the therapeutic regimen within the range that yields maximum efficacy with minimal toxicity may require a regimen based on the kinetics of the pharmaceutical composition's availability to one or more target sites. Distribution, equilibrium, and elimination of a pharmaceutical composition may be considered when determining the optimal concentration for a treatment regimen. The dosages of a pharmaceutical composition disclosed herein may be adjusted when combined to achieve desired effects. On the other hand, dosages of the pharmaceutical composition and various therapeutic agents may be independently optimized and combined to achieve a synergistic result wherein the pathology is reduced more than it would be if either was used alone.
(141) In particular, toxicity and therapeutic efficacy of the pharmaceutical composition may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index and it may be expressed as the ratio LD50/ED50. Pharmaceutical compositions exhibiting large therapeutic indices are preferred except when cytotoxicity of the composition is the activity or therapeutic outcome that is desired. Although pharmaceutical compositions that exhibit toxic side effects may be used, a delivery system can target such compositions to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. Generally, the pharmaceutical compositions of the present invention may be administered in a manner that maximizes efficacy and minimizes toxicity.
(142) Data obtained from cell culture assays and animal studies may be used in formulating a range of dosages for use in humans. The dosages of such compositions lie preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any composition used in the methods of the invention, the therapeutically effective dose may be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC.sub.50 (the concentration of the test composition that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information may be used to accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
(143) The methods may comprise administering a booster agent in addition to the administration of the composition therein. A booster agent may be an extra administration of the composition herein or a different agent. A booster (or booster vaccine) may be given after an earlier administration of the composition. The time of administration between the initial administration of the composition and the booster may be at least 1 minute, at least 5 minutes, at least 10 minutes, at least 20 minutes, at least 30 minutes, at least 40 minutes, at least 50 minutes, at least 1 hour, at least 2 hours, at least 4 hours, at least 8 hours, at least 12 hours, at least 1 day, at least 1 week, at least 2 week, at least 3 week, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 1 year, at least 5 years, at least 10 years, and any time period in-between.
(144) Delivery to Cells and Organisms
(145) The present disclosure also provides delivery systems for introducing the compositions herein to cells, tissues, organs, or organisms. A delivery system may comprise one or more delivery vehicles and/or cargos. Exemplary delivery systems and methods include those described in paragraphs to of Feng Zhang et al., (WO2016106236A1), and pages 1241-1251 and Table 1 of Lino C A et al., Delivering CRISPR: a review of the challenges and approaches, DRUG DELIVERY, 2018, VOL. 25, NO. 1, 1234-1257, which are incorporated by reference herein in their entireties.
(146) Cargos
(147) The delivery systems may comprise one or more cargos. A cargo may comprise one or more of the following: i) one or more polypeptides herein, ii) one or more polynucleotides encoding the polypeptide(s) or vectors comprising the polynucleotides; (iii) mRNA molecules encoding the one or more polypeptides; iv) cells comprising i), ii) and/or iii). In some examples, a cargo may comprise a plasmid encoding one or more engineered proteins herein.
(148) Physical Delivery
(149) In some embodiments, the cargos may be introduced to cells by physical delivery methods. Examples of physical methods include microinjection, electroporation, and hydrodynamic delivery. Both nucleic acid and proteins may be delivered using such methods. For example, the polypeptides and polynucleotides may be prepared in vitro, isolated, (refolded, purified if needed), and introduced to cells.
(150) Microinjection
(151) Microinjection of the cargo directly to cells can achieve high efficiency, e.g., above 90% or about 100%. In some embodiments, microinjection may be performed using a microscope and a needle (e.g., with 0.5-5.0 m in diameter) to pierce a cell membrane and deliver the cargo directly to a target site within the cell. Microinjection may be used for in vitro and ex vivo delivery.
(152) Polynucleotides and vectors comprising coding sequences for the polypeptides may be microinjected. In some cases, microinjection may be used i) to deliver DNA directly to a cell nucleus, and/or ii) to deliver mRNA (e.g., in vitro transcribed) to a cell nucleus or cytoplasm.
(153) Microinjection may be used to generate genetically modified animals. For example, gene editing cargos may be injected into zygotes to allow for efficient germline modification. Such approach can yield normal embryos and full-term mouse pups harboring the desired modification(s).
(154) Electroporation
(155) In some embodiments, the cargos and/or delivery vehicles may be delivered by electroporation. Electroporation may use pulsed high-voltage electrical currents to transiently open nanometer-sized pores within the cellular membrane of cells suspended in buffer, allowing for components with hydrodynamic diameters of tens of nanometers to flow into the cell. In some cases, electroporation may be used on various cell types and efficiently transfer cargo into cells. Electroporation may be used for in vitro and ex vivo delivery.
(156) Electroporation may also be used to deliver the cargo to into the nuclei of mammalian cells by applying specific voltage and reagents, e.g., by nucleofection. Such approaches include those described in Wu Y, et al. (2015). Cell Res 25:67-79; Ye L, et al. (2014). Proc Natl Acad Sci USA 111:9591-6; Choi P S, Meyerson M. (2014). Nat Commun 5:3728; Wang J, Quake S R. (2014). Proc Natl Acad Sci 111:13157-62. Electroporation may also be used to deliver the cargo in vivo, e.g., with methods described in Zuckermann M, et al. (2015). Nat Commun 6:7391.
(157) Hydrodynamic Delivery
(158) Hydrodynamic delivery may also be used for delivering the cargos, e.g., for in vivo delivery. In some examples, hydrodynamic delivery may be performed by rapidly pushing a large volume (8-10% body weight) solution containing the gene editing cargo into the bloodstream of a subject (e.g., an animal or human), e.g., for mice, via the tail vein. As blood is incompressible, the large bolus of liquid may result in an increase in hydrodynamic pressure that temporarily enhances permeability into endothelial and parenchymal cells, allowing for cargo not normally capable of crossing a cellular membrane to pass into cells. This approach may be used for delivering naked DNA plasmids and proteins. The delivered cargos may be enriched in liver, kidney, lung, muscle, and/or heart.
(159) Transfection
(160) The cargos, e.g., nucleic acids, may be introduced to cells by transfection methods for introducing nucleic acids into cells. Examples of transfection methods include calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendrimer transfection, heat shock transfection, magnetofection, lipofection, impalefection, optical transfection, proprietary agent-enhanced uptake of nucleic acid.
(161) Delivery Vehicles
(162) The delivery systems may comprise one or more delivery vehicles. The delivery vehicles may deliver the cargo into cells, tissues, organs, or organisms (e.g., animals or plants). The cargos may be packaged, carried, or otherwise associated with the delivery vehicles. The delivery vehicles may be selected based on the types of cargo to be delivered, and/or the delivery is in vitro and/or in vivo. Examples of delivery vehicles include vectors, viruses, non-viral vehicles, and other delivery reagents described herein.
(163) The delivery vehicles in accordance with the present invention may a greatest dimension (e.g. diameter) of less than 100 microns (m). In some embodiments, the delivery vehicles have a greatest dimension of less than 10 m. In some embodiments, the delivery vehicles may have a greatest dimension of less than 2000 nanometers (nm). In some embodiments, the delivery vehicles may have a greatest dimension of less than 1000 nanometers (nm). In some embodiments, the delivery vehicles may have a greatest dimension (e.g., diameter) of less than 900 nm, less than 800 nm, less than 700 nm, less than 600 nm, less than 500 nm, less than 400 nm, less than 300 nm, less than 200 nm, less than 150 nm, or less than 100 nm, less than 50 nm. In some embodiments, the delivery vehicles may have a greatest dimension ranging between 25 nm and 200 nm.
(164) In some embodiments, the delivery vehicles may be or comprise particles. For example, the delivery vehicle may be or comprise nanoparticles (e.g., particles with a greatest dimension (e.g., diameter) no greater than 1000 nm. The particles may be provided in different forms, e.g., as solid particles (e.g., metal such as silver, gold, iron, titanium), non-metal, lipid-based solids, polymers), suspensions of particles, or combinations thereof. Metal, dielectric, and semiconductor particles may be prepared, as well as hybrid structures (e.g., core-shell particles).
(165) Viral Vectors
(166) The cargos may be delivered by viruses. In some embodiments, viral vectors are used. A viral vector may comprise virally-derived DNA or RNA sequences for packaging into a virus (e.g., retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Viruses and viral vectors may be used for in vitro, ex vivo, and/or in vivo deliveries.
(167) Adeno Associated Virus (AAV)
(168) The compositions herein may be delivered by adeno associated virus (AAV). AAV vectors may be used for such delivery. AAV, of the Dependovirus genus and Parvoviridae family, is a single stranded DNA virus. In some embodiments, AAV may provide a persistent source of the provided DNA, as AAV delivered genomic material can exist indefinitely in cells, e.g., either as exogenous DNA or, with some modification, be directly integrated into the host DNA. In some embodiments, AAV do not cause or relate with any diseases in humans. The virus itself is able to efficiently infect cells while provoking little to no innate or adaptive immune response or associated toxicity.
(169) Examples of AAV that can be used herein include AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-8, and AAV-9. The type of AAV may be selected with regard to the cells to be targeted; e.g., one can select AAV serotypes 1, 2, 5 or a hybrid capsid AAV1, AAV2, AAV5 or any combination thereof for targeting brain or neuronal cells; and one can select AAV4 for targeting cardiac tissue. AAV8 is useful for delivery to the liver. AAV-2-based vectors were originally proposed for CFTR delivery to CF airways, other serotypes such as AAV-1, AAV-5, AAV-6, and AAV-9 exhibit improved gene transfer efficiency in a variety of models of the lung epithelium. Examples of cell types targeted by AAV are described in Grimm, D. et al, J. Virol. 82:5887-5911 (2008)). In some examples, AAV particles may be created in HEK 293 T cells. Once particles with specific tropism have been created, they are used to infect the target cell line much in the same way that native viral particles do. This may allow for persistent presence of engineered proteins in the infected cell type, and what makes this version of delivery particularly suited to cases where long-term expression is desirable. Examples of doses and formulations for AAV that can be used include those describe in U.S. Pat. Nos. 8,454,972 and 8,404,658.
(170) Various strategies may be used for delivery the systems and compositions herein with AAVs. In some examples, coding sequences of engineered proteins may be packaged directly onto one DNA plasmid vector and delivered via one AAV particle. In some examples, AAVs may be used to deliver gRNAs into cells that have been previously engineered to express the engineered protein. In some examples, coding sequences of two or more engineered proteins may be made into two separate AAV particles, which are used for co-transfection of target cells.
(171) Lentiviruses
(172) The compositions herein may be delivered by lentiviruses. Lentiviral vectors may be used for such delivery. Lentiviruses are complex retroviruses that have the ability to infect and express their genes in both mitotic and post-mitotic cells.
(173) Examples of lentiviruses include human immunodeficiency virus (HIV), which may use its envelope glycoproteins of other viruses to target a broad range of cell types; minimal non-primate lentiviral vectors based on the equine infectious anemia virus (EIAV), which may be used for ocular therapies. In certain embodiments, self-inactivating lentiviral vectors with an siRNA targeting a common exon shared by HIV tat/rev, a nucleolar-localizing TAR decoy, and an anti-CCR5-specific hammerhead ribozyme (see, e.g., DiGiusto et al. (2010) Sci Transl Med 2: 36ra43) may be used and/or adapted to the nucleic acid-targeting system herein.
(174) Lentiviruses may be pseudo-typed with other viral proteins, such as the G protein of vesicular stomatitis virus. In doing so, the cellular tropism of the lentiviruses can be altered to be as broad or narrow as desired. In some cases, to improve safety, second- and third-generation lentiviral systems may split essential genes across three plasmids, which may reduce the likelihood of accidental reconstitution of viable viral particles within cells.
(175) In some examples, leveraging the integration ability, lentiviruses may be used to create libraries of cells comprising various genetic modifications, e.g., for screening and/or studying genes and signaling pathways.
(176) Adenoviruses
(177) The systems and compositions herein may be delivered by adenoviruses. Adenoviral vectors may be used for such delivery. Adenoviruses include nonenveloped viruses with an icosahedral nucleocapsid containing a double stranded DNA genome. Adenoviruses may infect dividing and non-dividing cells.
(178) Non-Viral Vehicles
(179) The delivery vehicles may comprise non-viral vehicles. In general, methods and vehicles capable of delivering nucleic acids and/or proteins may be used for delivering the systems compositions herein. Examples of non-viral vehicles include lipid nanoparticles, cell-penetrating peptides (CPPs), DNA nanoclews, gold nanoparticles, streptolysin O, multifunctional envelope-type nanodevices (MENDs), lipid-coated mesoporous silica particles, and other inorganic nanoparticles.
(180) Lipid Particles
(181) The delivery vehicles may comprise lipid particles, e.g., lipid nanoparticles (LNPs) and liposomes.
(182) Lipid Nanoparticles (LNPs)
(183) LNPs may encapsulate nucleic acids within cationic lipid particles (e.g., liposomes), and may be delivered to cells with relative ease. In some examples, lipid nanoparticles do not contain any viral components, which helps minimize safety and immunogenicity concerns. Lipid particles may be used for in vitro, ex vivo, and in vivo deliveries. Lipid particles may be used for various scales of cell populations.
(184) In some examples. LNPs may be used for delivering DNA molecules and/or RNA molecules. In certain cases, LNPs may be use for delivering RNP complexes.
(185) Components in LNPs may comprise cationic lipids 1,2-dilineoyl-3-dimethylammonium-propane (DLinDAP), 1,2-dilinoleyloxy-3-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxyketo-N,N-dimethyl-3-aminopropane (DLinK-DMA), 1,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLinKC2-DMA), (3-o-[2-(methoxypolyethyleneglycol 2000) succinoyl]-1,2-dimyristoyl-sn-glycol (PEG-S-DMG), R-3-[(ro-methoxy-poly(ethylene glycol) 2000) carbamoyl]-1,2-dimyristyloxlpropyl-3-amine (PEG-C-DOMG, and any combination thereof. Preparation of LNPs and encapsulation may be adapted from Rosin et al, Molecular Therapy, vol. 19, no. 12, pages 1286-220 December 2011).
(186) Liposomes
(187) In some embodiments, a lipid particle may be liposome. Liposomes are spherical vesicle structures composed of a uni- or multilamellar lipid bilayer surrounding internal aqueous compartments and a relatively impermeable outer lipophilic phospholipid bilayer. In some embodiments, liposomes are biocompatible, nontoxic, can deliver both hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, and transport their load across biological membranes and the blood brain barrier (BBB).
(188) Liposomes can be made from several different types of lipids, e.g., phospholipids. A liposome may comprise natural phospholipids and lipids such as 1,2-distearoryl-sn-glycero-3-phosphatidyl choline (DSPC), sphingomyelin, egg phosphatidylcholines, monosialoganglioside, or any combination thereof.
(189) Several other additives may be added to liposomes in order to modify their structure and properties. For instance, liposomes may further comprise cholesterol, sphingomyelin, and/or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), e.g., to increase stability and/or to prevent the leakage of the liposomal inner cargo.
(190) Stable Nucleic-Acid-Lipid Particles (SNALPs)
(191) In some embodiments, the lipid particles may be stable nucleic acid lipid particles (SNALPs). SNALPs may comprise an ionizable lipid (DLinDMA) (e.g., cationic at low pH), a neutral helper lipid, cholesterol, a diffusible polyethylene glycol (PEG)-lipid, or any combination thereof. In some examples, SNALPs may comprise synthetic cholesterol, dipalmitoylphosphatidylcholine, 3-N-[(w-methoxy polyethylene glycol) 2000) carbamoyl]-1,2-dimyrestyloxypropylamine, and cationic 1,2-dilinoleyloxy-3-N,Ndimethylaminopropane. In some examples, SNALPs may comprise synthetic cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine, PEG-CDMA, and 1,2-dilinoleyloxy-3-(N;N-dimethyl) aminopropane (DLinDMA).
(192) Other Lipids
(193) The lipid particles may also comprise one or more other types of lipids, e.g., cationic lipids, such as amino lipid 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), DLin-KC2-DMA4, C12-200 and colipids distearoylphosphatidylcholine, cholesterol, and PEG-DMG.
(194) Lipoplexes/Polyplexes
(195) In some embodiments, the delivery vehicles comprise lipoplexes and/or polyplexes. Lipoplexes may bind to negatively charged cell membrane and induce endocytosis into the cells. Examples of lipoplexes may be complexes comprising lipid(s) and non-lipid components. Examples of lipoplexes and polyplexes include FuGENE-6 reagent, a non-liposomal solution containing lipids and other components, zwitterionic amino lipids (ZALs), Ca2b (e.g., forming DNA/Ca.sup.2+ microcomplexes), polyethylenimine (PEI) (e.g., branched PEI), and poly(L-lysine) (PLL).
(196) Cell Penetrating Peptides
(197) In some embodiments, the delivery vehicles comprise cell penetrating peptides (CPPs). CPPs are short peptides that facilitate cellular uptake of various molecular cargo (e.g., from nanosized particles to small chemical molecules and large fragments of DNA).
(198) CPPs may be of different sizes, amino acid sequences, and charges. In some examples, CPPs can translocate the plasma membrane and facilitate the delivery of various molecular cargoes to the cytoplasm or an organelle. CPPs may be introduced into cells via different mechanisms, e.g., direct penetration in the membrane, endocytosis-mediated entry, and translocation through the formation of a transitory structure.
(199) CPPs may have an amino acid composition that either contains a high relative abundance of positively charged amino acids such as lysine or arginine or has sequences that contain an alternating pattern of polar/charged amino acids and non-polar, hydrophobic amino acids. These two types of structures are referred to as polycationic or amphipathic, respectively. A third class of CPPs are the hydrophobic peptides, containing only apolar residues, with low net charge or have hydrophobic amino acid groups that are crucial for cellular uptake. Another type of CPPs is the trans-activating transcriptional activator (Tat) from Human Immunodeficiency Virus 1 (HIV-1). Examples of CPPs include to Penetratin, Tat (48-60), Transportan, and (R-AhX-R4) (Ahx refers to aminohexanoyl), Kaposi fibroblast growth factor (FGF) signal peptide sequence, integrin 3 signal peptide sequence, polyarginine peptide Args sequence, Guanine rich-molecular transporters, and sweet arrow peptide. Examples of CPPs and related applications also include those described in U.S. Pat. No. 8,372,951.
(200) CPPs can be used for in vitro and ex vivo work quite readily, and extensive optimization for each cargo and cell type is usually required. In some examples, CPPs may be covalently attached to the engineered protein directly, which is then complexed with the gRNA and delivered to cells. CPP may also be used to delivery RNPs.
(201) CPPs may be used to deliver the compositions and systems to plants. In some examples, CPPs may be used to deliver the components to plant protoplasts, which are then regenerated to plant cells and further to plants.
(202) DNA Nanoclews
(203) In some embodiments, the delivery vehicles comprise DNA nanoclews. A DNA nanoclew refers to a sphere-like structure of DNA (e.g., with a shape of a ball of yarn). The nanoclew may be synthesized by rolling circle amplification with palindromic sequences that aide in the self-assembly of the structure. The sphere may then be loaded with a payload. An example of DNA nanoclew is described in Sun W et al, J Am Chem Soc. 2014 Oct. 22; 136 (42): 14722-5; and Sun W et al, Angew Chem Int Ed Engl. 2015 Oct. 5; 54 (41): 12029-33. A DNA nanoclew may be coated, e.g., coated with PEI to induce endosomal escape.
(204) Gold Nanoparticles
(205) In some embodiments, the delivery vehicles comprise gold nanoparticles (also referred to AuNPs or colloidal gold). Gold nanoparticles may form complex with cargos. Gold nanoparticles may be coated, e.g., coated in a silicate and an endosomal disruptive polymer, PAsp (DET). Examples of gold nanoparticles include AuraSense Therapeutics' Spherical Nucleic Acid (SNA) constructs, and those described in Mout R, et al. (2017). ACS Nano 11:2452-8; Lee K, et al. (2017). Nat Biomed Eng 1:889-901.
(206) iTOP
(207) In some embodiments, the delivery vehicles comprise iTOP. iTOP refers to a combination of small molecules drives the highly efficient intracellular delivery of native proteins, independent of any transduction peptide. iTOP may be used for induced transduction by osmocytosis and propanebetaine, using NaCl-mediated hyperosmolality together with a transduction compound (propanebetaine) to trigger macropinocytotic uptake into cells of extracellular macromolecules. Examples of iTOP methods and reagents include those described in D'Astolfo D S, Pagliero R J, Pras A, et al. (2015). Cell 161:674-690.
(208) Polymer-Based Particles
(209) In some embodiments, the delivery vehicles may comprise polymer-based particles (e.g., nanoparticles). In some embodiments, the polymer-based particles may mimic a viral mechanism of membrane fusion. The polymer-based particles may be a synthetic copy of Influenza virus machinery and form transfection complexes with various types of nucleic acids ((siRNA, miRNA, plasmid DNA or shRNA, mRNA) that cells take up via the endocytosis pathway, a process that involves the formation of an acidic compartment. The low pH in late endosomes acts as a chemical switch that renders the particle surface hydrophobic and facilitates membrane crossing. Once in the cytosol, the particle releases its payload for cellular action. This Active Endosome Escape technology is safe and maximizes transfection efficiency as it is using a natural uptake pathway.
(210) Streptolysin O (SLO)
(211) The delivery vehicles may be streptolysin O (SLO). SLO is a toxin produced by Group A streptococci that works by creating pores in mammalian cell membranes. SLO may act in a reversible manner, which allows for the delivery of proteins (e.g., up to 100 kDa) to the cytosol of cells without compromising overall viability. Examples of SLO include those described in Sierig G, et al. (2003). Infect Immun 71:446-55; Walev I, et al. (2001). Proc Natl Acad Sci USA 98:3185-90; Teng K W, et al. (2017). Elife 6: e25460.
(212) Multifunctional Envelope-Type Nanodevice (MEND)
(213) The delivery vehicles may comprise multifunctional envelope-type nanodevice (MENDs). MENDs may comprise condensed plasmid DNA, a PLL core, and a lipid film shell. A MEND may further comprise cell-penetrating peptide (e.g., stearyl octaarginine). The cell penetrating peptide may be in the lipid shell. The lipid envelope may be modified with one or more functional components, e.g., one or more of: polyethylene glycol (e.g., to increase vascular circulation time), ligands for targeting of specific tissues/cells, additional cell-penetrating peptides (e.g., for greater cellular delivery), lipids to enhance endosomal escape, and nuclear delivery tags. In some examples, the MEND may be a tetra-lamellar MEND (T-MEND), which may target the cellular nucleus and mitochondria. In certain examples, a MEND may be a PEG-peptide-DOPE-conjugated MEND (PPD-MEND), which may target bladder cancer cells. Examples of MENDs include those described in Kogure K, et al. (2004). J Control Release 98:317-23; Nakamura T, et al. (2012). Acc Chem Res 45:1113-21.
(214) Lipid-Coated Mesoporous Silica Particles
(215) The delivery vehicles may comprise lipid-coated mesoporous silica particles. Lipid-coated mesoporous silica particles may comprise a mesoporous silica nanoparticle core and a lipid membrane shell. The silica core may have a large internal surface area, leading to high cargo loading capacities. In some embodiments, pore sizes, pore chemistry, and overall particle sizes may be modified for loading different types of cargos. The lipid coating of the particle may also be modified to maximize cargo loading, increase circulation times, and provide precise targeting and cargo release. Examples of lipid-coated mesoporous silica particles include those described in Du X, et al. (2014). Biomaterials 35:5580-90; Durfee P N, et al. (2016). ACS Nano 10:8325-45.
(216) Inorganic Nanoparticles
(217) The delivery vehicles may comprise inorganic nanoparticles. Examples of inorganic nanoparticles include carbon nanotubes (CNTs) (e.g., as described in Bates K and Kostarelos K. (2013). Adv Drug Deliv Rev 65:2023-33.), bare mesoporous silica nanoparticles (MSNPs) (e.g., as described in Luo G F, et al. (2014). Sci Rep 4:6064), and dense silica nanoparticles (SiNPs) (as described in Luo D and Saltzman W M. (2000). Nat Biotechnol 18:893-5).
(218) Exosomes
(219) The delivery vehicles may comprise exosomes. Exosomes include membrane bound extracellular vesicles, which can be used to contain and delivery various types of biomolecules, such as proteins, carbohydrates, lipids, and nucleic acids, and complexes thereof (e.g., RNPs). Examples of exosomes include those described in Schroeder A, et al., J Intern Med. 2010 January;267 (1): 9-21; El-Andaloussi S, et al., Nat Protoc. 2012 December; 7 (12): 2112-26; Uno Y, et al., Hum Gene Ther. 2011 June; 22 (6): 711-9; Zou W, et al., Hum Gene Ther. 2011 April; 22 (4): 465-75.
(220) In some examples, the exosome may form a complex (e.g., by binding directly or indirectly) to one or more components of the cargo. In certain examples, a molecule of an exosome may be fused with first adapter protein and a component of the cargo may be fused with a second adapter protein. The first and the second adapter protein may specifically bind each other, thus associating the cargo with the exosome. Examples of such exosomes include those described in Ye Y, et al., Biomater Sci. 2020 Apr. 28. doi: 10.1039/d0bm00427 h.
ADDITIONAL EXEMPLARY APPLICATIONS
(221) In another aspect, the present disclosure provides methods of determining an infection status of a subject. In some embodiments, the methods comprise contacting immune cells derived from the subject with the composition herein; and detecting cross-reactivity of the immune cells to the composition.
(222) In some embodiments, the methods may be used for performing T cell assay. For example, the methods may determine T cells' response to the compositions such as the polypeptides. The response may be used to evaluate the infection or immunity status of the subject from which the T cells are derived from. In one example, T cells (e.g., CD8+ T cells) may be isolated from PBMCs and incubated with the compositions herein. Proliferation of T cells can be measured by 3H thymidine incorporation. Secretion of cytokines from the T cells may be measured, e.g., by ELISA.
(223) In some embodiments, the information of HLA-I peptides from internal out-of-frame ORFs may be used to modify the sequence of canonical ORFs, e.g., to ensure the continuous synthesis and presentation of peptides from the optimized sequences.
METHOD OF IDENTIFYING IMMUNOGENIC POLYPEPTIDES
(224) In another aspect, the present disclosure provides methods for screening and identifying the immunogenic polypeptides herein. In general, the methods comprise isolating complex(es) of MHC-I (e.g., HLA-I) and binding partners from cells infected by a pathogen such as a virus (e.g., SARS-COV-2), and characterizing (e.g., determining the sequences) of polypeptides in the isolated complex, and identifying polypeptides derived from one or more proteins of the virus. In some embodiments, the method can include identifying polypeptides derived from one or more open reading frames. In some embodiments, the open reading frames are annotated ORFs, alternative ORFs, canonical ORFs, and/or noncanonical ORFs. ORFs are discussed and described in greater detail elsewhere herein.
(225) In certain examples, the methods of identifying immunogenic peptides comprising: a) lysing cells having a potential to express the immunogenic peptides of interest with a lysis buffer comprising a cell membrane disrupting detergent; b) enzymatic shearing of nucleic acids in the lysed cells; c) isolating HLA-I from the lysed cells, wherein the HLA-I is in complex with one or more polypeptides or proteins from the lysed cells; and d) determining sequences of the one or more polypeptides or proteins in complex with the HLA-I from (c).
(226) The cells used in the method may be treated with one or more cell signaling molecules related to infection by the pathogen. In some cases, the cells may express (e.g., overexpress by an exogenous gene) one or more proteins regulating or mediating a virus infection. For example, the cells may express one or more receptors involved in a viral infection process, e.g., ACE-2 and TMPRSS2. In certain cases, the cells may be engineered to alter (e.g., increase or decrease) HLA presentation. For example, the cells may express (e.g., by one or more exogenous genes) one or more of CITA, proteasome subunits, TPA, POMP, or ubiquitin-proteasome genes.
(227) In some embodiments, the methods comprise lysing the cells infected by the virus with a lysis buffer. The lysis buffer may be capable of breaking the cells while retaining intact complexes of HMC-I and its binding partners. The lysis buffer may comprise one or more membrane disrupting detergents. In one example, the membrane disrupting detergent is Triton-X. The concentration of the Triton-X in the lysis buffer may be from 0.1% to 5%, e.g., from 0.5% to 3%, from 1% to 2%, from 1.2% to 1.8%, or from 1.4% to 1.6%. In one example, the concentration of the Triton-X in the lysis buffer may be about 1%, about 1.1%, about 1.2%, about 1.3%, about 1.4%, about 1.5%, about 1.6%, about 1.7%, about 1.8%, about 1.9%, or about 2.0%.
(228) In some embodiments, the methods comprise shearing nucleic acid (e.g., DNA) in the lysed cells. In some examples, the shearing is enzymatic shearing, e.g., no sonication is used. In such cases, the shearing may be performed using an enzyme, e.g., nuclease. The nuclease may be an endonuclease that degrades all forms of DNA and RNA (single stranded, double stranded, linear and circular) while having no proteolytic activity. The endonuclease may be derived from Serratia marcescens or a variant thereof. In one example, the endonuclease is Benzonase. A salt may be used together with the enzyme in shearing the nucleic acid. The salt may be a Magnesium salt, e.g., MgCl.sub.2, MgSO.sub.4, and magnesium acetate.
(229) The methods may further comprise isolating MHC-I from the lysed cells. In an embodiment isolating the MHC-I comprises isolating the HLA-I from the lysed cells, wherein the HLA-I (or other MHC-I) is in complex with one or more polypeptides or proteins from the lysed cells. Such polypeptides and proteins may be derived the virus that infects the cells. The isolation may be performed using immunoprecipitation, e.g., using a reagent that bind to one or more components of MHC-1 or one or more molecules attached to MHC-1.
(230) The methods may also comprise determining the sequences of the one or more polypeptides or proteins in complex with the MHC-I. In some embodiments, the sequences may be determined using mass spectrometry, e.g., liquid chromatography tandem mass spectrometry analysis.
(231) In some embodiments, the methods may comprise characterizing the nucleic acids, e.g., RNA, in the infected. The results of the characterization may be used to determine the viral abundance in the cells. The determination may be performed using sequencing technologies such as shotgun sequencing, resequencing, de novo assembly, exome sequencing, DNA-Seq, Targeted DNA-Seq, Methyl-Seq, Targeted methyl-Seq, DNase-Seq, Sono-Seq, FAIRE-seq, MAINE-Seq, RNA-Seq, ChIP-Seq, RIP-Seq, CLIP-Seq, HITS-Seq, FRT-Seq, NET-Seq, Hi-C, Chia-PET, Ribo-Seq, TRAP, PARS, synthetic saturation mutagenesis, Immuno-Seq, Deep protein mutagenesis, PhIT-Seq, SMRT, and genome-wide chromatin interaction mapping. In some embodiments, the methods comprise performing RNA-Seq on the RNA in the infected cells.
(232) The methods may further comprise identifying HLA alleles that bind the polypeptides identified in using an HLA I epitope binding predictor and selecting a subset of polypeptides that bind a defined percentage of HLA I alleles in a population. The binding predictor may be a machine learning-based method, e.g., the methods described in O'Donnell T J, et al., MHCflurry 2.0: Improved Pan-Allele Prediction of MHC Class I-Presented Peptides by Incorporating Antigen Processing, Cell Syst. 2020 Jul. 22; 11 (1): 42-48.e7; Poran A, et al., Sequence-based prediction of SARS-COV-2 vaccine targets using a mass spectrometry-based bioinformatics predictor identifies immunogenic T cell epitopes. Genome Med 12, 70 (2020); and Sarkizova, S., Klaeger, S., Le, P. M. et al. A large peptidome dataset improves HLA class I epitope prediction across most of the human population. Nat Biotechnol 38, 199-209 (2020). https://doi.org/10.1038/s41587-019-0322-9, which are each incorporated by reference herein in their entireties.
(233) The immunogenic polypeptides may be selected based on sequencing data. For example, the methods may further comprise selecting immunogenic polypeptides demonstrating a relative abundance above a defined threshold as determine by analysis of the complete cellular transcriptome and/or proteome. In some cases, the expression level of genes may be determined (e.g., by computational methods based on the sequencing data) and the polypeptides may be ranked and selected from highly abundant genes (e.g., genes with high expression levels). Alternatively or additionally, ribosomal sequencing may be used (in some cases no RNA-seq data is used) to identify polypeptides that are being actively translated by the cell at one or more time points, and only those polypeptides that are actively translated are selected. The datasets from this approach are different from conventional mass-spectrometry search datasets in that they include out-of-frame ORFs, which may include internal out-of-frame ORFs.
(234) mRNA Vaccines
(235) In some embodiments, one or more polynucleotides encoding the one or more immunogenic polypeptides described herein are included in an mRNA vaccine composition. The mRNA vaccine composition can be administered to a subject in need thereof. In some embodiments, the vaccine is administered to a subject in an effective amount to induce an immune response in the subject.
(236) Described herein are pharmaceutical compositions that include one or more isolated messenger ribonucleic (mRNA) polynucleotides encoding at least one SARS-COV-2 antigenic polypeptide or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response to the antigenic polypeptide), such as any of those polynucleotides described in greater detail elsewhere herein, where the isolated mRNA is formulated in a lipid nanoparticle. As used herein antigenic polypeptide encompasses immunogenic fragments of the antigenic polypeptide (an immunogenic fragment that is induces (or is capable of inducing) an immune response to a SARS-COV-2 variant. The mRNA encoding at least one SARS-COV-2 antigenic polypeptide or immunogenic fragment thereof can include an open reading frame that encodes the at least one SARS-COV-2 antigenic polypeptide or immunogenic fragment thereof. In some embodiments, the open reading frame encodes at least two, at least five, or at least ten SARS-CoV-2 antigenic polypeptides and/or immunogenic fragments thereof. In some embodiments, the open reading frame encodes at least 100 antigenic polypeptides. In some embodiments, the open reading frame encodes 2-100 SARS-COV-2 antigenic polypeptides and/or immunogenic fragments thereof.
(237) In some embodiments, the pharmaceutical composition comprises a plurality of lipid nanoparticles comprising a cationic lipid, a neutral lipid, a cholesterol, and a PEG lipid, wherein the plurality of lipid nanoparticles optionally has a mean particle size of between 80 nm and 160 nm; and wherein the lipid nanoparticles comprise one or more polynucleotides encoding at least one SARS-COV-2 antigenic polypeptide or an immunogenic fragment thereof.
(238) In some embodiments, the mRNA vaccine is multivalent. In some embodiments, the mRNA of the mRNA vaccine is codon-optimized. In some embodiments, a RNA (e.g., mRNA) vaccine further includes an adjuvant.
(239) In some embodiments, the isolated mRNA is not self-replicating.
(240) In some embodiment, the isolated mRNA comprises and/or encodes one or more 5terminal cap (or cap structure), 3terminal cap, 5untranslated region, 3untranslated region, a tailing region, or any combination thereof.
(241) In some embodiments, the capping region of the isolated mRNA region may be from 1 to 10, e.g., 2-9, 3-8, 4-7, 1-5, 5-10, or at least 2, or 10 or fewer nucleotides in length. In some embodiments, the cap is absent.
(242) In some embodiments, a 5-cap structure is cap0, cap1, ARCA, inosine, N1-methyl-guanosine, 2-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, or 2-azido-guanosine.
(243) In some embodiments, the 5terminal cap is 7 mG (5) ppp (5) NlmpNp, m7GpppG cap, Nr-methylguanine. In some embodiments, the 3terminal cap is a 3-O-methyl-m7GpppG.
(244) In some embodiments, the 3-UTR is an alpha-globin 3-UTR. In some embodiments, the 5-UTR comprises a Kozak sequence.
(245) In some embodiments, the tailing sequence may range from absent to 500 nucleotides in length (e.g., at least 60, 70, 80, 90, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 nucleotides). In some embodiments, the tailing region is or includes a poly A tail. Where the tailing region is a polyA tail, the length may be determined in units of or as a function of polyA Binding Protein binding. In this embodiment, the polyA tail is long enough to bind at least 4 monomers of PolyA Binding Protein. PolyA Binding Protein monomers bind to stretches of approximately 38 nucleotides. As such, it has been observed that polyA tails of about 80 nucleotides and 160 nucleotides are functional. In some embodiments, the poly-A tail is at least 160 nucleotides in length.
(246) In some embodiments, the at least one SARS-COV-2 antigenic polypeptide linked to or fused to a signal peptide. In some embodiments, the isolated mRNA encoding a SARS-Cov-2 antigenic polypeptide or immunogenic fragment thereof further includes a polynucleotide sequence encoding a signal peptide. In some embodiments, the signal peptide is selected from: a HuIgGk signal peptide (METPAQLLFLLLLWLPDTTG (SEQ ID NO: 197)); IgE heavy chain epsilon-1 signal peptide (MDWTWILFLVAAATRVHS (SEQ ID NO: 198)); Japanese encephalitis PRM signal sequence (MLGSNSGQRVVFTILLLLVAPAYS (SEQ ID NO: 199)), VSVg protein signal sequence (MKCLLYLAFLFIGVNCA (SEQ ID NO: 200)) and Japanese encephalitis JEV signal sequence (MWLVSLAIVTACAGA (SEQ ID NO: 201)). In some embodiments, the signal peptide is fused to the N-terminus of at least one SARS-COV-2 antigenic polypeptide. In some embodiments, a signal peptide is fused to the C-terminus of at least one SARS-COV-2 antigenic polypeptide.
(247) In some embodiments, the polynucleotides of the mRNA vaccine composition are structurally modified and/or chemically modified. As used herein, a structural modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides. For example, the polynucleotide ATCG may be chemically modified to AT-5meC-G. The same polynucleotide may be structurally modified from ATCG to ATCCCG. Here, the dinucleotide CC has been inserted, resulting in a structural modification to the polynucleotide.
(248) In some embodiments, the polynucleotide, e.g., an mRNA of an mRNA vaccine composition described herein comprises at least one chemical modification. In some embodiments, the polynucleotide, e.g., an mRNA of an mRNA vaccine composition does not comprise a chemical or structural modification.
(249) In some embodiments, the at least one chemical modification is selected from pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2-O-methyl uridine. In some embodiments, the chemical modification is in the 5-position of the uracil. In some embodiments, the chemical modification is a N1-methylpseudouridine. In some embodiments, the chemical modification is a N1-ethylpseudouridine.
(250) In some embodiments, about 10%, 15%, 20%, 24%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, to/or about 100% of the uracil in of the SARS-COV-2 antigenic polypeptide or immunogenic fragment thereof encoding polynucleotide, such in the open reading frame, have a chemical modification, In some embodiments, 100% of the uracil in the open reading frame of the SARS-COV-2 antigenic polypeptide or immunogenic fragment thereof encoding polynucleotide have a N1-methyl pseudouridine in the 5-position of the uracil.
(251) In some embodiments, the mRNA polynucleotide includes a stabilization element. In some embodiments, the stabilization element is a histone stem-loop. In some embodiments, the stabilization element is a nucleic acid sequence having increased GC content relative to wild type sequence.
(252) In one embodiment, the mRNA polynucleotide may include a sequence encoding a self-cleaving peptide. The self-cleaving peptide may be, but is not limited to, a 2A peptide. As a non-limiting example, the 2A peptide may have the protein sequence: GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 202), fragments or variants thereof. In one embodiment, the 2A peptide cleaves between the last glycine and last proline. As another non-limiting example, the polynucleotides of the present invention may include a polynucleotide sequence encoding the 2A peptide having the protein sequence GSGATNFSLLKQAGDVEENPGP fragments or variants thereof.
(253) One such polynucleotide sequence encoding the 2A peptide is GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAG GAGAACCCTGGACCT (SEQ ID NO: 203). The polynucleotide sequence of the 2A peptide may be modified or codon optimized by the methods described herein and/or are known in the art.
(254) In one embodiment, this sequence may be used to separate the coding region of two or more polypeptides of interest. As a non-limiting example, the sequence encoding the 2A peptide may be between a first coding region A and a second coding region B (A-2Apep-B). The presence of the 2 A peptide would result in the cleavage of one long protein into protein A, protein B and the 2A peptide. Protein A and protein B may be the same or different peptides or polypeptides of interest. In another embodiment, the 2A peptide may be used in the polynucleotides of the present invention to produce two, three, four, five, six, seven, eight, nine, ten or more proteins.
(255) In some embodiments, the length of an mRNA included in the mRNA vaccine is greater than about 30 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or up to and including 100,000 nucleotides).
(256) In some embodiments, the length of an mRNA included in the mRNA vaccine includes from about 30 to about 100,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 1,000, from 30 to 1,500, from 30 to 3,000, from 30 to 5,000, from 30 to 7,000, from 30 to 10,000, from 30 to 25,000, from 30 to 50,000, from 30 to 70,000, from 100 to 250, from 100 to 500, from 100 to 1,000, from 100 to 1,500, from 100 to 3,000, from 100 to 5,000, from 100 to 7,000, from 100 to 10,000, from 100 to 25,000, from 100 to 50,000, from 100 to 70,000, from 100 to 100,000, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 3,000, from 500 to 5,000, from 500 to 7,000, from 500 to 10,000, from 500 to 25,000, from 500 to 50,000, from 500 to 70,000, from 500 to 100,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 3,000, from 1,000 to 5,000, from 1,000 to 7,000, from 1,000 to 10,000, from 1,000 to 25,000, from 1,000 to 50,000, from 1,000 to 70,000, from 1,000 to 100,000, from 1,500 to 3,000, from 1,500 to 5,000, from 1,500 to 7,000, from 1,500 to 10,000, from 1,500 to 25,000, from 1,500 to 50,000, from 1,500 to 70,000, from 1,500 to 100,000, from 2,000 to 3,000, from 2,000 to 5,000, from 2,000 to 7,000, from 2,000 to 10,000, from 2,000 to 25,000, from 2,000 to 50,000, from 2,000 to 70,000, and from 2,000 to 100,000).
(257) In some embodiments, the polynucleotides are linear. In yet another embodiment, the polynucleotides of the present invention that are circular are known as circular polynucleotides or circP. As used herein, circular polynucleotides or circP means a single stranded circular polynucleotide which acts substantially like, and has the properties of, an R A. The term circular is also meant to encompass any secondary or tertiary configuration of the circP.
(258) Other RNA modifications for mRNA vaccines and production of mRNA can be as described e.g., U.S. Pat. Nos. 8,278,036, 8,691,966, 8,748,089, 9,750,824, 10,232,055, 10,703,789, 10,702,600, 10,577,403, 10,442,756, 10,266,485, 10,064,959, 9,868,692, 10,064,959, 10,272,150; U.S. Publications, US20130197068, US20170043037, US20130261172, US20200030460, US20150038558, US20190274968, US20180303925, US20200276300; International Patent Application Publication Nos. WO/2018/081638A1, WO/2016/176330A1, which are incorporated herein by reference.
(259) In some embodiments, the mRNA vaccine includes one or more additional mRNAs that encode a polypeptide adjuvant. In some embodiments, the mRNA vaccine includes one or more additional mRNAs that encode a non SARS-Cov-2 antigen, such as an antigen to another disease causing agent.
(260) In some embodiments, the one or more additional mRNAs that encode a polypeptide adjuvant encode a flagellin polypeptide. In some embodiments, at least one flagellin polypeptide (e.g., encoded flagellin polypeptide) is an immunogenic flagellin fragment. In some embodiments at least one flagellin polypeptide has at least 80%, at least 85%, at least 90%, or at least 95% identity to a flagellin polypeptide having a sequence identified by any one of SEQ ID NO: 54-56 of U.S. Pat. No. 10,272,150.
(261) In some embodiments, at least one flagellin polypeptide and at least one SARS-Cov2 and/or additional antigenic polypeptide are encoded by a single RNA (e.g., mRNA) polynucleotide. In other embodiments, at least one flagellin polypeptide and at least one SARS-Cov2 and/or additional antigenic polypeptide are each encoded by a different RNA polynucleotide.
(262) The isolated mRNA(s) can be made in part or using only in vitro transcription. Methods of making polynucleotides by in vitro transcription are known in the art and are described in U.S. Provisional Patent Application Nos. 61/618,862, 61/681,645, 61/737,130, 61/618,866, 61/681,647, 61/737,134, 61/618,868, 61/681,648, 61/737,135, 61/618,873, 61/681,650, 61/737,147, 61/618,878, 61/681,654, 61/737,152, 61/618,885, 61/681,658, 61/737,155, 61/618,896, 61/668,157, 61/681,661, 61/737,160, 61/618,911, 61/681,667, 61/737,168, 61/618,922, 61/681,675, 61/737,174, 61/618,935, 61/681,687, 61/737,184, 61/618,945, 61/681,696, 61/737,191, 61/618,953, 61/681,704 61/737,203; International Publication Nos WO2013151666, WO2013151668, WO2013151663, WO2013151669, WO2013151670, WO2013151664, WO2013151665, WO2013151736, WO2013151672, WO2013151671 WO2013151667, and WO/2020/205793A1; the contents of each of which are herein incorporated by reference in their entireties.
(263) Lipid Nanoparticles
(264) The isolated mRNAs and orther polynucleotides of the mRNa vaccine can be formulated in a lipid nanoparticle. In some embodiments, the lipid nanoparticle is a cationic lipid nanoparticle.
(265) In some embodiments, the lipid nanoparticle comprises a molar ratio of 20-60% ionizable cationic lipid, 5-25% non-cationic lipid, 25-55% sterol, and 0.5-15% PEG-modified lipid.
(266) In some embodiments, the cationic lipid is a biodegradable cationic lipid. In some embodiments, the biodegradable cationic lipid comprises an ester linkage. In some embodiments, the biodegradable cationic lipid comprises DLin-DMA with an internal ester, DLin-DMA with a terminal ester, DLin-MC3-DMA with an internal ester, or DLin-MC3-DMA with a terminal ester.
(267) In some embodiments, a lipid nanoparticle comprises a cationic lipid, a PEG-modified lipid, a sterol and a non-cationic lipid. In some embodiments, a cationic lipid is an ionizable cationic lipid and the non-cationic lipid is a neutral lipid, and the sterol is a cholesterol. In some embodiments, a cationic lipid is selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino) butanoyl)oxy) heptadecanedioate (L319), (12Z,15Z)N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530). In some embodiments, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol is cholesterol, and the PEG-modified lipid is 1,2-dimyristoyl-racalycero-3-methoxypolyethylene glycol-2000 (PEG-DMG) or PEG-CDMA.
(268) In some embodiments, the lipid nanoparticle is any nanoparticle described in U.S. Pat. No. 10,442,756, and/or comprises any compound described in U.S. Pat. No. 10,442,756, including but not limited to a nanoparticle according to any one of Formulas (IA) or (II) described therein.
(269) In some embodiments, the lipid nanoparticle is any nanoparticle described in e.g., U.S. Pat. No. 10,266,485, and/or comprises any compound described in U.S. Pat. No. 10,266,485, including but not limited to a nanoparticle according to Formula (II) described therein.
(270) In some embodiments, the lipid nanoparticle is a nanoparticle described in U.S. Pat. No. 9,868,692, and/or comprises a compound described in e.g., U.S. Pat. No. 9,868,692, including but not limited to a nanoparticle according to Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), (IIe),
(271) In some embodiments, a lipid nanoparticle comprises compounds of Formula (I) and/or Formula (II) as described in U.S. patent Ser. No. 10/272,150.
(272) In some embodiments, the mRNA vaccine is formulated in a lipid nanoparticle that comprises a compound selected from Compounds 3, 18, 20, 25, 26, 29, 30, 60, 108-112 and 122 of U.S. Pat. No. 10,272,150.
(273) In some embodiments, at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) of the uracil in the open reading frame have a chemical modification, optionally wherein the vaccine is formulated in a lipid nanoparticle (e.g., a lipid nanoparticle comprises a cationic lipid, a PEG-modified lipid, a sterol and a non-cationic lipid).
(274) In some embodiments, the lipid nanoparticle has a mean diameter of 50-200 nm.
(275) In some embodiments, a lipid nanoparticle comprises compounds of Formula (I) and/or Formula (II), as discussed below.
(276) In some embodiments, a lipid nanoparticle comprises Compounds 3, 18, 20, 25, 26, 29, 30, 60, 108-112, or 122 as set forth in U.S. patent Ser. No. 10/272,150.
(277) In some embodiments, the lipid nanoparticle has a polydispersity value of less than 0.4 (e.g., less than 0.3, 0.2 or 0.1).
(278) In some embodiments, a plurality of lipid nanoparticles, such as when contained in a formulation, has a mean PDI of between 0.02 and 0.2.
(279) In some embodiments, a plurality of lipid nanoparticles, such as when contained in a formulation comprising one or more polynucleotide(s), has a mean lipid to polynucleotide ratio (wt/wt) of between 10 and 20.
(280) In some embodiments, the lipid nanoparticle has a net neutral charge at a neutral pH value.
(281) Methods of mRNA Vaccination
(282) The compositions described herein can be used to induce an antigen specific immune response to a SARS-Cov-2 variant.
(283) In some embodiments, the methods of inducing an antigen specific immune response in a subject include administering to the subject any of the RNA (e.g., mRNA) vaccine as provided herein in an amount effective to produce an antigen-specific immune response.
(284) In some embodiments, an antigen-specific immune response comprises a T cell response and/or a B cell response.
(285) In some embodiments, a method of producing an antigen-specific immune response comprises administering to a subject a single dose (no booster dose) of a RNA (e.g., mRNA) vaccine of the present disclosure.
(286) In some embodiments, the RNA (e.g., mRNA) vaccine is a combination vaccine comprising a combination of an mRNA vaccine described herein and at least one other mRNA vaccine. The at least one other mRNA vaccine can be against the same or a different virus or disease-causing agent.
(287) In some embodiments, a method further comprises administering to the subject a second (booster) dose of a RNA (e.g., mRNA) vaccine. Additional doses of a RNA (e.g., mRNA) vaccine may be administered.
(288) In some embodiments, the subject exhibits a seroconversion rate of at least 80% (e.g., at least 85%, at least 90%, or at least 95%) following the first dose or the second (booster) dose of the vaccine. Seroconversion is the time period during which a specific antibody develops and becomes detectable in the blood. After seroconversion has occurred, a virus can be detected in blood tests for the antibody. During an infection or immunization, antigens enter the blood, and the immune system begins to produce antibodies in response. Before seroconversion, the antigen itself may or may not be detectable, but antibodies are considered absent. During seroconversion, antibodies are present but not yet detectable. Any time after seroconversion, the antibodies can be detected in the blood, indicating a prior or current infection.
(289) In some embodiments, a RNA (e.g., mRNA) vaccine described herein is administered to a subject by intradermal, subcutaneous, or intramuscular injection. In some embodiments, the administering step comprises contacting a muscle tissue of the subject with a device suitable for injection of the composition. In some embodiments, the administering step comprises contacting a muscle tissue of the subject with a device suitable for injection of the composition in combination with electroporation.
(290) In some embodiments, the anti-antigenic polypeptide antibody titer produced in the subject is increased by at least 1 log relative to a control. In some embodiments, the anti-antigenic polypeptide antibody titer produced in the subject is increased by 1-3 log relative to a control.
(291) In some embodiments, the anti-antigenic polypeptide antibody titer produced in a subject is increased at least 2 times relative to a control. In some embodiments, the anti-antigenic polypeptide antibody titer produced in the subject is increased at least 5 times relative to a control. In some embodiments, the anti-antigenic polypeptide antibody titer produced in the subject is increased at least 10 times relative to a control. In some embodiments, the anti-antigenic polypeptide antibody titer produced in the subject is increased 2-10 times relative to a control.
(292) In some embodiments, the control is an anti-antigenic polypeptide antibody titer produced in a subject who has not been administered a RNA (e.g., mRNA) vaccine of the present disclosure. In some embodiments, the control is an anti-antigenic polypeptide antibody titer produced in a subject who has been administered a live attenuated or inactivated vaccine against SARS-COV-2 or wherein the control is an anti-antigenic polypeptide antibody titer produced in a subject who has been administered a recombinant or purified SARS-COV-2 protein vaccine.
(293) In some embodiments, the control is an anti-antigenic polypeptide antibody titer produced in a subject who has been administered a virus-like particle (VLP) vaccine comprising structural proteins of SARS-COV-2.
(294) The RNA (e.g., mRNA) vaccine of the present disclosure can be administered to a subject in an effective amount (e.g., an amount effective to induce an immune response in the subject).
(295) In some embodiments, the RNA (e.g., mRNA) vaccine is formulated in an effective amount to produce an antigen specific immune response in a subject.
(296) In some embodiments, the effective amount is a total dose of 25 g to 1000 g, or 50 g to 1000 g. In some embodiments, the effective amount is a total dose of 100 g. In some embodiments, the effective amount is a dose of 25 g administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 100 g administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 400 g administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 500 g administered to the subject a total of two times.
(297) In some embodiments, the efficacy (or effectiveness) of a RNA (e.g., mRNA) vaccine is greater than 60%.
(298) Vaccine efficacy may be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun. 1; 201 (11): 1607-10). For example, vaccine efficacy may be measured by double-blind, randomized, clinical controlled trials. Vaccine efficacy may be expressed as a proportionate reduction in disease attack rate (AR) between the unvaccinated (ARU) and vaccinated (ARV) study cohorts and can be calculated from the relative risk (RR) of disease among the vaccinated group with use of the following formulas:
Efficacy=(ARUARV)/ARU100; and
Efficacy=(1-RR)100.
(299) Likewise, vaccine effectiveness may be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun. 1; 201 (11): 1607-10). Vaccine effectiveness is an assessment of how a vaccine (which may have already proven to have high vaccine efficacy) reduces disease in a population. This measure can assess the net balance of benefits and adverse effects of a vaccination program, not just the vaccine itself, under natural field conditions rather than in a controlled clinical trial. Vaccine effectiveness is proportional to vaccine efficacy (potency) but is also affected by how well target groups in the population are immunized, as well as by other non-vaccine-related factors that influence the real-world outcomes of hospitalizations, ambulatory visits, or costs. For example, a retrospective case control analysis may be used, in which the rates of vaccination among a set of infected cases and appropriate controls are compared. Vaccine effectiveness may be expressed as a rate difference, with use of the odds ratio (OR) for developing infection despite vaccination:
Effectiveness=(1OR)100.
(300) In some embodiments, the efficacy (or effectiveness) of a RNA (e.g., mRNA) vaccine is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90%.
(301) In some embodiments, the vaccine immunizes the subject against one or more SARS-Cov-2 variants. Exemplary SARS-COV-2 variants are described elsewhere herein.
(302) In some embodiments, the subject to which the mRNA vaccine of the present disclosure is administered is about 5 years old or younger. For example, the subject may be between the ages of about 1 year and about 5 years (e.g., about 1, 2, 3, 5 or 5 years), or between the ages of about 6 months and about 1 year (e.g., about 6, 7, 8, 9, 10, 11 or 12 months). In some embodiments, the subject is about 12 months or younger (e.g., 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 months or 1 month). In some embodiments, the subject is about 6 months or younger.
(303) In some embodiments, the subject to which the mRNA vaccine of the present disclosure is administered was born full term (e.g., about 37-42 weeks). In some embodiments, the subject was born prematurely, for example, at about 36 weeks of gestation or earlier (e.g., about 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26 or 25 weeks). For example, the subject may have been born at about 32 weeks of gestation or earlier. In some embodiments, the subject was born prematurely between about 32 weeks and about 36 weeks of gestation. In such subjects, a RNA (e.g., mRNA) vaccine may be administered later in life, for example, at the age of about 6 months to about 5 years, or older.
(304) In some embodiments, the subject to which the mRNA vaccine of the present disclosure is administered the subject to which the mRNA vaccine of the present disclosure is administered is pregnant (e.g., in the first, second or third trimester) when administered an RNA (e.g., mRNA) vaccine.
(305) In some embodiments, the subject to which the mRNA vaccine of the present disclosure is administered is a young adult between the ages of about 20 years and about 50 years (e.g., about 20, 25, 30, 35, 40, 45 or 50 years old).
(306) In some embodiments, the subject to which the mRNA vaccine of the present disclosure is administered is an elderly subject about 60 years old, about 70 years old, or older (e.g., about 60, 65, 70, 75, 80, 85, 90, or about 100 or more years old).
(307) In some embodiments, the subject to which the mRNA vaccine of the present disclosure is administered has a chronic pulmonary disease (e.g., chronic obstructive pulmonary disease (COPD) or asthma). Two forms of COPD include chronic bronchitis, which involves a long-term cough with mucus, and emphysema, which involves damage to the lungs over time. Thus, a subject administered a RNA (e.g., mRNA) vaccine may have chronic bronchitis or emphysema.
(308) In some embodiments, the subject to which the mRNA vaccine of the present disclosure is administered is immunocompromised (has an impaired immune system, e.g., has an immune disorder or autoimmune disorder).
(309) In some embodiments, the mRNA vaccine of the present disclosure is delivered to a subject at a dosage of between 10 g/kg and 400 g/kg of the nucleic acid vaccine is administered to the subject. In some embodiments the dosage of the RNA polynucleotide is 1-5 g, 5-10 g, 10-15, 15-20, 10-25, 20-25, 20-50, 30-50, 40-50, 40-60, 60-80, 60-100 g, 50-100 g, 80-120 g, 40-120 g, 40-150 g, 50-150 g, 50-200 g, 80-200 g, 100-200 g, 120-250, 150-250, 180-280, 200-300, 50-300, 80-300, 100-300, 40-300 g, 50-350 g, 100-350 g, 200-350 g, 300-350 g, 320-400 g, 40-380 g, 40-100 g, 100-400 g, 200-400 g, or 300-400 g per dose. In some embodiments, the subject can receive 1, 2, 3, 4, 5, 6, 7, or more doses. After the initial dose (given at day zero) the subject can receive one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more additional doses, referred to in the art as booster doses. The booster doses can follow the initial dose at any suitable time interval such as within days, weeks, months, or even years. In some embodiments, multiple booster doses are needed close in time after the inital dose (such as within 1, 2, 3, or 4 weeks after the initial dose) followed by a larger gap in time (e.g., months or years before subsequent booster doses are needed). In some embodiments, a first dose of the mRNA vaccine is administered to the subject on day zero. In some embodiments, a second dose of the mRNA vaccine ais administered to the subject on day 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84 or more days after the first dose. In some embodiments, a third dose of the mRNA vaccine ais administered to the subject on day 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84 or more days after the first and/or second dose.
(310) In some embodiments, the mRNA vaccine confers an antibody titer superior to the criterion for seroprotection for a SARS-COV-2 variant for an acceptable percentage of human subjects. In some embodiments, the antibody titer produced by the mRNA vaccines of the invention is a neutralizing antibody titer. In some embodiments the neutralizing antibody titer is greater than a protein vaccine. In other embodiments the neutralizing antibody titer produced by the mRNA vaccines of the invention is greater than an adjuvanted protein vaccine. In yet other embodiments the neutralizing antibody titer produced by the mRNA vaccines of the invention is 1,000-10,000, 1,200-10,000, 1,400-10,000, 1,500-10,000, 1,000-5,000, 1,000-4,000, 1,800-10,000, 2000-10,000, 2,000-5,000, 2,000-3,000, 2,000-4,000, 3,000-5,000, 3,000-4,000, or 2,000-2,500. A neutralization titer is typically expressed as the highest serum dilution required to achieve a 50% reduction in the number of plaques.
(311) In some embodiments, a unit of use vaccine comprises between 10 g and 400 g of one or more RNA polynucleotides encoding the SARS-Cov-2 antigenic polypeptide(s) and/or immunogenic fragment(s) thereof and a pharmaceutically acceptable carrier or excipient, formulated for delivery to a human subject. In some embodiments, the vaccine further comprises a cationic lipid nanoparticle.
(312) Aspects of the invention provide methods of creating, maintaining or restoring antigenic memory to a SARS-COV-2 variant in an individual or population of individuals comprising administering to said individual or population an mRNA vaccine described herein.
(313) In some embodiments, the methods of vaccinating a subject comprising administering to the subject a single dosage of between 25 g/kg and 400 g/kg of an mRNA vaccine comprising one or more RNA polynucleotides encoding a SARS-COV-2 antigenic polypeptide and/or an immunogenic fragment thereof in an effective amount to vaccinate the subject.
(314) In some embodiments, the mRNA vaccines comprising one or more RNA polynucleotides encoding a SARS-COV-2 antigenic polypeptide and/or an immunogenic fragment thereof, wherein the RNA comprises at least one chemical modification, wherein the vaccine has at least 10 fold less RNA polynucleotide than is required for an unmodified mRNA vaccine to produce an equivalent antibody titer. In some embodiments, the RNA polynucleotide is present in a dosage of 25-100 micrograms.
(315) In some embodiments, the mRNA vaccine comprises an LNP formulated RNA polynucleotide having an open reading frame comprising no nucleotide modifications (unmodified), the open reading frame one or more RNA polynucleotides encoding a SARS-COV-2 antigenic polypeptide and/or an immunogenic fragment thereof, wherein the vaccine has at least 10 fold less RNA polynucleotide than is required for an unmodified mRNA vaccine not formulated in a LNP to produce an equivalent antibody titer. In some embodiments, the RNA polynucleotide is present in a dosage of 25-100 micrograms.
(316) In some embodiments, the mRNA vaccine comprises an LNP formulated RNA polynucleotide having an open reading frame comprising one or more modifications, the open reading frame one or more RNA polynucleotides encoding a SARS-COV-2 antigenic polypeptide and/or an immunogenic fragment thereof, wherein the vaccine has at least 10 fold less RNA polynucleotide than is required for an unmodified mRNA vaccine not formulated in a LNP to produce an equivalent antibody titer. In some embodiments, the RNA polynucleotide is present in a dosage of 25-100 micrograms.
(317) In some embodiments, the method includes vaccinating a subject with a combination vaccine including at least two nucleic acid sequences encoding respiratory antigens, wherein at least one encodes a SARS-COV-2 antigen wherein the dosage for the vaccine is a combined therapeutic dosage wherein the dosage of each individual nucleic acid encoding an antigen is a sub therapeutic dosage. In some embodiments, the combined dosage is 25 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dosage is 100 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments the combined dosage is 50 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dosage is 75 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dosage is 150 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dosage is 400 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the sub therapeutic dosage of each individual nucleic acid encoding an antigen is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 micrograms.
(318) In some embodiments, vaccines of the invention (e.g., LNP-encapsulated mRNA vaccines) produce prophylactically- and/or therapeutically-efficacious levels, concentrations and/or titers of antigen-specific antibodies in the blood or serum of a vaccinated subject. As defined herein, the term antibody titer refers to the amount of antigen-specific antibody produces in s subject, e.g., a human subject. In exemplary embodiments, antibody titer is expressed as the inverse of the greatest dilution (in a serial dilution) that still gives a positive result. In exemplary embodiments, antibody titer is determined or measured by enzyme-linked immunosorbent assay (ELISA). In exemplary embodiments, antibody titer is determined or measured by neutralization assay, e.g., by microneutralization assay. In certain aspects, antibody titer measurement is expressed as a ratio, such as 1:40, 1:100, etc.
(319) In some embodiments, an efficacious vaccine produces an antibody titer of greater than 1:40, greater that 1:100, greater than 1:400, greater than 1:1000, greater than 1:2000, greater than 1:3000, greater than 1:4000, greater than 1:500, greater than 1:6000, greater than 1:7500, greater than 1:10000. In exemplary embodiments, the antibody titer is produced or reached by 10 days following vaccination, by 20 days following vaccination, by 30 days following vaccination, by 40 days following vaccination, or by 50 or more days following vaccination. In exemplary embodiments, the titer is produced or reached following a single dose of vaccine administered to the subject. In other embodiments, the titer is produced or reached following multiple doses, e.g., following a first and a second dose (e.g., a booster dose.)
(320) In some embodiments, antigen-specific antibodies are measured in units of g/ml or are measured in units of IU/L (International Units per liter) or mIU/ml (milli International Units per ml). In exemplary embodiments of the invention, an efficacious vaccine produces >0.5 g/ml, >0.1 g/ml, >0.2 g/ml, >0.35 g/ml, >0.5 g/ml, >1 g/ml, >2 g/ml, >5 g/ml or >10 g/ml. In exemplary embodiments of the invention, an efficacious vaccine produces >10 mIU/ml, >20 mIU/ml, >50 mIU/ml, >100 mIU/ml, >200 mIU/ml, >500 mIU/ml or >1000 mIU/ml. In exemplary embodiments, the antibody level or concentration is produced or reached by 10 days following vaccination, by 20 days following vaccination, by 30 days following vaccination, by 40 days following vaccination, or by 50 or more days following vaccination. In exemplary embodiments, the level or concentration is produced or reached following a single dose of vaccine administered to the subject. In other embodiments, the level or concentration is produced or reached following multiple doses, e.g., following a first and a second dose (e.g., a booster dose.) In exemplary embodiments, antibody level or concentration is determined or measured by enzyme-linked immunosorbent assay (ELISA). In exemplary embodiments, antibody level or concentration is determined or measured by neutralization assay, e.g., by microneutralization assay.
(321) SARS-COV-2 Variants
(322) The present disclosure relates to and/or involves SARS-COV-2. More particularly the disclosure describes, inter alia, SARS-COV-2 variant immunogenic polypeptides and encoding polynucleotides. As described herein are vaccines that include the SARS-COV-2 variant immunogenic polypeptides and/or encoding polynucleotides. Such vaccines can be effective against one or more SARS-COV-2 variants.
(323) As used herein, the term variant refers to any virus having one or more mutations as compared to a known virus. A strain is a genetic variant or subtype of a virus. The terms strain, variant, and isolate may be used interchangeably. In certain embodiments, a variant has developed a specific group of mutations that causes the variant to behave differently than that of the strain it originated from. While there are many thousands of variants of SARS-COV-2, (Koyama, Takahiko Koyama; Platt, Daniela; Parida, Laxmi (June 2020). Variant analysis of SARS-COV-2 genomes. Bulletin of the World Health Organization. 98:495-504) there are also much larger groupings called clades. Several different clade nomenclatures for SARS-COV-2 have been proposed. As of December 2020, GISAID, referring to SARS-COV-2 as hCoV-19 identified seven clades (O, S, L, V, G, GH, and GR) (Alm E, Broberg E K, Connor T, et al. Geographical and temporal distribution of SARS-COV-2 clades in the WHO European Region, January to June 2020 [published correction appears in Euro Surveill. 2020 August; 25 (33):]. Euro Surveill. 2020; 25 (32): 2001410). Also as of December 2020, Nextstrain identified five (19A, 19B, 20A, 20B, and 20C) (Cited in Alm et al. 2020). Guan et al. identified five global clades (G614, S84, V251, 1378 and D392) (Guan Q, Sadykov M, Mfarrej S, et al. A genetic barcode of SARS-COV-2 for monitoring global distribution of different clades during the COVID-19 pandemic. Int J Infect Dis. 2020; 100:216-223). Rambaut et al. proposed the term lineage in a 2020 article in Nature Microbiology; as of December 2020, there have been five major lineages (A, B, B.1, B.1.1, and B.1.777) identified (Rambaut, A.; Holmes, E. C.; O'Toole, .; et al. A dynamic nomenclature proposal for SARS-COV-2 lineages to assist genomic epidemiology. 5:1403-1407).
(324) Genetic variants of SARS-COV-2 have been emerging and circulating around the world throughout the COVID-19 pandemic (see, e.g., The US Centers for Disease Control and Prevention; www.cdc.gov/coronavirus/2019-ncov/variants/variant-info.html). Exemplary, non-limiting variants applicable to the present disclosure include variants of SARS-COV-2, particularly those having substitutions of therapeutic concern. Table 10 shows exemplary, non-limiting genetic substitutions in SARS-COV-2 variants.
(325) TABLE-US-00001 TABLE 10 Spike Protein Common Pango Lineages with Spike Protein Substitution Substitutions L452R A.2.5, B.1, B.1.429, B.1.427, B.1.617.1, B.1.526.1, B.1.617.2, C.36.3 E484K B.1.1.318, B.1.1.7, B.1.351, B.1.525, B.1.526, B.1.621, B.1.623, P.1, P.1.1, P.1.2, R.1 K417N, E484K, B.1.351, B.1.351.3 N501Y K417T, E484K, P.1, P.1.1, P.1.2 N501Y
Phylogenetic Assignment of Named Global Outbreak (PANGO) Lineages is software tool developed by members of the Rambaut Lab. The associated web application was developed by the Centre for Genomic Pathogen Surveillance in South Cambridgeshire and is intended to implement the dynamic nomenclature of SARS-COV-2 lineages, known as the PANGO nomenclature. It is available at cov-lineages.org.
(326) In some embodiments, the SARS-COV-2 variant is and/or includes: B.1.1.7, also known as Alpha (WHO) or UK variant, having the following spike protein substitutions: 69del, 70del, 144del, (E484K*), (S494P*), N501Y, A570D, D614G, P681H, T716I, S982A, and D1118H (K1191N*); B.1.351, also known as Beta (WHO) or South Africa variant, having the following spike protein substitutions: D80A, D215G, 241del, 242del, 243del, K417N, E484K, N501Y, D614G, and A701V; B.1.427, also known as Epsilon (WHO) or US California variant, having the following spike protein substitutions: L452R, and D614G; B.1.429, also known as Epsilon (WHO) or US California variant, having the following spike protein substitutions: S13I, W152C, L452R, and D614G; B.1.617.2, also known as Delta (WHO) or India variant, having the following spike protein substitutions: T19R, (G142D), 156del, 157del, R158G, L452R, T478K, D614G, P681R, and D95ON; and P.1, also known as Gamma (WHO) or Japan/Brazil variant, having the following spike protein substitutions: L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, and T1027I, or any combination thereof.
(327) In some embodiments, the SARS-COV-2 variant is classified and/or otherwise identified as a Variant of Concern (VOC) by the World Health Organization and/or the U.S. Centers for Disease Control. A VOC is a variant for which there is evidence of an increase in transmissibility, more severe disease (e.g., increased hospitalizations or deaths), significant reduction in neutralization by antibodies generated during previous infection or vaccination, reduced effectiveness of treatments or vaccines, or diagnostic detection failures.
(328) In some embodiments, the SARS-Cov-2 variant is classified and/or otherwise identified as a Variant of High Consequence (VHC) by the World Health Organization and/or the U.S. Centers for Disease Control. A variant of high consequence has clear evidence that prevention measures or medical countermeasures (MCMs) have significantly reduced effectiveness relative to previously circulating variants.
(329) In some embodiments, the SARS-Cov-2 variant is classified and/or otherwise identified as a Variant of Interest (VOI) by the World Health Organization and/or the U.S. Centers for Disease Control. A VOI is a variant with specific genetic markers that have been associated with changes to receptor binding, reduced neutralization by antibodies generated against previous infection or vaccination, reduced efficacy of treatments, potential diagnostic impact, or predicted increase in transmissibility or disease severity.
(330) In some embodiments, the SARS-Cov-2 variant is classified and/or is otherwise identified as a Variant of Note (VON). As used herein, VON refers to both variants of concern and variants of note as the two phrases are used and defined by Pangolin (cov-lineages.org) and provided in their available VOC reports available at cov-lineages.org.
(331) In some embodiments the SARS-Cov-2 variant is a VOC. In some embodiments, the SARS-COV-2 variant is or includes an Alpha variant (e.g., Pango lineage B.1.1.7), a Beta variant (e.g., Pango lineage B.1.351, B.1.351.1, B.1.351.2, and/or B.1.351.3), a Delta variant (e.g., Pango lineage B.1.617.2, AY.1, AY.2, AY.3 and/or AY.3.1); a Gamma variant (e.g., Pango lineage P.1, P.1.1, P.1.2, P.1.4, P.1.6, and/or P.1.7), or any combination thereof.
(332) In some embodiments the SARS-Cov-2 variant is a VOI. In some embodiments, the SARS-COV-2 variant is or includes an Eta variant (e.g., Pango lineage B.1.525 (Spike protein substitutions A67V, 69del, 70del, 144del, E484K, D614G, Q677H, F888L)); an Iota variant (e.g., Pango lineage B.1.526 (Spike protein substitutions L5F, (D80G*), T95I, (Y144-*), (F157S*), D253G, (L452R*), (S477N*), E484K, D614G, A701V, (T859N*), (D950H*), (Q957R*))); a Kappa variant (e.g., Pango lineage B.1.617.1 (Spike protein substitutions (T951), G142D, E154K, L452R, E484Q, D614G, P681R, Q1071H)); Pango lineage variant B.1.617.2 (Spike protein substitutions T19R, G142D, L452R, E484Q, D614G, P681R, D950N)), Lambda (e.g., Pango lineage C.37); or any combination thereof.
(333) In some embodiments SARS-Cov-2 variant is a VON. In some embodiments, the SARS-Cov-2 variant is or includes Pango lineage variant P.1 (alias, B.1.1.28.1.) as described in Rambaut et al. 2020. Nat. Microbiol. 5:1403-1407) (spike protein substitutions: T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, H655Y, TI027I)); an Alpha variant (e.g., Pango lineage B.1.1.7); a Beta variant (e.g., Pango lineage B.1.351, B.1.351.1, B.1.351.2, and/or B.1.351.3); Pango lineage variant B.1.617.2 (Spike protein substitutions T19R, G142D, L452R, E484Q, D614G, P681R, D950N)); an Eta variant (e.g., Pango lineage B.1.525); Pango lineage variant A.23.1 (as described in Bugembe et al. medRxiv. 2021. doi: https://doi.org/10.1101/2021.02.08.21251393) (spike protein substitutions: F157L, V367F, Q613H, P681R); or any combination thereof.
EXAMPLES
Example 1
(334) Mapping the repertoire of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) derived class I human leukocyte antigen (HLA-I) peptides can deepen our understanding of the viral footprint as seen by cytotoxic T cells. However, no datasets are currently available that characterize naturally processed and presented peptides in infected cells. Therefore, Applicant profiled the HLA-I immunopeptidomes of two human cell lines across multiple timepoints pre and post infection using mass spectrometry. The pre infection profile provided a baseline or reference point to determine protein enrichment or depletion due to infection. Applicant found HLA-I peptides that were derived from canonical ORFs, as well as internal out of frame ORFs in Spike and Nucleoprotein. Although viral proteins were highly expressed, the representation of viral HLA-I peptides was relatively low.-Finally, Applicant demonstrated that the peptides identified by MS are highly likely to bind to HLA-I alleles that provide population coverage of up to 80%. These biological insights and the list of naturally presented SARS-COV-2 HLA-I peptides will facilitate data-driven, informed selection of peptides for immune monitoring and vaccines.
(335) In this example, Applicant presents the first examination of HLA-I immunopeptidome in two human cell-lines infected with SARS-COV-2 paired with RNA-seq and whole proteome analysis. Applicant identified viral HLA-I peptides derived from both canonical and internal out-of-frame ORFs and monitored their dynamics over multiple timepoints post infection. Using whole proteome measurements, Applicant show that SARS-COV-2 interfered with cellular pathways related to the proteosome that may result in lower presentation of viral peptides. This study provides a list of SARS-COV-2 HLA-I peptides that undergo endogenous processing and presentation that can inform future T cells assays in patients and contribute to the design of vaccines.
(336) Untargeted Profiling of HLA-I Peptides in SARS-COV-2 Infected Cells
(337) To decipher the repertoire of human and viral derived HLA-I peptides, Applicant immunoprecipitated HLA-I proteins from SARS-COV-2 infected A549 and HEK293T cells that were transduced to stably express ACE2 and TMPRSS2, and subjected HLA bound peptides to liquid chromatography tandem mass spectrometry analysis (LC-MS/MS) (
(338) In total, Applicant identified 5,837 and 6,372 HLA-bound 8-11mer peptides in uninfected and infected A549, and 4,281 and 1,336 unique peptides in HEK293T cells, respectively. Applicant found that length distributions do not differ between infected and uninfected cells and the majority of HLA-I peptides were 9-mers (
(339) Mapping SARS-COV-2 HLA-I Peptides from Canonical ORFs
(340) Next, Applicant examined HLA-I peptides that are derived from SARS-COV-2 genome (
(341) Surprisingly, Applicant did not detect HLA-I peptides from highly abundant SARS-CoV-2 proteins such as ORF3a, ORF8 and ORF6. To test if undetected HLA-I peptides could be explained by underrepresentation of tryptic peptides from these source protein, as some proteasome subunits have a tryptic-like specificity, Applicant examined the whole proteome mass-spectrometry data generated from the HLA-I IP cell lysates flowthrough (
(342) SARS-COV-2 HLA-I Peptides Derived from Internal Out of Frame ORFs in S and N
(343) Two of the LC-MS/MS detected HLA-I peptides in HEK293T, GPMVLRGLIT (SEQ ID NO: 6) and GLITLSYHL (SEQ ID NO: 5), were processed from internal out of frame ORFs in the coding region of S (
(344) Validation of Detected Antigens Using Synthetic Peptides is Shown in
(345) The Spike glycoprotein is the target of multiple SARS-COV-2 vaccines under development (Callaway 2020). Two of these vaccines are utilizing RNA-based delivery methods that often involve manipulating the native nucleotide sequence, such as codon optimization, to enhance expression. These techniques maintain the amino acids composition of the canonical ORF, yet may alter the sequence of proteins encoded in alternative reading frames. In the context of T cell immunity, it is crucial to understand the effect of optimizing RNA sequences of S on the endogenously processed and presented HLA-I peptides derived from the two internal out-of-frame S.iORF1/2. To evaluate the possible effects of codon optimization on HLA-I antigen presentation, Applicant examined the nucleotide sequence in the region encoding S.iORF1/2 in the human optimized S from the Krogan library (Gordon et al. 2020). As expected, there was no change in the main ORF, however, the aa sequence in the +1 frame, which encoded S.iORF1/2, was significantly different (
(346) HLA-I Peptides Derived from SARS-COV-2 do not Change Over a Time Course of Infection
(347) To investigate the dynamics of HLA-I presentation during infection Applicant performed a time course experiment in which samples for immunopeptidomics, proteomics and RNA-seq were harvested 3, 6, 12, 18 and 24 hours post infection. Applicant chose these time points based on a recent study showing low abundance of SARS-COV-2 proteins prior to 10 hours post infection (Bojkova et al. 2020). RNA-seq measurements showed progressively high infection with 47%, 54% and 65% of the cell's transcriptome mapped to SARS-COV-2 genome after 12, 18 and 24 hours, respectively (
(348) SARS-COV-2 Infection Interferes with Cellular Pathways that May Impact HLA-I Peptide Processing and Presentation
(349) The lack of detectable HLA-I peptides from highly expressed SARS-COV-2 proteins, such as N, as well as the results from the time course experiment encouraged Applicant to investigate the impact of SARS-COV-2 infection on the HLA-I presentation pathway. Applicant initially compared the overlap between HLA-I peptidomes of uninfected and 24 hr post infection cells and found 62% of these peptides were detected in both experiments (
(350) The SARS-COV-2 HLA-I Peptides Detected in this Study are Predicted to Bind 73 HLA-I Alleles
(351) To evaluate the accuracy of HLA-I epitope prediction methods, Applicant compared how well prediction algorithms did at ranking the SARS-COV-2 HLA-I peptides identified by LC-MS/MS. Applicant focused on two machine learning based prediction methods that were trained on monoallelic mass spectrometry data for this analysis (Sarkizova et al. 2020; Poran et al. 2020). HLAthena predictions at different rank cutoffs (top 0.1%, 0.5%, 1%) were assessed based on their ability to identify the observed SARS-COV-2 HLA-I peptides (
(352) MS observed SARS-COV-2 HLA-I peptides were predicted to bind well to a set of 73 HLA-A,-B, and -C alleles by HLAthena and 57 by RECON. This difference is likely due to the fact that HLAthena supports 92 HLA-I alleles, while RECON supported 74 at the time of publication. These data demonstrated that HLA-I immunopeptidomics on only two cell lines combined with accurate epitope prediction tools can rapidly prioritize multiple CD8+ T cell epitopes with high population coverage for COVID19 immune monitoring and vaccine development as well as provide candidates to monitor in patients over time.
(353) The study provided the first view of SARS-COV-2 peptides that are endogenously processed and presented on the HLA-I in infected cells. Remarkably, 6 of the 20 viral peptides detected in our study are derived from internal out of frame ORFs in SARS-COV-2 genome. This striking observation suggests that current studies on T cells from COVID19 patients, which traditionally focus on the canonical viral ORFs, exclude a set of host cell presented epitopes. The currently published peptide pools may be subject to false negative results. Therefore, unbiased approaches like LC-MS/MS based immunopeptidomics that identify naturally presented SARS-CoV-2 peptides can inform the design of future pools to allow a more accurate interpretation of T cell responses in COVID19 patients.
(354) Applicant demonstrates that synthetic approaches aiming at enhancing the expression of canonical ORFs, some of which may be utilized in the current vaccine strategies, may eliminate the production of the HLA-I peptides derived from overlapping reading frames. This is important when considering the induction of memory T cells in response to SARS-COV-2 vaccines that overexpress the Spike ORF. Examination of the effects of sequence manipulation on the amino acids encoded from S.iORF1 and S.iORF2 may be performed with emphasis on the frame that produced the two HLA-I peptides that Applicant identified GPMVLRGLIT (SEQ ID NO: 6) and GLITLSYHL (SEQ ID NO: 5). In broader terms, many viral genomes have evolved to increase their coding capacity by utilizing overlapping ORFs and programed frameshifting. Thus, the findings emphasize the importance of combining unbiased approaches to detect the complete translatome and immunopeptidome of viruses to design vaccines that will optimize both antibodies and T cells responses.
(355) The study provides a few evidences that SARS-COV-2 may interfere with the presentation of viral peptides. First, although cells are highly infected, with more than 60% of the transcriptome derived from the virus, only X of the 6,372 HLA-I peptides detected represent viral proteins. Moreover, while whole proteomics measurements show high abundance of viral proteins in comparison to host proteins, viral HLA-I peptides are not presented more frequently as would be expected. Second, SARS-COV-2 infection leads to significant decrease in the expression of POMP, an essential chaperone for the 20S proteasome assembly, and alters the expression of proteins in the ubiquitination pathway. By impacting proteasomal degradation SARS-COV-2 may reduce the precursors for downstream processing and HLA-I presentation. Third, although the nucleoprotein is the most abundant viral protein Applicant did not find HLA-I peptides that are derived from its sequence. This observation may represent a limitation of our method or that N-derived peptides are less likely to be presented on the 9 HLA-I alleles tested. However, a recent study that tested the reactivity of CD8+ T cells in COVID19 patients found more reactive T cells for Spike (26%), M (22%), and nsp6 (15%) than for N (12%) (Grifoni et al. 2020) suggesting that N is presented less efficiently than other viral proteins with lower expression levels.
(356) Although our study provides experimental measurements for only nine HLA alleles (three in HEK293T cells and six in A549 cells), Applicant show that these alleles cover a desired percentage of the populations. Two of the alleles, A0201 and B0702, are considered among the most abundant alleles and thus, are prioritized by other researchers for in-vitro and in-vivo studies (Grifoni et al. 2020; Ferretti et al.), allowing a direct comparison between our results and other efforts.
METHODS
(357) Cells
(358) Human embryonic kidney HEK293TT cells, human lung A549 cells, and Agrican green monkey kidney Vero E6 cells were maintained at 37 C. and 5% CO.sub.2 in DMEM containing 10% FBS. Applicant generated HEK293TT and A549 cells stably expressing human ACE2 and TMPRSS2 by transducing them with lentivirus particles carrying these two cDNAs followed by selection with 1 g/ml concentration of puromycin and blasticidin. Allotypes of A549 and HEK293T cells.
(359) SARS-COV-2 Virus Stock
(360) The 2019-nCOV/USA-WA1/2020 isolate (NCBI accession number: MN985325) of SARS-COV-2 was obtained from the Centers for Disease Control and Prevention and BEI Resources. To generate the virus master stock, Applicant infected Vero E6 cells with this isolate for 1 h at 37 C., removed the virus inoculum, rinsed the cell monolayer with 1PBS, and added DMEM supplemented with 2% FBS. Three days later, when the cytopathic effect of the virus became visible, Applicant harvested the culture medium, passed through a 0.2u filter, and stored it at 80 C. To generate the virus working stock, Applicant infected Vero E6 cells with the master stock at a multiplicity of infection (MOI) of 0.1 plaque forming units (PFU)/cell and harvested the culture medium three days later using the same protocol as for the master stock.
(361) Plaque Assay
(362) The plaque assay was performed on Vero E6 cells. Briefly, Applicant seeded the cells into a 12-well plate at a density of 2.510.sup.5 cells per well, and the next day, infected them with serial 10-fold dilutions of the virus for 1 h at 37 C. Applicant then added 1 ml per well of the overlay medium containing 2DMEM (Gibco: #12800017) supplemented with 4% FBS and mixed at a 1:1 ratio with 1.2% Avicel (DuPont; RC-581) to obtain the final concentrations of 2% and 0.6% for FBS and Avicel, respectively. Three days later, Applicant removed the overlay medium, rinsed the cell monolayer with 1PBS and fixed the cells with 4% paraformaldehyde for 30 minutes at room temperature. 0.1% crystal violet was used to visualize the plaques.
(363) RNA-Seq
(364) A549/HEK293TT cells were seeded on 6-well plates (one well per condition). After 11-24 hr, cells were infected with SARS-COV-2 with multiplicity of infection (MOI) of 3. At 12, 18 and 24 hrs post infection cells were lysed using Trizol (Thermo, 15596026). Total RNA was isolated using standard phenol chloroform precipitation. Standard Illumina TruSeq Stranded mRNA (LT) was performed using 500 ng of total RNA input (illumina, FC-122-2101). Oligo-dT beads were used to capture polyA tails of mRNA followed by fragmentation and priming of captured mRNA (8 minutes at 94C). Immediately first strand cDNA synthesis was performed. Second strand cDNA synthesis was performed using second strand marking master and DNA polymerase 1 and RNase H. cDNA was adenylated at the 3 ends followed immediately by RNA end ligation single-index adapters (AR001-AR012). Library amplification was performed for 15 cycles under standard illumina library PCR conditions. Library quantitation was performed using Agilent 2200 TapeStation D1000 ScreenTape (Agilent, 5067-5582). RNA sequencing was performed on the NextSeq 550 System using a NextSeq V2.5 High Output 75 cycle kit (illumina, 20024906).
(365) Immunoprecipitation of HLA-I Complex
(366) A549/HEK293T cells engineered to express SARS-COV-2 entry factors were seeded into nine 15 cm dishes (three dishes per time point) at a density of 15 million cells per dish for A549 cells and 20 million cells per dish for HEK293T cells. The next day, the cells were infected with SARS-COV-2 at a multiplicity of infection (MOI) of 3. To synchronize infection, the virus was bound to target cells in a small volume of opti-MEM on ice for one hour, followed by addition of DMEM/2% FBS and switching to 37 C. At 12, 18, and 24 h post-infection, the cells from three dishes were scraped into 3 ml/dish of cold lysis buffer (20 mM Tris, pH 8.0, 100 mM NaCl, 6 mM MgCl.sub.2, 1 mM EDTA, 60 mM Octyl -d-glucopyranoside, 0.2 mM Iodoacetamide, 1.5% Triton X-100, 50Complete Protease Inhibitor Tablet-EDTA free and PMSF) obtaining a total of 9 ml lysate. This lysate was split into 6 eppendorf tubes, with each tube receiving 1.5 ml volume, and incubated on ice for 15 min with 1 ul of Benzonase (Thomas Scientific, E1014-25KU) to degrade nucleic acid. The lysates were then centrifuged at 4,000 rpm for 22 min at 4 C. and the supernatants were transferred to another set of six eppendorf tubes containing a mixture of pre-washed beads (Millipore Sigma, GE17-0886-01) and 50 ul of an MHC class I antibody (W6/32) (Santa Cruz Biotechnology, sc-32235). The immune complexes were captured on the beads by incubating on a rotor at 4 C. for 3 hr. The unbound lysates were kept for whole proteomics analysis while the beads were washed to remove non-specifically bound material. In total, nine washing steps were performed; one wash with 1 mL of cold lysis wash buffer (20 mM Tris, pH 8.0, 100 mM NaCl, 6 mM MgCl.sub.2, 1 mM EDTA, 60 mM Octyl -d-glucopyranoside, 0.2 mM Iodoacetamide, 1.5% Triton X-100), four washes with 1 mL of cold complete wash buffer (20 mM Tris, pH 8.0, 100 mM NaCl, 1 mM EDTA, 60 mM Octyl -d-glucopyranoside, 0.2 mM Iodoacetamide), and four washes with 20 mM Tris pH 8.0 buffer. Dry beads were stored in 80 c until mass-spectrometry analysis was performed.
(367) HLA Peptidomics LC-MS/MS Data Generation
(368) HLA peptides were eluted and desalted from beads as described previously (Sarkizova et al. 2020). After the primary elution step, HLA peptides were reconstituted in 3% ACN/5% FA and subjected to microscaled basic reverse phase separation. Briefly, peptides were loaded on Stage-tips with 2 punches of SDB-XC material (Empore 3M) and eluted in three fractions with increasing the amount of ACN (5%, 10% and 30% in 0.1% NH.sub.4OH). For the time course experiment, one third of each sample was also labelled with TMT6 (Thermo Fisher Scientific, 12 h: 126, 18 h: 128, 24 h: 130), combined and desalted on C18, eluting with increasing amount of ACN (10%, 15% and 50%) in 5 mM Ammonium Formate. Peptides were reconstituted in 3% ACN/5% FA prior to loading on the analytical column (packed in-house, 75 m New Objective, C18 Reprosil Dr Maisch). MS/MS were acquired on a Thermo Orbitrap Exploris 480 equipped with FAIMS (Thermo Fisher Scientific) in data dependent acquisition. FAIMS CVs were set to 50 and 70 with a cycle time of 1.5s per FAIMS experiment. MS2 filltime was set to 100 ms, collision energy was 29CE or 32CE for TMT respectively. The TMT labelled sample was also acquired without FAIMS using the same parameters.
(369) Whole Proteome LC-MS/MS Data Generation
(370) 200 uL aliquot of HLA IP supernatants were reduced for 30 minutes with 5 mM DTT (Pierce DTT: A39255) and alkylated with 10 mM IAA (Sigma IAA: A3221-10VL) for 45 minutes both at 25 C. on a shaker (1000 rpm). Protein precipitation using methanol/chloroform was then performed. Briefly, methanol was added at a volume of 4 that of HLA IP supernant aliquot. This was followed by a 1 volume of chloroform and 3 volume of water. The sample was mixed by vortexing and incubated at 20 C. for 1.5 hours. Samples were then centrifuged at 14,000 rpm for 10 minutes and the upper liquid layer was removed leaving a protein pellet. The pellet was rinsed with 3 volume of methanol, vortexed lightly and centrifuged at 14,000 rpm for 10 minutes. Supernatant was removed and discarded without disturbing the pellet. Pellets were resuspended in 100 mM triethylammonium bicarbonate (pH 8.5) (TEAB). Samples were digested with LysC (1:50) for 2 hours on a shaker (1000 rpm) at 25 C., followed by trypsin (1:50) overnight. Samples were acidified by 1% formic acid final concentration and dried. Samples were reconstituted to 1 ug/uL using 3% ACN/5% FA for LC-MS/MS analysis.
(371) Peptidomics and Proteomics Mass-Spectrometry Data Interpretation
(372) MS/MS spectra were searched with Spectrum Mill (v 7.3 pre-release) against a RefSeq-based sequence database containing 41,457 proteins mapped to the human reference genome (hg38) obtained via the UCSC Table Browser (genome.ucsc.edu/cgi-bin/hgTables) on Jun. 29, 2018, with the addition of 13 proteins encoded in the human mitochondrial genome, 264 common laboratory contaminant proteins, 553 human internal out-of-frame small open reading frames, 28 SARS-Cov2 proteins obtained from RefSeq derived from the original Wuhan-Hu-1 China isolate NC_045512.2 (https://www.ncbi.nlm.nih.gov/nuccore/1798174254) [Wu; 2020], and 23 novel unannotated virus ORFs whose translation is supported by Riboseq (Finkel et al. 2020) for a total of 42,337 proteins. Amongst the 28 annotated SARS-Cov2 proteins Applicant opted to omit the full length polyproteins ORF1a and ORF1ab, to simplify peptide-to-protein assignment, and instead represented ORF1ab as the mature 16 individual non-structural proteins that result from proteolytic processing of the 1a and 1ab polyproteins. Applicant further added the D614G variant of the SARS-Cov2 Spike protein that is commonly observed in European and American virus isolates.
(373) Statistical Analysis
(374) Data analysis was performed using R Studio, Python and Excel.
(375) TABLE-US-00002 TABLE 1 Post Experiment translational Cell Experiment timecourse Sequence modifications Length Protein line 24 h (R1) 12 h FAVDAAKAY 9 nsp10 A549 x (SEQ ID NO: 28) EIKESVQTF 9 nsp2 A549 (SEQ ID NO: 15) FASEAARVV 9 nsp2 A549 x (SEQ ID NO: 17) LATNNLVVM 9 nsp2 A549 x (SEQ ID NO: 16) EEFEPSTQYEY 11 nsp3 A549 x (SEQ ID NO: 20) SEFSSLPSY 9 nsp8 A549 (SEQ ID NO: 27) DEFVVVTV 8 ORF9b A549 x (SEQ ID protein NO: 11) LEDKAFQL 8 ORF9b A549 x (SEQ ID protein NO: 10) EILDITPcSF cysteinylated 10 S A549 x x (SEQ ID Cys NO: 32) EILDITPCSF 10 S A549 (SEQ ID NO: 33) EILDITPcSFG cysteinylated 11 S A549 x x (SEQ ID Cys NO: 34) HADQLTPTW 9 S A549 x x (SEQ ID NO: 35) KNIDGYFKIY 10 S A549 x x (SEQ ID NO: 36) NATNVVIKV 9 S A549 x (SEQ ID NO: 37) QLTPTWRVY 9 S A549 (SEQ ID NO: 38) VATSRTLSY 9 M A549 x (SEQ ID NO: 41) VGYLQPRTF 9 S A549 x (SEQ ID NO: 39) APHGHVmVEL oxidized 10 nsp1 HEK293 x (SEQ ID M NO: 192) STSAFVETV 9 nsp2 HEK293 (SEQ ID NO: 19) KRVDWTIEY 9 nsp14 HEK293 x (SEQ ID NO: 29) FGDDTVIEV 9 nsp3 HEK293 (SEQ ID NO: 23) IRQEEVQEL 9 ORF7a HEK293 x (SEQ ID (reset) NO: 31) APRITFGGP 9 N HEK293 x (SEQ ID NO: 42) ELPDEFVVV 9 ORF9b HEK293 x (SEQ ID protein NO: 12) ELPDEFVVVTV 11 ORF9b HEK293 x (SEQ ID protein NO: 8) KAFQLTPIAV 10 ORF9b HEK293 (SEQ ID protein NO: 13) SLEDKAFQL 9 ORF9b HEK293 x x (SEQ ID protein NO: 7) GLITLSYHL 9 ORFS.iORF1|ORFS.iORF2 HEK293 x (SEQ ID NO: 5) GPmVLRGLIT oxidized 10 ORFS.iORF1|ORFS.iORF2 HEK293 x x (SEQ ID M NO: 193) MLLGSMLYM oxidized 9 ORFS.iORF1| HEK293 x (SEQ ID M NO: 204) YLnSTnVTI deamidated 9 nsp3 HEK293 x (SEQ ID N NO: 205) Experiment Experiment timecourse timecourse most likely timecourse timecourse TMT TMT no HLA Allele rank Sequence 18 h 24 h (R2) FAIMS FAIMS (HLAthena) HLAthena FAVDAAKAY x x C1203, 0.003 (SEQ ID C1601 NO: 28) EIKESVQTF x A2501 0.018 (SEQ ID NO: 15) FASEAARVV x x x C1601 0.05 (SEQ ID NO: 17) LATNNLVVM C1203, 0.08 (SEQ ID C1601 NO: 16) EEFEPSTQYEY B1801, 0.02 (SEQ ID B4403 NO: 20) SEFSSLPSY x B1801, 0.025 (SEQ ID B4403 NO: 27) DEFVVVTV x x B1801 0.008 (SEQ ID NO: 11) LEDKAFQL B1801, 0.27 (SEQ ID B4403 NO: 10) EILDITPcSF x x x A2501 0.1 (SEQ ID NO: 32) EILDITPCSF x A2501 0.1 (SEQ ID NO: 33) EILDITPcSFG x A2501 4.52 (SEQ ID NO: 34) HADQLTPTW x x A2501 1.52 (SEQ ID NO: 35) KNIDGYFKIY x x x B1801 0.87 (SEQ ID NO: 36) NATNVVIKV x x C1203, 0.018 (SEQ ID C1601 NO: 37) QLTPTWRVY x x C1601 0.77 (SEQ ID NO: 38) VATSRTLSY C1601 0.0007 (SEQ ID NO: 41) VGYLQPRTF x x x x C1601 0.63 (SEQ ID NO: 39) APHGHVmVEL B0702 0.11 (SEQ ID NO: 192) STSAFVETV x A0201 1.31 (SEQ ID NO: 19) KRVDWTIEY C0702 0.02 (SEQ ID NO: 29) FGDDTVIEV x A0201 0.53 (SEQ ID NO: 23) IRQEEVQEL x C0702 0.13 (SEQ ID NO: 31) APRITFGGP x B0702 3.05 (SEQ ID NO: 42) ELPDEFVVV x x x A0201 0.77 (SEQ ID NO: 12) ELPDEFVVVTV x A0201 0.42 (SEQ ID NO: 8) KAFQLTPIAV x A0201 0.57 (SEQ ID NO: 13) SLEDKAFQL x x x A0201 0.43 (SEQ ID NO: 7) GLITLSYHL A0201 0.23 (SEQ ID NO: 5) GPmVLRGLIT x x x(M native) B0702 2.12 (SEQ ID NO: 193) MLLGSMLYM A0201 2.16 (SEQ ID NO: 204) YLnSTnVTI A0201 0.14 (SEQ ID NO: 205)
Example 2
(376) As researchers work to continue the development of effective vaccines and therapeutics for Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-COV-2), the virus causing the ongoing Coronavirus Disease 19 (COVID-19) pandemic (Lu et al., 2020), it is critical to decipher how infected host cells interact with the immune system. Previous insights from SARS-COV and MERS-COV, as well as emerging evidence from SARS-COV-2, imply that T cell responses play an essential role in SARS-COV-2 immunity and viral clearance (Altmann and Boyton, 2020; Grifoni et al., 2020a; Le Bert et al., 2020; Moderbacher et al., 2020; Sekine et al., 2020). Growing concerns about emerging viral variants and potential resistance to antibody defenses spurred renewed discussions about other immune responses and, in particular, cytotoxic T cell responses (Ledford, 2021). When viruses infect cells, their proteins are processed and presented on the host cell surface by class I human leukocyte antigen (HLA-I). Circulating cytotoxic T cells recognize the presented foreign antigens and initiate an immune response, resulting in the clearance of infected cells. Investigating the repertoire of SARS-COV-2 derived HLA-I peptides will enable identification of viral signatures responsible for activation of cytotoxic T cells.
(377) The vast majority of studies that have interrogated the interaction between T cells and SARS-COV-2 antigens to date utilized overlapping peptide tiling approaches and/or bioinformatic predictions of HLA-I binding affinity (Campbell et al., 2020; Ferretti et al., 2020; Grifoni et al., 2020b; Nguyen et al., 2020; Poran et al., 2020; Tarke et al., 2020). While HLA-I prediction is undoubtedly a useful tool to identify putative antigens, it has limitations. First, antigen processing and presentation is a multi-step biological pathway, that includes translation of source proteins, degradation by the proteasome, peptide cleavage by aminopeptidases, peptide translocation into the endoplasmic reticulum (ER) by transporter associated with antigen presentation (TAP) and finally, HLA-I binding (Neefjes et al., 2011). Although many computational predictors now account for some of these steps, the average positive predictive values achieved across HLA alleles is still about 64% (Sarkizova et al., 2020). Second, prediction models do not account for ways in which viruses may manipulate cellular processes upon infection, which can affect antigen presentation. For example, viruses can attenuate translation of host proteins, downregulate the proteasome machinery, and interfere with HLA-I expression (Hansen and Bouvier, 2009; Sonenberg and Hinnebusch, 2009). These changes shape the collection of viral and human-derived HLA-I peptides presented to the immune system. Third, prediction models do not capture the dynamics of viral protein expression during the course of infection. Kinetics studies in vaccinia and Influenza viruses have shown that HLA-I presentation of viral epitopes can peak at 3.5-9.5 hours post infection (Croft et al., 2013; Wu et al., 2019). Moreover, translation inhibition of host genes by many viruses can suppress MHC class I presentation later in infection. Thus, proteins that are expressed earlier in the virus life cycle may contribute more to the repertoire of viral epitopes. In light of these limitations, experimental measurements of naturally presented peptides can vastly contribute to our understanding of SARS-COV-2 T cells immune response.
(378) Mass spectrometry based HLA-I immunopeptidomics provides a direct and untargeted method to discover endogenously presented peptides and to learn rules that govern antigen processing and presentation (Abelin et al., 2017; Bassani-Sternberg and Gfeller, 2016; Chong et al., 2018; Sarkizova et al., 2020). This technology has facilitated the detection of virus-derived HLA-I peptides for West Nile virus, vaccinia virus, human immunodeficiency virus (HIV), human cytomegalovirus (HCMV) and measles virus (Croft et al., 2013; Erhard et al., 2018; McMurtrey et al., 2008; Rucevic et al., 2016; Schellens et al., 2015; Ternette et al., 2016). These infectious disease studies revealed new antigens, characterized the kinetics of presented peptides during infection, and identified the sequences that activate T cell responses.
(379) Analysis of mass spectrometry-derived data relies upon selecting a set of viral ORFs to interrogate, and has largely focused on canonical ORFs. Over the past decade, genome-wide profiling of translated sequences has revealed a striking number of non-canonical ORFs in mammalian and viral genomes (Finkel et al., 2020a; Ingolia et al., 2009, 2011; Stern-Ginossar et al., 2012). While the function of most of these non-canonical ORFs remains unknown, it is becoming clear that the translated polypeptides, including from short ORFs, serve as fruitful substrates for the antigen presentation machinery in viral infection, uninfected cells and cancer (Chen et al., 2020b; Hickman et al., 2018; Ingolia et al., 2014; Maness et al., 2010; Ouspenskaia et al., 2020; Ruiz Cuevas et al., 2021; Starck and Shastri, 2016; Yang et al., 2016). Importantly, a recent study identified 23 novel ORFs in the genome of SARS-COV-2, some of which have higher expression levels than the canonical viral ORFs (Finkel et al., 2020b). Whether these non-canonical ORFs give rise to HLA-I bound peptides remains unknown.
(380) This Example at least presents examination of HLA-I immunopeptidome in two SARS-CoV-2-infected human cell lines, and complement this analysis with RNA-seq, global proteomics measurements and biochemical binding assays. Viral HLA-I peptides were identified that are derived from both canonical and non-canonical ORFs and monitor the dynamics of viral protein expression and peptides presentation over multiple timepoints post infection. It is shown that peptides derived from out-of-frame ORFs elicit T cell responses in immunized HLA-A2 transgenic mice and COVID-19 patients using ELISpot and multiplexed barcoded tetramer assays combined with single cell sequencing. These assays uncovered overall higher reactivity to the non-canonical HLA-I peptides than canonical, with one peptide presenting greater responses than some of the strongest T cell epitopes reported to date. Using whole proteome measurements, it is shown that the time of viral protein expression correlates with HLA-I presentation and immunogenicity and that SARS-COV-2 interferes with the cellular proteasomal pathway, potentially resulting in lower presentation of viral peptides. Computational predictions suggest that the detected HLA-I peptides can be presented by additional HLA-I alleles in the population beyond the nine alleles tested in our study. These findings can inform future immune monitoring assays in patients and aid in the design of efficacious vaccines. See also Weingarten-Gabbay et al., 2021. Cell. 184:3962-3980 (2021) and supplementary data, which is incorporated by reference herein as if expressed in its entirety herein.
(381) Results
(382) Profiling HLA-I Peptides in SARS-COV-2 Infected Cells by Mass Spectrometry
(383) To interrogate the repertoire of human and viral HLA-I peptides, we immunoprecipitated (IP) HLA-I proteins from SARS-COV-2-infected human lung A549 cells and human kidney HEK293T cells that were transduced to stably express ACE2 and TMPRSS2, two known viral entry factors. Then their HLA bound peptides were analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS) (
(384) A focus on achieving both biological relevance and HLA-I allelic coverage of the human population was implemented in choosing cell types for this study. A549 are lung carcinoma cells representing the key biological target of SARS-COV-2, and thus commonly used in COVID-19 studies. HEK293T cells endogenously express HLA-A*02:01 and B*07:02, two high frequency HLA-I alleles (AFA: 12.5%, API: 9.5%, HIS: 19.4%, EUR: 29.6%, USA: 24.2% for A*02:01; and AFA: 7.3%, API: 2.6%, HIS: 5.4%, EUR: 14.0%, USA: 10.8% for B*07:02 (Gragert et al., 2013; Poran et al., 2020)). While HEK293T cells do not represent cells from the respiratory system, it was shown that SARS-COV-2 has renal tropism (Puelles et al., 2020) and can directly infect human kidney organoids (Monteil et al., 2020). Together, the nine HLA-I alleles expressed by HEK293T and A549 cells cover at least one allele in 63.8% of the human population (
(385) Immunopeptidome analysis of high-containment pathogens is technically challenging and requires implementation of protocols that achieve complete virus inactivation while maintaining the integrity of the HLA-peptide complex. Therefore, the protocol was revised to accommodate the needs and restrictions associated with working in a biosafety level 3 (BSL3) laboratory. First, Benzonase nuclease was used instead of sonication to shear the genomic DNA before immunoprecipitation (Abelin et al., 2019). Second, the virus was inactivated using a lysis buffer containing 1.5% Triton-X, thereby obviating the need to boil or chemically process the cell lysates. The preliminary investigation showed that these experimental conditions achieved complete virus inactivation (
(386) The technical performance of these assays was validated by examining the overall characteristics of presented HLA peptides. 5,837 and 6,372 HLA-bound 8-11mer peptides were identified in uninfected and infected (24 hpi) A549 cells, and 4,281 and 1,336 unique peptides in HEK293T cells, respectively (data not shown). The reduction in the total number of peptides after infection in HEK293T cells is most likely due to cell death (about 50% of cells 24hpi). As expected, it was found that the peptide length distribution was not influenced by the virus infection, and the majority of HLA-I peptides were 9-mers (
(387) TABLE-US-00003 TABLE 3 population allele frequency % coverage % World A0201 15.28 28.23 World A2501 0.45 0.90 World A3001 2.51 4.95 World B0702 4.11 8.04 World B1801 2.30 4.55 World B4403 4.47 8.75 World C0702 13.10 24.49 World C1203 1.96 3.88 World C1601 2.42 4.78 EUR A0201 29.60 50.44 EUR A2501 1.93 3.81 EUR A3001 1.34 2.66 EUR B0702 13.99 26.02 EUR B1801 4.62 9.03 EUR B4403 4.96 9.68 EUR C0702 15.01 27.76 EUR C1203 4.89 9.54 EUR C1601 3.54 6.95 AFA A0201 12.46 23.36 AFA A2501 0.50 1.00 AFA A3001 6.91 13.33 AFA B0702 7.30 14.07 AFA B1801 3.57 7.01 AFA B4403 5.37 10.46 AFA C0702 6.97 13.45 AFA C1203 1.78 3.53 AFA C1601 9.79 18.62 API A0201 9.46 18.02 API A2501 0.06 0.11 API A3001 2.06 4.08 API B0702 2.63 5.19 API B1801 1.16 2.31 API B4403 4.24 8.31 API C0702 14.56 27.00 API C1203 2.74 5.40 API C1601 0.17 0.34 HIS A0201 19.40 35.04 HIS A2501 0.88 1.75 HIS A3001 2.11 4.17 HIS B0702 5.45 10.61 HIS B1801 3.95 7.75 HIS B4403 6.08 11.79 HIS C0702 11.28 21.29 HIS C1203 4.13 8.08 HIS C1601 5.05 9.85 USA A0201 24.16 42.48 USA A2501 1.42 2.83 USA A3001 2.27 4.48 USA B0702 10.82 20.48 USA B1801 4.13 8.08 USA B4403 5.16 10.06 USA C0702 13.25 24.75 USA C1203 4.20 8.22 USA C1601 4.41 8.62
(388) As previously described HLA-I peptidomics were performed (data not shown). Peptide identifications from HLA-I immunoprecipitation experiments in A549 and HEK293T cells+/ SARS-COV-2 after filtering for contaminants and length 8-11 were performed as previously noted (data not shown). For TMT time course experiments, peptides were filtered for quantitative values and TMT ratios to the 24 h time point were median normalized.
(389) To evaluate if the LC-MS/MS-detected peptides are indeed predicted to bind to the expressed HLA-I alleles, the most likely allele to which each peptide binds was inferred using HLAthena predictions (Sarkizova et al., 2020). A549 cells express A*25:01/30:01, B*18:01/44:03 and C*12:03/16:01, while HEK293T cells express A*02:01, B*07:02 and C*07:02 (determined by HLA allotyping). At a stringent cutoff of predicted percentile rank <=0.5, 87% of A549 and 73% of HEK293T identified peptides post infection were assigned to at least one of the alleles in the corresponding cell line (
(390) The observed differences in relative HLA alleles representation could stem from the expression levels of individual alleles and/or the range of peptides each allele can bind. The lack of allele-specific antibodies prevents direct protein level measurements of each individual HLA allele. Similarly, high transcript homology between individual HLA alleles only allows for relative expression quantification between the three HLA loci, HLA-A,-B and -C. Examining our RNA-seq measurements, a higher level of HLA-A expression was found compared to HLA-B and -C in both uninfected cell lines (
(391) To estimate the contribution of the range of peptides each allele can bind to the obtained surface representations, we scored all human-derived 9-mer peptides for each allele (
(392) Detecting HLA-I peptides across SARS-COV-2 genome
(393) Next, HLA-I peptides were examined that are derived from the SARS-COV-2 genome (
(394) Table 2 shows HLA-I bound peptide sequences from SARS-COV-2 proteins identified in both A549 and HEK293T cells. Cysteines were detected in their carbamidomethylated or cysteinylated modification state, methionines were oxidized. x denotes identification in individual experiments, T in TMT experiments, - indicates that the peptide was detected but did not pass FDR correction in that sample, confidence level in identification was evaluated based on Spectrum Mill Score, after manual inspection of MS/MS spectra and comparison to synthetic peptide spectra for available peptides (Y=validated by synthetic peptide, N/A=synthetic peptide not available). For binding prediction using HLAthena, residues were considered unmodified, columns show the most likely HLA allele a peptide is bound to in the respective cell line as well as the percentile binding rank.
(395) TABLE-US-00004 TABLE2 SARS-CoV-2HLA-Ipeptides Binding Exp. #exp invitro Cell 24h observed Syn. Spectrum Confidence HLAAllele rank (IC.sub.50, line Sequence Length Protein (R1) 3h 6h 12h 18h 24h(R2) in Peptide MillScore level (HLA-thena) (HLA-thena) [nM]*) A549 FAVDAAKAY 9 nsp10 x T x/T T T x/T 5 Y 17.03 High C1203,C1601 0.0027 N/A (SEQIDNO:28) EIKESVQTF 9 nsp2 T T T T T 2 Y 8.83 High A2501 0.0184 N/A (SEQIDNO:15) FASEAARVV 9 nsp2 x x/T x/T T x/T x/T 7 Y 13.87 High C1601 0.0049 N/A (SEQIDNO:17) LATNNLVVM 9 nsp2 x 1 N/A 5.26 Medium/LOW C1203,C1601 0.0848 N/A (SEQIDNO:16) TAQNSVRVL 9 nsp2 T T T 1 N/A 8.08 High C1203,C1601 0.1829 N/A (SEQIDNO:18) EEFEPSTQYEY 11 nsp3 x 1 Y 13.67 High B1801,B4403 0.0194 N/A (SEQIDNO:20) TTTIKPVTY 9 nsp3 x 1 N/A 10.04 High C1601 0.0869 N/A (SEQIDNO:21) TVIEVQGY 8 nsp3 T T T 1 N/A 7.82 High A2501 0.0528 N/A (SEQIDNO:22) SEFSSLPSY 9 nsp8 T T T 1 Y 6.85 High B1801,B4403 0.0246 0.37 (SEQIDNO:27) DEFVVVTV 8 ORF9b x T T T T T 3 Y 5.5 High B1801 0.0083 <0.5 (SEQIDNO:11) LEDKAFQL 8 ORF9b x 1 Y 6.97 High B1801,B4403 0.2739 35 (SEQIDNO:10) EILDITPCSF 10 S x x x/T x/T x/T 6 N/A 15.03 High A2501 0.0955 N/A (SEQIDNO:33) EILDITPCSFG 11 S x x x 3 N/A 9.83 High A2501 4.5204 N/A (SEQIDNO:47) HADQLTPTW* 9 S x x x x/T x/T T 6 Y 15.03 Medium, A2501 1.5199 N/A (SEQIDNO:35) alsoinneg. control KNIDGYFKIY 10 S x T T x x x 5 Y 16.92 High B1801 0.8731 >70000 (SEQIDNO:36) NATNVVIKV 9 S x T x/T T T T 4 Y 10.1 High C1203,C1601 0.0180 N/A (SEQIDNO:37) QLTPTWRVY 9 S T T T 3 Y 7.97 High C1601 0.7696 N/A (SEQIDNO:38) VGYLQPRTF 9 S x x T x/T x/T 5 Y 11.81 High C1601 0.6251 N/A (SEQIDNO:39) VATSRTLSY 9 M x T T T 2 N/A 7.64 Medium C1601 0.0007 N/A (SEQIDNO:41) METGGFSIDLP 11 F3R196 x 1 N/A 5.49 Medium B1801 3.2422 N/A (SEQIDNO:43) LSNPVILTK 9 F2R32 T T T 1 N/A 5.83 Medium A3001 1.6274 N/A (SEQIDNO:44) Exp. #exp HLA Binding Cell 24h Observed Syn. Spectrum Confidence Allele rank invitro line Sequence Length Protein (R1) 3h 6h 12h 18h 24h(R2) in Peptide MillScore level (HLA-thena) (HLA-thena) (IC.sub.50,[nM]*) HEK293T APHGHVMVEL 10 nsp1 x T T T 2 Y 14.36 High B0702 0.1099 6.1 (SEQIDNO:14) STSAFVETV 9 nsp2 T T T T T 2 N/A 11.55 High A0201 1.3088 N/A (SEQIDNO:19) KRVDWTIEY 9 nsp14 x T T T 2 Y 13.86 High C0702 0.0180 N/A (SEQIDNO:29) FGDDTVIEV 9 nsp3 T T T T T 2 Y 10.68 High A0201 0.5348 3.8 (SEQIDNO:23) YLNSTNVTI 9 nsp3 x 1 Y 7.31 Medium A0201 0.1354 12 (SEQIDNO:24) YLFDESGEFKL 11 nsp3 T T T 1 N/A 4.94 Medium A0201 0.0052 N/A (SEQIDNO:25) AGTDTTITV 9 nsp5 T T T 1 N/A 5.48 Medium A0201 3.4456 N/A (SEQIDNO:26) (notvalid with6 frame search) SVVSKVVKV 9 nsp15 T T T 1 N/A 6.81 Medium A0201 0.1482 N/A (SEQIDNO:30) IRQEEVQEL 9 ORF7a T x/T T T T 3 Y 16.01 High C0702 0.1322 N/A (SEQIDNO:31) APRITFGGP 9 N x x x 3 Y 15.03 High B0702 3.0563 N/A (SEQIDNO:42) ELPDEFVVV 9 ORF9b x x/T x/T x/T 5 Y 9.01 High A0201 0.7673 460 (SEQIDNO:12) ELPDEFVVVTV 11 ORF9b x 1 Y 5 High A0201 0.4190 1.6 (SEQIDNO:8) KAFQLTPIAV 10 ORF9b T T T T T 2 N/A 6.46 High A0201 0.5696 7.8 (SEQIDNO:13) SLEDKAFQL 9 ORF9b x T x/T x/T x/T x/T 7 Y 14.5 High A0201 0.4349 20 (SEQIDNO:7) NLNESLIDL 9 S T T T 1 N/A 7.75 High A0201 0.8444 N/A (SEQIDNO:40) GLITLSYHL 9 S.iORF1/2 x 1 Y 11.09 High A0201 0.2323 <0.5 (SEQIDNO:5) GPMVLRGLIT 10 S.iORF1/2 x x x/T x/T x/T 6 Y 15.37 High B0702 2.1237 168 (SEQIDNO:6) MLLGSMLYM 9 S.iORF1 x 3 Y 11.22 High A0201 2.1581 <0.5 (SEQIDNO:4) LSASLSNFLSI 11 F6R325 x x 2 N/A 10.63 Medium, A0201 5.9332 N/A (SEQIDNO:45) alsoin neg. control MPFQKPITL 9 F3R683 x 1 N/A 14.2 High B0702 0.0269 N/A (SEQIDNO:46) *For in-vitro binding assay, IC50 <500 nM indicates binding. **HADQLTPTW (SEQ ID NO: 35) swas observed in non-infected A549 cells
(396) To evaluate the binding affinity of the detected peptides to the predicted HLA alleles in the cell lines (Table 2) in-vitro binding assays with synthetic peptides and purified MHC complexes matching four of the HLA alleles expressed in A549 and HEK293T cells was performed (A*02:01, B*07:02, B*18:01 and B*44:03). Binding (IC.sub.50<500 nM) was confirmed for 19 of the 20 HLA-I peptides assigned to these alleles (
(397) TABLE-US-00005 TABLE4 In-vitrobindingmeasurementsofHLA-IpeptidesandpurifiedMHCcomplexes. HLAthena Peptide Assigned prediction ID LJIID ORFtype Sequence Organism Protein Len HLA (Rank) Peptide1 7283.0001 canonical APHGHVMVEL SARS- nsp1 10 B0702 0.11 (SEQIDNO:14) CoV-2 Peptide2 7283.0002 canonical IRQEEVQEL SARS- ORF7a 9 C0702 0.13 (SEQIDNO:31) CoV-2 Peptide3 7283.0003 non- SLEDKAFQL SARS- ORF9b 9 A0201 0.43 canonical (SEQIDNO:7) CoV-2 Peptide4 7283.0004 non- GPMVLRGLIT SARS- ORFS. 10 B0702 2.12 canonical (SEQIDNO:6) CoV-2 iORF1/2 Peptide5 7283.0005 non- GLITLSYHL SARS- ORFS. 9 A0201 0.23 canonical (SEQIDNO:5) CoV-2 iORF1/2 Peptide6 7283.0006 non- ELPDEFVVVTV SARS- ORF9b 11 A0201 0.42 canonical (SEQIDNO:8) CoV-2 Peptide7 7283.0007 canonical KRVDWTIEY SARS- nsp14 9 C0702 0.02 (SEQIDNO:29) CoV-2 Peptide8 7283.0008 canonical FAVDAAKAY SARS- nsp10 9 C1203, 0.00 (SEQIDNO:28) CoV-2 C1601 Peptide9 7283.0009 canonical FASEAARVV SARS- nsp2 9 C1601 0.00 (SEQIDNO:17) CoV-2 Peptide10 7283.0010 canonical EEFEPSTQYEY SARS- nsp3 11 B1801, 0.02 (SEQIDNO:20) CoV-2 B4403 Peptide12 7283.0012 non- LEDKAFQL SARS- ORF9b 8 B1801, 0.27 canonical (SEQIDNO:10) CoV-2 B4403 Peptide13 7283.0013 canonical HADQLTPTW SARS- S 9 A2501 1.52 (SEQIDNO:35) CoV-2 Peptide14 7283.0014 canonical EILDITPCSFG SARS- S 11 A2501 4.52 (SEQIDNO:47) CoV-2 Peptide15 7283.0015 canonical EILDITPCSF SARS- S 10 A2501 0.10 (SEQIDNO:33) CoV-2 Peptide16 7283.0016 canonical KNIDGYFKIY SARS- S 10 B1801 0.87 (SEQIDNO:36) CoV-2 Peptide17 7283.0017 canonical EIKESVQTF SARS- nsp2 9 A2501 0.02 (SEQIDNO:15) CoV-2 Peptide18 7283.0018 canonical SEFSSLPSY SARS- nsp8 9 B1801, 0.02 (SEQIDNO:27) CoV-2 B4403 Peptide19 7283.0019 non- DEFVVVTV SARS- ORF9b 8 B1801 0.01 canonical (SEQIDNO:11) CoV-2 Peptide20 7283.0020 canonical NATNVVIKV SARS- S 9 C1203, 0.02 (SEQIDNO:37) CoV-2 C1601 Peptide21 7283.0021 canonical VGYLQPRTF SARS- S 9 C1601 0.63 (SEQIDNO:39) CoV-2 Peptide22 7283.0022 canonical QLTPTWRVY SARS- S 9 C1601 0.77 (SEQIDNO:38) CoV-2 Peptide23 7283.0023 non- MLLGSMLYM SARS- ORFS. 9 A0201 2.16 canonical (SEQIDNO:4) CoV-2 iORF1 Peptide24 7283.0024 canonical YLNSTNVTI SARS- nsp3 9 A0201 0.14 (SEQIDNO:24) CoV-2 Peptide25 7283.0025 canonical VATSRTLSY SARS- M 9 C1601 0.00 (SEQIDNO:41) CoV-2 Peptide26 7283.0026 canonical LATNNLVVM SARS- nsp2 9 C1203, 0.08 (SEQIDNO:16) CoV-2 C1601 Peptide27 7283.0027 canonical STSAFVETV SARS- nsp2 9 A0201 1.31 (SEQIDNO:19) CoV-2 Peptide28 7283.0028 canonical FGDDTVIEV SARS- nsp3 9 A0201 0.53 (SEQIDNO:23) CoV-2 Peptide29 7283.0029 canonical APRITFGGP SARS- N 9 B0702 3.06 (SEQIDNO:42) CoV-2 Peptide30 7283.0030 non- ELPDEFVVV SARS- ORF9b 9 A0201 0.77 canonical (SEQIDNO:12) CoV-2 Peptide31 7283.0031 non- KAFQLTPIAV SARS- ORF9b 10 A0201 0.57 canonical (SEQIDNO:13) CoV-2 Peptide HLA- HLA- HLA- HLA- HLA- HLA- HLA- HLA- HLA- ID A*01:01 A*02:01 A*26:01 B*07:02 B*15:01 B*18:01 B*44:02 B*44:03 B*51:01 Peptide1 6.1 Peptide2 Peptide3 20 1585 Peptide4 2002 884 168 8552 Peptide5 +++ 40310 14300 1500 25960 24304 Peptide6 1.6 72 35095 1133 Peptide7 356 22730 Peptide8 6.7 2.7 35856 Peptide9 495 734 8546 2546 49532 207 Peptide10 18805 78 1.1 50 0.41 Peptide12 3891 14707 35 35395 208 Peptide13 13435 3353 5258 1802 Peptide14 7908 732 44304 22862 Peptide15 9089 2.6 454 17434 18268 10811 Peptide16 11813 1449 Peptide17 7.8 4934 37214 Peptide18 39796 875 6.9 0.37 16 8.2 Peptide19 13022 9548 52825 2054 +++ 2795 1283 12791 Peptide20 1165 43443 8106 536 Peptide21 777 707 2393 Peptide22 11 Peptide23 +++ 45517 1.1 18915 7872 Peptide24 12 7933 1.2 49631 3621 Peptide25 18751 11838 267 Peptide26 55 315 40182 46503 32710 Peptide27 12684 26 12065 8863 10440 Peptide28 3.8 2382 45711 Peptide29 893 59 Peptide30 460 6860 Peptide31 7.8 8598 1203 3872 16437 38654 A dash indicates IC.sub.50 >70000 nM. Binding <500 nM highlighted by bold font. +++indicates IC.sub.50 <0.5 nM. Underlined indicates an assigned allele
(398) Surprisingly, only one HLA-I peptide with an atypical HLA-B*07:02 binding motif was detected from N, a SARS-COV-2 protein expected to be highly abundant based on previous RNA-seq and Ribo-seq studies (Finkel et al., 2020b; Kim et al., 2020). To test if this low representation could be explained by lower expression of N in our experiment, the whole proteome mass spectrometry data generated from the flowthrough of the HLA-IP was examined. A strong correlation was found between the abundance of viral proteins in the proteome of the two cell lines in our study (Pearson R=0.91,
(399) Without being bound by theory, another potential explanation for reduced HLA-I presentation of N derived peptides was hypothesized, namely that the protein harbors fewer peptides compatible with the HLA binding motifs. To test if the low presentation of peptides from N stems from intrinsic properties of the protein sequence, we computed for each SARS-COV-2 ORF the ratio between the number of peptides that are predicted to be presented by at least one of the HLA-I alleles in each cell line and the number of total 8-11mers. Notably, N harbors less presentable peptides than most SARS-COV-2 proteins in both cell lines (
(400) Tables 5A-5B show SARS-COV-2 protein abundance and presentability. Table 5A shows SARS-COV-2 protein expression values as determined by whole proteome measurements in A549 and HEK293T cells and Ribo-Seq translation measurements that were previously published for Vero cells (Finkel et al., 2020b)). iBAQ-intensity-based absolute quantification. Table 5B shows HLA-I presentability estimates of SARS-COV-2 ORFs based on HLAthena predictions.
(401) TABLE-US-00006 TABLE 5A SARS-CoV-2 protein abundance. SARS- Ribo-seq Finkel CoV-2 Proteome A549 Proteome HEK293T et. al. (chx Protein* log10(iBAQ) log10(iBAQ) mean RPKM) N 10.6838 11.0857 293655.1145 M 9.6832 10.1197 121179.8465 ORF9b 9.5643 9.974 106480.3716 nsp5 10.0264 9.1273 NaN S 9.0701 9.8182 15648.6866 ORF3a 8.8004 9.8546 40845.54295 nsp8 8.9184 9.5997 NaN nsp1 9.1659 9.0199 NaN ORF7a 8.7613 9.3614 50612.85941 ORF8 NaN 8.9932 31104.73178 nsp2 8.5059 9.3273 NaN nsp9 8.5188 9.044 NaN nsp3 8.3431 8.9745 NaN nsp10 8.4466 8.8422 NaN nsp4 8.1335 8.7269 NaN ORF6 8.4021 8.3568 25280.79667 nsp12 7.5873 8.0576 NaN nsp15 7.1958 8.069 NaN nsp6 7.2054 7.9413 NaN nsp16 NaN 7.5285 NaN nsp13 7.1948 7.7905 NaN nsp7 NaN 7.039 NaN nsp14 6.7825 7.0481 NaN E NaN 6.4898 12351.48544
(402) TABLE-US-00007 TABLE 5B SARS-CoV-2 presentability estimates. number of fraction of total number pepties peptides rank of peptides predicted predicted (low- name lenAA (8-11mers) to bind to bind high) A549 10.uORF 10 6 0 0.0000 1 1a.uORF1 9 3 0 0.0000 2 1a.uORF1.ext 25 66 0 0.0000 3 1a.uORF2 13 18 0 0.0000 4 1a.uORF2.ext 33 98 0 0.0000 5 3a.iORF2 33 98 0 0.0000 6 7a.iORF2 8 1 0 0.0000 7 7b.iORF1 20 46 0 0.0000 8 8.iORF 9 3 0 0.0000 9 E.iORF 11 10 0 0.0000 10 nsp11 13 18 0 0.0000 11 nsp5 306 1190 15 0.0126 12 nsp9 113 418 6 0.0144 13 6.iORF 43 138 2 0.0145 14 N 419 1642 24 0.0146 15 nsp7 83 298 5 0.0168 16 nsp10 139 522 9 0.0172 17 nsp16 298 1158 20 0.0173 18 ORF8 121 450 9 0.0200 19 ORF7b 43 138 3 0.0217 20 N.iORF2 90 326 8 0.0245 21 S.iORF1 39 122 3 0.0246 22 nsp4 500 1966 50 0.0254 23 nsp14 527 2074 53 0.0256 24 S 1273 5096 132 0.0259 25 10.iORF 18 38 1 0.0263 26 nsp13 601 2370 63 0.0266 27 nsp6 290 1126 31 0.0275 28 N.iORF1 97 354 10 0.0282 29 ORF9b 97 354 10 0.0282 30 ORF7a 121 450 13 0.0289 31 nsp8 198 758 22 0.0290 32 ORF1ab 7096 28350 829 0.0292 33 7a.iORF1 119 442 13 0.0294 34 3a.iORF1 41 130 4 0.0308 35 nsp3 1945 7746 250 0.0323 36 nsp12 932 3694 121 0.0328 37 S.iORF2 31 90 3 0.0333 38 ORF3a 275 1066 36 0.0338 39 nsp2 638 2518 89 0.0353 40 ORF14 73 258 10 0.0388 41 nsp1 180 686 28 0.0408 42 M.ext 235 906 37 0.0408 43 E 75 266 11 0.0414 44 M 222 854 36 0.0422 45 ORF6 61 210 9 0.0429 46 nsp15 346 1350 61 0.0452 47 M.iORF 14 22 1 0.0455 48 ORF10 38 118 7 0.0593 49 7a.iORF3 15 26 2 0.0769 50 7b.iORF2 11 10 1 0.1000 51 HEK293T 10.uORF 10 6 0 0.0000 1 1a.uORF1 9 3 0 0.0000 2 1a.uORF1.ext 25 66 0 0.0000 3 1a.uORF2 13 18 0 0.0000 4 3a.iORF2 33 98 0 0.0000 5 7a.iORF2 8 1 0 0.0000 6 7a.iORF3 15 26 0 0.0000 7 7b.iORF1 20 46 0 0.0000 8 7b.iORF2 11 10 0 0.0000 9 8.iORF 9 3 0 0.0000 10 E.iORF 11 10 0 0.0000 11 nsp11 13 18 0 0.0000 12 nsp10 139 522 2 0.0038 13 nsp16 298 1158 6 0.0052 14 N 419 1642 11 0.0067 15 nsp8 198 758 6 0.0079 16 1a.uORF2.ext 33 98 1 0.0102 17 ORF8 121 450 5 0.0111 18 nsp2 638 2518 29 0.0115 19 ORF14 73 258 3 0.0116 20 S 1273 5096 61 0.0120 21 nsp14 527 2074 26 0.0125 22 nsp5 306 1190 15 0.0126 23 nsp12 932 3694 49 0.0133 24 nsp3 1945 7746 108 0.0139 25 ORF1ab 7096 28350 402 0.0142 26 nsp9 113 418 6 0.0144 27 6.iORF 43 138 2 0.0145 28 ORF3a 275 1066 17 0.0159 29 nsp1 180 686 11 0.0160 30 nsp15 346 1350 22 0.0163 31 nsp13 601 2370 39 0.0165 32 nsp7 83 298 6 0.0201 33 ORF7a 121 450 10 0.0222 34 E 75 266 6 0.0226 35 7a.iORF1 119 442 10 0.0226 36 nsp4 500 1966 45 0.0229 37 nsp6 290 1126 28 0.0249 38 M 222 854 22 0.0258 39 N.iORF1 97 354 10 0.0282 40 ORF9b 97 354 10 0.0282 41 ORF6 61 210 6 0.0286 42 M.ext 235 906 26 0.0287 43 ORF7b 43 138 4 0.0290 44 N.iORF2 90 326 10 0.0307 45 S.iORF1 39 122 5 0.0410 46 ORF10 38 118 5 0.0424 47 10.iORF 18 38 2 0.0526 48 S.iORF2 31 90 5 0.0556 49 3a.iORF1 41 130 11 0.0846 50 M.iORF 14 22 2 0.0909 51 92 HLA alleles fraction of fraction of pepties pepties predicted to predicted to rank bind (mean bind (median (low- name lenAA alleles) alleles) high) 10.uORF 10 0.0000 0.0000 1 1a.uORF1 9 0.0000 0.0000 2 7a.iORF2 8 0.0000 0.0000 3 8.iORF 9 0.0000 0.0000 4 1a.uORF2 13 0.0006 0.0000 5 E.iORF 11 0.0011 0.0000 6 3a.iORF2 33 0.0011 0.0000 7 7b.iORF1 20 0.0014 0.0000 8 1a.uORF1.ext 25 0.0018 0.0000 9 1a.uORF2.ext 33 0.0035 0.0000 10 6.iORF 43 0.0054 0.0000 11 7a.iORF3 15 0.0054 0.0000 12 7b.iORF2 11 0.0054 0.0000 13 ORF7b 43 0.0065 0.0000 14 nsp11 13 0.0066 0.0000 15 10.iORF 18 0.0072 0.0000 16 M.iORF 14 0.0128 0.0000 17 nsp10 139 0.0026 0.0019 18 N 419 0.0034 0.0030 19 nsp7 83 0.0037 0.0034 20 nsp5 306 0.0035 0.0034 21 nsp16 298 0.0039 0.0035 22 E 75 0.0069 0.0038 23 ORF14 73 0.0062 0.0039 24 ORF8 121 0.0048 0.0044 25 nsp14 527 0.0049 0.0046 26 S 1273 0.0048 0.0046 27 nsp13 601 0.0053 0.0046 28 ORF6 61 0.0079 0.0048 29 nsp2 638 0.0048 0.0048 30 nsp9 113 0.0052 0.0048 31 ORF1ab 7096 0.0054 0.0050 32 nsp4 500 0.0064 0.0051 33 nsp8 198 0.0056 0.0053 34 nsp3 1945 0.0057 0.0053 35 ORF3a 275 0.0066 0.0056 36 N.iORF1 97 0.0073 0.0056 37 ORF9b 97 0.0073 0.0056 38 nsp12 932 0.0063 0.0057 39 nsp1 180 0.0058 0.0058 40 M 222 0.0076 0.0059 41 nsp15 346 0.0062 0.0059 42 N.iORF2 90 0.0071 0.0061 43 nsp6 290 0.0071 0.0062 44 M.ext 235 0.0076 0.0066 45 ORF7a 121 0.0065 0.0067 46 7a.iORF1 119 0.0066 0.0068 47 3a.iORF1 41 0.0094 0.0077 48 S.iORF1 39 0.0080 0.0082 49 ORF10 38 0.0129 0.0085 50 S.iORF2 31 0.0098 0.0111 51
(403) The deep coverage of the viral proteins in whole proteome analysis (24 proteins) allowed us to uncover a number of other interesting insights. While the translation of ORF1a and lab, the source polyproteins of nsps 1-16, is 10-1000 fold lower than structural ORFs (Finkel et al., 2020b), it was found that the abundance of some non-structural proteins was comparable to that of structural proteins (e.g., nsp1 and nsp8,
(404) Kinetics of SARS-COV-2 Protein Expression and HLA-I Peptides Presentation
(405) To investigate the dynamics of HLA-I presentation during infection, HLA-I immunopeptidome analysis in A549 and HEK293T cells was performed at 3, 6, 12, 18 and 24hpi. To compare the abundance of HLA-I peptides across all five time points we utilized isobaric chemical labeling with tandem mass tags (TMT) for precise relative quantification and to reduce missing values due to stochastic sampling by LC-MS/MS. Due to technical reasons, the infection time course analysis was split into two batches. The first batch contained time points 3, 6, and 24 hpi, while the second batch 12, 18, and 24 hpi. Since the 24hpi time point was common to both batches, it was used to normalize peptides from each run.
(406) Labeling with TMT enabled the detection of 10 viral HLA-I peptides in A549 cells; four peptides were quantified across all timepoints, two were only detected in the 12|18|24 h plex, and four were only detected in the 3|6|24 h plex (see e.g.,
(407) A similar pattern of achieving maximal viral peptides presentation in earlier time points in HEK293T cells was observed as well. Overall, 13 peptides from SARS-COV-2 were detected in TMT labeled immunopeptidome experiments, with the caveat of observing some peptides only in the 3|6|24 h plex as described above (
(408) To examine the relationship between HLA peptide presentation and the time of viral protein expression, fractionated whole proteome mass spectrometry analysis was additionally performed across 3, 6, and 24hpi timepoints from the same cell lysates. While the majority of viral proteins were expressed in cells at 6hpi, only eight and nine proteins were detected at 3hpi in A549 and HEK293T cells, respectively (
(409) SARS-COV-2 Infection Interferes with Cellular Pathways that May Impact HLA-I Peptide Processing and Presentation
(410) To investigate how the levels of viral source proteins impact their ability to be processed and presented, we evaluated both the total abundance of viral proteins relative to host proteins and the rank of individual SARS-COV-2 proteins compared to human proteins. Although the overall viral abundance in the host proteome 24hpi is relatively low (HEK293T-2.6%; A549-3%,
(411) Tables 6A-6B show data associated with whole proteome analyses of A549 and HEK293T cells+/ SARS-COV-2 at 0, 3, 6, and 24hpi. Table 6A contains the protein groups used to plot the results from the two sample t-test results (
(412) TABLE-US-00008 TABLE 6A Shows the protein groups used to plot the results from the two sample t-test results (FIGS. 9E and 9F). These annotations are a combination of manual curation, KEGG, and GO annotations of genes from proteasomal pathway, antigen processing, ubiquitination pathway, IFN signaling, and SARS-CoV-2 genes. pathway geneSymbol proteinName SARS E E SARS M M SARS N N SARS S S SARS ORF3a ORF3a SARS ORF6 ORF6 SARS ORF7a ORF7a SARS ORF8 ORF8 SARS ORF9b ORF9b SARS nsp1 nsp1 SARS nsp2 nsp2 SARS nsp3 nsp3 SARS nsp4 nsp4 SARS nsp5 nsp5 SARS nsp6 nsp6 SARS nsp7 nsp7 SARS nsp8 nsp8 SARS nsp9 nsp9 SARS nsp10 nsp10 SARS nsp12 nsp12 SARS nsp13 nsp13 SARS nsp14 nsp14 SARS nsp15 nsp15 SARS nsp16 nsp16 Ub USP54 inactive ubiquitin carboxyl-terminal hydrolase 54 isoform 2 GN = USP54 Ub USP34 ubiquitin carboxyl-terminal hydrolase 34 GN = USP34 Ub USP53 inactive ubiquitin carboxyl-terminal hydrolase 53 GN = USP53 Ub USP43 ubiquitin carboxyl-terminal hydrolase 43 isoform 2 GN = USP43 Ub MYCBP2 E3 ubiquitin-protein ligase MYCBP2 GN = MYCBP2 Ub HERC1 probable E3 ubiquitin-protein ligase HERC1 GN = HERC1 Ub WWP1 NEDD4-like E3 ubiquitin-protein ligase WWP1 GN = WWP1 Ub MARCH7 E3 ubiquitin-protein ligase MARCH7 isoform a GN = MARCH7 Ub DTX3L E3 ubiquitin-protein ligase DTX3L GN = DTX3L Ub UBE3B ubiquitin-protein ligase E3B isoform 1 GN = UBE3B Ub USP9Y probable ubiquitin carboxyl-terminal hydrolase FAF-Y GN = USP9Y Ub USP32 ubiquitin carboxyl-terminal hydrolase 32 GN = USP32 Ub WWP2 NEDD4-like E3 ubiquitin-protein ligase WWP2 isoform 4 GN = WWP2 Ub ATG10 ubiquitin-like-conjugating enzyme ATG10 GN = ATG10 Ub HECTD4 probable E3 ubiquitin-protein ligase HECTD4 GN = HECTD4 Ub SH3RF1 E3 ubiquitin-protein ligase SH3RF1 GN = SH3RF1 Ub USP30 ubiquitin carboxyl-terminal hydrolase 30 isoform 2 GN = USP30 Ub HERC2 E3 ubiquitin-protein ligase HERC2 GN = HERC2 Ub COP1 E3 ubiquitin-protein ligase COP1 isoform b GN = COP1 Ub RNFT1 E3 ubiquitin-protein ligase RNFT1 GN = RNFT1 Ub UBE2E2 ubiquitin-conjugating enzyme E2 E2 GN = UBE2E2 Ub RNF19A E3 ubiquitin-protein ligase RNF19A GN = RNF19A Ub USP38 ubiquitin carboxyl-terminal hydrolase 38 isoform 2 GN = USP38 Ub USP31 ubiquitin carboxyl-terminal hydrolase 31 GN = USP31 Ub SMURF2 E3 ubiquitin-protein ligase SMURF2 GN = SMURF2 Ub CHFR E3 ubiquitin-protein ligase CHFR isoform 1 GN = CHFR Ub FANCL E3 ubiquitin-protein ligase FANCL isoform 1 GN = FANCL Ub TRIM32 E3 ubiquitin-protein ligase TRIM32 GN = TRIM32 Ub BAP1 ubiquitin carboxyl-terminal hydrolase BAP1 GN = BAP1 Ub DTX2 probable E3 ubiquitin-protein ligase DTX2 isoform a GN = DTX2 Ub CYLD ubiquitin carboxyl-terminal hydrolase CYLD isoform 2 GN = CYLD Ub HACE1 E3 ubiquitin-protein ligase HACE1 isoform b GN = HACE1 Ub RNF169 E3 ubiquitin-protein ligase RNF169 GN = RNF169 Ub PDZRN3 E3 ubiquitin-protein ligase PDZRN3 isoform 2 GN = PDZRN3 Ub USP27X ubiquitin carboxyl-terminal hydrolase 27 GN = USP27X Ub ZNRF2 E3 ubiquitin-protein ligase ZNRF2 GN = ZNRF2 Ub USP42 ubiquitin carboxyl-terminal hydrolase 42 GN = USP42 Ub JADE2 E3 ubiquitin-protein ligase Jade-2 isoform 1 GN = JADE2 Ub NEDD4L E3 ubiquitin-protein ligase NEDD4-like isoform 1 GN = NEDD4L Ub TRIM37 E3 ubiquitin-protein ligase TRIM37 isoform a GN = TRIM37 Ub TOPORS E3 ubiquitin-protein ligase Topors isoform 1 GN = TOPORS Ub TRAF7 E3 ubiquitin-protein ligase TRAF7 GN = TRAF7 Ub RNF111 E3 ubiquitin-protein ligase Arkadia isoform 1 GN = RNF111 Ub RNF138 E3 ubiquitin-protein ligase RNF138 isoform 1 GN = RNF138 Ub TRIM13 E3 ubiquitin-protein ligase TRIM13 isoform 2 GN = TRIM13 Ub RNF26 E3 ubiquitin-protein ligase RNF26 GN = RNF26 Ub TRIM69 #N/A Ub USP4 ubiquitin carboxyl-terminal hydrolase 4 isoform a GN = USP4 Ub MARCH9 E3 ubiquitin-protein ligase MARCH9 precursor GN = MARCH9 Ub RLIM E3 ubiquitin-protein ligase RLIM GN = RLIM Ub UBR3 E3 ubiquitin-protein ligase UBR3 GN = UBR3 Ub SMURF1 E3 ubiquitin-protein ligase SMURF1 isoform 3 GN = SMURF1 Ub HERPUD1 homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein isoform 2 GN = HERPUD1 Ub SHPRH E3 ubiquitin-protein ligase SHPRH isoform a GN = SHPRH Ub MKRN1 E3 ubiquitin-protein ligase makorin-1 isoform 1 GN = MKRN1 Ub RBBP6 E3 ubiquitin-protein ligase RBBP6 isoform 1 GN = RBBP6 Ub RNF146 E3 ubiquitin-protein ligase RNF146 isoform a GN = RNF146 Ub DZIP3 E3 ubiquitin-protein ligase DZIP3 GN = DZIP3 Ub TRIM21 E3 ubiquitin-protein ligase TRIM21 GN = TRIM21 Ub UBE3D E3 ubiquitin-protein ligase E3D isoform 1 GN = UBE3D Ub HERC6 probable E3 ubiquitin-protein ligase HERC6 isoform 2 GN = HERC6 Ub RFWD3 E3 ubiquitin-protein ligase RFWD3 GN = RFWD3 Ub TRIM56 E3 ubiquitin-protein ligase TRIM56 GN = TRIM56 Ub RNF168 E3 ubiquitin-protein ligase RNF168 GN = RNF168 Ub USP8 ubiquitin carboxyl-terminal hydrolase 8 isoform a GN = USP8 Ub RNF216 E3 ubiquitin-protein ligase RNF216 isoform a GN = RNF216 Ub MIB1 E3 ubiquitin-protein ligase MIB1 GN = MIB1 Ub CBLB E3 ubiquitin-protein ligase CBL-B isoform a GN = CBLB Ub USP20 ubiquitin carboxyl-terminal hydrolase 20 GN = USP20 Ub AMFR E3 ubiquitin-protein ligase AMFR isoform c GN = AMFR Ub UBAP2L ubiquitin-associated protein 2-like isoform a GN = UBAP2L Ub RNF123 E3 ubiquitin-protein ligase RNF123 GN = RNF123 Ub RNF170 E3 ubiquitin-protein ligase RNF170 isoform a GN = RNF170 Ub USP16 ubiquitin carboxyl-terminal hydrolase 16 isoform b GN = USP16 Ub TTC3 E3 ubiquitin-protein ligase TTC3 isoform 3 GN = TTC3 Ub USP28 ubiquitin carboxyl-terminal hydrolase 28 isoform b GN = USP28 Ub RNF34 E3 ubiquitin-protein ligase RNF34 isoform 2 GN = RNF34 Ub RNF31 E3 ubiquitin-protein ligase RNF31 isoform 1 GN = RNF31 Ub RNF4 E3 ubiquitin-protein ligase RNF4 isoform 1 GN = RNF4 Ub MID2 probable E3 ubiquitin-protein ligase MID2 isoform 1 GN = MID2 Ub NEDD4 E3 ubiquitin-protein ligase NEDD4 isoform 1 GN = NEDD4 Ub PJA2 E3 ubiquitin-protein ligase Praja-2 GN = PJA2 Ub UBR1 E3 ubiquitin-protein ligase UBR1 GN = UBR1 Ub UBR2 E3 ubiquitin-protein ligase UBR2 isoform 3 GN = UBR2 Ub DESI2 deubiquitinase DESI2 isoform 1 GN = DESI2 Ub RNF220 E3 ubiquitin-protein ligase RNF220 isoform 1 GN = RNF220 Ub LNX1 E3 ubiquitin-protein ligase LNX isoform a GN = LNX1 Ub TRIM33 E3 ubiquitin-protein ligase TRIM33 isoform alpha GN = TRIM33 Ub ZRANB1 ubiquitin thioesterase ZRANB1 GN = ZRANB1 Ub RAD18 E3 ubiquitin-protein ligase RAD18 GN = RAD18 Ub TRIM38 E3 ubiquitin-protein ligase TRIM38 GN = TRIM38 Ub OTULINL inactive ubiquitin thioesterase FAM105A GN = OTULINL Ub UBE2J1 ubiquitin-conjugating enzyme E2 JI GN = UBE2J1 Ub RNF213 E3 ubiquitin-protein ligase RNF213 isoform 3 GN = RNF213 Ub RNF135 E3 ubiquitin-protein ligase RNF135 isoform 1 GN = RNF135 Ub MIB2 E3 ubiquitin-protein ligase MIB2 isoform 2 GN = MIB2 Ub USP1 ubiquitin carboxyl-terminal hydrolase 1 GN = USP1 Ub RNF149 E3 ubiquitin-protein ligase RNF149 precursor GN = RNF149 Ub RNF14 E3 ubiquitin-protein ligase RNF14 isoform 1 GN = RNF14 Ub MYSM1 histone H2A deubiquitinase MYSM1 GN = MYSM1 Ub CDC34 ubiquitin-conjugating enzyme E2 R1 GN = CDC34 Ub UNKL putative E3 ubiquitin-protein ligase UNKL isoform 1 GN = UNKL Ub UEVLD ubiquitin-conjugating enzyme E2 variant 3 isoform a GN = UEVLD Ub PJA1 E3 ubiquitin-protein ligase Praja-1 isoform b GN = PJA1 Ub USP40 ubiquitin carboxyl-terminal hydrolase 40 GN = USP40 Ub SIAH1 E3 ubiquitin-proteinligase SIAH1 isoform b GN = SIAH1 Ub HECW1 E3 ubiquitin-protein ligase HECW1 isoform b GN = HECW1 Ub TRIM22 E3 ubiquitin-protein ligase TRIM22 isoform 2 GN = TRIM22 Ub RNF126 E3 ubiquitin-protein ligase RNF126 GN = RNF126 Ub USP37 ubiquitin carboxyl-terminal hydrolase 37 GN = USP37 Ub ZNRF1 E3 ubiquitin-protein ligase ZNRF1 GN = ZNRF1 Ub RNF13 E3 ubiquitin-protein ligase RNF13 isoform 1 GN = RNF13 Ub TRIM63 E3 ubiquitin-protein ligase TRIM63 GN = TRIM63 Ub USP33 ubiquitin carboxyl-terminal hydrolase 33 isoform 1 GN = USP33 Ub HERC4 probable E3 ubiquitin-protein ligase HERC4 isoform c GN = HERC4 Ub USP11 ubiquitin carboxyl-terminal hydrolase 11 GN = USP11 Ub USP24 ubiquitin carboxyl-terminal hydrolase 24 GN = USP24 Ub TRIM4 E3 ubiquitin-protein ligase TRIM4 isoform alpha GN = TRIM4 Ub RNF41 E3 ubiquitin-protein ligase NRDP1 isoform 1 GN = RNF41 Ub RNF5 E3 ubiquitin-protein ligase RNF5 GN = RNF5 Ub YOD1 ubiquitin thioesterase OTU1 isoform 2 GN = YOD1 Ub MEX3C RNA-binding E3 ubiquitin-protein ligase MEX3C GN = MEX3C Ub LRSAM1 E3 ubiquitin-protein ligase LRSAM1 isoform 1 GN = LRSAM1 Ub USP19 ubiquitin carboxyl-terminal hydrolase 19 isoform 1 GN = USP19 Ub NEURL1B E3 ubiquitin-protein ligase NEURL1B isoform hNEUR2-deltaNHR1 GN = NEURL1B Ub USP22 ubiquitin carboxyl-terminal hydrolase 22 GN = USP22 Ub USP46 ubiquitin carboxyl-terminal hydrolase 46 isoform 2 GN = USP46 Ub TRIM68 E3 ubiquitin-protein ligase TRIM68 isoform 1 GN = TRIM68 Ub UBTD2 ubiquitin domain-containing protein 2 GN = UBTD2 Ub MINDY3 ubiquitin carboxyl-terminal hydrolase MINDY-3 isoform a GN = MINDY3 Ub UBAC1 ubiquitin-associated domain-containing protein 1 GN = UBAC1 Ub RNF25 E3 ubiquitin-protein ligase RNF25 GN = RNF25 Ub XIAP E3 ubiquitin-protein ligase XIAP GN = XIAP Ub ZFP91 E3 ubiquitin-protein ligase ZFP91 isoform 2 GN = ZFP91 Ub MUL1 mitochondrial ubiquitin ligase activator of NFKB 1 GN = MUL1 Ub TRIM9 E3 ubiquitin-protein ligase TRIM9 isoform 1 GN = TRIM9 Ub TRIM11 E3 ubiquitin-protein ligase TRIM11 GN = TRIM11 Ub UBE2E1 ubiquitin-conjugating enzyme E2 E1 isoform 3 GN = UBE2E1 Ub RNF187 E3 ubiquitin-protein ligase RNF187 GN = RNF187 Ub PELI2 E3 ubiquitin-protein ligase pellino homolog 2 GN = PELI2 Ub USP44 ubiquitin carboxyl-terminal hydrolase 44 GN = USP44 Ub CBLL1 E3 ubiquitin-protein ligase Hakai isoform 2 GN = CBLL1 Ub UHRF2 E3 ubiquitin-protein ligase UHRF2 GN = UHRF2 Ub RNF114 E3 ubiquitin-protein ligase RNF114 GN = RNF114 Ub RNF115 E3 ubiquitin-protein ligase RNF115 GN = RNF115 Ub SYVN1 E3 ubiquitin-protein ligase synoyiolin isoform a precursor GN = SYVN1 Ub USP3 ubiquitin carboxyl-terminal hydrolase 3 isoform 1 GN = USP3 Ub UBE4B ubiquitin conjugation factor E4 B isoform 1 GN = UBE4B Ub RNF130 E3 ubiquitin-protein ligase RNF130 isoform 2 precursor GN = RNF130 Ub USP12 ubiquitin carboxyl-terminal hydrolase 12 GN = USP12 Ub ARIH2 E3 ubiquitin-protein ligase ARIH2 isoform a GN = ARIH2 Ub MINDY4 probable ubiquitin carboxyl-terminal hydrolase MINDY-4 GN = MINDY4 Ub VCPIP1 deubiquitinating protein VCIP135 GN = VCPIP1 Ub ALG13 putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13 isoform 1 GN = ALG13 Ub MGRN1 E3 ubiquitin-protein ligase MGRN1 isoform 3 GN = MGRN1 Ub UBE4A ubiquitin conjugation factor E4 A isoform 2 GN = UBE4A Ub UBL5 ubiquitin-like protein 5 GN = UBL5 Ub ATG12 ubiquitin-like protein ATG12 isoform 1 GN = ATG12 Ub AREL1 apoptosis-resistant E3 ubiquitin protein ligase 1 GN = AREL1 Ub TRIML2 probable E3 ubiquitin-protein ligase TRIML2 isoform 1 GN = TRIML2 Ub TRIP12 E3 ubiquitin-protein ligase TRIP12 isoform a GN = TRIP12 Ub USP6 ubiquitin carboxyl-terminal hydrolase 6 GN = USP6 Ub MARCH6 E3 ubiquitin-protein ligase MARCH6 isoform 1 GN = MARCH6 Ub HECTD1 E3 ubiquitin-protein ligase HECTD1 GN = HECTD1 Ub TMUB2 transmembrane and ubiquitin-like domain-containing protein 2 isoform b GN = TMUB2 Ub USP13 ubiquitin carboxyl-terminal hydrolase 13 GN = USP13 Ub UBR5 E3 ubiquitin-protein ligase UBR5 isoform 2 GN = UBR5 Ub RBX1 E3 ubiquitin-protein ligase RBX1 GN = RBX1 Ub USP29 ubiquitin carboxyl-terminal hydrolase 29 GN = USP29 Ub LTN1 E3 ubiquitin-protein ligase listerin isoform 2 GN = LTN1 Ub HECW2 E3 ubiquitin-protein ligase HECW2 isoform 1 GN = HECW2 Ub KCMF1 E3 ubiquitin-protein ligase KCMF1 GN = KCMF1 Ub TRIM7 E3 ubiquitin-protein ligase TRIM7 isoform 1 GN = TRIM7 Ub TRIM50 E3 ubiquitin-protein ligase TRIM50 isoform b GN = TRIM50 Ub UBE2J2 ubiquitin-conjugating enzyme E2 J2 isoform 2 GN = UBE2J2 Ub DTX3 probable E3 ubiquitin-protein ligase DTX3 isoform b GN = DTX3 Ub ATG7 ubiquitin-like modifier-activating enzyme ATG7 isoform b GN = ATG7 Ub SIAH2 E3 ubiquitin-protein ligase SIAH2 GN = SIAH2 Ub UBL7 ubiquitin-like protein 7 isoform a GN = UBL7 Ub UBE2B ubiquitin-conjugating enzyme E2 B GN = UBE2B Ub BRCC3 lys-63-specific deubiquitinase BRCC36 isoform 2 GN = BRCC3 Ub HERPUD2 homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 2 protein GN = HERPUD2 Ub MID1 E3 ubiquitin-protein ligase Midline-1 isoform 1 GN = MID1 Ub USP47 ubiquitin carboxyl-terminal hydrolase 47 isoform a GN = USP47 Ub RNF8 E3 ubiquitin-protein ligase RNF8 isoform 1 GN = RNF8 Ub USP25 ubiquitin carboxyl-terminal hydrolase 25 isoform USP25m GN = USP25 Ub UBB polyubiquitin-B precursor GN = UBB Ub USP26 ubiquitin carboxyl-terminal hydrolase 26 GN = USP26 Ub CBL E3 ubiquitin-protein ligase CBL GN = CBL Ub UBE2Q1 ubiquitin-conjugating enzyme E2 Q1 GN = UBE2Q1 Ub RFFL E3 ubiquitin-protein ligase rififylin GN = RFFL Ub UBAP1 ubiquitin-associated protein 1 isoform 2 GN = UBAP1 Ub UBE2W ubiquitin-conjugating enzyme E2 W isoform 1 GN = UBE2W Ub OTUD6B deubiquitinase OTUD6B isoform 2 GN = OTUD6B Ub OTUB2 ubiquitin thioesterase OTUB2 GN = OTUB2 Ub UHRF1 E3 ubiquitin-protein ligase UHRF1 isoform 1 GN = UHRF1 Ub ZNF598 E3 ubiquitin-protein ligase ZNF598 GN = ZNF598 Ub ITCH E3 ubiquitin-protein ligase Itchy homolog isoform 1 GN = ITCH Ub ATG3 ubiquitin-like-conjugating enzyme ATG3 isoform 2 GN = ATG3 Ub UBE2Q2 ubiquitin-conjugating enzyme E2 Q2 isoform 3 GN = UBE2Q2 Ub UBE3C ubiquitin-protein ligase E3C GN = UBE3C Ub RING1 E3 ubiquitin-protein ligase RING1 GN = RING1 Ub USP48 ubiquitin carboxyl-terminal hydrolase 48 isoform f GN = USP48 Ub RNF167 E3 ubiquitin-protein ligase RNF167 isoform a precursor GN = RNF167 Ub RNF139 E3 ubiquitin-protein ligase RNF139 GN = RNF139 Ub UBAP2 ubiquitin-associated protein 2 isoform 1 GN = UBAP2 Ub RNF40 E3 ubiquitin-protein ligase BRE1B isoform 2 GN = RNF40 Ub UBL3 ubiquitin-like protein 3 precursor GN = UBL3 Ub MSL2 E3 ubiquitin-protein ligase MSL2 isoform 2 GN = MSL2 Ub HECTD3 E3 ubiquitin-protein ligase HECTD3 GN = HECTD3 Ub USP14 ubiquitin carboxyl-terminal hydrolase 14 isoform b GN = USP14 Ub MKRN2 probable E3 ubiquitin-protein ligase makorin-2 isoform 1 GN = MKRN2 Ub OTULIN ubiquitin thioesterase otulin GN = OTULIN Ub UBE2C ubiquitin-conjugating enzyme E2 C isoform 1 GN = UBE2C Ub TRIM23 E3 ubiquitin-protein ligase TRIM23 isoform alpha GN = TRIM23 Ub UBE2S ubiquitin-conjugating enzyme E2 S GN = UBE2S Ub RNF2 E3 ubiquitin-protein ligase RING2 GN = RNF2 Ub PELI1 E3 ubiquitin-protein ligase pellino homolog 1 GN = PELI1 Ub PPP1R11 E3 ubiquitin-protein ligase PPP1R11 GN = PPP1R11 Ub ZSWIM2 E3 ubiquitin-protein ligase ZSWIM2 GN = ZSWIM2 Ub UBR7 putative E3 ubiquitin-protein ligase UBR7 GN = UBR7 Ub UBTD1 ubiquitin domain-containing protein 1 GN = UBTD1 Ub TMUB1 transmembrane and ubiquitin-like domain-containing protein 1 GN = TMUB1 Ub RNF185 E3 ubiquitin-protein ligase RNF185 isoform 1 GN = RNF185 Ub UBAC2 ubiquitin-associated domain-containing protein 2 isoform 1 precursor GN = UBAC2 Ub UBA5 ubiquitin-like modifier-activating enzyme 5 isoform 2 GN = UBA5 Ub MARCH5 E3 ubiquitin-protein ligase MARCH5 GN = MARCH5 Ub UBE3A ubiquitin-protein ligase E3A isoform 2 GN = UBE3A Ub UBE2L6 ubiquitin/ISG15-conjugating enzyme E2 L6 isoform 1 GN = UBE2L6 Ub TRIM25 E3 ubiquitin/ISG15 ligase TRIM25 GN = TRIM25 Ub ARIH1 E3 ubiquitin-protein ligase ARIH1 GN = ARIH1 Ub UBASH3B ubiquitin-associated and SH3 domain-containing protein B isoform 1 GN = UBASH3B Ub UBR4 E3 ubiquitin-protein ligase UBR4 GN = UBR4 Ub RNF20 E3 ubiquitin-protein ligase BRE1A GN = RNF20 Ub USP10 ubiquitin carboxyl-terminal hydrolase 10 isoform 1 GN = USP10 Ub UBE2Z ubiquitin-conjugating enzyme E2 Z GN = UBE2Z Ub UBE2R2 ubiquitin-conjugating enzyme E2 R2 GN = UBE2R2 Ub RNF181 E3 ubiquitin-protein ligase RNF181 GN = RNF181 Ub UBE2D1 ubiquitin-conjugating enzyme E2 D1 isoform 2 GN = UBE2D1 Ub URM1 ubiquitin-related modifier 1 isoform b GN = URM1 Ub UBFD1 ubiquitin domain-containing protein UBFD1 GN = UBFD1 Ub MINDY4B inactive ubiquitin carboxyl-terminal hydrolase MINDY-4B GN = MINDY4B Ub UBE2G1 ubiquitin-conjugating enzyme E2 G1 GN = UBE2G1 Ub ADRM1 proteasomal ubiquitin receptor ADRM1 isoform 1 GN = ADRM1 Ub HUWE1 E3 ubiquitin-protein ligase HUWE1 GN = HUWE1 Ub UBLCP1 ubiquitin-like domain-containing CTD phosphatase 1 GN = UBLCP1 Ub USP15 ubiquitin carboxyl-terminal hydrolase 15 isoform 1 GN = USP15 Ub USP9X probable ubiquitin carboxyl-terminal hydrolase FAF-X isoform 3 GN = USP9X Ub UBE2A ubiquitin-conjugating enzyme E2 A isoform 4 GN = UBE2A Ub UBL4A ubiquitin-like protein 4A GN = UBL4A Ub UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 GN = UBE2V2 Ub UBE2O (E3-independent) E2 ubiquitin-conjugating enzyme GN = UBE2O Ub UBA6 ubiquitin-like modifier-activating enzyme 6 GN = UBA6 Ub UCHL3 ubiquitin carboxyl-terminal hydrolase isozyme L3 isoform 2 GN = UCHL3 Ub UBE2E3 ubiquitin-conjugating enzyme E2 E3 GN = UBE2E3 Ub USP7 ubiquitin carboxyl-terminal hydrolase 7 isoform 1 GN = USP7 Ub RNF6 E3 ubiquitin-protein ligase RNF6 isoform 1 GN = RNF6 Ub STUB1 E3 ubiquitin-protein ligase CHIP isoform a GN = STUB1 Ub UBE2H ubiquitin-conjugating enzyme E2 H isoform 1 GN = UBE2H Ub UFD1 ubiquitin recognition factor in ER-associated degradation protein 1 isoform A GN = UFD1 Ub UBE2T ubiquitin-conjugating enzyme E2 T isoform 1 GN = UBE2T Ub UCHL5 ubiquitin carboxyl-terminal hydrolase isozyme L5 isoform 6 GN = UCHL5 Ub UFC1 ubiquitin-fold modifier-conjugating enzyme 1 GN = UFC1 Ub UBE2G2 ubiquitin-conjugating enzyme E2 G2 isoform 1 GN = UBE2G2 Ub UFM1 ubiquitin-fold modifier 1 isoform 1 precursor GN = UFM1 Ub USP5 ubiquitin carboxyl-terminal hydrolase 5 isoform 1 GN = USP5 Ub ISG15 ubiquitin-like protein ISG15 GN = ISG15 Ub UBE2K ubiquitin-conjugating enzyme E2 K isoform 1 GN = UBE2K Ub OTUB1 ubiquitin thioesterase OTUB1 GN = OTUB1 Ub UBE2D2 ubiquitin-conjugating enzyme E2 D2 isoform 1 GN = UBE2D2 Ub UBE2D3 ubiquitin-conjugating enzyme E2 D3 isoform 1 GN = UBE2D3 Ub UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 isoform d GN = UBE2V1 Ub UBE2L3 ubiquitin-conjugating enzyme E2 L3 isoform 4 GN = UBE2L3 Ub UBA1 ubiquitin-like modifier-activating enzyme 1 GN = UBA1 Ub UBE2N ubiquitin-conjugating enzyme E2 N GN = UBE2N Ub UCHL1 ubiquitin carboxyl-terminal hydrolase isozyme L1 GN = UCHL1 Proteasome POMP proteasome maturation protein GN = POMP Proteasome PSMA4 proteasome subunit alpha type-4 isoform 1 GN = PSMA4 Proteasome PSME4 proteasome activator complex subunit 4 GN = PSME4 Proteasome PSMA1 proteasome subunit alpha type-1 isoform 2 GN = PSMA1 Proteasome PSMD13 26S proteasome non-ATPase regulatory subunit 13 isoform 1 GN = PSMD13 Proteasome PSMC6 26S proteasome regulatory subunit 10B GN = PSMC6 Proteasome PSMB6 proteasome subunit beta type-6 isoform 1 precursor GN = PSMB6 Proteasome PSMA5 proteasome subunit alpha type-5 isoform 1 GN = PSMA5 Proteasome PSMB3 proteasome subunit beta type-3 GN = PSMB3 Proteasome PSMA6 proteasome subunit alpha type-6 isoform a GN = PSMA6 Proteasome PSMB5 proteasome subunit beta type-5 isoform 3 GN = PSMB5 Proteasome PSMD12 26S proteasome non-ATPase regulatory subunit 12 isoform 1 GN = PSMD12 Proteasome PSMA3 proteasome subunit alpha type-3 isoform 1 GN = PSMA3 Proteasome PSMC5 26S proteasome regulatory subunit 8 isoform 2 GN = PSMC5 Proteasome PSMB1 proteasome subunit beta type-1 GN = PSMB1 Proteasome PSMC4 26S proteasome regulatory subunit 6B isoform 1 GN = PSMC4 Proteasome PSMG2 proteasome assembly chaperone 2 isoform 1 GN = PSMG2 Proteasome PSMD6 26S proteasome non-ATPase regulatory subunit 6 isoform 1 GN = PSMD6 Proteasome PSMD3 26S proteasome non-ATPase regulatory subunit 3 GN = PSMD3 Proteasome PSMD14 26S proteasome non-ATPase regulatory subunit 14 GN = PSMD14 Proteasome PSMD2 26S proteasome non-ATPase regulatory subunit 2 isoform 1 GN = PSMD2 Proteasome PSMD1 26S proteasome non-ATPase regulatory subunit 1 isoform 1 GN = PSMD1 Proteasome PSMC1 26S proteasome regulatory subunit 4 isoform a GN = PSMC1 Proteasome PSMF1 proteasome inhibitor PI31 subunit isoform 4 GN = PSMF1 Proteasome PSME3 proteasome activator complex subunit 3 isoform 1 GN = PSME3 Proteasome PSMG3 proteasome assembly chaperone 3 GN = PSMG3 Proteasome PSMG4 proteasome assembly chaperone 4 isoform b GN = PSMG4 Proteasome PSMD8 26S proteasome non-ATPase regulatory subunit 8 GN = PSMD8 Proteasome PSMD9 26S proteasome non-ATPase regulatory subunit 9 isoform 1 GN = PSMD9 Proteasome PSMA2 proteasome subunit alpha type-2 GN = PSMA2 Proteasome PSMD4 26S proteasome non-ATPase regulatory subunit 4 isoform 1 GN = PSMD4 Proteasome PSMD10 26S proteasome non-ATPase regulatory subunit 10 isoform 1 GN = PSMD10 Proteasome PSMC2 26S proteasome regulatory subunit 7 isoform 1 GN = PSMC2 Proteasome PSMB7 proteasome subunit beta type-7 precursor GN = PSMB7 Proteasome PSMB2 proteasome subunit beta type-2 isoform 1 GN = PSMB2 Proteasome PSMG1 proteasome assembly chaperone 1 isoform 3 GN = PSMG1 Proteasome PSMD7 26S proteasome non-ATPase regulatory subunit 7 GN = PSMD7 Proteasome PSME2 proteasome activator complex subunit 2 GN = PSME2 Proteasome PSMA7 proteasome subunit alpha type-7 GN = PSMA7 Proteasome PSMB4 proteasome subunit beta type-4 GN = PSMB4 Proteasome PSME1 proteasome activator complex subunit 1 isoform 1 GN = PSME1 Proteasome PSMB10 proteasome subunit beta type-10 precursor GN = PSMB10 Proteasome PSMC3 26S proteasome regulatory subunit 6A GN = PSMC3 Proteasome PSMB8 proteasome subunit beta type-8 isoform E1 precursor GN = PSMB8 Proteasome PSMD11 26S proteasome non-ATPase regulatory subunit 11 GN = PSMD11 Proteasome PSMD5 26S proteasome non-ATPase regulatory subunit 5 isoform 1 GN = PSMD5 Proteasome PSMB9 proteasome subunit beta type-9 precursor GN = PSMB9 Proteasome PSMA8 proteasome subunit alpha-type 8 isoform 2 GN = PSMA8 IFN ADAR adenosine deaminase, RNA-specific IFN CACTIN cactin, spliceosome C complex subunit IFN CDC37 cell division cycle 37 IFN CNOT7 CCR4-NOT transcription complex, subunit 7 IFN DCST1 DC-STAMP domain containing 1 IFN FADD Fas (TNFRSF6)-associated via death domain IFN GM45717 predicted gene 45717 IFN HSP84-2 heat shock protein, 2 IFN IFITM1 interferon induced transmembrane protein 1 IFN IFITM2 interferon induced transmembrane protein 2 IFN IFITM3 interferon induced transmembrane protein 3 IFN IFITM6 interferon induced transmembrane protein 6 IFN IFITM7 interferon induced transmembrane protein 7 IFN IFNA1 interferon alpha 1 IFN IFNAR1 interferon (alpha and beta) receptor 1 IFN IFNAR2 interferon (alpha and beta) receptor 2 IFN IFNB1 interferon beta 1, fibroblast IFN IKBKE inhibitor of kappaB kinase epsilon IFN IRAK1 interleukin-1 receptor-associated kinase 1 IFN IRF3 interferon regulatory factor 3 IFN IRF7 interferon regulatory factor 7 IFN LSM14A LSM14A mRNA processing body assembly factor IFN MAVS mitochondrial antiviral signaling protein IFN METTL3 methyltransferase like 3 IFN MMP12 matrix metallopeptidase 12 IFN MUL1 mitochondrial ubiquitin ligase activator of NFKB 1 IFN MYD88 myeloid differentiation primary response gene 88 IFN NLRC5 NLR family, CARD domain containing 5 IFN OAS2 2-5 oligoadenylate synthetase 2 IFN PTPN2 protein tyrosine phosphatase, non-receptor type 2 IFN SAMHD1 SAM domain and HD domain, 1 IFN STAT1 signal transducer and activator of transcription 1 IFN STAT2 signal transducer and activator of transcription 2 IFN TBK1 TANK-binding kinase 1 IFN TREX1 three prime repair exonuclease 1 IFN TRIM6 tripartite motif-containing 6 IFN TTLL12 tubulin tyrosine ligase-like family, member 12 IFN UBE2K ubiquitin-conjugating enzyme E2K IFN WNT5A wingless-type MMTV integration site family, member 5A IFN YTHDF2 YTH N6-methyladenosine RNA binding protein 2 IFN YTHDF3 YTH N6-methyladenosine RNA binding protein 3 IFN ZBP1 Z-DNA binding protein 1 IFN TYK2 non-receptor tyrosine-protein kinase TYK2 GN = TYK2 IFN JAK1 tyrosine-protein kinase JAK1 isoform 1 GN = JAK1 Ag processing POMP proteasome maturation protein GN = POMP Ag processing PSMA4 proteasome subunit alpha type-4 isoform 1 GN = PSMA4 Ag processing THBS1 thrombospondin-1 precursor GN = THBS1 Ag processing PSME4 proteasome activator complex subunit 4 GN = PSME4 Ag processing AP3B1 AP-3 complex subunit beta-1 isoform 2 GN = AP3B1 Ag processing AP3D1 AP-3 complex subunit delta-1 isoform 3 GN = AP3D1 Ag processing PSMA1 proteasome subunit alpha type-1 isoform 2 GN = PSMA1 Ag processing PSMD13 26S proteasome non-ATPase regulatory subunit 13 isoform 1 GN = PSMD13 Ag processing PSMC6 26S proteasome regulatory subunit 10B GN = PSMC6 Ag processing PSMB6 proteasome subunit beta type-6 isoform 1 precursor GN = PSMB6 Ag processing PSMA5 proteasome subunit alpha type-5 isoform 1 GN = PSMA5 Ag processing PSMB3 proteasome subunit beta type-3 GN = PSMB3 Ag processing PSMA6 proteasome subunit alpha type-6 isoform a GN = PSMA6 Ag processing PSMB5 proteasome subunit beta type-5 isoform 3 GN = PSMB5 Ag processing PSMD12 26S proteasome non-ATPase regulatory subunit 12 isoform 1 GN = PSMD12 Ag processing PSMA3 proteasome subunit alpha type-3 isoform 1 GN = PSMA3 Ag processing PSMC5 26S proteasome regulatory subunit 8 isoform 2 GN = PSMC5 Ag processing PSMB1 proteasome subunit beta type-1 GN = PSMB1 Ag processing PSMC4 26S proteasome regulatory subunit 6B isoform 1 GN = PSMC4 Ag processing RAB10 ras-related protein Rab-10 GN = RAB10 Ag processing TRAF6 TNF receptor-associated factor 6 GN = TRAF6 Ag processing PSMG2 proteasome assembly chaperone 2 isoform 1 GN = PSMG2 Ag processing YTHDF1 YTH domain-containing family protein 1 GN = YTHDF1 Ag processing ATG5 autophagy protein 5 isoform a GN = ATG5 Ag processing PSMD6 26S proteasome non-ATPase regulatory subunit 6 isoform 1 GN = PSMD6 Ag processing PSMD3 26S proteasome non-ATPase regulatory subunit 3 GN = PSMD3 Ag processing PSMD14 26S proteasome non-ATPase regulatory subunit 14 GN = PSMD14 Ag processing PSMD2 26S proteasome non-ATPase regulatory subunit 2 isoform 1 GN = PSMD2 Ag processing PSMD1 26S proteasome non-ATPase regulatory subunit 1 isoform 1 GN = PSMD1 Ag processing BAG6 large proline-rich protein BAG6 isoform b GN = BAG6 Ag processing PSMC1 26S proteasome regulatory subunit 4 isoform a GN = PSMC1 Ag processing PSMF1 proteasome inhibitor PI31 subunit isoform 4 GN = PSMF1 Ag processing RAB8B ras-related protein Rab-8B GN = RAB8B Ag processing IDE insulin-degrading enzyme isoform 3 GN = IDE Ag processing PSME3 proteasome activator complex subunit 3 isoform 1 GN = PSME3 Ag processing B2M beta-2-microglobulin precursor GN = B2M Ag processing PSMG3 proteasome assembly chaperone 3 GN = PSMG3 Ag processing RAB35 ras-related protein Rab-35 isoform 2 GN = RAB35 Ag processing PSMG4 proteasome assembly chaperone 4 isoform b GN = PSMG4 Ag processing WASHC1 WASH complex subunit 1 GN = WASHC1 Ag processing IFI30 gamma-interferon-inducible lysosomal thiol reductase preproprotein GN = IFI30 Ag processing RAB27A ras-related protein Rab-27A GN = RAB27A Ag processing TREX1 three-prime repair exonuclease 1 isoform c GN = TREX1 Ag processing FLT3 receptor-type tyrosine-protein kinase FLT3 precursor GN = FLT3 Ag processing WDFY4 WD repeat- and FYVE domain-containing protein 4 GN = WDFY4 Ag processing MFSD6 major facilitator superfamily domain-containing protein 6 GN = MFSD6 Ag processing PSMD8 26S proteasome non-ATPase regulatory subunit 8 GN = PSMD8 Ag processing PSMD9 26S proteasome non-ATPase regulatory subunit 9 isoform 1 GN = PSMD9 Ag processing PSMA2 proteasome subunit alpha type-2 GN = PSMA2 Ag processing RAB5B ras-related protein Rab-5B isoform 1 GN = RAB5B Ag processing RAB6A ras-related protein Rab-6A isoform b GN = RAB6A Ag processing CALR calreticulin precursor GN = CALR Ag processing RAB4A ras-related protein Rab-4A isoform 1 GN = RAB4A Ag processing GBA glucosylceramidase isoform 1 precursor GN = GBA Ag processing PSMD4 26S proteasome non-ATPase regulatory subunit 4 isoform 1 GN = PSMD4 Ag processing CTSL cathepsin L1 isoform 1 preproprotein GN = CTSL Ag processing PSMD10 26S proteasome non-ATPase regulatory subunit 10 isoform 1 GN = PSMD10 Ag processing RAB34 ras-related protein Rab-34 isoform 5 GN = RAB34 Ag processing PIKFYVE 1-phosphatidylinositol 3-phosphate 5-kinase isoform 2 GN = PIKFYVE Ag processing PSMC2 26S proteasome regulatory subunit 7 isoform 1 GN = PSMC2 Ag processing PSMB7 proteasome subunit beta type-7 precursor GN = PSMB7 Ag processing PSMB2 proteasome subunit beta type-2 isoform 1 GN = PSMB2 Ag processing HFE hereditary hemochromatosis protein isoform 1 precursor GN = HFE Ag processing PSAP prosaposin isoform b preproprotein GN = PSAP Ag processing PSMG1 proteasome assembly chaperone 1 isoform 3 GN = PSMG1 Ag processing PSMD7 26S proteasome non-ATPase regulatory subunit 7 GN = PSMD7 Ag processing PSME2 proteasome activator complex subunit 2 GN = PSME2 Ag processing RAB32 ras-related protein Rab-32 GN = RAB32 Ag processing RELB transcription factor RelB GN = RELB Ag processing PSMA7 proteasome subunit alpha type-7 GN = PSMA7 Ag processing PSMB4 proteasome subunit beta type-4 GN = PSMB4 Ag processing UNC93B1 protein unc-93 homolog B1 GN = UNC93B1 Ag processing ERAP1 endoplasmic reticulum aminopeptidase 1 isoform b precursor GN = ERAP1 Ag processing RFTN1 raftlin GN = RFTN1 Ag processing TAP2 antigen peptide transporter 2 isoform 1 GN = TAP2 Ag processing PSME1 proteasome activator complex subunit 1 isoform 1 GN = PSME1 Ag processing RAB3B ras-related protein Rab-3B GN = RAB3B Ag processing PSMB10 proteasome subunit beta type-10 precursor GN = PSMB10 Ag processing PSMC3 26S proteasome regulatory subunit 6A GN = PSMC3 Ag processing PSMB8 proteasome subunit beta type-8 isoform E1 precursor GN = PSMB8 Ag processing TAPBP tapasin isoform 1 precursor GN = TAPBP Ag processing ICAM1 intercellular adhesion molecule 1 precursor GN = ICAM1 Ag processing PSMD11 26S proteasome non-ATPase regulatory subunit 11 GN = PSMD11 Ag processing PSMD5 26S proteasome non-ATPase regulatory subunit 5 isoform 1 GN = PSMD5 Ag processing PYCARD apoptosis-associated speck-like protein containing a CARD isoform b GN = PYCARD Ag processing PSMB9 proteasome subunit beta type-9 precursor GN = PSMB9 Ag processing CD68 macrosialin isoform B precursor GN = CD68 Ag processing PSMA8 proteasome subunit alpha-type 8 isoform 2 GN = PSMA8 Ag processing EXT1 exostosin-1 GN = EXT1 Ag processing PTPN22 tyrosine-protein phosphatase non-receptor type 22 isoform 3 GN = PTPN22 Ag processing TAP1 antigen peptide transporter 1 isoform 1 GN = TAP1
(413) TABLE-US-00009 TABLE 6B Contains all proteins that are statistically enriched or depleted in response to SARS-CoV-2 infection in HEK293T and A549 cells. Gene SARS_A549_24 idx Symbol pathway proteinName A549_FX HEK_FX hr_FX 3 ORF9b SARS ORF9b 4.28 4.28 9.5643 9 ORF7a SARS ORF7a 4.28 4.28 8.7613 1 N SARS N 4.28 4.28 10.6838 12 nsp3 SARS nsp3 4.28 4.28 8.3431 5 S SARS S 4.28 4.28 9.0701 19 nsp6 SARS nsp6 4.28 4.28 7.2054 13 nsp10 SARS nsp10 4.28 4.28 8.4466 7 nsp8 SARS nsp8 4.28 4.28 8.9184 6 ORF3a SARS ORF3a 4.28 4.28 8.8004 2 M SARS M 4.28 4.28 9.6832 10 nsp2 SARS nsp2 4.28 4.28 8.5059 18 TMED7- NA NA 5.16 5.16 8.54542 TICAM2 14 nsp4 SARS nsp4 4.28 4.28 8.1335 4 nsp5 SARS nsp5 4.28 4.28 10.0264 8 nsp1 SARS nsp1 4.28 4.28 9.1659 54 GIMAP7 NA NA 5.16 5.16 7.62864 17 nsp15 SARS nsp15 4.28 4.28 7.1958 11 nsp9 SARS nsp9 4.28 4.28 8.5188 20 nsp13 SARS nsp13 4.28 4.28 7.1948 93 NUDT8 NA NA 5.16 5.16 7.16627 40 nsp14 SARS nsp14 4.28 4.28 6.7825 33 GANAB NA NA 6.40767 7.38633 9.34854 63 SH3RF2 NA NA 5.16 5.16 7.92254 16 nsp12 SARS nsp12 4.28 4.28 7.5873 78 MGAT5B NA NA 7.519 7.05306 5.16 87 SVIP NA NA 6.74615 7.59067 5.16 26 MVB12B NA NA 5.75177 5.16 8.84397 35 SLC25A46 NA NA 7.55481 8.19694 5.16 138 XYLB NA NA 6.87526 6.62833 5.16 105 EBNA1BP2 NA NA 6.12302 6.27173 8.07528 141 YAE1 NA NA 6.76423 6.64661 5.16 131 UBE2F NA NA 6.74764 6.88127 5.16 30 ING2 NA NA 7.5142 8.33903 5.16 142 MUL1 Ub, IFN mitochondrial 6.71511 6.69387 5.16 ubiquitin ligase activator of NFKB 1 GN = MUL1 43 EIF2B4 NA NA 6.01614 5.10804 7.95948 102 EXT2 NA NA 6.97758 7.4194 5.16 23 MAD2L1BP NA NA 8.54711 7.93329 5.16 107 KATNB1 NA NA 6.94954 7.11242 5.16 21 ZWINT NA NA 8.29518 8.44072 5.16 127 NEU1 NA NA 6.84234 6.87992 5.16 135 TCF12 NA NA 6.9272 6.65123 5.16 146 C16orf70 NA NA 6.80018 6.72174 5.29567 100 AVL9 NA NA 7.43897 6.94893 5.16 36 SPTAN1 NA NA 5.65059 5.77428 8.24482 66 C14orf119 NA NA 7.07427 7.81061 5.16 104 WDR62 NA NA 7.08504 7.04618 5.41753 68 RTL8C NA NA 7.48605 7.31528 5.16 44 GPN3 NA NA 8.4572 7.98076 5.16 133 PEX1 NA NA 6.95938 6.63995 5.14707 32 TMBIM6 NA NA 7.81904 7.96583 5.16 97 HUS1 NA NA 7.37247 6.84606 5.16 74 AMD1 NA NA 7.30171 7.34951 5.16 108 PTOV1 NA NA 7.14977 6.9081 5.16 42 CCDC91 NA NA 7.89089 7.62144 5.16 122 C3orf38 NA NA 7.0453 6.74119 5.16 76 PTPRF NA NA 7.41808 7.0392 4.98268 95 TYK2 IFN non-receptor 7.09359 7.14549 5.16 tyrosine- protein kinase TYK2 GN = TYK2 124 ARMC9 NA NA 7.258 6.83061 5.46937 51 FIG. 4 NA NA 7.56528 7.58935 5.16 77 KLHL11 NA NA 7.05323 7.53313 5.16 58 ZBTB8OS NA NA 7.39991 7.65077 5.16 121 KLHL22 NA NA 6.93243 6.87114 5.16 113 TAB2 NA NA 6.71441 7.22894 5.16 116 LONP2 NA NA 7.12323 6.78131 5.16 119 UBXN8 NA NA 6.8597 6.98755 5.16 86 BRD9 NA NA 7.11857 7.25535 5.16 34 MACO1 NA NA 7.54435 8.30111 5.12563 31 FTL NA NA 8.82175 8.35704 6.5396 114 URGCP NA NA 7.31647 7.19259 5.70264 92 VPS37C NA NA 7.33683 6.9488 5.16 111 SETBP1 NA NA 5.1801 5.01025 7.19503 136 RAD51AP1 NA NA 6.75252 6.81837 5.16 139 KIAA0355 NA NA 6.74581 6.75013 5.16 123 HMG20B NA NA 7.04417 6.73725 5.16 46 SDHC NA NA 8.37315 7.41094 5.16 137 FOPNL NA NA 6.91681 6.63052 5.16 45 MED29 NA NA 7.76151 7.94996 5.16 83 TIMM17A NA NA 7.76757 7.34974 5.86391 70 RIOK2 NA NA 7.50851 7.72971 5.64839 27 DMAC1 NA NA 8.54856 7.64707 5.16 60 CENPK NA NA 7.5826 7.44812 5.16 144 TRAPPC6A NA NA 6.61008 6.75869 5.16 59 CDC42EP1 NA NA 7.0509 7.9949 5.16 98 SFR1 NA NA 7.20178 7.01025 5.16 89 FIGNL1 NA NA 7.22883 7.0968 5.16 69 DVL3 NA NA 7.77744 6.97683 5.16 38 RRAGA NA NA 7.75504 7.90821 5.16 57 GNL3L NA NA 7.20961 7.8753 5.16 52 UBE2B Ub ubiquitin- 7.42988 7.70339 5.16 conjugating enzyme E2 B GN = UBE2B 49 PIAS4 NA NA 7.4824 7.74274 5.16 29 CRCP NA NA 7.94801 7.90778 5.16 67 LIN9 NA NA 7.13339 7.89814 5.16 64 BOLA1 NA NA 6.99592 7.9552 5.16 120 MLF2 NA NA 8.10982 8.3972 6.65391 25 RNF181 Ub E3 ubiquitin- 8.0121 8.40212 5.16 protein ligase RNF181 GN = RNF181 61 IQGAP3 NA NA 7.97856 7.39418 5.54585 28 CUEDC2 NA NA 7.41344 8.56386 5.16 39 ETNK1 NA NA 7.64392 7.9914 5.16 115 C6orf106 NA NA 6.7847 7.16608 5.16 53 CEP170 NA NA 4.92607 5.76297 8.05556 65 AURKA NA NA 7.32702 7.57264 5.16 84 CALCOCO2 NA NA 7.67372 7.62207 5.16 130 EEF2K NA NA 6.9691 6.66576 5.16 47 ITM2B NA NA 7.30316 8.02715 5.16 125 UBL5 Ub ubiquitin- 8.78481 8.85015 6.93942 like protein 5 GN = UBL5 109 TRIM11 Ub E3 ubiquitin- 6.74419 7.29307 5.16 protein ligase TRIM11 GN = TRIM11 132 TADA1 NA NA 6.76131 6.85322 5.16 112 NEK3 NA NA 7.29447 6.70288 5.16 90 IFT74 NA NA 8.31087 7.68155 6.00069 99 KCTD10 NA NA 7.32018 6.86261 5.16 110 LAPTM4A NA NA 7.13413 6.88988 5.16 55 MID1IP1 NA NA 7.78343 7.9223 5.76805 101 TOP3B NA NA 7.14499 6.75397 4.93357 41 CDC20 NA NA 7.76224 7.77715 5.16 106 GRN NA NA 7.17075 6.9081 5.16 73 IMPA2 NA NA 7.74867 6.96118 5.16 24 YPEL5 NA NA 7.78453 8.64819 5.16 118 CENPF NA NA 6.69278 7.17093 5.16 79 TLE1 NA NA 7.44871 6.93207 5.04912 50 RPAIN NA NA 8.18159 7.02867 5.16 140 CCNL1 NA NA 6.89724 6.89486 5.45966 145 POMP Proteasome, proteasome 8.16835 8.31727 6.76333 Ag maturation processing protein GN = POMP 85 CD99L2 NA NA 8.04581 7.29337 5.86984 94 GMEB1 NA NA 6.98918 7.60008 5.30172 128 RPS6KA5 NA NA 7.1207 7.08826 5.16 71 CDCA3 NA NA 7.66563 7.08352 5.16 96 SYNRG NA NA 7.45806 7.72754 5.58526 129 MYO19 NA NA 7.17972 6.73838 5.16 62 RXRA NA NA 7.23969 7.72759 5.16 117 IFNGR1 NA NA 7.12329 6.93428 5.16 82 SLBP NA NA 6.93503 7.49038 5.16 126 RNF31 Ub E3 ubiquitin- 6.98847 6.77776 5.16 protein ligase RNF31 isoform 1 GN = RNF31 81 TEX30 NA NA 6.82746 7.61317 5.16 72 MAPK7 NA NA 7.85756 6.88112 5.16 56 ZNHIT3 NA NA 7.30996 7.77534 5.16 103 UBN2 NA NA 6.93992 6.61416 5.16 91 KIF20A NA NA 6.86353 7.43857 5.16 22 MRFAP1 NA NA 8.05253 8.67615 5.16 48 SLC7A6OS NA NA 7.17862 8.06937 5.16 143 C1orf112 NA NA 6.69761 6.67634 5.16 37 C12orf73 NA NA 7.60597 8.0614 5.16 75 TTC33 NA NA 6.87851 7.7657 5.16 134 PNPLA2 NA NA 6.72195 6.86733 5.16 80 PLIN2 NA NA 7.11868 7.3591 5.16 88 TMEM259 NA NA 7.33459 6.99736 5.16 15 ORF6 SARS ORF6 4.28 4.28 8.4021 SARS_HEK_24 SARS_A549_3 SARS_A549_6 SARS_HEK_3 idx hr_FX hr_FX hr_FX hr_FX 3 9.974 7.7619 9.7518 8.2347 9 9.3614 7.8576 9.026 8.21 1 11.0857 8.4207 10.1475 8.5226 12 8.9745 6.5329 8.2957 6.6888 5 9.8182 7.132 8.9502 7.8297 19 7.9413 4.28 7.9956 4.28 13 8.8422 4.28 8.0162 4.28 7 9.5997 4.28 8.3172 4.28 6 9.8546 4.28 8.9582 7.0803 2 10.1197 8.0095 9.5256 8.2954 10 9.3273 6.2344 8.5069 7.1763 18 8.41237 8.4908 8.46291 8.01737 14 8.7269 4.28 7.871 4.28 4 9.1273 4.28 8.1879 4.28 8 9.0199 7.9017 8.7855 7.974 54 7.4872 7.8167 8.05416 7.86664 17 8.069 4.28 6.9448 4.28 11 9.044 4.28 8.3779 4.28 20 7.7905 4.28 7.0469 4.28 93 7.10296 6.46379 6.67147 6.84178 40 7.0481 4.28 7.4141 4.28 33 9.89027 9.29014 9.28527 5.07174 63 7.03238 6.6657 7.04541 6.28304 16 8.0576 4.28 7.2983 4.28 78 5.16 5.75431 5.52849 5.86011 87 5.16 8.55887 8.77036 8.73779 26 8.06909 7.11249 6.72851 7.01864 35 5.16 7.18105 6.77896 5.44795 138 5.16 7.82298 7.51855 7.78536 105 8.09854 8.09173 6.96962 7.23812 141 5.16 7.24663 7.79748 7.034 131 5.16 6.37219 7.49327 7.4547 30 5.16 8.19978 6.66523 6.96095 142 5.16 7.25154 7.643 7.49712 43 8.25074 6.54145 6.61855 6.53524 102 5.43347 6.74931 8.74039 7.81074 23 5.16 7.08912 6.70975 7.78395 107 5.16 6.84901 7.78051 7.61291 21 5.16 7.84206 7.71975 8.33723 127 5.16 7.16292 7.35769 7.12794 135 5.16 7.68537 7.51116 6.99238 146 5.26189 7.35785 7.73712 7.77801 100 5.41852 7.93224 8.07353 8.49115 36 8.56811 8.30083 8.28258 6.75884 66 5.16 7.52051 8.38432 7.14093 104 4.92771 7.38777 7.59556 7.49095 68 5.16 7.72375 7.96595 7.49081 44 6.23405 7.75491 7.54675 7.76987 133 5.16 6.9799 7.36114 7.55908 32 5.16 7.72375 7.26867 7.88457 97 5.16 7.28291 7.81611 7.78092 74 5.16 7.77604 7.65638 7.15227 108 5.16 7.41427 7.4156 7.33241 42 5.16 7.52105 7.49415 7.07952 122 5.16 7.24292 7.14754 7.27069 76 5.16 7.15747 7.58327 7.48285 95 5.16 7.11834 6.94201 7.13422 124 5.16 7.39864 7.72342 7.9135 51 5.16 7.29575 7.40309 7.41812 77 5.16 7.47717 7.87891 7.42077 58 5.16 6.22643 7.90247 7.69377 121 5.16 7.08985 7.13418 7.38691 113 5.11472 7.24663 7.32736 7.65838 116 5.16 7.15767 7.77896 7.44783 119 5.16 6.77148 7.22265 7.38298 86 5.16 6.41609 6.55887 7.34178 34 5.28537 7.1419 7.78259 7.03052 31 5.16 8.52746 8.49736 8.28325 114 5.16 7.62706 7.52034 7.71466 92 5.16 8.41776 7.47365 7.98381 111 6.68234 6.28163 5.16 5.33824 136 5.16 6.2438 6.7662 7.96705 139 5.16 7.2596 7.22118 7.40605 123 5.16 6.68525 6.36561 7.34591 46 5.6117 8.21331 8.25432 8.26587 137 5.16 7.06307 7.22605 6.88167 45 5.51835 8.11134 8.11424 8.19285 83 5.16 8.17914 7.93139 8.03134 70 5.16 8.5916 7.96872 7.78793 27 5.16 8.34773 8.7192 8.01276 60 5.16 5.80503 6.57427 7.04488 144 5.16 6.90607 8.17405 7.8821 59 5.16 7.42518 7.8373 8.08735 98 5.16 7.37988 7.43059 7.45117 89 5.16 6.88263 7.35313 7.60983 69 5.16 6.72812 7.00081 7.03179 38 5.16 8.01037 7.87126 8.33111 57 5.16 8.38355 7.79629 7.82204 52 5.16 6.97388 7.77151 7.14093 49 5.16 6.46118 6.38976 7.35863 29 5.16 7.64981 7.47698 8.08195 67 5.35157 7.01174 6.4358 8.38263 64 5.16 7.48725 7.99517 8.15259 120 6.36538 8.14725 8.05666 8.70237 25 5.16 8.15034 7.76963 8.25805 61 5.16 8.01736 7.79253 7.0528 28 5.16 7.70835 7.24554 8.35019 39 5.16 7.90929 7.77544 7.97743 115 5.16 6.51208 5.99221 6.99924 53 7.43861 4.7726 5.99071 8.14707 65 5.16 7.82004 7.489 7.69515 84 6.04521 7.77927 8.3382 8.03017 130 5.16 6.9456 7.54435 6.95225 47 5.16 7.6524 7.38865 7.34836 125 7.23961 8.49527 8.55569 8.82196 109 5.16 8.16366 6.90278 7.77713 132 5.16 6.65891 6.78995 9.93266 112 5.16 6.99427 6.45317 7.23296 90 6.00061 8.02551 8.00924 8.3038 99 5.16 7.29115 7.67027 7.51277 110 5.16 7.53333 7.1401 7.20661 55 5.16 7.93359 8.12318 8.22865 101 5.16 7.79708 8.03998 7.23446 41 5.16 7.72187 7.86533 7.74447 106 5.16 7.19323 7.54099 7.71434 73 5.16 7.51862 7.2699 6.60568 24 5.16 7.92457 7.93113 7.84238 118 5.16 6.57522 6.51365 7.82379 79 5.16 7.59103 7.57903 7.65298 50 5.16 7.68954 7.50168 7.47768 140 5.16 7.73672 6.97206 7.80098 145 6.68661 8.33825 8.24425 8.33503 85 5.37899 7.70355 7.53695 7.92961 94 5.3431 7.73351 7.13209 8.1745 128 5.66016 5.16 6.20969 7.4791 71 5.16 7.49018 7.00924 7.66809 96 5.69696 7.59423 7.81276 7.16194 129 5.38122 8.10697 7.90176 7.1399 62 5.16 8.18831 8.07815 8.15881 117 5.33836 6.88193 6.73345 7.05199 82 5.16 7.66857 7.31854 8.08294 126 5.16 7.52182 7.29324 6.61604 81 5.16 6.66657 7.07235 7.7925 72 5.16 7.4676 7.38458 7.65686 56 5.16 7.16216 7.52061 7.39339 103 4.59498 6.80099 6.4046 7.23625 91 5.16 6.87794 6.91559 7.63308 22 5.16 7.87641 8.00521 8.23033 48 5.16 7.19145 7.20439 8.14093 143 5.16 7.29632 6.2582 7.47493 37 5.16 7.61178 7.81828 7.61285 75 5.16 7.13466 7.22773 8.15115 134 5.16 7.33173 7.44523 7.054 80 5.16 8.05181 8.07823 7.26142 88 5.16 7.66685 7.05429 7.2248 15 8.3568 4.28 4.28 4.28 idx SARS_HEK_6 hr_FX mean_diff_0_24 pval_0_24 pval_0_3 pval_0_6 A549_0_24_diff 3 9.6775 5.48915 0.00039 0.00099 1.84E05 5.2843 9 8.9534 4.78135 0.00134 0.0005 2.61E05 4.4813 1 10.0138 6.60475 0.00024 0.000057 0.000028 6.4038 12 8.3519 4.3788 0.00187 0.0004 3.38E05 4.0631 5 8.8341 5.16415 0.00188 0.00367 4.18E05 4.7901 19 7.9345 3.29335 0.00529 1 4.44E05 2.9254 13 8.1218 4.3644 0.00062 1 6.21E05 4.1666 7 8.1666 4.97905 0.00164 1 8.71E05 4.6384 6 9.1856 5.0475 0.0045 0.34962 0.00011 4.5204 2 9.2693 5.62145 0.00042 2.98E04 1.17E04 5.4032 10 8.2433 4.6366 0.00305 0.01516 0.00022 4.2259 18 8.24881 3.31889 0.00047 0.00052 0.00026 3.38542 14 8.1342 4.1502 0.00183 1 0.00028 3.8535 4 7.89 5.29685 0.00275 1 0.00035 5.7464 8 8.3846 4.8129 4.76E05 6.60E05 0.00049 4.8859 54 7.54605 2.39792 0.00169 0.00039 0.00108 2.46864 17 6.5905 3.3524 0.00759 1 0.00148 2.9158 11 7.7798 4.5014 0.00113 1 0.00173 4.2388 20 6.5635 3.21265 0.00341 1 0.00292 2.9148 93 7.00709 1.97462 0.00344 0.00568 0.0035 2.00627 40 6.7485 2.6353 0.00081 1 0.00483 2.5025 33 9.29154 2.72241 0.00536 0.86669 0.00561 2.94087 63 6.47133 2.31746 0.00621 0.00889 0.00769 2.76254 16 6.5321 3.54245 0.00154 1 0.0079 3.3073 78 5.98703 2.12603 0.00391 0.00755 0.01105 2.359 87 8.62251 2.00841 0.00953 0.0203 0.01851 1.58615 26 6.54647 3.00065 0.0028 0.0078 0.02316 3.09221 35 6.3287 2.71587 0.00211 0.09464 0.02445 2.39481 138 7.65708 1.5918 0.00854 0.01411 0.03147 1.71526 105 7.67799 1.88953 0.00422 0.021 0.03438 1.95226 141 9.19319 1.54542 0.00866 0.1536 0.03507 1.60423 131 7.65633 1.65446 0.00683 0.83916 0.03713 1.58764 30 6.84333 2.76661 0.00281 0.58691 0.04011 2.3542 142 7.28888 1.54449 0.00845 0.05502 0.04706 1.55511 43 6.91204 2.54302 0.00499 0.07409 0.04707 1.94334 102 7.95033 1.90175 0.00645 0.87224 0.04864 1.81758 23 7.45019 3.0802 0.00122 0.12191 0.05285 3.38711 107 7.62128 1.87098 0.00442 0.61255 0.05435 1.78954 21 7.72843 3.20795 0.00054 0.40121 0.05501 3.13518 127 7.69714 1.70113 0.00596 0.28561 0.06599 1.68234 135 7.35687 1.62921 0.00809 0.19814 0.06886 1.7672 146 7.1552 1.48218 0.00992 0.04545 0.09728 1.50451 100 7.70156 1.90469 0.0068 0.04726 0.09961 2.27897 36 6.3439 2.69402 0.00132 0.04198 0.10056 2.59423 66 8.07913 2.28244 0.00487 0.78222 0.10283 1.91427 104 7.50885 1.89299 0.00627 0.18567 0.10725 1.66751 68 7.83048 2.24067 0.00224 0.45905 0.113 2.32605 44 7.7319 2.52195 0.00789 0.18913 0.12439 3.2972 133 7.25595 1.64613 0.00818 0.23163 0.12522 1.81231 32 7.52662 2.73244 0.00102 0.73424 0.12604 2.65904 97 7.602 1.94927 0.00596 0.29377 0.12728 2.21247 74 7.92551 2.16561 0.00241 0.68971 0.13952 2.14171 108 7.56441 1.86893 0.00473 0.23786 0.14406 1.98977 42 6.69104 2.59616 0.00139 0.20071 0.1623 2.73089 122 7.66878 1.73324 0.00667 0.22839 0.18327 1.8853 76 7.76926 2.1573 0.00344 0.76974 0.18335 2.43541 95 5.47957 1.95954 0.00353 0.97804 0.19492 1.93359 124 7.33596 1.72962 0.0092 0.14316 0.19653 1.78863 51 6.57176 2.41732 0.00157 0.39992 0.19819 2.40528 77 7.613 2.13318 0.00395 0.6181 0.21366 1.89323 58 7.88101 2.36534 0.00195 0.39078 0.21518 2.23991 121 7.39037 1.74179 0.00549 0.2579 0.22366 1.77243 113 7.46763 1.83432 0.00732 0.22212 0.23221 1.55441 116 7.1176 1.79227 0.00617 0.28204 0.23756 1.96323 119 7.27895 1.76363 0.00539 0.65864 0.23915 1.6997 86 7.02317 2.02696 0.00322 0.49436 0.24559 1.95857 34 6.3686 2.71723 0.00272 0.08311 0.25054 2.41872 31 7.31638 2.73959 0.00973 0.57056 0.25866 2.28215 114 7.60961 1.82321 0.00799 0.15445 0.26156 1.61384 92 7.51802 1.98281 0.00452 0.02911 0.26361 2.17683 111 6.08023 1.84351 0.00747 0.1635 0.27263 2.01493 136 8.64234 1.62544 0.00708 0.65618 0.27361 1.59252 139 6.92019 1.58797 0.00764 0.07011 0.27576 1.58581 123 6.69987 1.73071 0.00672 0.73915 0.27665 1.88417 46 8.6353 2.5062 0.00652 0.45315 0.28061 3.21315 137 6.98696 1.61367 0.00846 0.48804 0.28244 1.75681 45 8.19115 2.51656 0.00187 0.2878 0.28809 2.60151 83 7.82481 2.0467 0.00849 0.12503 0.31679 1.90366 70 7.83872 2.21492 0.00377 0.20903 0.31696 1.86012 27 8.42544 2.93782 0.00261 0.85304 0.31809 3.38856 60 7.51657 2.35536 0.00181 0.10035 0.32329 2.4226 144 6.59721 1.52438 0.00925 0.17262 0.32346 1.45008 59 8.12815 2.3629 0.00642 0.65036 0.34351 1.8909 98 7.30478 1.94601 0.00389 0.26992 0.34633 2.04178 89 7.46963 2.00282 0.00336 0.82464 0.35779 2.06883 69 6.98042 2.21713 0.00614 0.26888 0.35809 2.61744 38 8.42111 2.67162 0.00112 0.26843 0.36881 2.59504 57 7.95308 2.38246 0.00363 0.22635 0.38367 2.04961 52 7.83942 2.40663 0.00187 0.12102 0.39761 2.26988 49 7.78754 2.45257 0.00172 0.16331 0.40846 2.3224 29 7.87723 2.76789 0.00093 0.83442 0.41066 2.78801 67 7.60404 2.25998 0.00559 0.78224 0.42542 1.97339 64 7.70635 2.31556 0.00712 0.51448 0.43426 1.83592 120 8.0252 1.74387 0.00744 0.62351 0.44865 1.45591 25 8.14127 3.04711 0.00087 0.99196 0.45266 2.8521 61 6.81905 2.33345 0.00419 0.76311 0.46698 2.43271 28 7.88126 2.82865 0.00495 0.94256 0.46884 2.25344 39 7.3824 2.65766 0.0014 0.65745 0.46993 2.48392 115 7.1764 1.81539 0.0062 0.53139 0.48504 1.6247 53 5.37879 2.40256 0.00727 0.43407 0.48508 3.12949 65 7.83129 2.28983 0.0022 0.28742 0.4897 2.16702 84 7.51565 2.04529 0.00968 0.35891 0.50203 2.51372 130 6.68323 1.65743 0.00783 0.6325 0.50469 1.8091 47 7.44525 2.50516 0.00336 0.67563 0.51836 2.14316 125 8.74074 1.72796 0.00676 0.57327 0.52126 1.84538 109 7.73745 1.85863 0.00736 0.04866 0.52269 1.58419 132 7.2048 1.64727 0.00681 0.28751 0.53086 1.60131 112 7.04391 1.83868 0.00823 0.74199 0.54826 2.13447 90 7.52235 1.99556 0.00654 0.64534 0.56743 2.31018 99 6.98042 1.93139 0.00552 0.35186 0.5709 2.16018 110 7.18186 1.85201 0.00491 0.26146 0.5792 1.97413 55 7.88276 2.38884 0.00332 0.42701 0.58253 2.01539 101 6.55107 1.90269 0.00578 0.17147 0.59874 2.21142 41 7.9282 2.6097 0.00117 0.88119 0.61188 2.60224 106 6.908 1.87943 0.00473 0.25662 0.61468 2.01075 73 7.05922 2.19493 0.00621 0.58534 0.63899 2.58867 24 8.10775 3.05636 0.00208 0.44145 0.64431 2.62453 118 7.93496 1.77186 0.0078 0.64411 0.64764 1.53278 79 7.10484 2.08583 0.00466 0.22168 0.68206 2.39959 50 8.16462 2.44513 0.00846 0.96658 0.69256 3.02159 140 6.59333 1.58622 0.00913 0.02074 0.69422 1.43757 145 8.04436 1.51784 0.0095 0.71074 0.71062 1.40502 85 7.52585 2.04518 0.00989 0.70833 0.71896 2.17597 94 7.74847 1.97222 0.00662 0.14055 0.72831 1.68746 128 7.59721 1.6944 0.00949 0.41972 0.73565 1.9607 71 7.48901 2.21457 0.00409 0.5557 0.74386 2.50563 96 7.14444 1.95169 0.00424 0.50672 0.75982 1.8728 129 6.38016 1.68844 0.0095 0.21468 0.78416 2.01972 62 6.53133 2.32364 0.0029 0.07827 0.79173 2.07969 117 7.17231 1.77961 0.00577 0.81473 0.80531 1.96329 82 7.26776 2.0527 0.00518 0.12545 0.80604 1.77503 126 6.23887 1.72311 0.00621 0.67237 0.80925 1.82847 81 7.19609 2.06032 0.00779 0.98739 0.82729 1.66746 72 7.16584 2.20934 0.00871 0.67524 0.83771 2.69756 56 7.4581 2.38265 0.00254 0.42337 0.86144 2.14996 103 7.03349 1.89955 0.00815 0.4697 0.8748 1.77992 91 7.27621 1.99105 0.00599 0.81303 0.8781 1.70353 22 8.86045 3.20434 0.00107 0.42127 0.88606 2.89253 48 7.92114 2.46399 0.00496 0.93977 0.90375 2.01862 143 7.02991 1.52697 0.0088 0.04478 0.91159 1.53761 37 7.82338 2.67369 0.0016 0.47774 0.96598 2.44597 75 7.43884 2.16211 0.00794 0.58494 0.97923 1.71851 134 6.16708 1.63464 0.00718 0.19672 0.98344 1.56195 80 6.41487 2.07889 0.00317 0.3316 0.99122 1.95868 88 7.27749 2.00598 0.00404 0.41209 0.99976 2.17459 15 4.28 4.09945 7.74E06 1 1 4.1221 idx A549_0_24_dir A549_0_3_diff A549_0_3_dir A549_3_6_diff 3 1 3.4819 1 1.9899 9 1 3.5776 1 1.1684 1 1 4.1407 1 1.7268 12 1 2.2529 1 1.7628 5 1 2.852 1 1.8182 19 1 0 0 3.7156 13 1 0 0 3.7362 7 1 0 0 4.0372 6 1 0 0 4.6782 2 1 3.7295 1 1.5161 10 1 1.9544 1 2.2725 18 1 3.3308 1 0.02789 14 1 0 0 3.591 4 1 0 0 3.9079 8 1 3.6217 1 0.8838 54 1 2.6567 1 0.23746 17 1 0 0 2.6648 11 1 0 0 4.0979 20 1 0 0 2.7669 93 1 1.30379 1 0.20768 40 1 0 0 3.1341 33 1 2.88247 1 0.00487 63 1 1.5057 1 0.37971 16 1 0 0 3.0183 78 1 1.76469 1 0.22582 87 1 1.81272 1 0.21149 26 1 1.36072 1 0.38397 35 1 0.37376 1 0.4021 138 1 0.94772 1 0.30443 105 1 1.96872 1 1.12211 141 1 0.4824 1 0.55085 131 1 0.37545 1 1.12108 30 1 0.68558 1 1.53455 142 1 0.53643 1 0.39146 43 1 0.52531 1 0.0771 102 1 0.22827 1 1.99109 23 1 1.45799 1 0.37937 107 1 0.10053 1 0.9315 21 1 0.45311 1 0.12231 127 1 0.32057 1 0.19478 135 1 0.75817 1 0.17421 146 1 0.55767 1 0.37927 100 1 0.49327 1 0.14129 36 1 2.65024 1 0.01825 66 1 0.44624 1 0.86381 104 1 0.30273 1 0.2078 68 1 0.2377 1 0.2422 44 1 0.70229 1 0.20816 133 1 0.02051 0 0.38124 32 1 0.09529 0 0.45509 97 1 0.08956 0 0.5332 74 1 0.47433 1 0.11966 108 1 0.2645 1 0.00133 42 1 0.36984 1 0.0269 122 1 0.19762 1 0.09537 76 1 0.26062 1 0.4258 95 1 0.02474 0 0.17633 124 1 0.14064 1 0.32479 51 1 0.26953 1 0.10734 77 1 0.42393 1 0.40174 58 1 1.17348 1 1.67605 121 1 0.15741 1 0.04433 113 1 0.53222 1 0.08073 116 1 0.03444 0 0.62129 119 1 0.08822 0 0.45117 86 1 0.70248 1 0.14278 34 1 0.40245 1 0.64069 31 1 0.29429 1 0.0301 114 1 0.31059 1 0.10672 92 1 1.08094 1 0.94411 111 1 1.10152 1 1.12163 136 1 0.50871 1 0.5224 139 1 0.51379 1 0.03842 123 1 0.35892 1 0.31964 46 1 0.15984 1 0.04101 137 1 0.14626 1 0.16297 45 1 0.34982 1 0.0029 83 1 0.41157 1 0.24774 70 1 1.08309 1 0.62287 27 1 0.20083 1 0.37147 60 1 1.77757 1 0.76924 144 1 0.29598 1 1.26798 59 1 0.37428 1 0.41212 98 1 0.1781 1 0.05071 89 1 0.3462 1 0.47051 69 1 1.04932 1 0.27269 38 1 0.25534 1 0.13912 57 1 1.17394 1 0.58726 52 1 0.456 1 0.79764 49 1 1.02122 1 0.07142 29 1 0.29821 1 0.17282 67 1 0.12165 1 0.57594 64 1 0.49133 1 0.50793 120 1 0.03743 0 0.09058 25 1 0.13824 1 0.38071 61 1 0.0388 0 0.22483 28 1 0.29491 1 0.46281 39 1 0.26537 1 0.13385 115 1 0.27262 1 0.51987 53 1 0.15347 1 1.21811 65 1 0.49302 1 0.33103 84 1 0.10555 1 0.55893 130 1 0.0235 0 0.59875 47 1 0.34924 1 0.26374 125 1 0.28953 1 0.06041 109 1 1.41947 1 1.26087 132 1 0.1024 1 0.13104 112 1 0.3002 1 0.5411 90 1 0.28536 1 0.01628 99 1 0.02902 0 0.37911 110 1 0.3992 1 0.39323 55 1 0.15016 1 0.18959 101 1 0.65209 1 0.2429 41 1 0.04038 0 0.14346 106 1 0.02248 0 0.34776 73 1 0.23005 1 0.24872 24 1 0.14004 1 0.00655 118 1 0.11757 1 0.06157 79 1 0.14232 1 0.01201 50 1 0.49205 1 0.18786 140 1 0.83948 1 0.76466 145 1 0.16989 1 0.094 85 1 0.34226 1 0.1666 94 1 0.74433 1 0.60143 128 1 1.9607 1 1.04969 71 1 0.17544 1 0.48094 96 1 0.13616 1 0.21854 129 1 0.92725 1 0.20521 62 1 0.94862 1 0.11016 117 1 0.24136 1 0.14849 82 1 0.73355 1 0.35003 126 1 0.53335 1 0.22859 81 1 0.16089 1 0.40578 72 1 0.38996 1 0.08303 56 1 0.14781 1 0.35845 103 1 0.13893 1 0.39639 91 1 0.01441 0 0.03765 22 1 0.17612 1 0.1288 48 1 0.01284 0 0.01294 143 1 0.59872 1 1.03812 37 1 0.00581 0 0.2065 75 1 0.25615 1 0.09308 134 1 0.60978 1 0.11351 80 1 0.93313 1 0.02641 88 1 0.33225 1 0.61256 15 1 0 0 0 idx A549_3_6_dir A549_6_24_diff A549_6_24_dir HEK_0_24_diff HEK_0_24_dir 3 1 0.1875 1 5.694 1 9 1 0.2647 1 5.0814 1 1 1 0.5363 1 6.8057 1 12 1 0.0474 0 4.6945 1 5 1 0.1199 1 5.5382 1 19 1 0.7902 1 3.6613 1 13 1 0.4304 1 4.5622 1 7 1 0.6012 1 5.3197 1 6 1 0.1578 1 5.5746 1 2 1 0.1576 1 5.8397 1 10 1 0.001 0 5.0473 1 18 0 0.0825 0 3.25237 1 14 1 0.2625 1 4.4469 1 4 1 1.8385 1 4.8473 1 8 1 0.3804 1 4.7399 1 54 1 0.42553 1 2.3272 1 17 1 0.251 1 3.789 1 11 1 0.1409 1 4.764 1 20 1 0.1479 1 3.5105 1 93 1 0.4948 1 1.94296 1 40 1 0.6316 1 2.7681 1 33 0 0.06328 0 2.50394 1 63 1 0.87714 1 1.87238 1 16 1 0.289 1 3.7776 1 78 1 0.36849 1 1.89306 1 87 1 3.61036 1 2.43067 1 26 1 2.11546 1 2.90909 1 35 1 1.61896 1 3.03694 1 138 1 2.35855 1 1.46833 1 105 1 1.10566 1 1.8268 1 141 1 2.63748 1 1.48661 1 131 1 2.33327 1 1.72127 1 30 1 1.50523 1 3.17903 1 142 1 2.483 1 1.53387 1 43 0 1.34094 1 3.1427 1 102 1 3.58039 1 1.98593 1 23 1 1.54975 1 2.77329 1 107 1 2.62051 1 1.95242 1 21 1 2.55975 1 3.28072 1 127 1 2.19769 1 1.71992 1 135 1 2.35116 1 1.49123 1 146 1 2.44145 1 1.45985 1 100 1 2.91353 1 1.53041 1 36 0 0.03776 0 2.79382 1 66 1 3.22432 1 2.65061 1 104 1 2.17803 1 2.11847 1 68 1 2.80595 1 2.15528 1 44 1 2.38675 1 1.74671 1 133 1 2.21406 1 1.47995 1 32 1 2.10867 1 2.80583 1 97 1 2.65611 1 1.68606 1 74 1 2.49638 1 2.18951 1 108 0 2.2556 1 1.7481 1 42 0 2.33415 1 2.46144 1 122 0 1.98754 1 1.58119 1 76 1 2.60059 1 1.8792 1 95 1 1.78201 1 1.98549 1 124 1 2.25405 1 1.67061 1 51 1 2.24309 1 2.42935 1 77 1 2.71891 1 2.37313 1 58 1 2.74247 1 2.49077 1 121 0 1.97418 1 1.71114 1 113 0 2.16736 1 2.11422 1 116 1 2.61896 1 1.62131 1 119 1 2.06265 1 1.82755 1 86 1 1.39887 1 2.09535 1 34 1 2.65696 1 3.01574 1 31 0 1.95776 1 3.19704 1 114 1 1.8177 1 2.03259 1 92 1 2.31365 1 1.7888 1 111 1 2.03503 1 1.67209 1 136 1 1.6062 1 1.65837 1 139 0 2.06118 1 1.59013 1 123 1 1.20561 1 1.57725 1 46 0 3.09432 1 1.79924 1 137 1 2.06605 1 1.47052 1 45 0 2.95424 1 2.43161 1 83 1 2.06748 1 2.18974 1 70 1 2.32033 1 2.56971 1 27 1 3.5592 1 2.48707 1 60 1 1.41427 1 2.28812 1 144 1 3.01405 1 1.59869 1 59 1 2.6773 1 2.8349 1 98 0 2.27059 1 1.85025 1 89 1 2.19313 1 1.9368 1 69 1 1.84081 1 1.81683 1 38 1 2.71126 1 2.74821 1 57 1 2.63629 1 2.7153 1 52 1 2.61151 1 2.54339 1 49 0 1.22976 1 2.58274 1 29 1 2.31698 1 2.74778 1 67 1 1.2758 1 2.54657 1 64 1 2.83517 1 2.7952 1 120 0 1.40276 1 2.03182 1 25 1 2.60963 1 3.24212 1 61 1 2.24668 1 2.23418 1 28 1 2.08554 1 3.40386 1 39 1 2.61544 1 2.8314 1 115 1 0.83221 1 2.00608 1 53 1 2.06484 1 1.67564 1 65 1 2.329 1 2.41264 1 84 1 3.1782 1 1.57686 1 130 1 2.38435 1 1.50576 1 47 1 2.22865 1 2.86715 1 125 0 1.61626 1 1.61054 1 109 1 1.74278 1 2.13307 1 132 1 1.62995 1 1.69322 1 112 1 1.29317 1 1.54288 1 90 0 2.00854 1 1.68094 1 99 1 2.51027 1 1.70261 1 110 1 1.9801 1 1.72988 1 55 1 2.35514 1 2.7623 1 101 1 3.10641 1 1.59397 1 41 1 2.70533 1 2.61715 1 106 1 2.38099 1 1.7481 1 73 1 2.1099 1 1.80118 1 24 0 2.77113 1 3.48819 1 118 0 1.35365 1 2.01093 1 79 0 2.5299 1 1.77207 1 50 1 2.34168 1 1.86867 1 140 1 1.51239 1 1.73486 1 145 0 1.48092 1 1.63066 1 85 1 1.66711 1 1.91438 1 94 1 1.83036 1 2.25698 1 128 1 1.04969 1 1.4281 1 71 1 1.84924 1 1.92352 1 96 1 2.2275 1 2.03058 1 129 1 2.74176 1 1.35716 1 62 1 2.91815 1 2.56759 1 117 1 1.57345 1 1.59592 1 82 1 2.15854 1 2.33038 1 126 1 2.13324 1 1.61776 1 81 1 1.91235 1 2.45317 1 72 0 2.22458 1 1.72112 1 56 1 2.36061 1 2.61534 1 103 1 1.2446 1 2.01918 1 91 0 1.75559 1 2.27857 1 22 1 2.84521 1 3.51615 1 48 0 2.04439 1 2.90937 1 143 1 1.0982 1 1.51634 1 37 1 2.65828 1 2.9014 1 75 0 2.06773 1 2.6057 1 134 1 2.28523 1 1.70733 1 80 0 2.91823 1 2.1991 1 88 1 1.89429 1 1.83736 1 15 0 4.1221 1 4.0768 1 idx HEK_0_3_diff HEK_0_3_dir HEK_3_6_diff HEK_3_6_dir HEK_6_24_diff 3 3.9547 1 1.4428 1 0.2965 9 3.93 1 0.7434 1 0.408 1 4.2426 1 1.4912 1 1.0719 12 2.4088 1 1.6631 1 0.6226 5 3.5497 1 1.0044 1 0.9841 19 0 0 3.6545 1 0.0068 13 0 0 3.8418 1 0.7204 7 0 0 3.8866 1 1.4331 6 2.8003 1 2.1053 1 0.669 2 4.0154 1 0.9739 1 0.8504 10 2.8963 1 1.067 1 1.084 18 2.85737 1 0.23144 1 0.16357 14 0 0 3.8542 1 0.5927 4 0 0 3.61 1 1.2373 8 3.694 1 0.4106 1 0.6353 54 2.70664 1 0.32058 1 0.05885 17 0 0 2.3105 1 1.4785 11 0 0 3.4998 1 1.2642 20 0 0 2.2835 1 1.227 93 1.68178 1 0.16531 1 0.09588 40 0 0 2.4685 1 0.2996 33 2.31459 1 4.21981 1 0.59873 63 1.12304 1 0.18829 1 0.56105 16 0 0 2.2521 1 1.5255 78 1.19296 1 0.12692 1 0.82703 87 1.14712 1 0.11528 1 3.46251 26 1.85864 1 0.47217 1 1.52262 35 2.74898 1 0.88075 1 1.1687 138 1.15703 1 0.12828 1 2.49708 105 0.96638 1 0.43987 1 0.42055 141 0.38739 1 2.15919 1 4.03319 131 0.57343 1 0.20163 1 2.49633 30 1.37808 1 0.11761 1 1.68333 142 0.80324 1 0.20824 1 2.12888 43 1.4272 1 0.3768 1 1.3387 102 0.39134 1 0.13959 1 2.51686 23 0.14934 1 0.33377 1 2.29019 107 0.50049 1 0.00837 0 2.46128 21 0.10349 1 0.6088 1 2.56843 127 0.24802 1 0.5692 1 2.53714 135 0.34116 1 0.36449 1 2.19687 146 1.05627 1 0.62281 1 1.89331 100 1.54223 1 0.7896 1 2.28304 36 0.98455 1 0.41493 1 2.2242 66 0.66968 1 0.93819 1 2.91913 104 0.44477 1 0.0179 0 2.58114 68 0.17553 1 0.33967 1 2.67048 44 0.21088 1 0.03797 0 1.49785 133 0.91913 1 0.30313 1 2.09595 32 0.08126 0 0.35795 1 2.36662 97 0.93486 1 0.17892 1 2.442 74 0.19724 1 0.77324 1 2.76551 108 0.42431 1 0.232 1 2.40441 42 0.54192 1 0.38848 1 1.53104 122 0.5295 1 0.39809 1 2.50878 76 0.44365 1 0.28641 1 2.60926 95 0.01127 0 1.65466 1 0.31957 124 1.08288 1 0.57754 1 2.17596 51 0.17124 1 0.84636 1 1.41176 77 0.11236 1 0.19223 1 2.453 58 0.043 0 0.18723 1 2.72101 121 0.51577 1 0.00346 0 2.23037 113 0.42944 1 0.19076 1 2.35291 116 0.66652 1 0.33024 1 1.9576 119 0.39543 1 0.10404 1 2.11895 86 0.08643 0 0.31861 1 1.86317 34 1.27059 1 0.66192 1 1.08323 31 0.07379 0 0.96687 1 2.15638 114 0.52207 1 0.10505 1 2.44961 92 1.03501 1 0.46578 1 2.35802 111 0.32799 1 0.74199 1 0.60211 136 1.14869 1 0.67529 1 3.48234 139 0.65592 1 0.48586 1 1.76019 123 0.60866 1 0.64605 1 1.53987 46 0.85493 1 0.36942 1 3.0236 137 0.25115 1 0.10529 1 1.82696 45 0.24289 1 0.0017 0 2.6728 83 0.6816 1 0.20654 1 2.66481 70 0.05822 0 0.05078 0 2.67872 27 0.36569 1 0.41267 1 3.26544 60 0.40324 1 0.47169 1 2.35657 144 1.12341 1 1.28489 1 1.43721 59 0.09245 0 0.0408 0 2.96815 98 0.44092 1 0.14639 1 2.14478 89 0.51303 1 0.1402 1 2.30963 69 0.05496 0 0.05137 0 1.82042 38 0.4229 1 0.09 0 3.26111 57 0.05326 0 0.13104 1 2.79308 52 0.56246 1 0.69848 1 2.67942 49 0.38412 1 0.42891 1 2.62754 29 0.17418 1 0.20473 1 2.71723 67 0.48448 1 0.77858 1 2.25247 64 0.19739 1 0.44624 1 2.54635 120 0.30518 1 0.67717 1 1.65983 25 0.14407 1 0.11677 1 2.98127 61 0.34138 1 0.23374 1 1.65905 28 0.21367 1 0.46893 1 2.72126 39 0.01397 0 0.59503 1 2.2224 115 0.16684 1 0.17717 1 2.0164 53 2.3841 1 2.76828 1 2.05982 65 0.12251 1 0.13614 1 2.67129 84 4.08E01 1 0.51452 1 1.47044 130 0.2865 1 0.26903 1 1.52323 47 0.67879 1 0.09688 0 2.28525 125 0.02819 0 0.08122 0 1.50113 109 0.48406 1 0.03968 0 2.57745 132 3.07943 1 2.72786 1 2.0448 112 0.53008 1 0.18905 1 1.88391 90 0.62225 1 0.78146 1 1.52174 99 0.65016 1 0.53235 1 1.82042 110 0.31673 1 0.02475 0 2.02186 55 0.30635 1 0.34588 1 2.72276 101 0.48049 1 0.68339 1 1.39107 41 0.03269 0 0.18373 1 2.7682 106 0.80624 1 0.80634 1 1.748 73 0.3555 1 0.45354 1 1.89922 24 0.80581 1 0.26537 1 2.94775 118 0.65286 1 0.11117 1 2.77496 79 0.72091 1 0.54814 1 1.94484 50 0.449 1 0.68695 1 3.00462 140 0.90613 1 1.20766 1 1.43333 145 0.01776 0 0.29066 1 1.35775 85 0.63624 1 0.40376 1 2.14686 94 0.57442 1 0.42603 1 2.40537 128 0.39085 1 0.1181 1 1.93705 71 0.58457 1 0.17907 1 2.32901 96 0.5656 1 0.0175 0 1.44748 129 0.40152 1 0.75974 1 0.99894 62 0.43121 1 1.62748 1 1.37133 117 0.11772 1 0.12032 1 1.83395 82 0.59256 1 0.81518 1 2.10776 126 0.16172 1 0.37717 1 1.07887 81 0.17933 1 0.59641 1 2.03609 72 0.77574 1 0.49102 1 2.00584 56 0.38195 1 0.06471 0 2.2981 103 0.62209 1 0.20276 1 2.43851 91 0.1945 1 0.35686 1 2.11621 22 0.44581 1 0.63011 1 3.70045 48 0.07156 0 0.21979 1 2.76114 143 0.79859 1 0.44502 1 1.86991 37 0.44855 1 0.21052 1 2.66338 75 0.38545 1 0.71231 1 2.27884 134 0.18667 1 0.88692 1 1.00708 80 0.09769 0 0.84655 1 1.25487 88 0.22744 1 0.05269 0 2.11749 15 0 0 0 0 4.0768 idx HEK_6_24_dir dir_FX_count_0 dir_FX_count_p1 dir_FX_count_n1 3 1 0 7 1 9 1 0 7 1 1 1 0 8 0 12 1 1 7 0 5 1 0 8 0 19 0 3 4 1 13 1 2 6 0 7 1 2 6 0 6 1 1 6 1 2 1 0 8 0 10 1 1 7 0 18 1 2 6 0 14 1 2 6 0 4 1 2 6 0 8 1 0 8 0 54 0 1 5 2 17 1 2 6 0 11 1 2 6 0 20 1 2 6 0 93 0 1 7 0 40 1 2 5 1 33 1 2 5 1 63 1 0 8 0 16 1 2 6 0 78 1 0 1 7 87 1 0 3 5 26 1 0 6 2 35 1 0 1 7 138 1 0 2 6 105 1 0 7 1 141 1 0 4 4 131 1 0 3 5 30 1 0 1 7 142 1 0 3 5 43 1 1 7 0 102 1 0 3 5 23 1 0 0 8 107 1 1 2 5 21 1 0 0 8 127 1 0 4 4 135 1 0 3 5 146 1 0 3 5 100 1 0 3 5 36 1 2 5 1 66 1 0 3 5 104 1 1 3 4 68 1 0 4 4 44 1 1 0 7 133 1 1 2 5 32 1 2 0 6 97 1 1 2 5 74 1 0 2 6 108 1 1 3 4 42 1 1 0 7 122 1 1 3 4 76 1 0 3 5 95 1 2 0 6 124 1 0 3 5 51 1 0 1 7 77 1 0 3 5 58 1 1 2 5 121 1 2 2 4 113 1 1 2 5 116 1 1 2 5 119 1 1 2 5 86 1 1 1 6 34 1 0 1 7 31 1 2 0 6 114 1 0 2 6 92 1 0 2 6 111 1 0 7 1 136 1 0 3 5 139 1 1 2 5 123 1 0 1 7 46 1 1 2 5 137 1 0 4 4 45 1 2 2 4 83 1 0 2 6 70 1 2 1 5 27 1 0 3 5 60 1 0 2 6 144 1 0 3 5 59 1 2 2 4 98 1 1 2 5 89 1 0 2 6 69 1 2 1 5 38 1 1 2 5 57 1 1 2 5 52 1 0 2 6 49 1 1 1 6 29 1 0 1 7 67 1 0 1 7 64 1 0 3 5 120 1 2 1 5 25 1 0 1 7 61 1 1 0 7 28 1 0 1 7 39 1 1 1 6 115 1 0 1 7 53 1 0 6 2 65 1 0 3 5 84 1 0 3 5 130 1 1 2 5 47 1 1 1 6 125 1 3 0 5 109 1 1 2 5 132 1 0 2 6 112 1 0 1 7 90 1 1 1 6 99 1 1 2 5 110 1 1 2 5 55 1 0 3 5 101 1 0 3 5 41 1 2 2 4 106 1 1 2 5 73 1 0 1 7 24 1 1 2 5 118 1 1 2 5 79 1 1 2 5 50 1 0 2 6 140 1 0 2 6 145 1 2 1 5 85 1 0 1 7 94 1 0 2 6 128 1 0 3 5 71 1 0 1 7 96 1 1 2 5 129 1 0 2 6 62 1 0 2 6 117 1 0 2 6 82 1 0 2 6 126 1 0 1 7 81 1 0 2 6 72 1 1 1 6 56 1 1 1 6 103 1 0 1 7 91 1 2 1 5 22 1 0 2 6 48 1 3 0 5 143 1 0 2 6 37 1 1 2 5 75 1 1 2 5 134 1 0 3 5 80 1 2 1 5 88 1 1 2 5 15 1 4 4 0
(414) To assess if there are global changes in HLA-I antigen presentation due to SARS-COV-2 infection, the overlap between HLA-I peptidomes of uninfected and 24hpi A549 cells was compared. A degree of overlap of these peptides was found detected in both experiments (62%,
(415) Initially, the canonical HLA-I presentation pathway proteins was evaluated across both the uninfected and 24hpi A549 and HEK293T cells in the fractionated proteome data that contained about 7,000 quantified proteins (
(416) Next, all proteins detected in uninfected and 24 hpi A549 and HEK293T were compared to determine if proteins involved in ubiquitination, proteasomal function, antigen processing and IFN signaling were altered (
(417) SARS-COV-2 HLA-I Peptides are Derived from Internal Out-of-Frame ORFs in S and N
(418) Remarkably, nine HLA-I peptides processed from internal out-of-frame ORFs present in the coding region of S and N were detected. In the S.iORF1/2 proteins, three HLA-I peptides were detected: GPMVLRGLIT (SEQ ID NO: 6), GLITLSYHL (SEQ ID NO: 5) and MLLGSMLYM (SEQ ID NO: 4) in HEK293T cells, all of which are predicted to bind HLA alleles in this cell line
(419) Six of the peptides from out-of-frame ORFs were predicted to bind HLA-A*02:01 in HEK293T cells, suggesting the potential for widespread presentation of these non-canonical HLA-I peptides in the population. To confirm presentation by HLA-A*02:01 in-vitro binding assays were performed in the presence of a high affinity radiolabeled A*02:01 ligand (
(420) In the context of T cell immunity and vaccine development, it is crucial to understand the effect of optimizing RNA sequences on the endogenously processed and presented HLA-I peptides derived from internal out-of-frame ORFs. Exogenous expression of viral proteins in vaccines often involve manipulating the native nucleotide sequence, e.g., via codon optimization, to enhance expression. These techniques maintain the amino acids sequence of the canonical ORF, yet may alter the sequence of proteins encoded in alternative reading frames. In addition to the two current mRNA vaccines targeting the S glycoprotein (Callaway, 2020; Jackson et al., 2020; Mulligan et al., 2020) the nucleocapsid is also considered for vaccine development (Dutta et al., 2020; Zhu et al., 2004). It was thus aimed to investigate the effect of optimizing the RNA sequence of S and N on the endogenously processed and presented HLA-I peptides derived from S.iORF1/2 and ORF9b, respectively.
(421) The native viral sequence was compared to synthetic S and N from a SARS-COV-2 human optimized ORFs library (Gordon et al., 2020) in the regions encoding the two internal out-of-frame ORFs. As expected, there was no change in the main ORFs, however, the amino acid sequence in the +1 frame, which encodes S.iORF1/2 and ORF9b, is significantly different (
(422) Out-of-Frame HLA-I Peptides Elicit T Cell Responses in Humanized HLA-A2 Mice and COVID-19 Patients
(423) To evaluate the immunogenicity of the HLA-A*02:01 peptides detected by mass spectrometry, three assays probing the T cell responses in a humanized mouse model, COVID-19 patients, and unexposed humans were conducted. First, five transgenic HLA-A2 mice were immunized with a pool of nine HLA-A*02:01 peptides for 10 days and tested the T cell responses to individual peptides using INF ELISpot assay. A positive response was observed to three non-canonical peptides from out-of-frame ORFs, two from S.iORF1/2 (GLITLSYHL (SEQ ID NO: 5) and MLLGSMLYM (SEQ ID NO: 4)) and one from ORF9b (ELPDEFVVVTV (SEQ ID NO: 8)), as well as a canonical peptide from nsp3 (YLNSTNVTI (SEQ ID NO: 24))
(424) Next, the immunogenicity of the HLA-I peptides in the context of COVID-19 disease was investigated. ELISpot assays were performed with PBMCs from six convalescent patients expressing HLA-A*02:01 and monitored IFN secretion in response to a pool of 15 HLA-I peptides from canonical ORFs and 7 peptides from the out-of-frame ORFs (3 from S.iORF1/2 and 4 from ORF9b, Table 7). As a positive control, the T cells responses were compared to a pool of 102 peptides tiling the nucleocapsid (NC) protein measured in the same patients as part of another study (Gallagher et al. in preparation). Positive responses to the non-canonical pool in two of the six samples was observed (
(425) Table 7 shows a list of HLA-I peptides tested in the two pools of canonical and non-canonical ORFs.
(426) TABLE-US-00010 TABLE7 Peptidepool Peptidesequence Peptidelength SARS-Cov-2protein CellLine 1-cannonical APHGHVMVEL 10 nsp1 A549 (SEQIDNO:14) 1-cannonical EEFEPSTQYEY 11 nsp3 A549 (SEQIDNO:20) 1-cannonical EIKESVQTF 9 nsp2 A549 (SEQIDNO:15) 1-cannonical EILDITPCSF 10 S A549 (SEQIDNO:33) 1-cannonical EILDITPCSFG 11 S A549 (SEQIDNO:47) 1-cannonical FASEAARVV 9 nsp2 A549 (SEQIDNO:17) 1-cannonical FAVDAAKAY 9 nsp10 A549 (SEQIDNO:28) 1-cannonical IRQEEVQEL 9 ORF7a A549 (SEQIDNO:31) 1-cannonical KNIDGYFKIY 10 S HEK293T (SEQIDNO:36) 1-cannonical KRVDWTIEY 9 nsp14 HEK293T (SEQIDNO:29) 1-cannonical NATNVVIKV 9 S HEK293T (SEQIDNO:37) 1-cannonical QLTPTWRVY 9 S HEK293T (SEQIDNO:38) 1-cannonical SEFSSLPSY 9 nsp8 HEK293T (SEQIDNO:27) 1-cannonical VGYLQPRTF 9 S HEK293T (SEQIDNO:39) 1-cannonical YLNSTNVTI 9 nsp3 HEK293T (SEQIDNO:24) 2-non- DEFVVVTV 8 ORF9b A549 cannonical (SEQIDNO:11) 2-non- ELPDEFVVVTV 11 ORF9b A549 cannonical (SEQIDNO:8) 2-non- GLITLSYHL 9 ORFS. A549 cannonical (SEQIDNO:5) iORF1/2 2-non- GPMVLRGLIT 10 ORFS. A549 cannonical (SEQIDNO:6) iORF1/2 2-non- LEDKAFQL 8 ORF9b HEK293T cannonical (SEQIDNO:10) 2-non- MLLGSMLYM 9 ORFS. HEK293T cannonical (SEQIDNO:4) iORF1/2 2-non- SLEDKAFQL 9 ORF9b HEK293T cannonical (SEQIDNO:7)
(427) To delineate the T cell responses against individual HLA-I peptides in humans, a novel multiplexed technology combining barcoded tetramer assay and single-cell sequencing in collaboration with Repertoire Immune Medicines was utilized. DNA-encoded pMHCs and single-cell sequencing was used to detect and characterize epitope-reactive CD8+ T cells in convalescent COVID-19 patients and unexposed subjects (
(428) Testing nine HLA-A*02:01 samples (seven COVID-19 convalescent and two unexposed) reactivity to our positive controls as well as to non-canonical HLA-I peptides was observed. The previously reported A*02:01 epitopes from influenza and SARS-COV-2 all elicited expected responses, albeit relatively weak responses to KLWAQCVQL (SEQ ID NO: 208) (
(429) Examining the gene expression profile and the TCR sequence of the reacting T cells provides additional supporting evidence for the functional relevance of the ELPDEFVVVTV (SEQ ID NO: 8) epitope during the course of COVID-19. To characterize the cell state, single-cell transcriptomics analysis was visualized via uniform manifold approximation and projection (UMAP) (
(430) While the T cell data provides strong evidence for CD8+ responses to peptides from ORF9b in COVID-19 patients, significant responses to HLA-I peptides from S.iORF1/2, GLITLSYHL (SEQ ID NO: 5) and MLLGSMLYM (SEQ ID NO: 4) were not detected in the seven tested COVID-19 samples. To evaluate the immunogenicity of the third HLA-I peptide from S.iORF1/2, GPMVLRGLIT (SEQ ID NO: 6), an additional barcoded tetramer assay with PBMCs from COVID-19 patients expressing HLA-B*07:02 and a B*07:02 tetramer library was performed. As controls, B*07:02 epitopes from EBV (RPPIFIRRL (SEQ ID NO: 210)) and SARS-CoV-2 (SPRWYFYYL (SEQ ID NO: 211)) were included. As expected, positive reactivity to the two control peptides as well as overall greater CD8+ responses to HLA-I peptides that bind B*07:02 than peptides that do not (Wilcoxon rank-sum p<10-10,
(431) Tables 8A-8B show (Table 8A) A table of tested peptides in a multiplexed tetramer assay and the summary statistics of the T cell responses in seven convalescent COVID-19 patients and two unexposed subjects expressing HLA-A*02:01. clonotypethe total number of unique reacting T cell clones in positive samples based on the CDR3 region of the T cell receptor; nCellsthe total number of reacting T cells in positive samples; subjectsthe number of patients in which positive T cells were obtained. Peptides were ranked according to the number of detected reacting T cell clones. GILGFVFTL (SEQ ID NO: 206) from Influenza virus and YLQPRTFLL (SEQ ID NO: 207), KLWAQCVQL (SEQ ID NO: 208), LLYDANYFL (SEQ ID NO: 209) from SARS-COV-2 served as positive controls. (Table 8B) Similar to (Table 8A) but for B*07:02 tetramer library. Summary statistics of the T cell responses in five convalescent COVID-19 patients and three unexposed subjects expressing HLA-B*07:02. RPPIFIRRL (SEQ ID NO: 210) from EBV and SPRWYFYYL (SEQ ID NO: 211) from SARS-COV-2 served as positive controls.
(432) TABLE-US-00011 TABLE8A COVID-19convalescent Unexposed Bind_ (nsubjects=7) (nsubjects=2) A0201 Protein clonotypes nCells subjects clonotypes nCells subjects GILGFVFTL not Matrixprotein1, 150 825 7 42 80 2 (SEQIDNO:206) tested InfluenzaA02:01(+) cntrl ELPDEFVVVTV Yes ORF9b 60 323 5 6 6 2 (SEQIDNO:8) YLQPRTFLL not S,SARS-CoV-2 20 25 5 7 7 2 (SEQIDNO:207) tested A02:01(+)cntrl LLYDANYFL not ORF3a,SARS-CoV-2 13 13 5 2 2 2 (SEQIDNO:209) tested A02:01(+)cntrl SLEDKAFQL Yes ORF9b 12 12 5 5 5 2 (SEQIDNO:7) LATNNLVVM No nsp2 9 14 3 4 4 2 (SEQIDNO:16) YLNSTNVTI Yes nsp3 7 8 3 7 7 2 (SEQIDNO:24) FASEAARVV Yes nsp2 6 8 5 5 5 2 (SEQIDNO:17) NATNVVIKV No S 6 8 3 1 1 1 (SEQIDNO:37) STSAFVETV Yes nsp2 5 6 2 5 7 2 (SEQIDNO:19) KAFQLTPIAV Yes ORF9b 5 5 2 1 1 1 (SEQIDNO:13) GPMVLRGLIT No ORFS.iORF1/2 5 5 3 1 1 1 (SEQIDNO:6) VGYLQPRTF No S 4 4 2 1 1 1 (SEQIDNO:39) EILDITPCSFG No S 3 5 2 4 4 2 (SEQIDNO:47) ELPDEFVVV Yes ORF9b 3 3 1 0 0 0 (SEQIDNO:12) SEFSSLPSY No nsp8 3 3 3 0 0 0 (SEQIDNO:27) KLWAQCVQL not nsp7,SARS-CoV-2 3 3 2 1 1 1 (SEQIDNO:208) tested A02:01(+)cntrl EIKESVQTF No nsp2 2 4 2 0 0 0 (SEQIDNO:15) IRQEEVQEL No ORF7a 2 2 2 1 1 1 (SEQIDNO:31) QLTPTWRVY No S 2 2 2 0 0 0 (SEQIDNO:38) FAVDAAKAY No nsp10 2 3 2 1 1 1 (SEQIDNO:28) GLITLSYHL Yes ORFS.iORF1/2 2 4 2 2 2 2 (SEQIDNO:5) FGDDTVIEV Yes nsp3 2 2 1 4 4 2 (SEQIDNO:23) KNIDGYFKIY No S 2 2 1 1 1 1 (SEQIDNO:36) APHGHVMVEL No nsp1 1 2 1 0 0 0 (SEQIDNO:14) APRITFGGP No N 1 1 1 0 0 0 (SEQIDNO:42) HADQLTPTW No S 1 1 1 0 0 0 (SEQIDNO:35) LEDKAFQL No ORF9b 1 1 1 0 0 0 (SEQIDNO:10) EEFEPSTQYEY No nsp3 1 1 1 1 1 1 (SEQIDNO:20) DEFVVVTV No ORF9b 1 1 1 0 0 0 (SEQIDNO:11) KRVDWTIEY No nsp14 0 0 0 0 0 0 (SEQIDNO:29) EILDITPCSF No S 0 0 0 3 3 2 (SEQIDNO:33) MLLGSMLYM Yes ORFS.iORF1 0 0 0 4 4 2 (SEQIDNO:4) VATSRTLSY No M 0 0 0 0 0 0 (SEQIDNO:41) RPPIFIRRL not Nuclearantigen3, 0 0 0 0 0 0 (SEQIDNO:210) tested EBVB07:02(+)cntrl SPRWYFYYL not N,SARS-CoV-2 0 0 0 0 0 0 (SEQIDNO:211) tested B07:02(+)cntrl
(433) TABLE-US-00012 TABLE8B COVID-19convalescent Unexposed (nsubjects=5) (nsubjects=3) Bind_ clonotypes nCells subjects clonotypes nCells subjects B0702 Protein (conv) (conv) (conv) (unex) (unex) (unex) SPRWYFYYL not N,SARS-CoV-2 136 320 5 45 49 3 (SEQIDNO:211) tested B07:02(+)cntrl RPPIFIRRL not Nuclearantigen3, 37 200 5 58 162 3 (SEQIDNO:210) tested EBVB07:02(+)cntrl LATNNLVVM Yes nsp2 26 35 3 275 279 3 (SEQIDNO:16) APHGHVMVEL Yes nsp1 7 9 1 19 19 3 (SEQIDNO:14) GPMVLRGLIT Yes ORFS.iORF1/2 7 9 1 31 31 2 (SEQIDNO:6) SEFSSLPSY No nsp8 4 4 2 10 10 3 (SEQIDNO:27) SLEDKAFQL No ORF9b 4 6 2 9 9 2 (SEQIDNO:7) YLNSTNVTI No nsp3 4 4 2 17 17 3 (SEQIDNO:24) EILDITPCSFG No S 4 5 1 13 13 3 (SEQIDNO:47) EILDITPCSF No S 4 5 1 9 9 3 (SEQIDNO:33) KRVDWTIEY No nsp14 3 3 1 9 9 3 (SEQIDNO:29) ELPDEFVVV No ORF9b 3 4 3 5 5 2 (SEQIDNO:12) HADQLTPTW No S 3 3 2 12 12 3 (SEQIDNO:35) IRQEEVQEL No ORF7a 3 4 3 3 3 1 (SEQIDNO:31) VGYLQPRTF No S 3 3 2 18 18 2 (SEQIDNO:39) ELPDEFVVVTV No ORF9b 3 4 2 6 7 3 (SEQIDNO:8) DEFVVVTV No ORF9b 2 4 1 13 13 3 (SEQIDNO:11) KNIDGYFKIY No S 2 3 2 6 6 2 (SEQIDNO:36) EEFEPSTQYEY No nsp3 2 4 2 8 8 2 (SEQIDNO:20) FAVDAAKAY No nsp10 2 4 1 13 13 3 (SEQIDNO:28) EIKESVQTF No nsp2 1 2 1 6 6 2 (SEQIDNO:15) LEDKAFQL No ORF9b 1 2 1 3 3 1 (SEQIDNO:10) VATSRTLSY No M 1 1 1 1 1 1 (SEQIDNO:41) APRITFGGP Yes N 1 1 1 8 9 2 (SEQIDNO:42) FASEAARVV No nsp2 1 2 1 10 10 3 (SEQIDNO:17) GILGFVFTL not Matrixprotein1, 1 1 1 14 14 3 (SEQIDNO:206) tested InfluenzaA02:01(+) cntrl KLWAQCVQL not nsp7,SARS-CoV-2 1 1 1 3 3 1 (SEQIDNO:208) tested A02:01(+)cntrl GLITLSYHL No ORFS.iORF1/2 1 2 1 9 9 2 (SEQIDNO:5) NATNVVIKV No S 0 0 0 8 8 2 (SEQIDNO:37) QLTPTWRVY No S 0 0 0 6 6 2 (SEQIDNO:38) MLLGSMLYM No ORFS.iORF1 0 0 0 2 2 1 (SEQIDNO:4) STSAFVETV No nsp2 0 0 0 8 8 3 (SEQIDNO:19) FGDDTVIEV No nsp3 0 0 0 5 5 2 (SEQIDNO:23) KAFQLTPIAV No ORF9b 0 0 0 2 2 1 (SEQIDNO:13) LLYDANYFL not ORF3a,SARS-CoV-2 0 0 0 0 0 0 (SEQIDNO:209) tested A02:01(+)cntrl YLQPRTFLL not S,SARS-CoV-2 0 0 0 2 2 2 (SEQIDNO:207) tested A02:01(+)cntrl
LC-MS/MS-Identified SARS-COV-2 Peptides can be Presented by Additional HLA Alleles in the Population
(434) Increasingly accurate HLA-I presentation prediction tools are routinely applied to the full transcriptome or proteome of an organism to computationally nominate presentable epitopes. However, these tools are trained on data that is agnostic to virus-specific processes that may interfere with the presentation pathway. Thus, the sensitivity and specificity of in silico predictions for any particular virus are insufficiently characterized. To assess how well computational tools would recover the HLA-I peptides that we identified by LC-MS/MS, HLAthena (predictor trained exclusively on endogenous HLA epitopes) (Abelin et al., 2017; Sarkizova et al., 2020) was used to retrospectively predict all 8-11mer peptides tiling known SARS-COV-2 proteins against the complement of HLA-I alleles expressed by A549 and HEK293T (
(435) Within a total of 39,875 SARS-COV-2 8-11mers, 14 out of 18 A549 peptides and 11 out of 18 HEK293T peptides had percentile rank scores within the top 1000 viral peptides (top 1.5% and 1.7% for A549 and HEK293T, respectively). To account for variability in viral protein expression levels, this analysis was also performed within the source protein of each peptide. It was found that 16 out of 36 peptides scored within the top 10 epitopes amongst all 8-11mers that the source protein can give rise to, and 21 scored within the top 20. Overall, predicted ranks were higher for A549 compared to HEK293T, which could partially be due to the larger number of viable cells and deeper peptidome we obtained for A549. These observations suggest that while an in silico epitope prediction scheme that nominates the top 10-20 peptides of each viral protein would recover 50% (16-29 of 36) of observed epitopes with very high priority, this short list would still only encompass 5-10% true LC-MS/MS positives.
(436) Next, the HLA allele coverage achieved was estimated by the observed endogenously processed and presented viral epitopes amongst AFA, API, EUR, HIS, USA, and World populations at different rank cutoffs (top 0.1%, 0.5%, 1% and 2%) based on HLAthena predictions across 92 HLA-A,-B, and -C alleles (
(437) TABLE-US-00013 TABLE9A HLAPredictions HLAthena best best rank percentile #of %rank number # predicted predicted within rankwithin rank peptides with ofalleles allalleles pep viral experiments rank allele allviral allviral within in in with with peptide length protein detected (MSi) (MSi) peptides proteins protein protein protein prank<=2 prank<=2 A549 VATSRTLSY 9 M 2 0.0007 C1601 2 0.0050 1 854 0.1171 2 C1203,C1601 (SEQIDNO:41) FAVDAAKAY 9 nsp10 5 0.0027 C1601 8 0.0201 1 522 0.1916 3 A2501,C1203, (SEQIDNO:28) C1601 FASEAARVV 9 nsp2 7 0.0049 C1601 18 0.045 2 2518 0.0794 2 C1203,C1601 (SEQIDNO:17) 1 DEFVVVTV 8 ORF9b 3 0.0083 B1801 24 0.0602 2 354 0.5650 2 B1801,B4403 (SEQIDNO:11) NATNVVIKV 9 S 4 0.0180 C1203 45 0.1129 5 5096 0.0981 2 C1203,C1601 (SEQIDNO:37) EIKESVQTF 9 nsp2 2 0.0184 A2501 47 0.1179 3 2518 0.1191 1 A2501 (SEQIDNO:15) EEFEPSTQYEY 11 nsp3 1 0.0194 B1801 49 0.1229 18 7746 0.2324 3 A2501,B1801, (SEQIDNO:20) B4403 SEFSSLPSY 9 nsp8 1 0.0246 B1801 59 0.1480 1 758 0.1319 2 B1801,B4403 (SEQIDNO:27) TVIEVQGY 8 nsp3 1 0.0582 A2501 128 0.3210 34 7746 0.4389 1 A2501 (SEQIDNO:22) LATNNLVVM 9 nsp2 1 0.0848 C1203 189 0.4740 18 2518 0.7149 2 C1203,C1601 (SEQIDNO:16) TTTIKPVTY 9 nsp3 1 0.0869 C1601 196 0.4915 51 7746 0.6584 4 A2501,B1801, (SEQIDNO:21) C1203,C1601 EILDITPCSF 10 S 6 0.0955 A2501 210 0.5266 32 5096 0.6279 2 A2501,B1801 (SEQIDNO:33) TAQNSVRVL 9 nsp2 1 0.1829 C1601 398 0.9981 41 2518 1.6283 2 C1203,C1601 (SEQIDNO:18) LEDKAFQL 8 ORF9b 1 0.2740 B1801 613 1.5373 6 354 1.6949 2 B1801,B4403 (SEQIDNO:10) VGYLQPRTF 9 S 5 0.6251 C1601 1473 3.6940 185 5096 3.6303 1 C1601 (SEQIDNO:39) QLTPTWRVY 9 S 3 0.7696 C1601 1835 4.6019 238 5096 4.6703 3 A2501,C1203, (SEQIDNO:38) C1601 KNIDGYFKIY 10 S 5 0.8731 B1801 2074 5.2013 265 5096 5.2002 4 B1801,B4403, (SEQIDNO:36) C1203,C1601 EILDITPCSFG 11 S 3 4.5200 A2501 10633 26.6658 1274 5096 25.0000 0 unknown (SEQIDNO:47) HEK293 YLFDESGEFKL 11 nsp3 1 0.0052 A0201 6 0.0150 1 7746 0.0129 2 A0201,C0702 (SEQIDNO:25) KRVDWTIEY 9 nsp14 2 0.0180 C0702 13 0.0326 1 2074 0.0482 1 C0702 (SEQIDNO:29) APHGHVMVEL 10 nsp1 2 0.1099 B0702 95 0.2382 3 686 0.4373 1 B0702 (SEQIDNO:14) IRQEEVQEL 9 ORF7a 3 0.1322 C0702 122 0.3060 3 450 0.6667 1 C0702 (SEQIDNO:31) YLNSTNVTI 9 nsp3 1 0.1354 A0201 126 0.3160 24 7746 0.3098 1 A0201 (SEQIDNO:24) SVVSKVVKV 9 nsp15 1 0.1482 A0201 145 0.3636 5 1350 0.3704 1 A0201 (SEQIDNO:30) GLITLSYHL 9 S.iORF1/2 1 0.2323 A0201 245 0.6144 3 90 3.3333 1 A0201 (SEQIDNO:5) ELPDEFVVVTV 11 ORF9b 1 0.4190 A0201 489 1.2263 9 354 2.5424 1 A0201 (SEQIDNO:8) SLEDKAFQL 9 ORF9b 7 0.4349 A0201 512 1.2840 10 354 2.8249 1 A0201 (SEQIDNO:7) FGDDTVIEV 9 nsp3 2 0.5348 A0201 629 1.5774 114 7746 1.4717 1 A0201 (SEQIDNO:23) KAFQLTPIAV 10 ORF9b 2 0.5696 A0201 682 1.7103 12 354 3.3898 1 A0201 (SEQIDNO:13) ELPDEFVVV 9 ORF9b 5 0.7673 A0201 1006 2.5229 18 354 5.0847 1 A0201 (SEQIDNO:12) NLNESLIDL 9 S 1 0.8444 A0201 1131 2.8364 140 5090 2.7473 1 A0201 (SEQIDNO:40) STSAFVETV 9 nsp2 2 1.3088 A0201 1866 4.6796 84 2518 3.3360 1 A0201 (SEQIDNO:19) GPMVLRGLIT 10 S.iORF1/2 6 2.1237 B0702 3184 7.9850 18 90 20.0000 0 unknown (SEQIDNO:6) MLLGSMLYM 9 S.iORF1 3 2.1581 A0201 3238 8.1204 23 122 18.8525 0 unknown (SEQIDNO:4) APRITFGGP 9 N 3 3.0563 B0702 4781 11.9900 151 1642 9.1961 0 unknown (SEQIDNO:42) AGTDTTITV 9 nsp5 1 3.4456 A0201 5467 13.7103 129 1190 10.8403 0 unknown (SEQIDNO:26) NetMHC.EL rank percentile rank number # best best within rankwithin with %rank ofalleles allalleles pep viral experiments predicted predicted allviral allviral in within with with peptide length protein detected rank allele peptides proteins protein protein prank<=2 prank<=2 A549 VATSRTLSY 9 M 2 0.2747 C1203 319 0.8000 5 0.5855 3 A2501,C1203, (SEQIDNO:41) C1601 FAVDAAKAY 9 nsp10 5 0.0388 A2501 51 0.1279 1 0.1916 4 A2501,B1801, (SEQIDNO:28) C1203,C1601 FASEAARVV 9 nsp2 7 0.4669 C1203 537 1.3467 37 1.4694 2 C1203,C1601 (SEQIDNO:17) DEFVVVTV 8 ORF9b 3 0.3051 B1801 358 0.8978 5 1.4124 1 B1801 (SEQIDNO:11) NATNVVIKV 9 S 4 4.4224 C1203 3870 9.7053 482 9.4584 0 unknown (SEQIDNO:37) EIKESVQTF 9 nsp2 2 0.0116 A2501 18 0.0451 2 0.0794 1 A2501 (SEQIDNO:15) EEFEPSTQYEY 11 nsp3 1 0.0604 B1801 76 0.1906 21 0.2711 2 B1801,B4403 (SEQIDNO:20) SEFSSLPSY 9 nsp8 1 0.0049 B1801 6 0.0150 1 0.1319 3 A2501,B1801, (SEQIDNO:27) B4403 TVIEVQGY 8 nsp3 1 0.6897 A2501 764 1.9160 193 2.4916 1 A2501 (SEQIDNO:22) LATNNLVVM 9 nsp2 1 0.8716 C1203 932 2.3373 72 2.8594 2 C1203,C1601 (SEQIDNO:16) TTTIKPVTY 9 nsp3 1 0.5000 A2501 571 1.4320 139 1.7945 1 A2501 (SEQIDNO:21) EILDITPCSF 10 S 6 0.2582 A2501 303 0.7599 35 0.6868 1 A2501 (SEQIDNO:33) TAQNSVRVL 9 nsp2 1 0.6833 C1601 756 1.8959 56 2.2240 2 C1203,C1601 (SEQIDNO:18) LEDKAFQL 8 ORF9b 1 2.3170 B1801 2268 5.6878 21 5.9322 0 unknown (SEQIDNO:10) VGYLQPRTF 9 S 5 0.3630 C1610 409 1.0257 51 1.0008 2 C1203,C1601 (SEQIDNO:39) QLTPTWRVY 9 S 3 1.9329 A2501 1915 4.8025 239 4.6900 1 A2501 (SEQIDNO:38) KNIDGYFKIY 10 S 5 4.5554 B4403 3961 9.9335 493 9.6743 0 unknown (SEQIDNO:36) EILDITPCSFG 11 S 3 24.2039 A2501 16524 41.4395 2066 40.5416 0 unknown (SEQIDNO:47) HEK293 YLFDESGEFKL 11 nsp3 1 0.0721 A0201 27 0.0677 5 0.0645 1 A0201 (SEQIDNO:25) KRVDWTIEY 9 nsp14 2 0.0798 C0702 29 0.0727 3 0.1446 1 C0702 (SEQIDNO:29) APHGHVMVEL 10 nsp1 2 0.1336 B0702 61 0.1530 2 0.2915 1 B0702 (SEQIDNO:14) IRQEEVQEL 9 ORF7a 3 0.2608 C0702 126 0.3160 1 0.2222 1 C0702 (SEQIDNO:31) YLNSTNVTI 9 nsp3 1 0.1219 A0201 57 0.1429 9 0.1162 1 A0201 (SEQIDNO:24) SVVSKVVKV 9 nsp15 1 0.7246 A0201 410 1.0282 15 1.1111 1 A0201 (SEQIDNO:30) GLITLSYHL 9 S.iORF1/2 1 0.1875 A0201 88 0.2207 1 1.1111 1 A0201 (SEQIDNO:5) ELPDEFVVVTV 11 ORF9b 1 4.4149 A0201 2917 7.3154 36 10.1695 0 unknown (SEQIDNO:8) SLEDKAFQL 9 ORF9b 7 0.2732 A0201 135 0.3386 5 1.4124 1 A0201 (SEQIDNO:7) FGDDTVIEV 9 nsp3 2 0.8750 A0201 504 1.2639 89 1.1490 1 A0201 (SEQIDNO:23) KAFQLTPIAV 10 ORF9b 2 5.8640 A0201 3877 9.7229 57 16.1017 0 unknown (SEQIDNO:13) ELPDEFVVV 9 ORF9b 5 1.4838 A0201 915 2.2947 17 4.8023 1 A0201 (SEQIDNO:12) NLNESLIDL 9 S 1 0.5256 A0201 272 0.6821 22 0.4317 1 A0201 (SEQIDNO:40) STSAFVETV 9 nsp2 2 1.3131 A0201 804 2.0163 38 1.5091 1 A0201 (SEQIDNO:19) GPMVLRGLIT 10 S.iORF1/2 6 5.0765 B0702 3370 8.4514 22 24.4444 0 unknown (SEQIDNO:6) MLLGSMLYM 9 S.iORF1 3 0.5413 A0201 287 0.7197 4 3.2787 1 A0201 (SEQIDNO:4) APRITFGGP 9 N 3 2.8837 B0702 1897 4.7574 55 3.3496 0 unknown (SEQIDNO:42) AGTDTTITV 9 nsp5 1 6.0434 A0201 4023 10.0890 116 9.7479 0 unknown (SEQIDNO:26)
(438) TABLE-US-00014 TABLE 9B Allele Frequencies allele locus World EUR AFA API HIS USA A0101 A 0.04843 0.17181 0.04742 0.05082 0.06702 0.1285958 A0201 A 0.15284 0.29604 0.12458 0.09458 0.19403 0.2415828 A0202 A 0.00803 0.00083 0.04201 0.00028 0.00678 0.0073167 A0203 A 0.0151 0 0.00021 0.03162 0.00025 0.0022221 A0204 A 0.00295 0 0.00021 0 0.00276 0.0005137 A0205 A 0.00849 0.00801 0.01872 0.00339 0.01481 0.0103171 A0206 A 0.03469 0.00197 0.00021 0.04828 0.03916 0.0114304 A0207 A 0.02127 0 0 0.04376 0 0.0029757 A0211 A 0.00316 0 0.00021 0.01158 0.00326 0.0013891 A0301 A 0.04272 0.14347 0.08132 0.02597 0.07907 0.1158797 A1101 A 0.11661 0.05642 0.01581 0.17899 0.04618 0.0575514 A1102 A 0.00698 0.00006 0 0.01525 0 0.0010744 A2301 A 0.02335 0.01684 0.10774 0.00226 0.0369 0.0314688 A2402 A 0.18816 0.08686 0.02205 0.18238 0.12324 0.0911385 A2407 A 0.0046 0.00006 0.00083 0.01779 0.0005 0.0014455 A2501 A 0.00451 0.01925 0.00499 0.00056 0.00879 0.0142415 A2601 A 0.03354 0.02948 0.01414 0.03896 0.02887 0.0279771 A2902 A 0.01626 0.03279 0.0364 0.00141 0.04167 0.0326992 A3001 A 0.02505 0.01341 0.06905 0.02061 0.02108 0.0226496 A3002 A 0.01489 0.00921 0.06219 0.00056 0.02811 0.0189945 A3101 A 0.04093 0.02351 0.0104 0.03247 0.04794 0.0266753 A3201 A 0.01434 0.03133 0.01414 0.01299 0.02711 0.0270539 A3301 A 0.01153 0.00991 0.02121 0.00113 0.01958 0.0125178 A3303 A 0.04081 0.00133 0.04451 0.0943 0.01305 0.0154576 A3401 A 0.01618 0 0.00042 0.01581 0.00025 0.0011749 A3402 A 0.00535 0.00044 0.03349 0.00028 0.00326 0.0053211 A3601 A 0.00391 0.00006 0.02413 0 0.00276 0.0037324 A6601 A 0.00573 0.00261 0.01477 0.00028 0.00552 0.004581 A6801 A 0.02299 0.02503 0.03681 0.01863 0.04694 0.0300177 A6802 A 0.01323 0.00845 0.0651 0.00028 0.0246 0.0182713 A7401 A 0.00779 0.00006 0.0522 0.00113 0.00753 0.0083821 B0702 B 0.04105 0.13987 0.07303 0.02632 0.05453 0.108239 B0704 B 0.03122 0.00044 0 0 0 0.0002741 B0801 B 0.0296 0.12525 0.03838 0.01641 0.04452 0.0920867 B1301 B 0.0257 0 0.00041 0.03254 0.00075 0.0023993 B1302 B 0.01418 0.02644 0.00954 0.0232 0.01201 0.0214323 B1402 B 0.01234 0.03095 0.02199 0.00113 0.04102 0.0295029 B1501 B 0.03431 0.06654 0.00975 0.0348 0.02876 0.0501793 B1502 B 0.01319 0 0.00083 0.03565 0.00025 0.0025786 B1503 B 0.01184 0.00089 0.06245 0.00028 0.01601 0.0116971 B1510 B 0.00612 0.00013 0.03029 0.00085 0.00475 0.0050034 B1517 B 0.00294 0.00273 0.00602 0.00453 0.0065 0.0039535 B1801 B 0.02299 0.0462 0.03568 0.0116 0.03952 0.0412724 B2705 B 0.01236 0.03254 0.00664 0.00849 0.01676 0.0246826 B3501 B 0.05466 0.05713 0.06494 0.04273 0.06353 0.0583159 B3503 B 0.0093 0.01563 0.00353 0.02405 0.01376 0.0142641 B3507 B 0.01281 0 0 0 0 0 B3701 B 0.02498 0.01347 0.00539 0.01471 0.00575 0.011121 B3801 B 0.00789 0.0218 0.00166 0.00453 0.01926 0.0175 B3802 B 0.00928 0 0 0.0365 0 0.002482 B4001 B 0.0512 0.05643 0.01328 0.0798 0.01351 0.0447263 B4002 B 0.04175 0.00991 0.00353 0.03056 0.04852 0.017261 B4006 B 0.01799 0.00006 0.00021 0.03707 0.00275 0.0030701 B4201 B 0.01045 0 0.05456 0 0.00625 0.0083565 B4402 B 0.02162 0.09011 0.02116 0.00764 0.03327 0.0653279 B4403 B 0.04473 0.04963 0.05373 0.04244 0.06078 0.0516488 B4501 B 0.00995 0.00426 0.04502 0.00226 0.01526 0.0114811 B4601 B 0.02358 0 0 0.06112 0 0.0041562 B4901 B 0.00881 0.01341 0.02822 0.00113 0.02351 0.0163223 B5001 B 0.00933 0.00807 0.00934 0.00736 0.01451 0.0093241 B5101 B 0.05222 0.04544 0.02178 0.06282 0.05778 0.0456469 B5201 B 0.02331 0.0096 0.01432 0.03679 0.02676 0.0150968 B5301 B 0.01622 0.00324 0.11245 0.00085 0.01551 0.0197619 B5401 B 0.01386 0 0 0.03282 0.00025 0.0022758 B5501 B 0.00624 0.01729 0.00415 0.00538 0.01051 0.0135392 B5502 B 0.01 0 0 0.01585 0 0.0010778 B5601 B 0.01416 0.00496 0.00228 0.00792 0.0035 0.0045479 B5701 B 0.01018 0.03832 0.00477 0.02066 0.01176 0.0279824 B5703 B 0.00468 0.00032 0.03382 0 0.00675 0.0058854 B5801 B 0.02891 0.0047 0.03506 0.05772 0.01451 0.0140698 B5802 B 0.00836 0.00006 0.04108 0 0.0045 0.006293 C0102 C 0.08481 0.02922 0.0085 0.13375 0.04927 0.0371011 C0202 C 0.02805 0.03729 0.08461 0.00395 0.04227 0.0421929 C0302 C 0.02461 0.00146 0.01369 0.05643 0.00625 0.0076676 C0303 C 0.0558 0.05457 0.01182 0.05023 0.03402 0.0449723 C0304 C 0.09132 0.08215 0.0533 0.08352 0.06978 0.076229 C0401 C 0.11177 0.10534 0.18457 0.0807 0.16508 0.1247163 C0403 C 0.01942 0 0.00041 0.01467 0.00025 0.0010961 C0501 C 0.02614 0.09136 0.03526 0.00847 0.04652 0.0703703 C0602 C 0.0616 0.09301 0.08855 0.06518 0.05878 0.0844999 C0701 C 0.06887 0.16658 0.12401 0.03894 0.10355 0.1411454 C0702 C 0.13101 0.15006 0.06968 0.1456 0.11281 0.1325102 C0704 C 0.01467 0.01118 0.00871 0.01016 0.0095 0.0104865 C0801 C 0.04522 0.00006 0.00124 0.07985 0.02826 0.0106059 C0802 C 0.02017 0.03875 0.03733 0.00395 0.04927 0.0380463 C1202 C 0.03191 0.00934 0.00145 0.04486 0.01301 0.0113519 C1203 C 0.01959 0.04892 0.01783 0.02737 0.04127 0.0419732 C1402 C 0.02539 0.0115 0.01265 0.04797 0.01326 0.0144427 C1403 C 0.01471 0.00013 0.0027 0.01383 0.0005 0.0014685 C1502 C 0.03362 0.01861 0.00539 0.04966 0.03052 0.0210593 C1601 C 0.0242 0.03539 0.09788 0.00169 0.05053 0.0440742 C1701 C 0.0188 0.00667 0.07362 0.00141 0.02251 0.0180045
(439) TABLE-US-00015 TABLE9C EstimatedPopulationCoverage thr0.1_ thr0.1_ thr0.1_ thr0.2_ thr0.2_ thr0.2_ thr0.3_ thr0.3_ thr0.3_ thr0.4_ thr0.4_ thr0.5_ thr0.5_ thr0.5_ Pep- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- assign_ num_ thr0.4_ assign_ num_ cover- tide alleles alleles age alleles alleles age alleles alleles age alleles alleles coverage alleles alleles age A549 DEF B1801, 5 0.2519 B1801, 5 0.2519 B1801, 6 0.2827 B1801, 7 0.2995 B1801, 7 0.2995 VV B4002, B4002, B4002, B4002, B4002, VT B4901, B4901, B4006, B4006, B4006, V B5001, B5001, B4901, B4501, B4501, (SEQ B5101 B5101 B5001, B4901, B4901, ID B5101 B5001, B5001, NO: B5101 B5101 11) LED unknown 0 0.0000 unknown 0 0.0000 B1801, 2 0.1429 B1801, 3 0.1771 A0202, 6 0.3022 KAF B4001 B4001, B1801, QL C0802 B4001, (SEQ B4402, ID B4403, NO: C0802 10) TVI A2501, 2 0.0747 A2501, 2 0.0747 A2501, 3 0.0822 A2501, 3 0.0822 A2501, 5 0.1409 EV A2601 A2601 A2601, A2601, A2601, QG A3601 A3601 A2902, Y A3002, (SEQ A3601 ID NO: 22) EIK A2501, 2 0.0747 A2501, 2 0.0747 A2501, 2 0.0747 A2501, 3 0.0989 A2501, 4 0.1555 ESV A2601 A2601 A2601 A2601, A2601, QTF B1502 B1502, (SEQ C1202 ID NO: 15) FAS C0303, 4 0.3454 C0302, 6 0.4774 C0202, 8 0.5605 C0202, 9 0.6184 B5101, 11 0.6793 EA C0304, C0303, C0302, C0302, C0202, AR C1203, C0304, C0303, C0303, C0302, VV C1601 C0602, C0304, C0304, C0303, (SEQ C1203, C0602, C0602, C0304, ID C1601 C1202, C0801, C0602. NO: C1203, C1202, C0801, 17) C1601 C1203, C0802, C1601 C1202, C1203, C1601 FAV B3501. 8 0.4234 B3501, 10 0.5663 B1502. 11 0.5788 B1502, 11 0.5788 B1502, 11 0.5788 DA B3507, B3507, B3501, B3501, B3501, AK B4601, B4601, B3507, B3507, B3507, AY C0202, C0202, B4601, B4601, B4601, (SEQ C0302, C0302, C0202. C0202, C0202, ID C0303, C0303, C0302, C0302. C0302, NO: C1202, C0304, C0303, C0303, C0303, 28) C1601 C1202, C0304, C0304, C0304, C1203, C1202, C1202, C1202, C1601 C1203, C1203, C1203, C1601 C1601 C1601 LAT C0704, 2 0.0673 B3503, 5 0.1748 B3503, 7 0.3482 B3503, 8 0.4333 B3503, 9 0.4615 NN C1203 C0302, B3507, B3507, B3507, LV C0704, C0302, C0302, C0302, VM C1203, C0304, C0303, C0303, (SEQ C1601 C0704, C0304, C0304, ID C1203, C0704, C0403, NO: C1601 C1203, C0704, 16) C1601 C1203, C1601 NA A6802, 2 0.0641 A6802, 2 0.0641 A0206, 3 0.1287 A0206, 5 0.3126 A0206, 6 0.3404 TN C1203 C1203 A6802, A6802, A6802, VVI C1203 B5101, B5101, KV C0602, C0602, (SEQ C1203 C1203, ID C1701 NO: 37) QLT unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 A3002 1 0.0296 PT WR VY (SEQ ID NO: 38) SEF B1801, 2 0.1309 B1801, 3 0.1707 B1801, 3 0.1707 B1801, 3 0.1707 B1801, 3 0.1707 SSL B4403 B4402, B4402, B4402, B4402, PSY B4403 B4403 B4403 B4403 (SEQ ID NO: 27) TA unknown 0 0.0000 C1601 1 0.0478 C1203, 2 0.0857 C1203, 2 0.0857 C0102, 5 0.4754 QNS C1601 C1601 C0303, VR C0304, VL C1203, (SEQ C1601 ID NO: 18) TTT B1517, 2 0.0534 B1517, 2 0.0534 A3601, 3 0.0608 A0101, 4 0.1499 A0101, 4 0.1499 IKP C1601 C1601 B1517, A3601, A3601, VT C1601 B1517, B1517, Y C1601 C1601 (SEQ ID NO: 21) VA B1517, 3 0.1070 B1517, 5 0.2104 B1517, 6 0.2473 B1517, 7 0.2670 A3601, 8 0.2727 TSR C0202, C0202, B4601, B3507, B1517, TLS C1601 C0302, C0202, B4601, B3507, Y C1202, C0302, C0202, B4601, (SEQ C1601 C1202, C0302, C0202, ID C1601 C1202, C0302, NO: C1601 C1202, 41) C1601 VG unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 YL QPR TF (SEQ ID NO: 39) EIL A2501 1 0.0090 A2501 1 0.0090 A2501 1 0.0090 A2501 1 0.0090 A2501, 2 0.0747 DIT A2601 PCS F (SEQ ID NO: 33) KNI unknown 0 0.0000 A3002, 2 0.0937 A3002, 2 0.0937 A3002, 4 0.2313 A3002, 5 0.2535 DG C1502 C1502 B5802, A3201, YFK C0701, B5802, IY C1502 C0701, (SEQ C1502 ID NO: 36) EEF B1801, 3 0.1707 B1801, 3 0.1707 B1801, 3 0.1707 B1801, 3 0.1707 B1801, 3 0.1707 EPS B4402, B4402, B4402, B4402, B4402, TQ B4403 B4403 B4403 B4403 B4403 YE Y (SEQ ID NO: 20) EIL unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 DIT PCS FG (SEQ ID NO: 47) HEK293 AG unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 C0704 1 0.0291 TDT TIT V (SEQ ID NO: 26 APR unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 ITF GGP (SEQ ID NO: 42) ELP A0207 1 0.0421 A0206, 2 0.1088 A0206, 2 0.1088 A0206, 2 0.1088 A0206, 2 0.1088 DEF A0207 A0207 A0207 A0207 VV V (SEQ ID NO: 12 FGD A0207, 4 0.1639 A0207, 6 0.4213 A0206, 7 0.4616 A0206, 7 0.4616 A0206, 8 0.5806 DT C0403, C0401, A0207, A0207, A0207, VIE C0501, C0403, C0401, C0401, C0304, V C0802 C0501, C0403, C0403, C0401, (SEQ C0801, C0501, C0501, C0403, ID C0802 C0801, C0801, C0501, NO: C0802 C0802 C0801, 23) C0802 GLI unknown 0 0.0000 unknown 0 0.0000 A0201, 2 0.2959 A0201, 2 0.2959 A0201, 2 0.2959 TLS A0202 A0202 A0202 YH L (SEQ ID NO: 5) IRQ unknown 0 0.0000 C0702 1 0.2449 C0701, 2 0.3598 C0602, 3 0.4546 C0602, 3 0.4546 EEV C0702 C0701, C0701, QEL C0702 C0702 (SEQ ID NO: 31) KR B2705, 3 0.3755 B2705, 4 0.4680 B1503, 5 0.4807 A3201, 6 0.4955 A3201, 6 0.4955 VD C0701, C0602, B2705, B1503, B1503, WTI C0702 C0701, C0602, B2705, B2705, EY C0702 C0701, C0602, C0602, (SEQ C0702 C0701, C0701, ID C0702 C0702 NO: 29) ML unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 LGS ML YM (SEQ ID NO: 4) NL unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 A0204 1 0.0059 A0204 1 0.0059 NES LID L (SEQ ID NO: 40) SLE unknown 0 0.0000 A0207 1 0.0421 A0207 1 0.0421 A0204, 2 0.0479 A0201, 4 0.3359 DK A0207 A0202, AFQ A0204, L A0207 (SEQ ID NO: 7) STS A0205 1 0.0169 A0205, 2 0.0430 A0205, 2 0.0430 A0205, 2 0.0430 A0203, 3 0.0723 AFV A6802 A6802 A6802 A0205, ETV A6802 (SEQ ID NO: 19) SVV A0203, 4 0.1379 A0201, 6 0.4493 A0201, 9 0.5134 A0201, 11 0.5502 A0201, 12 0.5688 SKY A0205, A0203, A0203, A0203, A0203, VK A0206, A0205, A0205, A0204, A0204, V A6802 A0206, A0206, A0205, A0205, (SEQ A2601, A0207, A0206, A0206, ID A6802 A0211, A0207, A0207, NO: A2601, A0211, A0211, 30) A6802, A2601, A2601, C0202 A6802, A6802, C0202, C0202, C1502 C1203, C1502 YL unknown 0 0.0000 A0201, 2 0.3077 A0201, 3 0.3210 A0201, 4 0.3258 A0201, 5 0.3448 NST A0203 A0202, A0202, A0202, NV A0203 A0203, A0203, TI A0204 A0204, (SEQ B1302 ID NO: 24) APH B4201 1 0.0208 B0702, 4 0.2120 B0702, 5 0.2350 B0702, 6 0.3036 B0702, 7 0.3256 GH B0704, B0704, B0704, B0704, VM B0801, B0801, B0801, B0801, VEL B4201 B4201, B4201, B4201, (SEQ C0704 C0704, B5601, ID C0801 C0704, NO: C0801 14) GP unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 MV LRG LIT (SEQ ID NO: 6) KAF A0211, 2 0.0433 A0211, 3 0.0697 A0211, 6 0.1834 A0211, 7 0.2156 A0211, 8 0.2547 QLT C1701 B5401, B5101, B5101, B5101, PIA C1701 B5401, B5401, B5201, V B5502, B5502, B5401, (SEQ C1701, C1203, B5502, ID G0104 C1701, C1203, NO: G0104 C1701, 13) G0104 ELP A0207 1 0.0421 A0207 1 0.0421 A0207, 2 0.0862 A0207, 3 0.2346 A0201, 5 0.4723 DEF B5201 B5201, A0207, VV C0102 A6802, VT B5201, V C0102 (SEQ ID NO: 8) YLF A0201, 4 0.3061 A0201, 13 0.4768 A0201, 15 0.5127 A0201, 19 0.6719 A0201, 21 0.6927 DES A0202, A0202, A0202, A0202, A0202, GEF A0204, A0203, A0203, A0203, A0203, KL A0211 A0204, A0204, A0204, A0204, (SEQ A0205, A0205, A0205, A0205, ID A0206, A0206, A0206, A0206, NO: A0207, A0207, A0207, A0207, 25) A0211, A0211, A0211, A0211, A2902, A2902, A2902, A2902, C1701, B1301, A3201, A3201, G0101, B3503, B1301, B1301, G0103, C1701, B3501, B1302, G0104 G0101, B3503, B3501, G0103, C0304, B3503, G0104 C0403, C0304, C1701, C0403, G0101, C0704, G0103, C1701, G0104 G0101, G0103, G0104 Peps B1801, 38 0.9585 B1801, 52 0.9958 B1801, 60 0.9978 B1801, 65 0.9996 B1801, 67 0.9996 Com B4002, B4002, B4002, B4002, B4002, bined B4901, B4901, B4006, B4006, B4006, B5001, B5001, B4901, B4501, B4501, B5101, B5101, B5001, B4901, B4901, unknown, unknown, B5101, B5001, B5001, A2 A2 B1801, B5101, B5101, 501,A2 501,A2 B4001, B1801, A0202, 601,A2 601,A2 A2501, B4001, B1801, 501,A2 501,A2 A2601, C0802, B4001, 601,C0 601,C0 A3601, A2501, B4402, 303,C0 302,C0 A2501, A2601, B4403, 304,C1 303,C0 A2601, A3601, C0802, 203,C1 304,C0 C0202, A2501, A2501, 601,B3 602,C1 C0302, A2601, A2601, 501,B3 203,C1 C0303, B1502, A2902, 507,B4 601,B3 C0304, C0202, A3002, 601,C0 501,B3 C0602, C0302, A3601, 202,C0 507,B4 C1202, C0304, A2601, 303,C1 202,C0 C1601, C0602, B1502, 202,C1 302,C0 B1502, C0801, C1202, 601,C0 303,C0 B3501, C1202, B5101, 704,C1 304,C1 B3507, C1203, C0202, 203,A6 202,C1 B4601, C1601, C0302, 802,C1 203,C1 C0202, B1502, C0303, 203,un 601,B3 C0302, B3501, C0304, known, 503,C0 C0303, B3507, C0602, B1801, 302,C0 C0304, B4601, C0801, B4403, 704,C1 C1202, C0202, C0802, unkno 203,C1 C1203, C0302, C1202, wn,B1 601,A6 C1601, C0303, C1203, 517,C1 802,C1 B3503, C0304, C1601, 601,B1 203,un B3507, C1202, B1502, 517,C0 known, C0302, C1203, B3501, 202,C1 B1801, C0304, C1601, B3507, 601,un B4402, C0704, B3503, B4601, known, B4403, C1203, B3507, C0202, A2501, C1601, C1601, C0302, C0302, unkno B1517, A0206, C0303, C0303, wn,B1 C1601, A6802, C0304, C0304, 801,B4 B1517, C1203, C0704, C1202, 402,B4 C0202, unkno C1203, C1203, 403,un C0302, wn,B18 C1601, C1601, known, C1202, 01,B44 A0206, B3503, unkno C1601, 02,B44 A6802, B3507, wn,unk unkno 03,C12 B5101, C0302, nown, wn,A2 03,C16 C0602, C0303, A0207, 501,A3 01,A36 C1203, C0304, A0207, 002,C1 01,B15 unknow C0403, C0403, 502,B1 17,C16 n,B180 C0704, C0501, 801,B4 01,B15 1,B440 C1203, C0802, 402,B4 17,B46 2,B440 C1601, unkno 403,un 01,C02 3,C120 A0206, wn,unk known, 02,C03 3,C160 A6802, nown, unkno 02,C12 1,A010 B5101, B2705, wn,unk 02,C16 1,A360 C0602, C0701, nown, 01,unk 1,B151 C1203, C0702, A0206, nown, 7,C160 C1701, unkno A0207, A2501, 1,B151 A3002, wn,unk A0207, A3002, 7,B350 B1801, nown,u C0401, C1502, 7,B460 B4402, nknow C0403, B1801, 1,C020 B4403, n,A020 C0501, B4402, 2,C030 C0102, 5,A020 C0801, B4403, 2,C120 C0303, 3,A020 C0802, unkno 2,C160 C0304, 5,A020 unkno wn,unk 1,unkno C1203, 6,A680 wn,C07 nown,u wn,A25 C1601, 2,unkn 02,B27 nknow 01,A30 A0101, own,B 05,C06 n,A020 02,B58 A3601, 4201,u 02,C07 6,A020 02,C07 B1517, nknow 01,C07 7,A020 01,C15 C1601, n,A021 02,unk 6,A020 02,B18 A3601, 1,C170 nown,u 7,C040 01,B44 B1517, 1,A020 nknow 1,C040 02,B44 B3507, 7,A020 n,A020 3,C050 03,unkn B4601, 1,A020 7,A020 1,C080 own,un C0202, 2,A020 5,A680 1,C080 known, C0302, 4,A021 2,A020 2,A020 unknow C1202, 1 1,A020 1,A020 n,A020 C1601, 3,A020 2,C070 6,A020 unkno 5,A020 1,C070 7,A020 wn,A2 6,A260 2,B150 6,A020 501,A2 1,A680 3,B270 7,C040 601,A3 2,A020 5,C060 1,C040 002,A3 1,A020 2,C070 3,C050 802,C0 2,B070 2,unkn 1,C080 701,C1 4,B080 own,un 2,A020 502,B1 1,B420 known, 1,A020 801,B4 1,unkn A0207, 2,C060 402,B4 own,A A0205, 2,C070 403,un 0211,B A6802, 1,C070 known, 5401,C A0201, 2,A320 C0704, 1701,A A0203, 1,B150 unkno 0207,A A0205, 3,B270 wn,A0 0201,A A0206, 5,C060 206,A0 0202,A A0207, 2,C070 207,A0 0203,A A0211, 1,C070 206,A0 0204,A A2601, 2,unkno 207,C0 0205,A A6802, wn,A02 304,C0 0206,A C0202, 04,A02 401,C0 0207,A A0201, 04,A02 403,C0 0211,A A0202, 07,A02 501,C0 2902,C A0203, 05,A68 801,C0 1701,G B0702, 02,A02 802,A0 0101,G B0704, 01,A02 201,A0 0103,G B0801, 03,A02 202,C0 0104 B4201, 04,A02 602,C0 C0704, 05,A02 701,C0 unkno 06,A02 702,A3 wn,A0 07,A02 201,B1 211,B5 11,A26 503,B2 101,B5 01,A68 705,C0 401,B5 02,C02 602,C0 502,C1 02,C15 701,C0 701,G0 02,A02 702,un 104,A0 01,A02 known, 207,B5 02,A02 A0204, 201,A0 03,A02 A0201, 201,A0 04,B07 A0202, 202,A0 02,B07 A0204, 203,A0 04,B08 A0207, 204,A0 01,B42 A0203, 205,A0 01,C07 A0205, 206,A0 04,C08 A6802, 207,A0 01,unkn A0201, 211,A2 own,A0 A0203, 902,B1 211,B5 A0204, 301,B3 101,B5 A0205, 503,C1 401,B5 A0206, 701,G0 502,C1 A0207, 101,G0 203,C1 A0211, 103,G0 701,G0 A2601, 104 104,A0 A6802, 207,B5 C0202, 201,C0 C1203, 102,A0 C1502, 201,A0 A0201, 202,A0 A0202, 203,A0 A0203, 204,A0 A0204, 205,A0 B1302, 206,A0 B0702, 207,A0 B0704, 211,A2 B0801, 902,A3 B4201, 201,B1 B5601, 301,B3 C0704, 501,B3 C0801, 503,C0 unkno 304,C0 wn,A0 403,C1 211,B5 701,G0 101,B5 101,G0 201,B5 103,G0 401,B5 104 502,C1 203,C1 701,G0 104,A0 201,A0 207,A6 802,B5 201,C0 102,A0 201,A0 202,A0 203,A0 204,A0 205,A0 206,A0 207,A0 211,A2 902,A3 201,B1 301,B1 302,B3 501,B3 503,C0 304,C0 403,C0 704,C1 701,G0 101,G0 103,G0 104 thr0.6_ thr0.6_ thr0.6_ thr0.7_ thr0.7_ thr0.7_ thr0.8_ thr0.8_ thr0.8_ thr0.9_ thr0.9_ thr0.9_ thr1_ thr1_ thr1_ Pep- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- tide alleles alleles age alleles alleles age alleles alleles age alleles alleles age alleles alleles age A549 DEF B1801, 9 0.4113 B1402, 10 0.4301 B1402,B1 11 0.4623 A6802, 12 0.4764 A6802, 13 0.5092 VV B3701, B1801, 801,B370 B1402, B1402, VT B4002, B3701, 1,B4002, B1801, B1801, V B4006, B4002, B4006,B4 B3701, B3701, (SEQ B4403, B4006, 402,B440 B4002, B4002, ID B4501, B4403, 3,B4501, B4006, B4006, NO: B4901, B4501, B4901,B5 B4402, B4402, 11) B5001, B4901, 001,B510 B4403, B4403, B5101 B5001, 1 B4501, B4501, B5101 B4901, B4901, B5001, B5001, B5101 B5101, B5201 LED A0202, 7 0.3149 A0202, 11 0.4085 A0202,A 13 0.4301 A0101, 14 0.4846 A0101, 15 0.4999 KAF B1801, A3601, 3601,B15 A0202, A0202, QL B3801, B1510, 10,B1801 A3601, A3601, (SEQ B4001, B1801, ,B3503,B B1510, B1510, ID B4402, B3503, 3801,B40 B1801, B1801, NO: B4403, B3801, 01,B4002 B3503, B3503, 10) C0802 B4001, ,B4402,B B3801, B3801, B4002, 4403,B45 B4001, B4001, B4402, 01,B5703 B4002, B4002, B4403, ,C0802 B4402, B4402, C0802 B4403, B4403, B4501, B4501, B5703, B5703, C0802 C0704, C0802 TVI A0101, 6 0.2283 A0101, 7 0.2485 A0101,A 8 0.3295 A0101, 9 0.3779 A0101, 9 0.3779 EV A2501, A2501, 2501,A26 A2501, A2501, QG A2601, A2601, 01,A2902 A2601, A2601, Y A2902, A2902, ,A3002,A A2902, A2902, (SEQ A3002, A3002, 3601,B15 A3002, A3002, ID A3601 A3601, 02,B3501 A3601, A3601, NO: B1502 B1501, B1501, 22) B1502, B1502, B3501 B3501 EIK A2501, 4 0.1555 A2501, 4 0.1555 A2501,A 4 0.1555 A2501, 5 0.2132 A2501, 5 0.2132 ESV A2601, A2601, 2601,B15 A2601, A2601, QTF B1502, B1502, 02,C1202 B1501, B1501, (SEQ C1202 C1202 B1502, B1502, ID C1202 C1202 NO: 15) FAS B5101, 11 0.6793 B5101, 11 0.6793 B5101,C0 11 0.6793 B5101, 12 0.7143 B5101, 13 0.7402 EA C0202, C0202, 202,C030 C0202, C0202, AR C0302, C0302, 2,C0303, C0302, C0302, VV C0303, C0303, C0304,C0 C0303, C0303, (SEQ C0304, C0304, 602,C080 C0304, C0304, ID C0602, C0602, 1,C0802, C0602, C0501, NO: C0801, C0801, C1202,C1 C0801, C0602, 17) C0802, C0802, 203,C160 C0802, C0801, C1202, C1202, 1 C1202, C0802, C1203, C1203, C1203, C1202, C1601 C1601 C1502, C1203, C1601 C1502, C1601 FAV B1501, 12 0.6105 B1501, 15 0.7553 A2902.B 16 0.7632 A2902, 16 0.7632 A2902, 17 0.7831 DA B1502, B1502, 1501,B15 B1501, B1501, AK B3501, B1503, 02,B1503 B1502, B1502, AY B3507, B3501, ,B3501,B B1503, B1503, (SEQ B4601, B3507, 3507,B46 B3501, B3501, ID C0202, B4601, 01,B5301 B3507, B3507, NO: C0302, B5301, ,C0202,C B4601, B4601, 28) C0303, C0202, 0302,C03 B5301, B5301, C0304, C0302, 03,C0304 C0202, C0202, C1202, C0303, ,C0702,C C0302, C0302, C1203, C0304, 1202,C12 C0303, C0303, C1601 C0702, 03,C1601 C0304, C0304, C1202, C0702, C0702, C1203, C1202, C1202, C1601 C1203, C1203, C1601 C1402, C1601 LAT B3503, 10 0.4882 B3501, 11 0.5438 B3501,B3 12 0.5827 B3501, 12 0.5827 B3501, 12 0.5827 NN B3507, B3503, 503,B350 B3503, B3503, LV C0302, B3507, 7,C0302, B3507, B3507, VM C0303, C0302, C0303,C0 C0302, C0302, (SEQ C0304, C0303, 304,C040 C0303, C0303, ID C0403, C0304, 3,C0704, C0304, C0304, NO: C0704, C0403, C1202,C1 C0403, C0403, 16) C1203, C0704, 203,C160 C0704, C0704, C1601, C1203, 1,C1701 C1202, C1202, C1701 C1601, C1203, C1203, C1701 C1601, C1601, C1701 C1701 NA A0206, 6 0.3404 A0206, 6 0.3404 A0206,A 7 0.3754 A0206, 10 0.4911 A0206, 13 0.5660 TN A6802, A6802, 6802,B51 A6802, A6802, VVI B5101, B5101, 01,C0602 B1302, B1302, KV C0602, C0602, ,C1203,C B5101, B5101, (SEQ C1203, C1203, 1601,C17 C0202, B5301, ID C1701 C1701 01 C0602, C0202, NO: C0801, C0602, 37) C1203, C0704, C1601, C0801, C1701 C1203, C1502, C1601, C1701 QLT A3002 1 0.0296 A3002 1 0.0296 A3002,B 3 0.1002 A3002, 3 0.1002 A3002, 3 0.1002 PT 1502,C16 B1502, B1502, WR 01 C1601 C1601 VY (SEQ ID NO: 38) SEF B1801, 3 0.1707 B1801, 3 0.1707 B1801,B4 3 0.1707 B1801, 3 0.1707 B1801, 3 0.1707 SSL B4402, B4402, 402,B440 B4402, B4402, PSY B4403 B4403 3 B4403 B4403 (SEQ ID NO: 27) TA B0704, 7 0.5878 B0704, 8 0.5967 B0704,B4 8 0.5967 B0704, 8 0.5967 B0704, 9 0.6143 QNS C0102, B4201, 201,C010 B4201, B4201, VR C0303, C0102, 2,C0303, C0102, C0102, VL C0304, C0303, C0304,C0 C0303, C0303, (SEQ C0602, C0304, 602,C120 C0304, C0304, ID C1203, C0602, 3,C1601 C0602, C0602, NO: C1601 C1203, C1203, C0704, 18) C1601 C1601 C1203, C1601 TTT A0101, 5 0.1722 A0101, 6 0.2105 A0101,A 6 0.2105 A0101, 9 0.2810 A0101, 9 0.2810 IKP A3601, A3601, 3601,B15 A3002, A3002, VT B1502, B1502, 02,B1517 A3601, A3601, Y B1517, B1517, ,B1801,C B1502, B1502, (SEQ C1601 B1801, 1601 B1517, B1517, ID C1601 B1801, B1801, NO: B5701, B5701, 21) C1203, C1203, C1601 C1601 VA A2902, 10 0.3268 A2902, 10 0.3268 A2902,A 10 0.3268 A2902, 10 0.3268 A2902, 10 0.3268 TSR A3601, A3601, 3601,B15 A3601, A3601, TLS B1517, B1517, 17,B3507 B1517, B1517, Y B3507, B3507, ,B4601,C B3507, B3507, (SEQ B4601, B4601, 0202,C03 B4601, B4601, ID C0202, C0202, 02,C1202 C0202, C0202, NO: C0302, C0302, ,C1203,C C0302, C0302, 41) C1202, C1202, 1601 C1202, C1202, C1203, C1203, C1203, C1203, C1601 C1601 C1601 C1601 VG B1503 1 0.0235 B1503, 2 0.0702 B1503,B5 3 0.0859 B1503, 3 0.0859 B1503, 3 0.0859 YL C1601 802,C160 B5802, B5802, QPR 1 C1601 C1601 TF (SEQ ID NO: 39) EIL A2501, 2 0.0747 A2301, 3 0.1190 A2301,A 4 0.1437 A2301, 6 0.1784 A2301, 8 0.1999 DIT A2601 A2501, 2501,A26 A2407, A2407, PCS A2601 01,A6802 A2501, A2501, F A2601, A2601, (SEQ A3201, A3201, ID A6802 A6802, NO: B1502, 33) G0104 KNI A3002, 7 0.2756 A3002, 7 0.2756 A3002,A 8 0.2906 A2601, 10 0.3699 A2601, 11 0.4034 DG A3201, A3201, 3201,B15 A3002, A3002, YFK B1503, B1503, 03,B1517 A3201, A3201, IY B1517, B1517, ,B5701,B B1503, B1503, (SEQ B5802, B5802, 5802,C07 B1517, B1517, ID C0701, C0701, 01,C1502 B1801, B1801, NO: C1502 C1502 B5701, B5701, 36) B5802, B5802, C0701, C0701, C1502 C1502, C1601 EEF B1801, 3 0.1707 B1801, 3 0.1707 A3201,B 5 0.2881 A3201, 5 0.2881 A2902, 6 0.3114 EPS B4402, B4402, 1801,B35 B1801, A3201, TQ B4403 B4403 01,B4402 B3501, B1801, YE ,B4403 B4402, B3501, Y B4403 B4402, (SEQ B4403 ID NO: 20) EIL unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 DIT PCS FG (SEQ ID NO: 47) HEK293 AG C0704 1 0.0291 C0704 1 0.0291 C0704 1 0.0291 C0704 1 0.0291 C0704 1 0.0291 TDT TIT V (SEQ ID NO: 26) APR unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 ITF GGP (SEQ ID NO: 42) ELP A0206, 3 0.1336 A0206, 3 0.1336 A0201,A 5 0.3948 A0201, 5 0.3948 A0201, 5 0.3948 DEF A0207, A0207, 0206,A02 A0206, A0206, VV A6802 A6802 07,A6802 A0207, A0207, V ,G0104 A6802, A6802, (SEQ G0104 G0104 ID NO: 12) FGD A0201, 9 0.7054 A0201, 9 0.7054 A0201,A 11 0.7772 A0201, 11 0.7772 A0201, 11 0.7772 DT A0206, A0206, 0206,A02 A0206, A0206, VIE A0207, A0207, 07,C0303 A0207, A0207, V C0304, C0304, ,C0304,C C0303, C0303, (SEQ C0401, C0401, 0401,C04 C0304, C0304, ID C0403, C0403, 03,C0501 C0401, C0401, NO: C0501, C0501, ,C0801,C C0403, C0403, 23) C0801, C0801, 0802,C15 C0501, C0501, C0802 C0802 02 C0801, C0801, C0802, C0802, C1502 C1502 GLI A0201, 2 0.2959 A0201, 2 0.2959 A0201,A 3 0.3008 A0201, 3 0.3008 A0201, 4 0.3061 TLS A0202 A0202 0202,A02 A0202, A0202, YH 04 A0204 A0204, L A0211 (SEQ ID NO: 5) IRQ C0602, 3 0.4546 C0602, 3 0.4546 C0602,C0 3 0.4546 C0602, 3 0.4546 B1402, 5 0.4764 EEV C0701, C0701, 701,C070 C0701, B3801, QEL C0702 C0702 2 C0702 C0602, (SEQ C0701, ID C0702 NO: 31) KR A3201, 6 0.4955 A3201, 6 0.4955 A3201,B 8 0.5553 A3201, 8 0.5553 A3201, 8 0.5553 VD B1503, B1503, 1503,B27 B1503, B1503, WTI B2705, B2705, 05,B4601 B2705, B2705, EY C0602, C0602, ,C0202,C B4601, B4601, (SEQ C0701, C0701, 0602,C07 C0202, C0202, ID C0702 C0702 01,C0702 C0602, C0602, NO: C0701, C0701, 29) C0702 C0702 ML unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 LGS ML YM (SEQ ID NO: 4) NL A0204 1 0.0059 A0202, 3 0.0515 A0202,A 3 0.0515 A0201, 4 0.3258 A0201, 5 0.3603 NES A0203, 0203,A02 A0202, A0202, LID A0204 04 A0203, A0203, L A0204 A0204, (SEQ A0207 ID NO: 40) SLE A0201, 4 0.3359 A0201, 4 0.3359 A0201,A 4 0.3359 A0201, 5 0.3696 A0201, 6 0.3696 DK A0202, A0202, 0202,A02 A0202, A0202, AFQ A0204, A0204, 04,A0207 A0204, A0204, L A0207 A0207 A0207, A0207, (SEQ B1301 B1301, ID G0103 NO: 7) STS A0202, 5 0.1480 A0202, 6 0.2088 A0202,A 6 0.2088 A0202, 7 0.2405 A0202, 8 0.2457 AFV A0203, A0203, 0203,A02 A0203, A0203, ETV A0205, A0205, 05,A0206 A0205, A0205, (SEQ A6802, A0206, ,A6802,C A0206, A0206, ID C1502 A6802, 1502 A6802, A0211, NO: C1502 C1203, A6802, 19) C1502 C1203, C1502 SVV A0201, 12 0.5688 A0201, 12 0.5688 A0201,A 15 0.6069 A0201, 16 0.6589 A0201, 16 0.6589 SKY A0203, A0203, 0202,A02 A0202, A0202, VK A0204, A0204, 03,A0204 A0203, A0203, V A0205, A0205, ,A0205,A A0204, A0204, (SEQ A0206, A0206, 0206,A02 A0205, A0205, ID A0207, A0207, 07,A0211 A0206, A0206, NO: A0211, A0211, ,A2601,A A0207, A0207, 30) A2601, A2601, 6802,B13 A0211, A0211, A6802, A6802, 02,C0202 A2601, A2601, C0202, C0202, ,C1203,C A6802, A6802, C1203, C1203, 1502,C17 B1302, B1302, C1502 C1502 01 C0202, C0202, C0602, C0602, C1203, C1203, C1502, C1502, C1701 C1701 YL A0201, 6 0.3783 A0201, 6 0.3783 A0201,A 6 0.3783 A0201, 6 0.3783 A0201, 6 0.3783 NST A0202, A0202, 0202,A02 A0202, A0202, NV A0203, A0203, 03,A0204 A0203, A0203, TI A0204, A0204, ,A0207,B A0204, A0204, (SEQ A0207, A0207, 1302 A0207, A0207, ID B1302 B1302 B1302 B1302 NO: 24) APH B0702, 8 0.3523 B0702, 8 0.3523 B0702,B0 8 0.3523 B0702, 9 0.3671 B0702, 9 0.3671 GH B0704, B0704, 704,B080 B0704, B0704, VM B0801, B0801, 1,B4201, B0801, B0801, VEL B4201, B4201, B5601,C0 B4201, B4201, (SEQ B5601, B5601, 704,C080 B5502, B5502, ID C0704, C0704, 1,C1701 B5601, B5601, NO: C0801, C0801, C0704, C0704, 14) C1701 C1701 C0801, C0801, C1701 C1701 GP unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 MV LRG LIT (SEQ ID NO: 6) KAF A0201, 10 0.4824 A0201, 10 0.4824 A0201,A 12 0.5166 A0201, 13 0.5166 A0201, 17 0.5915 QLT A0211, A0211, 0203,A02 A0203, A0203, PIA A6802, A6802, 11,A6802 A0211, A0204, V B5101, B5101, ,B5101,B A6802, A0206, (SEQ B5201, B5201, 5201,B54 B5101, A0211, ID B5401, B5401, 01,B5502 B5201, A6802, NO: B5502, B5502, ,B5601,C B5401, B1302, 13) C1203, C1203, 1203,C17 B5502, B4006, C1701, C1701, 01,G0104 B5601, B5101, G0104 G0104 C1203, B5201, C1701, B5401, G0101, B5502, G0104 B5601, C1203, C1701, G0101, G0104 ELP A0201, 6 0.5273 A0201, 7 0.5447 A0201,A 9 0.6009 A0201, 10 0.6097 A0201, 10 0.6097 DEF A0207, A0203, 0203,A02 A0203, A0203, VV A6802, A0207, 06,A0207 A0205, A0205, VT B5101, A6802, ,A6802,B A0206, A0206, V B5201, B5101, 5101,B52 A0207, A0207, (SEQ C0102 B5201, 01,C0102 A6802, A6802, ID C0102 ,C0403 B5101, B5101, NO: B5201, B5201, 8) C0102, C0102, C0403 C0403 YLF A0201, 22 0.7506 A0201, 26 0.8326 A0201,A 28 0.8646 A0201, 29 0.8953 A0201, 31 0.9189 DES A0202, A0202, 0202,A02 A0202, A0202, GEF A0203, A0203, 03,A0204 A0203, A0203, KL A0204, A0204, ,A0205,A A0204, A0204, (SEQ A0205, A0205, 0206,A02 A0205, A0205, ID A0206, A0206, 07,A0211 A0206, A0206, NO: A0207, A0207, ,A2902,A A0207, A0207, 25) A0211, A0211, 3201,B13 A0211, A0211, A2902, A2902, 01,B1302 A2902, A2902, A3201, A3201, ,B1517,B A3201, A3201, B1301, B1301, 3501,B35 B1301, B1301, B1302, B1302, 03,C0102 B1302, B1302, B3501, B3501, ,C0302,C B1517, B1517, B3503, B3503, 0303,C03 B3501, B3501, C0102, C0102, 04,C0403 B3503, B3503, C0304, C0302, ,C0602,C C0102, C0102, C0403, C0303, 0704,C14 C0302, C0302, C0704, C0304, 02,C1502 C0303, C0303, C1701, C0403, ,C1701,G C0304, C0304, G0101, C0704, 0101,G01 C0403, C0403, G0103, C1402, 03,G0104 C0602, C0602, G0104 C1502, C0701, C0701, C1701, C0704, C0704, G0101, C1402, C0801, G0103, C1502, C1402, G0104 C1701, C1403, G0101, C1502, G0103, C1701, G0104 G0101, G0103, G0104 Peps B1801, 70 0.9998 B1402, 75 0.9999 B1402,B1 77 0.9999 A6802, 78 0.9999 A6802, 79 1.0000 Comb- B3701, B1801, 801,B370 B1402, B1402, ined B4002, B3701, 1,B4002, B1801, B1801, B4006, B4002, B4006,B4 B3701, B3701, B4403, B4006, 402,B440 B4002, B4002, B4501, B4403, 3,B4501, B4006, B4006, B4901, B4501, B4901,B5 B4402, B4402, B5001, B4901, 001,B510 B4403, B4403, B5101, B5001, 1,A0202, B4501, B4501, A0202, B5101, A3601,B B4901, B4901, B1801, A0202, 1510,B18 B5001, B5001, B3801, A3601, 01,B3503 B5101, B5101, B4001, B1510, ,B3801,B A0101, B5201, B4402, B1801, 4001,B40 A0202, A0101, B4403, B3503, 02,B4402 A3601, A0202, C0802, B3801, ,B4403,B B1510, A3601, A0101, B4001, 4501,B57 B1801, B1510, A2501, B4002, 03,C0802 B3503, B1801, A2601, B4402, ,A0101,A B3801, B3503, A2902, B4403, 2501,A26 B4001, B3801, A3002, C0802, 01,A2902 B4002, B4001, A3601, A0101, ,A3002,A B4402, B4002, A2501, A2501, 3601,B15 B4403, B4402, A2601, A2601, 02,B3501 B4501, B4403, B1502, A2902, ,A2501,A B5703, B4501, C1202, A3002, 2601,B15 C0802, B5703, B5101, A3601, 02,C1202 A0101, C0704, C0202, B1502, ,B5101,C A2501, C0802, C0302, A2501, 0202,C03 A2601, A0101, C0303, A2601, 02,C0303 A2902, A2501, C0304, B1502, ,C0304,C A3002, A2601, C0602, C1202, 0602,C08 A3601, A2902, C0801, B5101, 01,C0802 B1501, A3002, C0802, C0202, ,C1202,C B1502, A3601, C1202, C0302, 1203,C16 B3501, B1501, C1203, C0303, 01,A2902 A2501, B1502, C1601, C0304, ,B1501,B A2601, B3501, B1501, C0602, 1502,B15 B1501, A2501, B1502, C0801, 03,B3501 B1502, A2601, B3501, C0802, ,B3507,B C1202, B1501, B3507, C1202, 4601,B53 B5101, B1502, B4601, C1203, 01,C0202 C0202, C1202, C0202, C1601, ,C0302,C C0302, B5101, C0302, B1501, 0303,C03 C0303, C0202, C0303, B1502, 04,C0702 C0304, C0302, C0304, B1503, ,C1202,C C0602, C0303, C1202, B3501, 1203,C16 C0801, C0304, C1203, B3507, 01,B3501 C0802, C0501, C1601, B4601, ,B3503,B C1202, C0602, B3503, B5301, 3507,C03 C1203, C0801, B3507, C0202, 02,C0303 C1502, C0802, C0302, C0302, ,C0304,C C1601, C1202, C0303, C0303, 0403,C07 A2902, C1203, C0304, C0304, 04,C1202 B1501, C1502, C0403, C0702, ,C1203,C B1502, C1601, C0704, C1202, 1601,C17 B1503, A2902, C1203, C1203, 01,A0206 B3501, B1501, C1601, C1601, ,A6802,B B3507, B1502, C1701, B3501, 5101,C06 B4601, B1503, A0206, B3503, 02,C1203 B5301, B3501, A6802, B3507, ,C1601,C C0202, B3507, B5101, C0302, 1701,A30 C0302, B4601, C0602, C0303, 02,B1502 C0303, B5301, C1203, C0304, ,C1601,B C0304, C0202, C1701, C0403, 1801,B44 C0702, C0302, A3002, C0704, 02,B4403 C1202, C0303, B1801, C1203, ,B0704,B C1203, C0304, B4402, C1601, 4201,C01 C1601, C0702, B4403, C1701, 02,C0303 B3501, C1202, B0704, A0206, ,C0304,C B3503, C1203, C0102, A6802, 0602,C12 B3507, C1402, C0303, B5101, 03,C1601 C0302, C1601, C0304, C0602, ,A0101,A C0303, B3501, C0602, C1203, 3601,B15 C0304, B3503, C1203, C1701, 02,B1517 C0403, B3507, C1601, A3002, ,B1801,C C0704, C0302, A0101, B1801, 1601,A29 C1202, C0303, A3601, B4402, 02,A3601 C1203, C0304, B1502, B4403, ,B1517,B C1601, C0403, B1517, B0704, 3507,B46 C1701, C0704, C1601, B4201, 01,C0202 A0206, C1202, A2902, C0102, ,C0302,C A6802, C1203, A3601, C0303, 1202,C12 B1302, C1601, B1517, C0304, 03,C1601 B5101, C1701, B3507, C0602, ,B1503,B C0202, A0206, B4601, C1203, 5802,C16 C0602, A6802, C0202, C1601, 01,A2301 C0801, B1302, C0302, A0101, ,A2501,A C1203, B5101, C1202, A3601, 2601,A68 C1601, B5301, C1203, B1502, 02,A3002 C1701, C0202, C1601, B1517, ,A3201,B A3002, C0602, B1503, B1801, 1503,B15 B1502, C0704, A2501, C1601, 17,B5701 C1601, C0801, A2601, A2902, ,B5802,C B1801, C1203, A3002, A3601, 0701,C15 B4402, C1502, A3201, B1517, 02,A3201 B4403, C1601, B1503, B3507, ,B1801,B B0704, C1701, B1517, B4601, 3501,B44 B4201, A3002, B5802, C0202, 02,B4403 C0102, B1502, C0701, C0302, ,unknown C0303, C1601, C1502, C1202, ,C0704,u C0304, B1801, B1801, C1203, nknown, C0602, B4402, B4402, C1601, A0201,A C1203, B4403, B4403, B1503, 0206,A02 C1601, B0704, unkno C1601, 07,A6802 A0101, B4201, wn,C0 A2301, ,G0104,A A3002, C0102, 704,un A2501, 0201,A02 A3601, C0303, known, A2601, 06,A0207 B1502, C0304, A0206, A3002, ,C0303,C B1517, C0602, A0207, A3201, 0304,C04 B1801, C0704, A6802, B1503, 01,C0403 B5701, C1203, A0201, B1517, ,C0501,C C1203, C1601, A0206, B5802, 0801,C08 C1601, A0101, A0207, C0701, 02,C1502 A2902, A3002, C0304, C1502, ,A0201,A A3601, A3601, C0401, B1801, 0202,A02 B1517, B1502, C0403, B4402, 04,C0602 B3507, B1517, C0501, B4403, ,C0701,C B4601, B1801, C0801, unkno 0702,A32 C0202, B5701, C0802, wn,C07 01,B1503 C0302, C1203, A0201, 04,unk ,B2705,B C1202, C1601, A0202, flown, 4601,C02 C1203, A2902, C0602, A0206, 02,C0602 C1601, A3601, C0701, A0207, ,C0701,C B1503, B1517, C0702, A6802, 0702,unk B5802, B3507, A3201, A0201, nown,A0 C1601, B4601, B1503, A0206, 202,A020 A2301, C0202, B2705, A0207, 3,A0204, A2407, C0302, C0602, C0304, A0201,A A2501, C1202, C0701, C0401, 0202,A02 A2601, C1203, C0702, C0403, 04,A0207 A3201, C1601, unkno C0501, ,A0202,A A6802, B1503, wn,A0 C0801, 0203,A02 A2601, B5802, 204,A0 C0802, 05,A0206 A3002, C1601, 201,A0 A0201, ,A6802,C A3201, A2301, 202,A0 A0202, 1502,A02 B1503, A2407, 204,A0 C0602, 01,A0202 B1517, A2501, 207,A0 C0701, ,A0203,A B1801, A2601, 202,A0 C0702, 0204,A02 B5701, A3201, 203,A0 A3201, 05,A0206 B5802, A6802, 205,A6 B1503, ,A0207,A C0701, B1502, 802,C1 B2705, 0211,A26 C1502, G0104, 502,A0 C0602, 01,A6802 A3201, A2601, 201,A0 C0701, ,B1302,C B1801, A3002, 203,A0 C0702, 0202,C12 B3501, A3201, 204,A0 unkno 03,C1502 B4402, B1503, 205,A0 wn,A0 ,C1701,A B4403, B1517, 206,A0 202,A0 0201,A02 unknow B1801, 207,A0 203,A0 02,A0203 n,C070 B5701, 211,A2 204,A0 ,A0204,A 4,unkno B5802, 601,A6 201,A0 0207,B13 wn,A02 C0701, 802,C0 202,A0 02,B0702 01,A02 C1502, 202,C1 204,A0 ,B0704,B 06,A02 C1601, 203,C1 207,A0 0801,B42 07,A68 A2902, 502,A0 202,A0 01,B5601 02,G01 A3201, 201,A0 203,A0 ,C0704,C 04,A02 B1801, 202,A0 205,A0 0801,C17 01,A02 B3501, 203,A0 206,A6 01,unkno 06,A02 B4402, 204,A0 802,C1 wn,A020 07,C03 B4403, 207,B1 502,A0 1,A0203, 03,C03 unkno 302,B0 201,A0 A0211,A 04,C04 wn,C07 702,B0 203,A0 6802,B51 01,C04 04,unk 704,B0 204,A0 01,B5201 03,C05 nown, 801,B4 205,A0 ,B5401,B 01,C08 A0201, 201,B5 206,A0 5502,B56 01,C08 A0206, 601,C0 207,A0 01,C1203 02,C15 A0207, 704,C0 211,A2 ,C1701,G 02,A02 A6802, 801,C1 601,A6 0104,A02 01,A02 G0104, 701,un 802,C0 01,A0203 02,A02 A0201, known, 202,C1 ,A0206,A 04,C06 A0206, A0201, 203,C1 0207,A68 02,C07 A0207, A0211, 502,A0 02,B5101 01,C07 C0303, A6802, 201,A0 ,B5201,C 02,A32 C0304, B5101, 202,A0 0102,C04 01,B15 C0401, B5201, 203,A0 03,A0201 03,B27 C0403, B5401, 204,A0 ,A0202,A 05,B46 C0501, B5502, 207,B1 0203,A02 01,C02 C0801, C1203, 302,B0 04,A0205 02,C06 C0802, C1701, 702,B0 ,A0206,A 02,C07 C1502, G0104, 704,B0 0207,A02 01,C07 A0201, A0201, 801,B4 11,A2902 02,unkn A0202, A0207, 201,B5 ,A3201,B own,A0 A0204, A6802, 601,C0 1301,B13 201,A0 A0211, B5101, 704,C0 02,B1517 202,A0 B1402, B5201, 801,C1 ,B3501,B 203,A0 B3801, C0102, 701,un 3503,C01 204,A0 C0602, A0201, known, 02,C0302 201,A0 C0701, A0202, A0201, ,C0303,C 202,A0 C0702, A0203, A0211, 0304,C04 204,A0 A3201, A0204, A6802, 03,C0602 207,B1 B1503, A0205, B5101, ,C0704,C 301,A0 B2705, A0206, B5201, 1402,C15 202,A0 B4601, A0207, B5401, 02,C1701 203,A0 C0202, A0211, B5502, ,G0101,G 205,A0 C0602, A2902, C1203, 0103,G01 206,A6 C0701, A3201, C1701, 04 802,C1 C0702, B1301, G0104, 203,C1 unkno B1302, A0201, 502,A0 wn,A0 B3501, A0203, 201,A0 201,A0 B3503, A0207, 202,A0 202,A0 C0102, A6802, 203,A0 203,A0 C0304, B5101, 204,A0 204,A0 C0403, B5201, 205,A0 207,A0 C0704, C0102, 206,A0 201,A0 C1701, A0201, 207,A0 202,A0 G0101, A0202, 211,A2 204,A0 G0103, A0203, 601,A6 207,B1 G0104 A0204, 802,B1 301,G0 A0205, 302,C0 103,A0 A0206, 202,C0 202,A0 A0207, 602,C1 203,A0 A0211, 203,C1 205,A0 A2902, 502,C1 206,A0 A3201, 701,A0 211,A6 B1301, 201,A0 802,C1 B1302, 202,A0 203,C1 B3501, 203,A0 502,A0 B3503, 204,A0 201,A0 C0102, 207,B1 202,A0 C0302, 302,B0 203,A0 C0303, 702,B0 204,A0 C0304, 704,B0 205,A0 C0403, 801,B4 206,A0 C0704, 201,B5 207,A0 C1402, 502,B5 211,A2 C1502, 601,C0 601,A6 C1701, 704,C0 802,B1 G0101, 801,C1 302,C0 G0103, 701,unk 202,C0 G0104 nown,A 602,C1 0201,A 203,C1 0203,A 502,C1 0211,A 701,A0 6802,B 201,A0 5101,B 202,A0 5201,B 203,A0 5401,B 204,A0 5502,B 207,B1 5601,C 302,B0 1203,C 702,B0 1701,G 704,B0 0101,G 801,B4 0104,A 201,B5 0201,A 502,B5 0203,A 601,C0 0205,A 704,C0 0206,A 801,C1 0207,A 701.un 6802,B known, 5101,B A0201, 5201,C A0203, 0102,C A0204, 0403,A A0206, 0201,A A0211, 0202,A A6802, 0203,A B1302, 0204,A B4006, 0205,A B5101, 0206,A B5201, 0207,A B5401, 0211,A B5502, 2902,A B5601, 3201,B C1203, 1301,B C1701, 1302,B G0101, 1517,B G0104, 3501,B A0201, 3503,C A0203, 0102,C A0205, 0302,C A0206, 0303,C A0207, 0304,C A6802, 0403,C B5101, 0602,C B5201, 0701,C C0102, 0704,C C0403, 1402,C A0201, 1502,C A0202, 1701,G A0203, 0101,G A0204, 0103,G A0205, 0104 A0206, A0207, A0211, A2902, A3201, B1301, B1302, B1517, B3501, B3503, C0102, C0302, C0303, C0304, C0403, C0602, C0701, C0704, C0801, C1402, C1403, C1502, C1701, G0101, G0103, G0104 thr0.6_ thr0.6_ thr0.6_ thr0.7_ thr0.7_ thr0.7_ thr0.8_ thr0.8_ thr0.8_ thr0.9_ thr0.9_ thr0.9_ thr1_ thr1_ thr1_ Pep- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- tide alleles alleles age alleles alleles age alleles alleles age alleles alleles age alleles alleles age A549 DEF B1801, 9 0.4113 B1402, 10 0.4301 B1402,B1 11 0.4623 A6802, 12 0.4764 A6802, 13 0.5092 VV B3701, B1801, 801,B370 B1402, B1402, VT B4002, B3701, 1,B4002, B1801, B1801, V B4006, B4002, B4006,B4 B3701, B3701, (SEQ B4403, B4006, 402,B440 B4002, B4002, ID B4501, B4403, 3,B4501, B4006, B4006, NO: B4901, B4501, B4901,B5 B4402, B4402, 11) B5001, B4901, 001,B510 B4403, B4403, B5101 B5001, 1 B4501, B4501, B5101 B4901, B4901, B5001, B5001, B5101 B5101, B5201 LED A0202, 7 0.3149 A0202, 11 0.4085 A0202,A 13 0.4301 A0101, 14 0.4846 A0101, 15 0.4999 KAF B1801, A3601, 3601,B15 A0202, A0202, QL B3801, B1510, 10,B1801 A3601, A3601, (SEQ B4001, B1801, ,B3503,B B1510, B1510, ID B4402, B3503, 3801,B40 B1801, B1801, NO: B4403, B3801, 01,B4002 B3503, B3503, 10) C0802 B4001, ,B4402,B B3801, B3801, B4002, 4403,B45 B4001, B4001, B4402, 01,B5703 B4002, B4002, B4403, ,C0802 B4402, B4402, C0802 B4403, B4403, B4501, B4501, B5703, B5703, C0802 C0704, C0802 TVI A0101, 6 0.2283 A0101, 7 0.2485 A0101,A 8 0.3295 A0101, 9 0.3779 A0101, 9 0.3779 EV A2501, A2501, 2501,A26 A2501, A2501, QG A2601, A2601, 01,A2902 A2601, A2601, Y A2902, A2902, ,A3002,A A2902, A2902, (SEQ A3002, A3002, 3601,B15 A3002, A3002, ID A3601 A3601, 02,B3501 A3601, A3601, NO: B1502 B1501, B1501, 22) B1502, B1502, B3501 B3501 EIK A2501, 4 0.1555 A2501, 4 0.1555 A2501,A 4 0.1555 A2501, 5 0.2132 A2501, 5 0.2132 ESV A2601, A2601, 2601,B15 A2601, A2601, QTF B1502, B1502, 02,C1202 B1501, B1501, (SEQ C1202 C1202 B1502, B1502, ID C1202 C1202 NO: 15) FAS B5101, 11 0.6793 B5101, 11 0.6793 B5101,C0 11 0.6793 B5101, 12 0.7143 B5101, 13 0.7402 EA C0202, C0202, 202,C030 C0202, C0202, AR C0302, C0302, 2,C0303, C0302, C0302, VV C0303, C0303, C0304,C0 C0303, C0303, (SEQ C0304, C0304, 602,C080 C0304, C0304, ID C0602, C0602, 1,C0802, C0602, C0501, NO: C0801, C0801, C1202,C1 C0801, C0602, 17) C0802, C0802, 203,C160 C0802, C0801, C1202, C1202, 1 C1202, C0802, C1203, C1203, C1203, C1202, C1601 C1601 C1502, C1203, C1601 C1502, C1601 FAV B1501, 12 0.6105 B1501, 15 0.7553 A2902,B 16 0.7632 A2902, 16 0.7632 A2902, 17 0.7831 DA B1502, B1502, 1501,B15 B1501, B1501, AK B3501, B1503, 02,B1503 B1502, B1502, AY B3507, B3501, ,B3501,B B1503, B1503, (SEQ B4601, B3507, 3507,B46 B3501, B3501, ID C0202, B4601, 01,B5301 B3507, B3507, NO: C0302, B5301, ,C0202,C B4601, B4601, 28) C0303, C0202, 0302,C03 B5301, B5301, C0304, C0302, 03,C0304 C0202, C0202, C1202, C0303, ,C0702,C C0302, C0302, C1203, C0304, 1202,C12 C0303, C0303, C1601 C0702, 03,C1601 C0304, C0304, C1202, C0702, C0702, C1203, C1202, C1202, C1601 C1203, C1203, C1601 C1402, C1601 LAT B3503, 10 0.4882 B3501, 11 0.5438 B3501,B3 12 0.5827 B3501, 12 0.5827 B3501, 12 0.5827 NN B3507, B3503, 503,B350 B3503, B3503, LV C0302, B3507, 7,C0302, B3507, B3507, VM C0303, C0302, C0303,C0 C0302, C0302, (SEQ C0304, C0303, 304,C040 C0303, C0303, ID C0403, C0304, 3,C0704, C0304, C0304, NO: C0704, C0403, C1202,C1 C0403, C0403, 16) C1203, C0704, 203,C160 C0704, C0704, C1601, C1203, 1,C1701 C1202, C1202, C1701 C1601, C1203, C1203, C1701 C1601, C1601, C1701 C1701 NA A0206, 6 0.3404 A0206, 6 0.3404 A0206,A 7 0.3754 A0206, 10 0.4911 A0206, 13 0.5660 TN A6802, A6802, 6802,B51 A6802, A6802, VVI B5101, B5101, 01,C0602 B1302, B1302, KV C0602, C0602, ,C1203,C B5101, B5101, (SEQ C1203, C1203, 1601,C17 C0202, B5301, ID C1701 C1701 01 C0602, C0202, NO: C0801, C0602, 37) C1203, C0704, C1601, C0801, C1701 C1203, C1502, C1601, C1701 QLT A3002 1 0.0296 A3002 1 0.0296 A3002,B 3 0.1002 A3002, 3 0.1002 A3002, 3 0.1002 PT 1502,C16 B1502, B1502, WR 01 C1601 C1601 VY (SEQ ID NO: 38) SEF B1801, 3 0.1707 B1801, 3 0.1707 B1801,B4 3 0.1707 B1801, 3 0.1707 B1801, 3 0.1707 SSL B4402, B4402, 402,B440 B4402, B4402, PSY B4403 B4403 3 B4403 B4403 (SEQ ID NO: 27) TA B0704, 7 0.5878 B0704, 8 0.5967 B0704,B4 8 0.5967 B0704, 8 0.5967 B0704, 9 0.6143 QNS C0102, B4201, 201,C010 B4201, B4201, VR C0303, C0102, 2,C0303, C0102, C0102, VL C0304, C0303, C0304,C0 C0303, C0303, (SEQ C0602, C0304, 602,C120 C0304, C0304, ID C1203, C0602, 3,C1601 C0602, C0602, NO: C1601 C1203, C1203, C0704, 18) C1601 C1601 C1203, C1601 TTT A0101, 5 0.1722 A0101, 6 0.2105 A0101,A 6 0.2105 A0101, 9 0.2810 A0101, 9 0.2810 IKP A3601, A3601, 3601,B15 A3002, A3002, VT B1502, B1502, 02,B1517 A3601, A3601, Y B1517, B1517, ,B1801,C B1502, B1502, (SEQ C1601 B1801, 1601 B1517, B1517, ID C1601 B1801, B1801, NO: B5701, B5701, 21) C1203, C1203, C1601 C1601 VA A2902, 10 0.3268 A2902, 10 0.3268 A2902,A 10 0.3268 A2902, 10 0.3268 A2902, 10 0.3268 TSR A3601, A3601, 3601,B15 A3601, A3601, TLS B1517, B1517, 17,B3507 B1517, B1517, Y B3507, B3507, ,B4601,C B3507, B3507, (SEQ B4601, B4601, 0202,C03 B4601, B4601, ID C0202, C0202, 02,C1202 C0202, C0202, NO: C0302, C0302, ,C1203,C C0302, C0302, 41) C1202, C1202, 1601 C1202, C1202, C1203, C1203, C1203, C1203, C1601 C1601 C1601 C1601 VG B1503 1 0.0235 B1503, 2 0.0702 B1503,B5 3 0.859 B1503, 3 0.0859 B1503, 3 0.0859 YL C1601 802,C160 B5802, B5802, QPR 1 C1601 C1601 TF (SEQ ID NO: 39) EIL A2501, 2 0.0747 A2301, 3 0.1190 A2301,A 4 0.1437 A2301, 6 0.1784 A2301, 8 0.1999 DIT A2601 A2501, 2501,A26 A2407, A2407, PCS A2601 01,A6802 A2501, A2501, F A2601, A2601, (SEQ A3201, A3201, ID A6802 A6802, NO: B1502, 33) G0104 KNI A3002, 7 0.2756 A3002, 7 0.2756 A3002,A 8 0.2906 A2601, 10 0.3699 A2601, 11 0.4034 DG A3201, A3201, 3201,B15 A3002, A3002, YFK B1503, B1503, 03,B1517 A3201, A3201, IY B1517, B1517, ,B5701,B B1503, B1503, (SEQ B5802, B5802, 5802,C07 B1517, B1517, ID C0701, C0701, 01,C1502 B1801, B1801, NO: C1502 C1502 B5701, B5701, 36) B5802, B5802, C0701, C0701, C1502 C1502, C1601 EEF B1801, 3 0.1707 B1801, 3 0.1707 A3201,B 5 0.2881 A3201, 5 0.2881 A2902, 6 0.3114 EPS B4402, B4402, 1801,B35 B1801, A3201, TQ B4403 B4403 01,B4402 B3501, B1801, YE ,B4403 B4402, B3501, Y B4403 B4402, (SEQ B4403 ID NO: 20) EIL unknown 0 0.0000 unknown 0 0.0000 unknownn 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 DIT PCS FG (SEQ ID NO: 47) HEK293 AG C0704 1 0.0291 C0704 1 0.0291 C0704 1 0.0291 C0704 1 0.0291 C0704 1 0.0291 TDT TIT V (SEQ ID NO: 26) APR unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 ITF GGP (SEQ ID NO: 42) ELP A0206, 3 0.1336 A0206, 3 0.1336 A0201,A 5 0.3948 A0201, 5 0.3948 A0201, 5 0.3948 DEF A0207, A0207, 0206,A02 A0206, A0206, VV A6802 A6802 07,A6802 A0207, A0207, V ,G0104 A6802, A6802, (SEQ G0104 G0104 ID NO: 12) FGD A0201, 9 0.7054 A0201, 9 0.7054 A0201,A 11 0.7772 A0201, 11 0.7772 A0201, 11 0.7772 DT A0206, A0206, 0206,A02 A0206, A0206, VIE A0207, A0207, 07,C0303 A0207, A0207, V C0304, C0304, ,C0304,C C0303, C0303, (SEQ C0401, C0401, 0401,C04 C0304, C0304, ID C0403, C0403, 03,C0501 C0401, C0401, NO: C0501, C0501, ,C0801,C C0403, C0403, 23) C0801, C0801, 0802,C15 C0501, C0501, C0802 C0802 02 C0801, C0801, C0802, C0802, C1502 C1502 GLI A0201, 2 0.2959 A0201, 2 0.2959 A0201,A 3 0.3008 A0201, 3 0.3008 A0201, 4 0.3061 TLS A0202 A0202 0202,A02 A0202, A0202, YH 04 A0204 A0204, L A0211 (SEQ ID NO: 5) IRQ C0602, 3 0.4546 C0602, 3 0.4546 C0602,C0 3 0.4546 C0602, 3 0.4546 B1402, 5 0.4764 EEV C0701, C0701, 701,C070 C0701, B3801, QEL C0702 C0702 2 C0702 C0602, (SEQ C0701, ID C0702 NO: 31) KR A3201, 6 0.4955 A3201, 6 0.4955 A3201,B 8 0.5553 A3201, 8 0.5553 A3201, 8 0.5553 VD B1503, B1503, 1503,B27 B1503, B1503, WTI B2705, B2705, 05,B4601 B2705, B2705, EY C0602, C0602, ,C0202,C B4601, B4601, (SEQ C0701, C0701, 0602,C07 C0202, C0202, ID C0702 C0702 01,C0702 C0602, C0602, NO: C0701, C0701, 29) C0702 C0702 ML unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 LGS ML YM (SEQ ID NO: 4) NL A0204 1 0.0059 A0202, 3 0.0515 A0202,A 3 0.0515 A0201, 4 0.3258 A0201, 5 0.3603 NES A0203, 0203,A02 A0202, A0202, LID A0204 04 A0203, A0203, L A0204 A0204, (SEQ A0207 ID NO: 40) SLE A0201, 4 0.3359 A0201, 4 0.3359 A0201,A 4 0.3359 A0201, 5 0.3696 A0201, 6 0.3696 DK A0202, A0202, 0202,A02 A0202, A0202, AFQ A0204, A0204, 04,A0207 A0204, A0204, L A0207 A0207 A0207, A0207, (SEQ B1301 B1301, ID G0103 NO: 7) STS A0202, 5 0.1480 A0202, 6 0.2088 A0202,A 6 0.2088 A0202, 7 0.2405 A0202, 8 0.2457 AFV A0203, A0203, 0203,A02 A0203, A0203, ETV A0205, A0205, 05,A0206 A0205, A0205, (SEQ A6802, A0206, ,A6802,C A0206, A0206, ID C1502 A6802, 1502 A6802, A0211, NO: C1502 C1203, A6802, 19) C1502 C1203, C1502 SVV A0201, 12 0.5688 A0201, 12 0.5688 A0201,A 15 0.6069 A0201, 16 0.6589 A0201, 16 0.6589 SKY A0203, A0203, 0202,A02 A0202, A0202, VK A0204, A0204, 03,A0204 A0203, A0203, V A0205, A0205, ,A0205,A A0204, A0204, (SEQ A0206, A0206, 0206,A02 A0205, A0205, ID A0207, A0207, 07,A0211 A0206, A0206, NO: A0211, A0211, ,A2601,A A0207, A0207, 30) A2601, A2601, 6802,B13 A0211, A0211, A6802, A6802, 02,C0202 A2601, A2601, C0202, C0202, ,C1203,C A6802, A6802, C1203, C1203, 1502,C17 B1302, B1302, C1502 C1502 01 C0202, C0202, C0602, C0602, C1203, C1203, C1502, C1502, C1701 C1701 YL A0201, 6 0.3783 A0201, 6 0.3783 A0201,A 6 0.3783 A0201, 6 0.3783 A0201, 6 0.3783 NST A0202, A0202, 0202,A02 A0202, A0202, NV A0203, A0203, 03,A0204 A0203, A0203, TI A0204, A0204, ,A0207,B A0204, A0204, (SEQ A0207, A0207, 1302 A0207, A0207, ID B1302 B1302 B1302 B1302 NO: 24) APH B0702, 8 0.3523 B0702, 8 0.3523 B0702,B0 8 0.3523 B0702, 9 0.3671 B0702, 9 0.3671 GH B0704, B0704, 704,B080 B0704, B0704, VM B0801, B0801, 1,B4201, B0801, B0801, VEL B4201, B4201, B5601,C0 B4201, B4201, (SEQ B5601, B5601, 704,C080 B5502, B5502, ID C0704, C0704, 1,C1701 B5601, B5601, NO: C0801, C0801, C0704, C0704, 14) C1701 C1701 C0801, C0801, C1701 C1701 GP unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 MV LRG LIT (SEQ ID NO: 6) KAF A0201, 10 0.4824 A0201, 10 0.4824 A0201,A 12 0.5166 A0201, 13 0.5166 A0201, 17 0.5915 QLT A0211, A0211, 0203,A02 A0203, A0203, PIA A6802, A6802, 11,A6802 A0211, A0204, V B5101, B5101, ,B5101,B A6802, A0206, (SEQ B5201, B5201, 5201,B54 B5101, A0211, ID B5401, B5401, 01,B5502 B5201, A6802, NO: B5502, B5502, ,B5601,C B5401, B1302, 13) C1203, C1203, 1203,C17 B5502, B4006, C1701, C1701, 01,G0104 B5601, B5101, G0104 G0104 C1203, B5201, C1701, B5401, G0101, B5502, G0104 B5601, C1203, C1701, G0101, G0104 ELP A0201, 6 0.5273 A0201, 7 0.5447 A0201,A 9 0.6009 A0201, 10 0.6097 A0201, 10 0.6097 DEF A0207, A0203, 0203,A02 A0203, A0203, VV A6802, A0207, 06,A0207 A0205, A0205, VT B5101, A6802, ,A6802,B A0206, A0206, V B5201, B5101, 5101,B52 A0207, A0207, (SEQ C0102 B5201, 01,C0102 A6802, A6802, ID C0102 ,C0403 B5101, B5101, NO: B5201, B5201, 8) C0102, C0102, C0403 C0403 YLF A0201, 22 0.7506 A0201, 26 0.8326 A0201,A 28 0.8646 A0201, 29 0.8953 A0201, 31 0.9189 DES A0202, A0202, 0202,A02 A0202, A0202, GEF A0203, A0203, 03,A0204 A0203, A0203, KL A0204, A0204, ,A0205,A A0204, A0204, (SEQ A0205, A0205, 0206,A02 A0205, A0205, ID A0206, A0206, 07,A0211 A0206, A0206, NO: A0207, A0207, ,A2902,A A0207, A0207, 25) A0211, A0211, 3201,B13 A0211, A0211, A2902, A2902, 01,B1302 A2902, A2902, A3201, A3201, ,B1517,B A3201, A3201, B1301, B1301, 3501,B35 B1301, B1301, B1302, B1302, 03,C0102 B1302, B1302, B3501, B3501, ,C0302,C B1517, B1517, B3503, B3503, 0303,C03 B3501, B3501, C0102, C0102, 04,C0403 B3503, B3503, C0304, C0302, ,C0602,C C0102, C0102, C0403, C0303, 0704,C14 C0302, C0302, C0704, C0304, 02,C1502 C0303, C0303, C1701, C0403, ,C1701,G C0304, C0304, G0101, C0704, 0101,G01 C0403, C0403, G0103, C1402, 03,G0104 C0602, C0602, G0104 C1502, C0701, C0701, C1701, C0704, C0704, G0101, C1402, C0801, G0103, C1502, C1402, G0104 C1701, C1403, G0101, C1502, G0103, C1701, G0104 G0101, G0103, G0104 Peps B1801, 70 0.9998 B1402, 75 0.9999 B1402,B1 77 0.999 A6802, 78 0.9999 A6802, 79 1.0000 Comb- B3701, B1801, 801,B370 B1402, B1402, ined B4002, B3701, 1,B4002, B1801, B1801, B4006, B4002, B4006,B4 B3701, B3701, B4403, B4006, 402,B440 B4002, B4002, B4501, B4403, 3,B4501, B4006, B4006, B4901, B4501, B4901,B5 B4402, B4402, B5001, B4901, 001,B510 B4403, B4403, B5101, B5001, 1,A0202, B4501, B4501, A0202, B5101, A3601,B B4901, B4901, B1801, A0202, 1510,B18 B5001, B5001, B3801, A3601, 01,B3503 B5101, B5101, B4001, B1510, ,B3801,B A0101, B5201, B4402, B1801, 4001,B40 A0202, A0101, B4403, B3503, 02,B4402 A3601, A0202, C0802, B3801, ,B4403,B B1510, A3601, A0101, B4001, 4501,B57 B1801, B1510, A2501, B4002, 03,C0802 B3503, B1801, A2601, B4402, ,A0101,A B3801, B3503, A2902, B4403, 2501,A26 B4001, B3801, A3002, C0802, 01,A2902 B4002, B4001, A3601, A0101, ,A3002,A B4402, B4002, A2501, A2501, 3601,B15 B4403, B4402, A2601, A2601, 02,B3501 B4501, B4403, B1502, A2902, ,A2501,A B5703, B4501, C1202, A3002, 2601,B15 C0802, B5703, B5101, A3601, 02,C1202 A0101, C0704, C0202, B1502, ,B5101,C A2501, C0802, C0302, A2501, 0202,C03 A2601, A0101, C0303, A2601, 02,C0303 A2902, A2501, C0304, B1502, ,C0304,C A3002, A2601, C0602, C1202, 0602,C08 A3601, A2902, C0801, B5101, 01,C0802 B1501, A3002, C0802, C0202, ,C1202,C B1502, A3601, C1202, C0302, 1203,C16 B3501, B1501, C1203, C0303, 01,A2902 A2501, B1502, C1601, C0304, ,B1501,B A2601, B3501, B1501, C0602, 1502,B15 B1501, A2501, B1502, C0801, 03,B3501 B1502, A2601, B3501, C0802, ,B3507,B C1202, B1501, B3507, C1202, 4601,B53 B5101, B1502, B4601, C1203, 01,C0202 C0202, C1202, C0202, C1601, ,C0302,C C0302, B5101, C0302, B1501, 0303,C03 C0303, C0202, C0303, B1502, 04,C0702 C0304, C0302, C0304, B1503, ,C1202,C C0602, C0303, C1202, B3501, 1203,C16 C0801, C0304, C1203, B3507, 01,B3501 C0802, C0501, C1601, B4601, ,B3503,B C1202, C0602, B3503, B5301, 3507,C03 C1203, C0801, B3507, C0202, 02,C0303 C1502, C0802, C0302, C0302, ,C0304,C C1601, C1202, C0303, C0303, 0403,C07 A2902, C1203, C0304, C0304, 04,C1202 B1501, C1502, C0403, C0702, ,C1203,C B1502, C1601, C0704, C1202, 1601,C17 B1503, A2902, C1203, C1203, 01,A0206 B3501, B1501, C1601, C1601, ,A6802,B B3507, B1502, C1701, B3501, 5101,C06 B4601, B1503, A0206, B3503, 02,C1203 B5301, B3501, A6802, B3507, ,C1601,C C0202, B3507, B5101, C0302, 1701,A30 C0302, B4601, C0602, C0303, 02,B1502 C0303, B5301, C1203, C0304, ,C1601,B C0304, C0202, C1701, C0403, 1801,B44 C0702, C0302, A3002, C0704, 02,B4403 C1202, C0303, B1801, C1203, ,B0704,B C1203, C0304, B4402, C1601, 4201,C01 C1601, C0702, B4403, C1701, 02,C0303 B3501, C1202, B0704, A0206, ,C0304,C B3503, C1203, C0102, A6802, 0602,C12 B3507, C1402, C0303, B5101, 03,C1601 C0302, C1601, C0304, C0602, ,A0101,A C0303, B3501, C0602, C1203, 3601,B15 C0304, B3503, C1203, C1701, 02,B1517 C0403, B3507, C1601, A3002, ,B1801,C C0704, C0302, A0101, B1801, 1601,A29 C1202, C0303, A3601, B4402, 02,A3601 C1203, C0304, B1502, B4403, ,B1517,B C1601, C0403, B1517, B0704, 3507,B46 C1701, C0704, C1601, B4201, 01,C0202 A0206, C1202, A2902, C0102, ,C0302,C A6802, C1203, A3601, C0303, 1202,C12 B1302, C1601, B1517, C0304, 03,C1601 B5101, C1701, B3507, C0602, ,B1503,B C0202, A0206, B4601, C1203, 5802,C16 C0602, A6802, C0202, C1601, 01,A2301 C0801, B1302, C0302, A0101, ,A2501,A C1203, B5101, C1202, A3601, 2601,A68 C1601, B5301, C1203, B1502, 02,A3002 C1701, C0202, C1601, B1517, ,A3201,B A3002, C0602, B1503, B1801, 1503,B15 B1502, C0704, A2501, C1601, 17,B5701 C1601, C0801, A2601, A2902, ,B5802,C B1801, C1203, A3002, A3601, 0701,C15 B4402, C1502, A3201, B1517, 02,A3201 B4403, C1601, B1503, B3507, ,B1801,B B0704, C1701, B1517, B4601, 3501,B44 B4201, A3002, B5802, C0202, 02,B4403 C0102, B1502, C0701, C0302, ,unknown C0303, C1601, C1502, C1202, ,C0704,u C0304, B1801, B1801, C1203, nknown, C0602, B4402, B4402, C1601, A0201,A C1203, B4403, B4403, B1503, 0206,A02 C1601, B0704, unkno C1601, 07,A6802 A0101, B4201, wn,C0 A2301, ,G0104,A A3002, C0102, 704,un A2501, 0201,A02 A3601, C0303, known, A2601, 06,A0207 B1502, C0304, A0206, A3002, ,C0303,C B1517, C0602, A0207, A3201, 0304,C04 B1801, C0704, A6802, B1503, 01,C0403 B5701, C1203, A0201, B1517, ,C0501,C C1203, C1601, A0206, B5802, 0801,C08 C1601, A0101, A0207, C0701, 02,C1502 A2902, A3002, C0304, C1502, ,A0201,A A3601, A3601, C0401, B1801, 0202,A02 B1517, B1502, C0403, B4402, 04,C0602 B3507, B1517, C0501, B4403, ,C0701,C B4601, B1801, C0801, unkno 0702,A32 C0202, B5701, C0802, wn,C07 01,B1503 C0302, C1203, A0201, 04,unk ,B2705,B C1202, C1601, A0202, nown, 4601,C02 C1203, A2902, C0602, A0206, 02,C0602 C1601, A3601, C0701, A0207, ,C0701,C B1503, B1517, C0702, A6802, 0702,unk B5802, B3507, A3201, A0201, nown,A0 C1601, B4601, B1503, A0206, 202,A020 A2301, C0202, B2705, A0207, 3,A0204, A2407, C0302, C0602, C0304, A0201,A A2501, C1202, C0701, C0401, 0202,A02 A2601, C1203, C0702, C0403, 04,A0207 A3201, C1601, unkno C0501, ,A0202,A A6802, B1503, wn,A0 C0801, 0203,A02 A2601, B5802, 204,A0 C0802, 05,A0206 A3002, C1601, 201,A0 A0201, ,A6802,C A3201, A2301, 202,A0 A0202, 1502,A02 B1503, A2407, 204,A0 C0602, 01,A0202 B1517, A2501, 207,A0 C0701, ,A0203,A B1801, A2601, 202,A0 C0702, 0204,A02 B5701, A3201, 203,A0 A3201, 05,A0206 B5802, A6802, 205,A6 B1503, ,A0207,A C0701, B1502, 802,C1 B2705, 0211,A26 C1502, G0104, 502,A0 C0602, 01,A6802 A3201, A2601, 201,A0 C0701, ,B1302,C B1801, A3002, 203,A0 C0702, 0202,C12 B3501, A3201, 204,A0 unkno 03,C1502 B4402, B1503, 205,A0 wn,A0 ,C1701,A B4403, B1517, 206,A0 202,A0 0201,A02 unknow B1801, 207,A0 203,A0 02,A0203 n,C070 B5701, 211,A2 204,A0 ,A0204,A 4,unkno B5802, 601,A6 201,A0 0207,B13 wn,A02 C0701, 802,C0 202,A0 02,B0702 01,A02 C1502, 202,C1 204,A0 ,B0704,B 06,A02 C1601, 203,C1 207,A0 0801,B42 07,A68 A2902, 502,A0 202,A0 01,B5601 02,G01 A3201, 201,A0 203,A0 ,C0704,C 04,A02 B1801, 202,A0 205,A0 0801,C17 01,A02 B3501, 203,A0 206,A6 01,unkno 06,A02 B4402, 204,A0 802,C1 wn,A020 07,C03 B4403, 207,B1 502,A0 1,A0203, 03,C03 unkno 302,B0 201,A0 A0211,A 04,C04 wn,C07 702,B0 203,A0 6802,B51 01,C04 04,unk 704,B0 204,A0 01,B5201 03,C05 nown, 801,B4 205,A0 ,B5401,B 01,C08 A0201, 201,B5 206,A0 5502,B56 01,C08 A0206, 601,C0 207,A0 01,C1203 02,C15 A0207, 704,C0 211,A2 ,C1701,G 02,A02 A6802, 801,C1 601,A6 0104,A02 01,A02 G0104, 701,un 802,C0 01,A0203 02,A02 A0201, known, 202,C1 ,A0206,A 04,C06 A0206, A0201, 203,C1 0207,A68 02,C07 A0207, A0211, 502,A0 02,B5101 01,C07 C0303, A6802, 201,A0 ,B5201,C 02,A32 C0304, B5101, 202,A0 0102,C04 01,B15 C0401, B5201, 203,A0 03,A0201 03,B27 C0403, B5401, 204,A0 ,A0202,A 05,B46 C0501, B5502, 207,B1 0203,A02 01,C02 C0801, C1203, 302,B0 04,A0205 02,C06 C0802, C1701, 702,B0 ,A0206,A 02,C07 C1502, G0104, 704,B0 0207,A02 01,C07 A0201, A0201, 801,B4 11,A2902 02,unkn A0202, A0207, 201,B5 ,A3201,B own,A0 A0204, A6802, 601,C0 1301,B13 201,A0 A0211, B5101, 704,C0 02,B1517 202,A0 B1402, B5201, 801,C1 ,B3501,B 203,A0 B3801, C0102, 701,un 3503,C01 204,A0 C0602, A0201, known, 02,C0302 201,A0 C0701, A0202, A0201, ,C0303,C 202,A0 C0702, A0203, A0211, 0304,C04 204,A0 A3201, A0204, A6802, 03,C0602 207,B1 B1503, A0205, B5101, ,C0704,C 301,A0 B2705, A0206, B5201, 1402,C15 202,A0 B4601, A0207, B5401, 02,C1701 203,A0 C0202, A0211, B5502, ,G0101,G 205,A0 C0602, A2902, C1203, 0103,G01 206,A6 C0701, A3201, C1701, 04 802,C1 C0702, B1301, G0104, 203,C1 unkno B1302, A0201, 502,A0 wn,A0 B3501, A0203, 201,A0 201,A0 B3503, A0207, 202,A0 202,A0 C0102, A6802, 203,A0 203,A0 C0304, B5101, 204,A0 204,A0 C0403, B5201, 205,A0 207,A0 C0704, C0102, 206,A0 201,A0 C1701, A0201, 207,A0 202,A0 G0101, A0202, 211,A2 204,A0 G0103, A0203, 601,A6 207,B1 G0104 A0204, 802,B1 301,G0 A0205, 302,C0 103,A0 A0206, 202,C0 202,A0 A0207, 602,C1 203,A0 A0211, 203,C1 205,A0 A2902, 502,C1 206,A0 A3201, 701,A0 211,A6 B1301, 201,A0 802,C1 B1302, 202,A0 203,C1 B3501, 203,A0 502,A0 B3503, 204,A0 201,A0 C0102, 207,B1 202,A0 C0302, 302,B0 203,A0 C0303, 702,B0 204,A0 C0304, 704,B0 205,A0 C0403, 801,B4 206,A0 C0704, 201,B5 207,A0 C1402, 502,B5 211,A2 C1502, 601,C0 601,A6 C1701, 704,C0 802,B1 G0101, 801,C1 302,C0 G0103, 701,unk 202,C0 G0104 nown,A 602,C1 0201,A 203,C1 0203,A 502,C1 0211,A 701,A0 6802,B 201,A0 5101,B 202,A0 5201,B 203,A0 5401,B 204,A0 5502,B 207,B1 5601,C 302,B0 1203,C 702,B0 1701,G 704,B0 0101,G 801,B4 0104,A 201,B5 0201,A 502,B5 0203,A 601,C0 0205,A 704,C0 0206,A 801,C1 0207,A 701.un 6802,B known, 5101,B A0201, 5201,C A0203, 0102,C A0204, 0403,A A0206, 0201,A A0211, 0202,A A6802, 0203,A B1302, 0204,A B4006, 0205,A B5101, 0206,A B5201, 0207,A B5401, 0211,A B5502, 2902,A B5601, 3201,B C1203, 1301,B C1701, 1302,B G0101, 1517,B G0104, 3501,B A0201, 3503,C A0203, 0102,C A0205, 0302,C A0206, 0303,C A0207, 0304,C A6802, 0403,C B5101, 0602,C B5201, 0701,C C0102, 0704,C C0403, 1402,C A0201, 1502,C A0202, 1701,G A0203, 0101,G A0205, 0103,G A0206, 0104 A0207, A0211, A2902, A3201, B1301, B1302, B1517, B3501, B3503, C0102, C0302, C0303, C0304, C0403, C0602, C0701, C0704, C0801, C1402, C1403, C1502, C1701, G0101, G0103, G0104 thr1.1_ thr1.1_ thr1.1_ thr1.2_ thr1.2_ thr1.2_ thr1.3_ thr1.3_ thr1.3_ thr1.4_ thr1.4_ thr1.4_ thr1.5_ thr1.5_ thr1.5_ Pep- assign_ num cover- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- tide alleles alleles age alleles alleles age alleles alleles age alleles alleles age alleles alleles age A549 DEF A6802, 13 0.5092 A6802, 13 0.5092 A6802,B 13 0.5092 A6802, 13 0.5092 A6802, 15 0.5897 VV B1402, B1402, 1402,B18 B1402, B1402, VT B1801, B1801, 01,B3701 B1801, B1801, V B3701, B3701, ,B4002,B B3701, B3701, (SEQ B4002, B4002, 4006,B44 B4002, B4001, ID B4006, B4006, 02,B4403 B4006, B4002, NO: B4402, B4402, ,B4501,B B4402, B4006, 11) B4403, B4403, 4901,B50 B4403, B4402, B4501, B4501, 01,B5101 B4501, B4403, B4901, B4901, ,B5201 B4901, B4501, B5001, B5001, B5001, B4901, B5101, B5101, B5101, B5001, B5201 B5201 B5201 B5101, B5201, C0704 LED A0101, 15 0.4999 A0101, 15 0.4999 A0101,A 16 0.5118 A0101, 17 0.5155 A0101, 17 0.5155 KAF A0202, A0202, 0202,A36 A0202, A0202, QL A3601, A3601, 01,B1510 A3601, A3601, (SEQ B1510, B1510, ,B1801,B B1510, B1510, ID B1801, B1801, 3503,B38 B1517, B1517, NO: B3503, B3503, 01,B4001 B1801, B1801, 10) B3801, B3801, ,B4002,B B3503, B3503, B4001, B4001, 4402,B44 B3801, B3801, B4002, B4002, 03,B4501 B4001, B4001, B4402, B4402, ,B5001,B B4002, B4002, B4403, B4403, 5703,C07 B4402, B4402, B4501, B4501, 04,C0802 B4403, B4403, B5703, B5703, B4501, B4501, C0704, C0704, B5001, B5001, C0802 C0802 B5703, B5703, C0704, C0704, C0802 C0802 TVI A0101, 9 0.3779 A0101, 9 0.3779 A0101,A 10 0.3981 A0101, 11 0.4561 A0101, 12 0.4756 EV A2501, A2501, 2501,A26 A0301, A0301, QG A2601, A2601, 01,A2902 A2501, A2501, Y A2902, A2902, ,A3002,A A2601, A2601, (SEQ A3002, A3002, 3201,A36 A2902, A2902, ID A3601, A3601, 01,B1501 A3002, A3002, NO: B1501, B1501, ,B1502,B A3201, A3201, 22) B1502, B1502, 3501 A3601, A3601, B3501 B3501 B1501, B1501, B1502, B1502, B3501 B3501, B5301 EIK A2501, 5 0.2132 A2501, 6 0.2394 A2501,A 6 0.2394 A2501, 6 0.2394 A2501, 7 0.2766 ESV A2601, A2601, 2601,A34 A2601, A2601, QTF B1501, A3401, 01,B1501 A3401, A3401, (SEQ B1502, B1501, ,B1502,C B1501, B1501, ID C1202 B1502, 1202 B1502, B1502, NO: C1202 C1202 B4601, 15) C1202 FAS B5101, 13 0.7402 B5101, 13 0.7402 B5101,C0 13 0.7402 B5101, 14 0.7542 B5101, 14 0.7542 EA C0202, C0202, 202,C030 C0202, C0202, AR C0302, C0302, 2,C0303, C0302, C0302, VV C0303, C0303, C0304,C0 C0303, C0303, (SEQ C0304, C0304, 501,C060 C0304, C0304, ID C0501, C0501, 2,C0801, C0501, C0501, NO: C0602, C0602, C0802,C1 C0602, C0602, 17) C0801, C0801, 202,C120 C0704, C0704, C0802, C0802, 3,C1502, C0801, C0801, C1202, C1202, C1601 C0802, C0802, C1203, C1203, C1202, C1202, C1502, C1502, C1203, C1203, C1601 C1601 C1502, C1502, C1601 C1601 FAV A2501, 18 0.7850 A2501, 18 0.7850 A2501,A 18 0.7850 A2501, 18 0.7850 A2501, 19 0.7960 DA A2902, A2902, 2902,B15 A2902, A2902, AK B1501, B1501, 01,B1502 B1501, B1501, AY B1502, B1502, ,B1503,B B1502, B1502, (SEQ B1503, B1503, 3501,B35 B1503, B1503, ID B3501, B3501, 07,B4601 B3501, B3501, NO: B3507, B3507, ,B5301,C B3507, B3507, 28) B4601, B4601, 0202,C03 B4601, B4601, B5301, B5301, 02,C0303 B5301, B5301, C0202, C0202, ,C0304,C C0202, C0202, C0302, C0302, 0702,C12 C0302, C0302, C0303, C0303, 02,C1203 C0303, C0303, C0304, C0304, ,C1402,C C0304, C0304, C0702, C0702, 1601 C0702, C0702, C1202, C1202, C1202, C1202, C1203, C1203, C1203, C1203, C1402, C1402, C1402, C1402, C1601 C1601 C1601 C1403, C1601 LAT B3501, 12 0.5827 B3501, 13 0.6155 B3501,B3 14 0.6655 B3501, 14 0.6655 B3501, 14 0.6655 NN B3503, B3503, 503,B350 B3503, B3503, LV B3507, B3507, 7,C0202, B3507, B3507, VM C0302, C0202, C0302,C0 C0202, C0202, (SEQ C0303, C0302, 303,C030 C0302, C0302, ID C0304, C0303, 4,C0403, C0303, C0303, NO: C0403, C0304, C0704,C0 C0304, C0304, 16) C0704, C0403, 801,C120 C0403, C0403, C1202, C0704, 2,C1203, C0704, C0704, C1203, C1202, C1601,C1 C0801, C0801, C1601, C1203, 701 C1202, C1202, C1701 C1601, C1203, C1203, C1701 C1601, C1601, C1701 C1701 NA A0201, 14 0.6942 A0201, 14 0.6942 A0201,A 15 0.7006 A0201, 15 0.7006 A0201, 15 0.7006 TN A0206, A0206, 0205,A02 A0205, A0205, VVI A6802, A6802, 06,A6802 A0206, A0206, KV B1302, B1302, ,B1302,B A6802, A6802, (SEQ B5101, B5101, 5101,B53 B1302, B1302, ID B5301, B5301, 01,C0202 B5101, B5101, NO: C0202, C0202, ,C0602,C B5301, B5301, 37) C0602, C0602, 0704,C08 C0202, C0202, C0704, C0704, 01,C1203 C0602, C0602, C0801, C0801, ,C1502,C C0704, C0704, C1203, C1203, 1601,C17 C0801, C0801, C1502, C1502, 01 C1203, C1203, C1601, C1601, C1502, C1502, C1701 C1701 C1601, C1601, C1701 C1701 QLT A3002, 3 0.1002 A0101, 4 0.1865 A0101,A 4 0.1865 A0101, 4 0.1865 A0101, 6 0.2722 PT B1502, A3002, 3002,B15 A3002, A3002, WR C1601 B1502, 02,C1601 B1502, B1501, VY C1601 C1601 B1502, (SEQ C1203, ID C1601 NO: 38) SEF B1503, 4 0.1921 B1503, 4 0.1921 B1503,B1 5 0.2654 B1503, 5 0.2654 B1503, 6 0.2959 SSL B1801, B1801, 801,B400 B1801, B1801, PSY B4402, B4402, 2,B4402, B4002, B4002, (SEQ B4403 B4403 B4403 B4402, B4006, ID B4403 B4402, NO: B4403 27) TA B0704, 10 0.6218 B0704, 10 0.6218 B0704,B3 10 0.6218 B0704, 14 0.7542 B0704, 14 0.7542 QNS B3503, B3503, 503,B420 B3503, B3503, VR B4201, B4201, 1,C0102, B4201, B4201, VL C0102, C0102, C0303,C0 B5802, B5802, (SEQ C0303, C0303, 304,C060 C0102, C0102, ID C0304, C0304, 2,C0704, C0303, C0303, NO: C0602, C0602, C1203,C1 C0304, C0304, 18) C0704, C0704, 601 C0602, C0602, C1203, C1203, C0701, C0701, C1601 C1601 C0704, C0704, C0802, C0802, C1202, C1202, C1203, C1203, C1601 C1601 TTT A0101, 11 0.3883 A0101, 11 0.3883 A0101,A 11 0.3883 A0101, 13 0.4162 A0101, 14 0.4511 IKP A0301, A0301, 0301,A30 A0301, A0301, VT A3002, A3002, 02,A3601 A2902, A2902, Y A3601, A3601, ,B1502,B A3002, A3002, (SEQ B1502, B1502, 1517,B18 A3601, A3601, ID B1517, B1517, 01,B5701 B1502, B1502, NO: B1801, B1801, ,C1202,C B1517, B1517, 21) B5701, B5701, 1203,C16 B1801, B1801, C1202, C1202, 01 B5701, B5701, C1203, C1203, B5703, B5703, C1601 C1601 C1202, C0202, C1203, C1202, C1601 C1203, C1601 VA A2902, 10 0.3268 A2902, 10 0.3268 A2902,A 10 0.3268 A2902, 10 0.3268 A0101, 12 0.4344 TSR A3601, A3601, 3601,B15 A3601, A2902, TLS B1517, B1517, 17,B3507 B1517, A3601, Y B3507, B3507, ,B4601,C B3507, B1501, (SEQ B4601, B4601, 202,C03 B4601, B1517, ID C0202, C0202, 02,C1202 C0202, B3507, NO: C0302, C0302, ,C1203,C C0302, B4601, 41) C1202, C1202, 1601 C1202, C0202, C1203, C1203, C1203, C0302, C1601 C1601 C1601 C1202, C1203, C1601 VG B1503, 3 0.0859 B1503, 3 0.0859 B1503,B5 4 0.1408 B1503, 4 0.1048 B1503, 4 0.1048 YL B5802, B5802, 701,B580 B5701, B5701, QPR C1601 C1601 2,C1601 B5802, B5802, TF C1601 C1601 (SEQ ID NO: 39) EIL A0211, 10 0.2453 A0211, 10 0.2453 A0211,A 13 0.3082 A0211, 16 0.4198 A0211, 18 0.4407 DIT A2301, A2301, 2301,A24 A2301, A2301, PCS A2407, A2407, 07,A2501 A2407, A2407, F A2501, A2501, ,A2601,A A2501, A2501, (SEQ A2601, A2601, 3201,A34 A2601, A2601, ID A3201, A3201, 02,A6802 A3201, A2902, NO: A6802, A6802, ,B1502,B A3402, A3201, 33) B1502, B1502, 3507,B46 A6802, A3402, C1402, C1402, 01,C1402 B1502, A6802, G0104 G0104 G0104 B1801, B1502, B3507, B1801, B4601, B3507, C0202, B4601, C1202, C0202, C1402, C1202, G0104 C1402, G0101, G0104 KNI A2601, 14 0.5037 A2601, 15 0.5079 A2601,A 17 0.6646 A2601, 17 0.6646 A2601, 17 0.6646 DG A3002, A3002, 3002,A32 A3002, A3002, YFK A3201, A3201, 01,A3601 A3201, A3201, IY B1503, A3601, ,B1503,B A3601, A3601, (SEQ B1517, B1503, 1517,B18 B1503, B1503, ID B1801, B1517, 01,B4403 B1517, B1517, NO: B4403, B1801, ,B4601,B B1801, B1801, 36) B4601, B4403, 5701,B58 B4403, B4403, B5701, B4601, 02,C0701 B4601, B4601, B5802, B5701, ,C0702,C B5701, B5701, C0701, B5802, 0704,C15 B5802, B5802, C0704, C0701, 02,C1601 C0701, C0701, C1502, C0704, ,C1701 C0702, C0702, C1601 C1502, C0704, C0704, C1601 C1502, C1502, C1601, C1601, C1701 C1701 EEF A2902, 7 0.3459 A2601, 10 0.4557 A2601,A 10 0.4557 A2501, 12 0.4771 A2501, 14 0.5404 EPS A3201, A2902, 2902,A32 A2601, A2601, TQ B1801, A3201, 01,B1501 A2902, A2902, YE B3501, B1501, ,B1801,B A3201, A3201, Y B4402, B1801, 3501,B35 B1501, B1501, (SEQ B4403, B3501, 07,B4402 B1801, B1801, ID C1402 B3507, ,B4403,C B3501, B3501, NO: B4402, 1402 B3507, B3507, 20) B4403, B4402, B4402, C1402 B4403, B4403, C1402, C0202, C1403 C1202, C1402, C1403 EIL unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 DIT PCS FG (SEQ ID NO: 47) HEK293 AG C0704 1 0.0291 C0704 1 0.0291 C0704 1 0.0291 C0704 1 0.0291 C0704 1 0.0291 TDT TIT V (SEQ ID NO: 26) APR unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unkno 0 0.0000 ITF wn GGP (SEQ ID NO: 42) ELP A0201, 5 0.3948 A0201, 5 0.3948 A0201,A 6 0.3948 A0201, 7 0.3948 A0201, 7 0.3948 DEF A0206, A0206, 0206,A02 A0206, A0206, VV A0207, A0207, 07,A6802 A0207, A0207, V A6802, A6802, ,G0101,G A6802, A6802, (SEQ G0104 G0104 0104 G0101, G0101, ID G0103, G0103, NO: G0104 G0104 12) FGD A0201, 11 0.7772 A0101, 13 0.8132 A0101,A 13 0.8123 A0101, 13 0.8132 A0101, 13 0.8132 DT A0206, A0201, 0201,A02 A0201, A0201, VIE A0207, A0206, 06,A0207 A0206, A0206, V C0303, A0207, ,C0303,C A0207, A0207, (SEQ C0304, C0303, 0304,C04 C0303, C0303, ID C0401, C0304, 01,C0403 C0304, C0304, NO: C0403, C0401, ,C0501,C C0401, C0401, 23) C0501, C0403, 0704,C08 C0403, C0403, C0801, C0501, 01,C0802 C0501, C0501, C0802, C0704, ,C1502 C0704, C0704, C1502 C0801, C0801, C0801, C0802, C0802, C0802, C1502 C1502 C1502 GLI A0201, 4 0.3061 A0201, 4 0.3061 A0201,A 5 0.3202 A0201, 6 0.3581 A0201, 6 0.3581 TLS A0202, A0202, 0202,A02 A0202, A0202, YH A0204, A0204, 04,A0205 A0204, A0204, L A0211 A0211 ,A0211 A0205, A0205, (SEQ A0211, A0211, ID A2301 A2301 NO: 5) IRQ B1402, 5 0.4764 B1402, 5 0.4764 B1402,B3 5 0.4764 B1402, 5 0.4764 B1402, 5 0.4764 EEV B3801, B3801, 801,C060 B3801, B3801, QEL C0602, C0602, 2,C0701, C0602, C0602, (SEQ C0701, C0701, C0702 C0701, C0701, ID C0702 C0702 C0702 C0702 NO: 31) KR A2902, 9 0.5699 A2902, 9 0.5699 A2902,A 10 0.5830 A2902, 10 0.5830 A2902, 11 0.5919 VD A3201, A3201, 3002,A32 A3002, A3002, WTI B1503, B1503, 01,B1503 A3201, A3201, EY B2705, B2705, ,B2705,B B1503, B1503, (SEQ B4601, B4601, 4601,C02 B2705, B2705, ID C0202, C0202, 02,C0602 B4601, B4601, NO: C0602, C0602, ,C0701,C C0202, B5701, 29) C0701, C0701, 0702 C0602, C0202, C0702 C0702 C0701, C0602, C0702 C0701, C0702 ML unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 LGS ML YM (SEQ ID NO: 4) NL A0201, 5 0.3603 A0201, 5 0.3603 A0201,A 5 0.3603 A0201, 5 0.3603 A0201, 5 0.3603 NES A0202, A0202, 0202,A02 A0202, A0202, LID A0203, A0203, 03,A0204 A0203, A0203, L A0204, A0204, ,A0207 A0204, A0204, (SEQ A0207 A0207 A0207 A0207 ID NO: 40) SLE A0201, 7 0.3696 A0201, 7 0.3696 A0201,A 8 0.4021 A0201, 8 0.4021 A0201, 9 0.4267 DK A0202, A0202, 0202,A02 A0202, A0202, AFQ A0204, A0204, 04,A0207 A0204, A0204, L A0207, A0207, ,B1301,C A0207, A0207, (SEQ B1301, B1301, 0501,G01 B1301, B1301, ID G0103, G0103, 03,G0104 C0501, C0501, NO: G0104 G0104 G0103, C0802, 7) G0104 G0103, G0104 STS A0202, 8 0.2457 A0202, 8 0.2457 A0202,A 9 0.2506 A0201, 10 0.4802 A0201, 10 0.4802 AFV A0203, A0203, 0203,A02 A0202, A0202, ETV A0205, A0205, 04,A0205 A0203, A0203, (SEQ A0206, A0206, ,A0206,A A0204, A0204, ID A0211, A0211, 0211,A68 A0205, A0205, NO: A6802, A6802, 02,C1203 A0206, A0206, 19) C1203, C1203, ,C1502 A0211, A0211, C1502 C1502 A6802, A6802, C1203, C1203, C1502 C1502 SVV A0201, 16 0.6589 A0201, 17 0.6632 A0201,A 17 0.6632 A0201, 17 0.6632 A0201, 17 0.6632 SKY A0202, A0202, 0202,A02 A0202, A0202, VK A0203, A0203, 03,A0204 A0203, A0203, V A0204, A0204, ,A0205,A A0204, A0204, (SEQ A0205, A0205, 0206,A02 A0205, A0205, ID A0206, A0206, 07,A0211 A0206, A0206, NO: A0207, A0207, ,A2501,A A0207, A0207, 30) A0211, A0211, 2601,A68 A0211, A0211, A2601, A2501, 02,B1302 A2501, A2501, A6802, A2601, ,C0202,C A2601, A2601, B1302, A6802, 0602,C12 A6802, A6802, C0202, B1302, 03,C1502 B1302, B1302, C0602, C0202, ,C1701 C0202, C0202, C1203, C0602, C0602, C0602, C1502, C1203, C1203, C1203, C1701 C1502, C1502, C1502, C1701 C1701 C1701 YL A0201, 6 0.3783 A0201, 6 0.3783 A0201,A 7 0.3882 A0201, 9 0.4499 A0201, 9 0.4499 NST A0202, A0202, 0202,A02 A0202, A0202, NV A0203, A0203, 03,A0204 A0203, A0203, TI A0204, A0204, ,A0207,B A0204, A0204, (SEQ A0207, A0207, 1302,B38 A0207, A0207, ID B1302 B1302 01 B1301, B1301, NO: B1302, B1302, 24) B3801, B3801, C0501 C0501 APH B0702, 10 0.3762 B0702, 12 0.4079 B0702,B0 13 0.4326 B0702, 13 0.4326 B0702, 13 0.4326 GH B0704, B0704, 704,B080 B0704, B0704, VM B0801, B0801, 1,B3503, B0801, B0801, VEL B4201, B3503, B3507,B4 B3503, B3503, (SEQ B5501, B3507, 201,B550 B3507, B3507, ID B5502, B4201, 1,B5502, B4201, B4201, NO: B5601, B5501, B5601,C0 B5501, B5501, 14) C0704, B5502, 403,C070 B5502, B5502, C0801, B5601, 4,C0801, B5601, B5601, C1701 C0704, C1701 C0403, C0403, C0801, C0704, C0704, C1701 C0801, C0801, C1701 C1701 GP unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 MV LRG LIT (SEQ ID NO: 6) KAF A0201, 20 0.6205 A0201, 20 0.6205 A0201,A 20 0.6205 A0201, 21 0.6260 A0201, 21 0.6260 QLT A0202, A0202, 0202,A02 A0202, A0202, PIA A0203, A0203, 03,A0204 A0203, A0203, V A0204, A0204, ,A0205,A A0204, A0204, (SEQ A0205, A0205, 0206,A02 A0205, A0205, ID A0206, A0206, 11,A6802 A0206, A0206, NO: A0211, A0211, ,B1302,B A0211, A0211, 13) A6802, A6802, 4006,B51 A6802, A6802, B1302, B1302, 01,B5201 B1302, B1302, B4006, B4006, ,B5401,B B4006, B4006, B5101, B5101, 5502,B56 B5101, B5101, B5201, B5201, 01,C0704 B5201, B5201, B5401, B5401, ,C1203,C B5401, B5401, B5502, B5502, 1701,G01 B5501, B5501, B5601, B5601, 01,G0104 B5502, B5502, C0704, C0704, B5601, B5601, C1203, C1203, C0704, C0704, C1701, C1701, C1203, C1203, G0101, G0101, C1701, C1701, G0104 G0104 G0101, G0101, G0104 G0104 ELP A0201, 12 0.6910 A0201, 13 0.7018 A0201,A 16 0.7018 A0201, 16 0.7018 A0201, 16 0.7018 DEF A0203, A0203, 0203,A02 A0203, A0203, VV A0205, A0205, 05,A0206 A0205, A0205, VT A0206, A0206, ,A0207,A A0206, A0206, V A0207, A0207, 2601,A68 A0207, A0207, (SEQ A2601, A2601, 02,B5101 A2601, A2601, ID A6802, A6802, ,B5201,C A6802, A6802, NO: B5101, B5101, 0102,C04 B5101, B5101, 8) B5201, B5201, 03,C0602 B5201, B5201, C0102, C0102, ,C0704,G C0102, C0102, C0403, C0403, 0101,G01 C0403, C0403, C0602 C0602, 03,G0104 C0602, C0602, C0704 C0704, C0704, G0101, G0101, G0103, G0103, G0104 G0104 YLF A0201, 36 0.9692 A0201, 39 0.9920 A0201,A 39 0.9920 A0201, 42 0.9928 A0201, 44 0.9935 DES A0202, A0202, 0202,A02 A0202, A0202, GEF A0203, A0203, 03,A0204 A0203, A0203, KL A0204, A0204, ,A0205,A A0204, A0204, (SEQ A0205, A0205, 0206,A02 A0205, A0205, ID A0206, A0206, 07,A0211 A0206, A0206, NO: A0207, A0207, ,A2902,A A0207, A0207, 25) A0211, A0211, 3201,B08 A0211, A0211, A2902, A2902, 01,B1301 A2407, A2407, A3201, A3201, ,B1302,B A2902, A2902, B0801, B0801, 1510,B15 A3201, A3201, B1301, B1301, 17,B3501 B0801, B0801, B1302, B1302, ,B3503,B B1301, B1301, B1510, B1510, 3507,B38 B1302, B1302, B1517, B1517, 01,C0102 B1502, B1502, B3501, B3501, ,C0302,C B1510, B1510, B3503, B3503, 0303,C03 B1517, B1517, B3801, B3507, 04,C0401 B3501, B3501, C0102, B3801, ,C0403,C B3503, B3503, C0302, C0102, 0501,C06 B3507, B3507, C0303, C0302, 02,C0701 B3801, B3801, C0304, C0303, ,C0702,C B4601, B4601, C0403, C0304, 0704,C08 C0102, B5201, C0602, C0401, 01,C1402 C0302, B5301, C0701, C0403, ,C1403,C C0303, C0102, C0702, C0501, 1502,C16 C0304, C0302, C0704, C0602, 01,C1701 C0401, C0303, C0801, C0701, ,G0101,G C0403, C0304, C1402, C0702, 0103,G01 C0501, C0401, C1403, C0704, 04 C0602, C0403, C1502, C0801, C0701, C0501, C1601, C1402, C0702, C0602, C1701, C1403, C0704, C0701, G0101, C1502, C0801, C0702, G0103, C1601, C1402, C0704, G0104 C1701, C1403, C0801, G0101, C1502, C1402, G0103, C1601, C1403, G0104 C1701, C1502, G0101, C1601, G0103, C1701, G0104 G0101, G0103, G0104 Peps A6802, 81 1.0000 A6802, 82 1.0000 A6802,B 83 1.0000 A6802, 83 1.0000 A6802, 83 1.0000 Comb- B1402, B1402, 1402,B18 B1402, B1402, ined B1801, B1801, 01,B3701 B1801, B1801, B3701, B3701, ,B4002,B B3701, B3701, B4002, B4002, 4006,B44 B4002, B4001, B4006, B4006, 02,B4403 B4006, B4002, B4402, B4402, ,B4501,B B4402, B4006, B4403, B4403, 4901,B50 B4403, B4402, B4501, B4501, 01,B5101 B4501, B4403, B4901, B4901, ,B5201,A B4901, B4501, B5001, B5001, 0101,A02 B5001, B4901, B5101, B5101, 02,A3601 B5101, B5001, B5201, B5201, ,B1510,B B5201, B5101, A0101, A0101, 1801,B35 A0101, B5201, A0202, A0202, 03,B3801 A0202, C0704, A3601, A3601, ,B4001,B A3601, A0101, B1510, B1510, 4002,B44 B1510, A0202, B1801, B1801, 02,B4403 B1517, A3601, B3503, B3503, ,B4501,B B1801, B1510, B3801, B3801, 5001,B57 B3503, B1517, B4001, B4001, 03,C0704 B3801, B1801, B4002, B4002, ,C0802,A B4001, B3503, B4402, B4402, 0101,A25 B4002, B3801, B4403, B4403, 01,A2601 B4402, B4001, B4501, B4501, ,A2902,A B4403, B4002, B5703, B5703, 3002,A32 B4501, B4402, C0704, C0704, 01,A3601 B5001, B4403, C0802, C0802, ,B1501,B B5703, B4501, A0101, A0101, 1502,B35 C0704, B5001, A2501, A2501, 01,A2501 C0802, B5703, A2601, A2601, ,A2601,A A0101, C0704, A2902, A2902, 3401,B15 A0301, C0802, A3002, A3002, 01,B1502 A2501, A0101, A3601, A3601, ,C1202,B A2601, A0301, B1501, B1501, 5101,C02 A2902, A2501, B1502, B1502, 02,C0302 A3002, A2601, B3501, B3501, ,C0303,C A3201, A2902, A2501, A2501, 0304,C05 A3601, A3002, A2601, A2601, 01,C0602 B1501, A3201, B1501, A3401, ,C0801,C B1502, A3601, B1502, B1501, 0802,C12 B3501, B1501, C1202, B1502, 02,C1203 A2501, B1502, B5101, C1202, ,C1502,C A2601, B3501, C0202, B5101, 1601,A25 A3401, B5301, C0302, C0202, 01,A2902 B1501, A2501, C0303, C0302, ,B1501,B B1502, A2601, C0304, C0303, 1502,B15 C1202, A3401, C0501, C0304, 03,B3501 B5101, B1501, C0602, C0501, ,B3507,B C0202, B1502, C0801, C0602, 4601,B53 C0302, B4601, C0802, C0801, 01,C0202 C0303, C1202, C1202, C0802, ,C0302,C C0304, B5101, C1203, C1202, 0303,C03 C0501, C0202, C1502, C1203, 04,C0702 C0602, C0302, C1601, C1502, ,C1202,C C0704, C0303, A2501, C1601, 1203,C14 C0801, C0304, A2902, A2501, 02,C1601 C0802, C0501, B1501, A2902, ,B3501,B C1202, C0602, B1502, B1501, 3503,B35 C1203, C0704, B1503, B1502, 07,C0202 C1502, C0801, B3501, B1503, ,C0302,C C1601, C0802, B3507, B3501, 0303,C03 A2501, C1202, B4601, B3507, 04,C0403 A2902, C1203, B5301, B4601, ,C0704,C B1501, C1502, C0202, B5301, 0801,C12 B1502, C1601, C0302, C0202, 02,C1203 B1503, A2501, C0303, C0302, ,C1601,C B3501, A2902, C0304, C0303, 1701,A02 B3507, B1501, C0702, C0304, 01,A0205 B4601, B1502, C1202, C0702, ,A0206,A B5301, B1503, C1203, C1202, 6802,B13 C0202, B3501, C1402, C1203, 02,B5101 C0302, B3507, C1601, C1402, ,B5301,C C0303, B4601, B3501, C1601, 0202,C06 C0304, B5301, B3503, B3501, 02,C0704 C0702, C0202, B3507, B3503, ,C0801,C C1202, C0302, C0302, B3507, 1203,C15 C1203, C0303, C0303, C0202, 02,C1601 C1402, C0304, C0304, C0302, ,C1701,A C1601, C0702, C0403, C0303, 0101,A30 B3501, C1202, C0704, C0304, 02,B1502 B3503, C1203, C1202, C0403, ,C1601,B B3507, C1402, C1203, C0704, 1503,B18 C0202, C1403, C1601, C1202, 01,B4002 C0302, C1601, C1701, C1203, ,B4402,B C0303, B3501, A0201, C1601, 4403,B07 C0304, B3503, A0206, C1701, 04,B3503 C0403, B3507, A6802, A0201, ,B4201,C C0704, C0202, B1302, A0206, 0102,C03 C0801, C0302, B5101, A6802, 03,C0304 C1202, C0303, B5301, B1302, ,C0602,C C1203, C0304, C0202, B5101, 0704,C12 C1601, C0403, C0602, B5301, 03,C1601 C1701, C0704, C0704, C0202, ,A0101,A A0201, C0801, C0801, C0602, 0301,A30 A0205, C1202, C1203, C0704, 02,A3601 A0206, C1203, C1502, C0801, ,B1502,B A6802, C1601, C1601, C1203, 1517,B18 B1302, C1701, C1701, C1502, 01,B5701 B5101, A0201, A3002, C1601, ,C1202,C B5301, A0205, B1502, C1701, 1203,C16 C0202, A0206, C1601, A0101, 01,A2902 C0602, A6802, B1503, A3002, ,A3601,B C0704, B1302, B1801, B1502, 1517,B35 C0801, B5101, B4402, C1601, 07,B4601 C1203, B5301, B4403, B1503, ,C0202,C C1502, C0202, B0704, B1801, 0302,C12 C1601, C0602, B3503, B4402, 02,C1203 C1701, C0704, B4201, B4403, ,C1601,B A0101, C0801, C0102, B0704, 1503,B57 A3002, C1203, C0303, B3503, 01,B5802 B1502, C1502, C0304, B4201, ,C1601,A C1601, C1601, C0602, C0102, 0211,A23 B1503, C1701, C0704, C0303, 01,A2407 B1801, A0101, C1203, C0304, ,A2501,A B4002, A3002, C1601, C0602, 2601,A32 B4402, B1501, A0101, C0704, 01,A3402 B4403, B1502, A0301, C1203, ,A6802,B B0704, C1203, A3002, C1601, 1502,B35 B3503, C1601, A3601, A0101, 07,B4601 B4201, B1503, B1502, A0301, ,C1402,G B5802, B1801, B1517, A3002, 0104,A26 C0102, B4002, B1801, A3601, 01,A3002 C0303, B4006, B5701, B1502, ,A3201,A C0304, B4402, C1202, B1517, 3601,B15 C0602, B4403, C1203, B1801, 03,B1517 C0701, B0704, C1601, B5701, ,B1801,B C0704, B3503, A2902, C1202, 4403,B46 C0802, B4201, A3601, C1203, 01,B5701 C1202, B5802, B1517, C1601, ,B5802,C C1203, C0102, B3507, A2902, 0701,C07 C1601, C0303, B4601, A3601, 02,C0704 A0101, C0304, C0202, B1517, ,C1502,C A0301, C0602, C0302, B3507, 1601,C17 A2902, C0701, C1202, B4601, 01,A2601 A3002, C0704, C1203, C0202, ,A2902,A A3601, C0802, C1601, C0302, 3201,B15 B1502, C1202, B1503, C1202, 01,B1801 B1517, C1203, B5802, C1203, ,B3501,B B1801, C1601, C1601, C1601, 3507,B44 B5701, A0101, A0211, B1503, 02,B4403 B5703, A0301, A2301, B5802, ,C1402,u C1202, A2902, A2407, C1601, nknown, C1203, A3002, A2501, A0211, C0704,un C1601, A3601, A2601, A2301, known,A A2902, B1502, A3201, A2407, 0201,A02 A3601, B1517, A6802, A2501, 06,A0207 B1517, B1801, B1502, A2601, ,A6802,G B3507, B5701, C1402, A3201, 0101,G01 B4601, B5703, G0104, A6802, 04,A0101 C0202, C0202, A2601, B1502, ,A0201,A C0302, C1202, A3002, C1402, 0206,A02 C1202, C1203, A3201, G0104, 07,C0303 C1203, C1601, B1503, A2601, ,C0304,C C1601, A0101, B1517, A3002, 0401,C04 B1503, A2902, B1801, A3201, 03,C0501 B5701, A3601, B4403, A3601, ,C0704,C B5802, B1501, B4601, B1503, 0801,C08 C1601, B1517, B5701, B1517, 02,C1502 A0211, B3507, B5802, B1801, ,A0201,A A2301, B4601, C0701, B4403, 0202,A02 A2407, C0202, C0704, B4601, 04,A0205 A2501, C0302, C1502, B5701, ,A0211,B A2601, C1202, C1601, B5802, 1402,B38 A3201, C1203, A2902, C0701, 01,C0602 A3402, C1601, A3201, C0704, ,C0701,C A6802, B1503, B1801, C1502, 0702,A29 B1502, B5701, B3501, C1601, 02,A3002 B1801, B5802, B4402, A2601, ,A3201,B B3507, C1601, B4403, A2902, 1503,B27 B4601, A0211, C1402, A3201, 05,B4601 C0202, A2301, unkno B1501, ,C0202,C C1202, A2407, wn,C0 B1801, 0602,C07 C1402, A2501, 704,un B3501, 01,C0702 G0104, A2601, known, B3507, ,unknown A2601, A2902, A0201, B4402, ,A0201,A A3002, A3201, A0206, B4403, 0202,A02 A3201, A3402, A0207, C1402, 03,A0204 A3601, A6802, A6802, unkno ,A0207,A B1503, B1502, G0104, wn,C07 0201,A02 B1517, B1801, A0201, 04,unk 02,A0204 B1801, B3507, A0206, flown, ,A0207,B B4403, B4601, A0207, A0201, 1301,C05 B4601, C0202, C0303, A0206, 01,G0103 B5701, C1202, C0304, A0207, ,G0104,A B5802, C1402, C0401, A6802, 0202,A02 C0701, G0101, C0403, G0104, 03,A0204 C0702, G0104, C0501, A0101, ,A0205,A C0704, A2601, C0801, A0201, 0206,A02 C1502, A3002, C0802, A0206, 11,A6802 C1601, A3201, C1502, A0207, ,C1203,C C1701, A3601, A0201, C0303, 1502,A02 A2501, B1503, A0202, C0304, 01,A0202 A2601, B1517, A0204, C0401, ,A0203,A A2902, B1801, A0211, C0403, 0204,A02 A3201, B4403, B1402, C0501, 05,A0206 B1501, B4601, B3801, C0704, ,A0207,A B1801, B5701, C0602, C0801, 0211,A25 B3501, B5802, C0701, C0802, 01,A2601 B3507, C0701, C0702, C1502, ,A6802,B B4402, C0702, A2902, A0201, 1302,C02 B4403, C0704, A3201, A0202, 02,C0602 C1402, C1502, B1503, A0204, ,C1203,C C1403, C1601, B2705, A0211, 1502,C17 unknow C1701, B4601, B1402, 01,A0201 n,C070 A2501, C0202, B3801, ,A0202,A 4,unkno A2601, C0602, C0602, 0203,A02 wn,A02 A2902, C0701, C0701, 04,A0207 01,A02 A3201, C0702, C0702, ,B1302,B 06,A02 B1501, unkno A2902, 3801,B07 07,A68 B1801, wn,A0 A3201, 02,B0704 02,G01 B3501, 201,A0 B1503, ,B0801,B 01,G01 B3507, 202,A0 B2705, 3503,B35 03,G01 B4402, 203,A0 B4601, 07,B4201 04,A01 B4403, 204,A0 C0202, ,B5501,B 01,A02 C0202, 207,A0 C0602, 5502,B56 01,A02 C1202, 201,A0 C0701, 01,C0403 06,A02 C1402, 202,A0 C0702, ,C0704,C 07,C03 C1403, 204,A0 unkno 0801,C17 03,C03 unkno 207,B1 wn,A0 01,unkno 04,C04 wn,C07 301,G0 201,A0 wn,A020 01,C04 04,unk 103,G0 202,A0 1,A0202, 03,C05 nown, 104,A0 203,A0 A0203,A 01,C07 A0201, 202,A0 204,A0 0204,A02 04,C08 A0206, 203,A0 207,A0 05,A0206 01,C08 A0207, 205,A0 201,A0 ,A0211,A 02,C15 A6802, 206,A0 202,A0 6802,B13 02,A02 G0101, 211,A6 204,A0 02,B4006 01,A02 G0103, 802,C1 207,B1 ,B5101,B 02,A02 G0104, 203,C1 301,G0 5201,B54 04,A02 A0101, 502,A0 103,G0 01,B5502 05,A02 A0201, 201,A0 104,A0 ,B5601,C 11,A23 A0206, 202,A0 202,A0 0704,C12 01,B14 A0207, 203,A0 203,A0 03,C1701 02,B38 C0303, 204,A0 205,A0 ,G0101,G 01,C06 C0304, 205,A0 206,A0 0104,A02 02,C07 C0401, 206,A0 211,A6 01,A0203 01,C07 C0403, 207,A0 802,C1 ,A0205,A 02,A29 C0501, 211,A2 203,C1 0206,A02 02,A30 C0704, 601,A6 502,A0 07,A2601 02,A32 C0801, 802,B1 201,A0 ,A6802,B 01,B15 C0802, 302,C0 202,A0 5101,B52 03,B27 C1502, 202,C0 203,A0 01,C0102 05,B46 A0201, 602,C1 204,A0 ,C0403,C 01,C02 A0202, 203,C1 205,A0 0602,C07 02,C06 A0204, 502,C1 206,A0 04,G0101 02,C07 A0205, 701,A0 207,A0 ,G0103,G 01,C07 A0211, 201,A0 211,A2 0104,A02 02,unkn A2301, 202,A0 501,A2 01,A0202 own,A0 B1402, 203,A0 601,A6 ,A0203,A 201,A0 B3801, 204,A0 802,B1 0204,A02 202,A0 C0602, 207,B1 302,C0 05,A0206 203,A0 C0701, 302,B0 202,C0 ,A0207,A 204,A0 C0702, 702,B0 602,C1 0211,A29 207,A0 A2902, 704,B0 203,C1 02,A3201 201,A0 A3002, 801,B4 502,C1 ,B0801,B 202,A0 A3201, 201,B5 701,A0 1301,B13 204,A0 B1503, 501,B5 201,A0 02,B1510 207,B1 B2705, 502,B5 202,A0 ,B1517,B 301,C0 B4601, 601,C0 203,A0 3501,B35 501,G0 B5701, 704,C0 204,A0 03,B3507 103,G0 C0202, 801,C1 207,B1 ,B3801,C 104,A0 C0602, 701,un 302,B0 0102,C03 201,A0 C0701, known, 702,B0 02,C0303 202,A0 C0702, A0201, 704,B0 ,C0304,C 203,A0 unkno A0202, 801,B3 0401,C04 204,A0 wn,A0 A0203, 503,B3 03,C0501 205,A0 201,A0 A0204, 507,B4 ,C0602,C 206,A0 202,A0 A0205, 201,B5 0701,C07 211,A6 203,A0 A0206, 501,B5 02,C0704 802,C1 204,A0 A0211, 502,B5 ,C0801,C 203,C1 207,A0 A6802, 601,C0 1402,C14 502,A0 201,A0 B1302, 704,C0 03,C1502 201,A0 202,A0 B4006, 801,C1 ,C1601,C 202,A0 204,A0 B5101, 701,un 1701,G01 203,A0 207,B1 B5201, known, 01,G0103 204,A0 301,C0 B5401, A0201, ,G0104 205,A0 501,C0 B5502, A0202, 206,A0 802,G0 B5601, A0203, 207,A0 103,G0 C0704, A0204, 211,A2 104,A0 C1203, A0205, 501,A2 201,A0 C1701, A0206, 601,A6 202,A0 G0101, A0211, 802,B1 203,A0 G0104, A6802, 302,C0 204,A0 A0201, B1302, 202,C0 205,A0 A0203, B4006, 602,C1 206,A0 A0205, B5101, 203,C1 211,A6 A0206, B5201, 502,C1 802,C1 A0207, B5401, 701,A0 203,C1 A2601, B5502, 201,A0 502,A0 A6802, B5601, 202,A0 201,A0 B5101, C0704, 203,A0 202,A0 B5201, C1203, 204,A0 203,A0 C0102, C1701, 207,B1 204,A0 C0403, G0101, 301,B1 205,A0 C0602, G0104, 302,B3 206,A0 A0201, A0201, 801,C0 207,A0 A0202, A0203, 501,B0 211,A2 A0203, A0205, 702,B0 501,A2 A0204, A0206, 704,B0 601,A6 A0205, A0207, 801,B3 802,B1 A0206, A2601, 503,B3 302,C0 A0207, A6802, 507,B4 202,C0 A0211, B5101, 201,B5 602,C1 A2902, B5201, 501,B5 203,C1 A3201, C0102, 502,B5 502,C1 B0801, C0403, 601,C0 701,A0 B1301, C0602, 403,C0 201,A0 B1302, C0704, 704,C0 202,A0 B1510, A0201, 801,C1 203,A0 B1517, A0202, 701,unk 204,A0 B3501, A0203, nown,A 207,B1 B3503, A0204, 0201,A 301,B1 B3801, A0205, 0202,A 302,B3 C0102, A0206, 0203,A 801,C0 C0302, A0207, 0204,A 501,B0 C0303, A0211, 0205,A 702,B0 C0304, A2902, 0206,A 704,B0 C0403, A3201, 0211,A 801,B3 C0602, B0801, 6802,B 503,B3 C0701, B1301, 1302,B 507,B4 C0702, B1302, 4006,B 201,B5 C0704, B1510, 5101,B 501,B5 C0801, B1517, 5201,B 502,B5 C1402, B3501, 5401,B 601,C0 C1403, B3503, 5501,B 403,C0 C1502, B3507, 5502,B 704,C0 C1601, B3801, 5601,C 801,C1 C1701, C0102, 0704,C 701,un G0101, C0302, 1203,C known, G0103, C0303, 1701,G A0201, G0104 C0304, 0101,G A0202, C0401, 0104,A A0203, C0403, 0201,A A0204, C0501, 0203,A A0205, C0602, 0205,A A0206, C0701, 0206,A A0211, C0702, 0207,A A6802, C0704, 2601,A B1302, C0801, 6802,B B4006, C1402, 5101,B B5101, C1403, 5201,C B5201, C1502, 0102,C B5401, C1601, 0403,C B5501, C1701, 0602,C B5502, G0101, 0704,G B5601, G0103, 0101,G C0704, G0104 0103,G C1203, 0104,A C1701, 0201,A G0101, 0202,A G0104, 0203,A A0201, 0204,A A0203, 0205,A A0205, 0206,A A0206, 0207,A A0207, 0211,A A2601, 2407,A A6802, 2902,A B5101, 3201,B B5201, 0801,B C0102, 1301,B C0403, 1302,B C0602, 1502,B C0704, 1510,B G0101, 1517,B G0103, 3501,B G0104, 3503,B A0201, 3507,B A0202, 3801,B A0203, 4601,C A0204, 0102,C A0205, 0302,C A0206, 0303,C A0207, 0304,C A0211, 0401,C A2407, 0403,C A2902, 0501,C A3201, 0602,C B0801, 0701,C B1301, 0702,C B1302, 0704,C B1502, 0801,C B1510, 1402,C B1517, 1403,C B3501, 1502,C B3503, 1601,C B3507, 1701,G B3801, 0101,G B4601, 0103,G B5201, 0104 B5301, C0102, C0302, C0303, C0304, C0401, C0403, C0501, C0602, C0701, C0702, C0704, C0801, C1402, C1403, C1502, C1601, C1701, G0101, G0103, G0104 thr1.6_ thr1.6_ thr1.6_ thr1.7_ thr1.7_ thr1.7_ thr1.8_ thr1.8_ thr1.8_ thr1.9_ thr1.9_ thr1.9_ thr2_ thr2_ thr2_ Pep- assign_ num cover- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- assign_ num_ cover- tide alleles alleles age alleles alleles age alleles alleles age alleles alleles age alleles alleles age A549 DEF A6802, 16 0.6072 A6802, 16 0.6072 A6802,B 16 0.6072 A6802, 16 0.6072 A6802, 16 0.6072 VV B1302, B1302, 1302,B14 B1302, B1302, VT B1402, B1402, 02,B1801 B1402, B1402, V B1801, B1801, ,B3701,B B1801, B1801, (SEQ B3701, B3701, 4001,B40 B3701, B3701, ID B4001, B4001, 02,B4006 B4001, B4001, NO: B4002, B4002, ,B4402,B B4002, B4002, 11) B4006, B4006, 4403,B45 B4006, B4006, B4402, B4402, 01,B4901 B4402, B4402, B4403, B4403, ,B5001,B B4403, B4403, B4501, B4501, 5101,B52 B4501, B4501, B4901, B4901, 01,C0704 B4901, B4901, B5001, B5001, B5001, B5001, B5101, B5101, B5101, B5101, B5201, B5201, B5201, B5201, C0704 C0704 C0704 C0704 LED A0101, 21 0.5963 A0101, 23 0.6419 A0101,A 23 0.6419 A0101, 24 0.6611 A0101, 28 0.7173 KAF A0202, A0202, 0202,A02 A0202, A0202, QL A0207, A0207, 07,A3601 A0207, A0206, (SEQ A3601, A3601, ,B1301,B A3601, A0207, ID B1301, B1301, 1510,B15 B1301, A3601, NO: B1510, B1510, 17,B1801 B1510, B1301, 10) B1517, B1517, ,B3503,B B1517, B1510, B1801, B1801, 3507,B37 B1801, B1517, B3503, B3503, 01,B3801 B3503, B1801, B3701, B3507, ,B4001,B B3507, B3503, B3801, B3701, 4002,B44 B3701, B3507, B4001, B3801, 02,B4403 B3801, B3701, B4002, B4001, ,B4501,B B4001, B3801, B4402, B4002, 5001,B57 B4002, B3802, B4403, B4402, 03,B5801 B4402, B4001, B4501, B4403, ,C0704,C B4403, B4002, B5001, B4501, 0802,G01 B4501, B4402, B5703, B5001, 01 B5001, B4403, C0704, B5703, B5703, B4501, C0802, B5801, B5801, B4901, G0101 C0704, C0501, B5001, C0802, C0704, B5301, G0101 C0802, B5703, G0101 B5801, C0501, C0704, C0802, G0101 TVI A0101, 13 0.5045 A0101, 13 0.5045 A0101,A 13 0.5045 A0101, 13 0.5045 A0101, 13 0.5045 EV A0301, A0301, 0301,A25 A0301, A0301, QG A2501, A2501, 01,A2601 A2501, A2501, Y A2601, A2601, ,A2902,A A2601, A2601, (SEQ A2902, A2902, 3002,A32 A2902, A2902, ID A3002, A3002, 01,A3601 A3002, A3002, NO: A3201, A3201, ,A6801,B A3201, A3201, 22) A3601, A3601, 1501,B15 A3601, A3601, A6801, A6801, 02,B3501 A6801, A6801, B1501, B1501, ,B5301 B1501, B1501, B1502, B1502, B1502, B1502, B3501, B3501, B3501, B3501, B5301 B5301 B5301 B5301 EIK A2501, 7 0.2766 A2501, 7 0.2766 A2501,A 7 0.2766 A2501, 7 0.2766 A2501, 7 0.2766 ESV A2601, A2601, 2601,A34 A2601, A2601, QTF A3401, A3401, 01,B1501 A3401, A3401, (SEQ B1501, B1501, ,B1502,B B1501, B1501, ID B1502, B1502, 4601,C12 B1502, B1502, NO: B4601, B4601, 02 B4601, B4601, 15) C1202 C1202 C1202 C1202 FAS B3503, 15 0.7590 B3503, 15 0.7590 B3503,B5 15 0.7590 B3503, 15 0.7590 B3503, 15 0.7590 EA B5101, B5101, 101,C020 B5101, B5101, AR C0202, C0202, 2,C0302, C0202, C0202, VV C0302, C0302, C0303,C0 C0302, C0302, (SEQ C0303, C0303, 304,C050 C0303, C0303, ID C0304, C0304, 1,C0602, C0304, C0304, NO: C0501, C0501, C0704,C0 C0501, C0501, 17) C0602, C0602, 801,C080 C0602, C0602, C0704, C0704, 2,C1202, C0704, C0704, C0801, C0801, C1203,C1 C0801, C0801, C0802, C0802, 502,C160 C0802, C0802, C1202, C1202, 1 C1202, C1202, C1203, C1203, C1203, C1203, C1502, C1502, C1502, C1502, C1601 C1601 C1601 C1601 FAV A2501, 19 0.7960 A2501, 19 0.7960 A2501,A 19 0.7960 A2501, 19 0.7960 A2501, 20 0.8098 DA A2902, A2902, 2902,B15 A2902, A2601, AK B1501, B1501, 01,B1502 B1501, A2902, AY B1502, B1502, ,B1503,B B1502, B1501, (SEQ B1503, B1503, 3501,B35 B1503, B1502, ID B3501, B3501, 07,B4601 B3501, B1503, NO: B3507, B3507, ,B5301,C B3507, B3501, 28) B4601, B4601, 0202,C03 B4601, B3507, B5301, B5301, 02,C0303 B5301, B4601, C0202, C0202, ,C0304,C C0202, B5301, C0302, C0302, 0702,C12 C0302, C0202, C0303, C0303, 02,C1203 C0303, C0302, C0304, C0304, ,C1402,C C0304, C0303, C0702, C0702, 1403,C16 C0702, C0304, C1202, C1202, 01 C1202, C0702, C1203, C1203, C1203, C1202, C1402, C1402, C1402, C1203, C1403, C1403, C1403, C1402, C1601 C1601 C1601 C1403, C1601 LAT B3501, 14 0.6655 B3501, 14 0.6655 B3501,B3 14 0.6655 B3501, 14 0.6655 B3501, 14 0.6655 NN B3503, B3503, 503,B350 B3503, B3503, LV B3507, B3507, 7,C0202, B3507, B3507, VM C0202, C0202, C0302,C0 C0202, C0202, (SEQ C0302, C0302, 303,C030 C0302, C0302, ID C0303, C0303, 4,C0403, C0303, C0303, NO: C0304, C0304, C0704,C0 C0304, C0304, 16) C0403, C0403, 801,C120 C0403, C0403, C0704, C0704, 2,C1203, C0704, C0704, C0801, C0801, C1601,C1 C0801, C0801, C1202, C1202, 701 C1202, C1202, C1203, C1203, C1203, C1203, C1601, C1601, C1601, C1601, C1701 C1701 C1701 C1701 NA A0201, 15 0.7006 A0201, 15 0.7006 A0201,A 15 0.7006 A0201, 15 0.7006 A0201, 15 0.7006 TN A0205, A0205, 0205,A02 A0205, A0205, VVI A0206, A0206, 06,A6802 A0206, A0206, KV A6802, A6802, ,B1302,B A6802, A6802, (SEQ B1302, B1302, 5101,B53 B1302, B1302, ID B5101, B5101, 01,C0202 B5101, B5101, NO: B5301, B5301, ,C0602,C B5301, B5301, 37) C0202, C0202, 0704,C08 C0202, C0202, C0602, C0602, 01,C1203 C0602, C0602, C0704, C0704, ,C1502,C C0704, C0704, C0801, C0801, 1601,C17 C0801, C0801, C1203, C1203, 01 C1203, C1203, C1502, C1502, C1502, C1502, C1601, C1601, C1601, C1601, C1701 C1701 C1701 C1701 QLT A0101, 6 0.2722 A0101, 7 0.3371 A0101,A 7 0.3371 A0101, 8 0.3437 A0101, 9 0.3495 PT A3002, A0301, 0301,A30 A0301, A0301, WR B1501, A3002, 02,B1501 A2501, A2501, VY B1502, B1501, ,B1502,C A3002, A3002, (SEQ C1203, B1502, 1203,C16 B1501, A3601, ID C1601 C1203, 01 B1502, B1501, NO: C1601 C1203, B1502, 38) C1601 C1203, C1601 SEF B1503, 6 0.2959 B1502, 7 0.3179 B1502,B1 7 0.3179 B1502, 7 0.3179 B1502, 7 0.3179 SSL B1801, B1503, 503,B180 B1503, B1503, PSY B4002, B1801, 1,B4002, B1801, B1801, (SEQ B4006, B4002, B4006,B4 B4002, B4002, ID B4402, B4006, 402,B440 B4006, B4006, NO: B4403 B4402, 3 B4402, B4402, 27) B4403 B4403 B4403 TA B0704, 14 0.7542 B0704, 14 0.7542 B0704,B3 15 0.7946 B0704, 15 0.7946 B0704, 15 0.7946 QNS B3503, B3503, 503,B420 B3503, B3503, VR B4201, B4201, 1,B5802, B4201, B4201, VL B5802, B5802, C0102,C0 B5802, B5802, (SEQ C0102, C0102, 303,C030 C0102, C0102, ID C0303, C0303, 4,C0602, C0303, C0303, NO: C0304, C0304, C0701,C0 C0304, C0304, 18) C0602, C0602, 704,C080 C0602, C0602, C0701, C0701, 1,C0802, C0701, C0701, C0704, C0704, C1202,C1 C0704, C0704, C0802, C0802, 203,C160 C0801, C0801, C1202, C1202, 1 C0802, C0802, C1203, C1203, C1202, C1202, C1601 C1601 C1203, C1203, C1601 C1601 TTT A0101, 16 0.5220 A0101, 16 0.5220 A0101,A 16 0.5220 A0101, 16 0.5220 A0101, 18 0.5424 IKP A0301, A0301, 0301,A29 A0301, A0301, VT A2902, A2902, 02,A3002 A2902, A2501, Y A3002, A3002, ,A3601,B A3002, A2902, (SEQ A3601, A3601, 1501,B15 A3601, A3002, ID B1501, B1501, 02,B1517 B1501, A3201, NO: B1502, B1502, ,B1801,B B1502, A3601, 21) B1517, B1517, 5701,B57 B1517, B1501, B1801, B1801, 03,B5801 B1801, B1502, B5701, B5701, ,C0202,C B5701, B1517, B5703, B5703, 1202,C12 B5703, B1801, B5801, B5801, 03,C1601 B5801, B5701, C0202, C0202, C0202, B5703, C1202, C1202, C1202, B5801, C1203, C1203, C1203, C0202, C1601 C1601 C1601 C1202, C1203, C1601 VA A0101, 12 0.4344 A0101, 14 0.4882 A0101,A 14 0.4882 A0101, 15 0.5244 A0101, 15 0.5244 TSR A2902, A2902, 2902,A36 A2601, A2601, TLS A3601, A3601, 01,B1501 A2902, A2902, Y B1501, B1501, ,B1517,B A3601, A3601, (SEQ B1517, B1517, 3507,B46 B1501, B1501, ID B3507, B3507, 01,B5301 B1517, B1517, NO: B4601, B4601, ,B5801,C B3507, B3507, 41) C0202, B5301, 0202,C03 B4601, B4601, C0302, B5801, 02,C1202 B5301, B5301, C1202, C0202, ,C1203,C B5801, B5801, C1203, C0302, 1601 C0202, C0202, C1601 C1202, C0302, C0302, C1203, C1202, C1202, C1601 C1203, C1203, C1601 C1601 VG B1503, 4 0.1048 B1503, 4 0.1048 B1503,B5 4 0.1048 B1503, 5 0.1986 B1503, 5 0.1986 YL B5701, B5701, 701,B580 B5101, B5101, QPR B5802, B5802, 2,C1601 B5701, B5701, TF C1601 C1601 B5802, B5802, (SEQ C1601 C1601 ID NO: 39) EIL A0211, 19 0.4585 A0211, 20 0.5205 A0211,A 21 0.5463 A0211, 22 0.5628 A0211, 23 0.5820 DIT A2301, A2301, 2301,A24 A2301, A2301, PCS A2407, A2407, 07,A2501 A2407, A2407, F A2501, A2501, ,A2601,A A2501, A2501, (SEQ A2601, A2601, 2902,A32 A2601, A2601, ID A2902, A2902, 01,A3402 A2902, A2902, NO: A3201, A3201, ,A6802,B A3201, A3201, 33) A3402, A3402, 1502,B18 A3401, A3401, A6802, A6802, 01,B3501 A3402, A3402, B1502, B1502, ,B3507,B A6802, A6802, B1801, B1801, 4601,C02 B1502, B1502, B3507, B3501, 02,C0302 B1801, B1801, B4601, B3507, ,C1202,C B3501, B3501, C0202, B4601, 1402,C14 B3507, B3507, C1202, C0202, 03,G0101 B4601, B4601, C1402, C1202, ,G0104 C0202, C0202, C1403, C1402, C0302, C0302, G0101, C1403, C1202, C0403, G0104 G0101, C1402, C1202, G0104 C1403, C1402, G0101, C1403, G0104 G0101, G0104 KNI A2601, 20 0.7091 A2601, 23 0.7920 A2601,A 23 0.7920 A2601, 26 0.8156 A2601, 27 0.8321 DG A3002, A3002, 3002,A32 A3002, A3002, YFK A3201, A3201, 01,A3601 A3201, A3201, IY A3601, A3601, ,B1503,B A3601, A3601, (SEQ B1503, B1503, 1517,B18 B1503, B1503, ID B1517, B1517, 01,B2705 B1517, B1517, NO: B1801, B1801, ,B4402,B B1801, B1801, 36) B2705, B2705, 4403,B46 B2705, B2705, B4403, B4402, 01,B5001 B4402, B4402, B4601, B4403, ,B5701,B B4403, B4403, B5001, B4601, 5802,C02 B4601, B4601, B5701, B5001, 02,C0602 B5001, B5001, B5802, B5701, ,C0701,C B5701, B5701, C0701, B5802, 0702,C07 B5802, B5802, C0702, C0202, 04,C1202 C0202, C0202, C0704, C0602, ,C1502,C C0602, C0602, C1202, C0701, 1601,C17 C0701, C0701, C1502, C0702, 01 C0702, C0702, C1601, C0704, C0704, C0704, C1701 C1202, C1202, C1202, C1502, C1203, C1203, C1601, C1403, C1402, C1701 C1502, C1403, C1601, C1502, C1701, C1601, G0103 C1701, G0103 EEF A2501, 16 0.5679 A2501, 17 0.5786 A2501,A 18 0.5885 A2501, 18 0.5885 A2501, 18 0.5885 EPS A2601, A2601, 2601,A29 A2601, A2601, TQ A2902, A2902, 02,A3002 A2902, A2902, YE A3002, A3002, ,A3201,B A3002, A3002, Y A3201, A3201, 1501,B15 A3201, A3201, (SEQ B1501, B1501, 03,B1801 B1501, B1501, ID B1503, B1503, ,B3501,B B1503, B1503, NO: B1801, B1801, 3507,B44 B1801, B1801, 20) B3501, B3501, 02,B4403 B3501, B3501, B3507, B3507, ,B4501,B B3507, B3507, B4402, B4402, 5001,C02 B4402, B4402, B4403, B4403, 02,C1202 B4403, B4403, C0202, B4501, ,C1402,C B4501, B4501, C1202, C0202, 1403 B5001, B5001, C1402, C1202, C0202, C0202, C1403 C1402, C1202, C1202, C1403 C1402, C1402, C1403 C1403 EIL unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 DIT PCS FG (SEQ ID NO: 47) HEK293 AG C0704 1 0.0291 C0704 1 0.0291 C0704,C1 2 0.0942 C0704, 2 0.0942 B1302, 3 0.1198 TDT 502 C1502 C0704, TIT C1502 V (SEQ ID NO: 26) APR unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 ITF GGP (SEQ ID NO: 42) ELP A0201, 7 0.3948 A0201, 7 0.3948 A0201,A 7 0.3948 A0201, 7 0.3948 A0201, 7 0.3948 DEF A0206, A0206, 0206,A02 A0206, A0206, VV A0207, A0207, 07,A6802 A0207, A0207, V A6802, A6802, ,G0101,G A6802, A6802, (SEQ G0101, G0101, 0103,G01 G0101, G0101, ID G0103, G0103, 04 G0103, G0103, NO: G0104 G0104 G0104 G0104 12) FGD A0101, 13 0.8132 A0101, 15 0.8370 A0101,A 17 0.8849 A0101, 17 0.8849 A0101, 17 0.8849 DT A0201, A0201, 0201,A02 A0201, A0201, VIE A0206, A0206, 06,A0207 A0206, A0206, V A0207, A0207, ,B5101,C A0207, A0207, (SEQ C0303, C0303, 0303,C03 B5101, B5101, ID C0304, C0304, 04,C0401 C0303, C0303, NO: C0401, C0401, ,C0403,C C0304, C0304, 23) C0403, C0403, 0501,C06 C0401, C0401, C0501, C0501, 02,C0704 C0403, C0403, C0704, C0704, ,C0801,C C0501, C0501, C0801, C0801, 0802,C12 C0602, C0602, C0802, C0802, 03,C1502 C0704, C0704, C1502 C1203, ,C1701 C0801, C0801, C1502, C0802, C0802, C1701 C1203, C1203, C1502, C1502, C1701 C1701 GLI A0201, 6 0.3581 A0201, 7 0.3907 A0201,A 7 0.3907 A0201, 8 0.4226 A0201, 8 0.4226 TLS A0202, A0202, 0202,A02 A0202, A0202, YH A0204, A0204, 04,A0205 A0204, A0204, L A0205, A0205, ,A0211,A A0205, A0205, (SEQ A0211, A0211, 2301,B13 A0207, A0207, ID A2301 A2301, 01 A0211, A0211, NO: B1301 A2301, A2301, 5) B1301 B1301 IRQ B1402, 5 0.4764 B1402, 5 0.4764 B1402,B3 5 0.4764 B1402, 5 0.4764 B1402, 5 0.4764 EEV B3801, B3801, 801,C060 B3801, B3801, QEL C0602, C0602, 2,C0701, C0602, C0602, (SEQ C0701, C0701, C0702 C0701, C0701, ID C0702 C0702 C0702 C0702 NO: 31) KR A2902, 12 0.5919 A2902, 13 0.6141 A2902,A 14 0.6165 A2902, 15 0.6440 A0301, 16 0.6751 VD A3002, A3002, 3002,A32 A3002, A2902, WTI A3201, A3201, 01,B1503 A3201, A3002, EY B1503, B1503, ,B1517,B B1501, A3201, (SEQ B2705, B2705, 2705,B46 B1503, B1501, ID B4601, B4601, 01,B5701 B1517, B1503, NO: B5701, B5701, ,C0202,C B2705, B1517, 29) C0202, C0202, 0602,C07 B4601, B2705, C0602, C0602, 01,C0702 B5701, B4601, C0701, C0701, ,C1203,G C0202, B5701, C0702, C0702, 0104 C0602, C0202, G0104 C1203, C0701, C0602, G0104 C0702, C0701, C1203, C0702, G0104 C1203, G0104 ML unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 LGS ML YM (SEQ ID NO: 4) NL A0201, 5 0.3603 A0201, 5 0.3603 A0201,A 6 0.3738 A0201, 7 0.4755 A0201, 7 0.4755 NES A0202, A0202, 0202,A02 A0202, A0202, LID A0203, A0203, 03,A0204 A0203, A0203, L A0204, A0204, ,A0205,A A0204, A0204, (SEQ A0207 A0207 0207 A0205, A0205, ID A0207, A0207, NO: C0102 C0102 40) SLE A0201, 11 0.4311 A0201, 12 0.4651 A0201,A 12 0.4651 A0201, 13 0.4763 A0201, 13 0.4763 DK A0202, A0202, 0202,A02 A0202, A0202, AFQ A0204, A0204, 04,A0207 A0204, A0204, L A0207, A0207, ,A0211,B A0205, A0205, (SEQ A0211, A0211, 0801,B13 A0207, A0207, ID B1301, B0801, 01,C0501 A0211, A0211, NO: C0501, B1301, ,C0802,G B0801, B0801, 7) C0802, C0501, 0101,G01 B1301, B1301, G0101, C0802, 03,G0104 C0501, C0501, G0103, G0101, C0802, C0802, G0104 G0103, G0101, G0101, G0104 G0103, G0103, G0104 G0104 STS A0201, 10 0.4802 A0201, 11 0.5041 A0201,A 12 0.5184 A0201, 12 0.5184 A0201, 12 0.5184 AFV A0202, A0202, 0202,A02 A0202, A0202, ETV A0203, A0203, 03,A0204 A0203, A0203, (SEQ A0204, A0204, ,A0205,A A0204, A0204, ID A0205, A0205, 0206,A02 A0205, A0205, NO: A0206, A0206, 11,A6802 A0206, A0206, 19) A0211, A0211, ,B1302,B A0211, A0211, A6802, A6802, 5201,C12 A6802, A6802, C1203, B5201, 03,C1502 B1302, B1302, C1502 C1203, B5201, B5201, C1502 C1203, C1203, C1502 C1502 SVV A0201, 17 0.6632 A0201, 17 0.6632 A0201,A 17 0.6632 A0201, 17 0.6632 A0201, 17 0.6632 SKY A0202, A0202, 0202,A02 A0202, A0202, VK A0203, A0203, 03,A0204 A0203, A0203, V A0204, A0204, ,A0205,A A0204, A0204, (SEQ A0205, A0205, 0206,A02 A0205, A0205, ID A0206, A0206, 07,A0211 A0206, A0206, NO: A0207, A0207, ,A2501,A A0207, A0207, 30) A0211, A0211, 2601,A68 A0211, A0211, A2501, A2501, 02,B1302 A2501, A2501, A2601, A2601, ,C0202,C A2601, A2601, A6802, A6802, 0602,C12 A6802, A6802, B1302, B1302, 03,C1502 B1302, B1302, C0202, C0202, ,C1701 C0202, C0202, C0602, C0602, C0602, C0602, C1203, C1203, C1203, C1203, C1502, C1502, C1502, C1502, C1701 C1701 C1701 C1701 YL A0201, 9 0.4499 A0201, 9 0.4499 A0201,A 9 0.4499 A0201, 10 0.5415 A0201, 10 0.5415 NST A0202, A0202, 0202,A02 A0202, A0202, NV A0203, A0203, 03,A0204 A0203, A0203, TI A0204, A0204, ,A0207,B A0204, A0204, (SEQ A0207, A0207, 1301,B13 A0207, A0207, ID B1301, B1301, 02,B3801 B1301, B1301, NO: B1302, B1302, ,C0501 B1302, B1302, 24) B3801, B3801, B3801, B3801, C0501 C0501 C0102, C0102, C0501 C0501 APH B0702, 14 0.4409 B0702, 17 0.6508 B0702,B0 17 0.6508 B0702, 17 0.6508 B0702, 17 0.6508 GH B0704, B0704, 704,B080 B0704, B0704, VM B0801, B0801, 1,B1510, B0801, B0801, VEL B1510, B1510, B3501,B3 B1510, B1510, (SEQ B3503, B3501, 503,B350 B3501, B3501, ID B3507, B3503, 7,B4001, B3503, B3503, NO: B4201, B3507, B4201,B5 B3507, B3507, 14) B5501, B4001, 501,B550 B4001, B4001, B5502, B4201, 2,B5601, B4201, B4201, B5601, B5501, C0102,C0 B5501, B5501, C0403, B5502, 403,C070 B5502, B5502, C0704, B5601, 4,C0801, B5601, B5601, C0801, C0102, C1701 C0102, C0102, C1701 C0403, C0403, C0403, C0704, C0704, C0704, C0801, C0801, C0801, C1701 C1701 C1701 GP unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 unknown 0 0.0000 MV LRG LIT (SEQ ID NO: 6) KAF A0201, 22 0.6947 A0201, 23 0.6947 A0201,A 23 0.6947 A0201, 23 0.6947 A0201, 24 0.7261 QLT A0202, A0202, 0202,A02 A0202, A0202, PIA A0203, A0203, 03,A0204 A0203, A0203, V A0204, A0204, ,A0205,A A0204, A0204, (SEQ A0205, A0205, 0206,A02 A0205, A0205, ID A0206, A0206, 11,A6802 A0206, A0206, NO: A0211, A0211, ,B1302,B A0211, A0211, 13) A6802, A6802, 4006,B51 A6802, A6802, B1302, B1302, 01,B5201 B1302, B1302, B4006, B4006, ,B5401,B B4006, B4006, B5101, B5101, 5501,B55 B5101, B5101, B5201, B5201, 02,B5601 B5201, B5201, B5401, B5401, ,C0304,C B5401, B5401, B5501, B5501, 0704,C12 B5501, B5501, B5502, B5502, 03,C1701 B5502, B5502, B5601, B5601, ,G0101,G B5601, B5601, C0304, C0304, 0103,G01 C0304, C0304, C0704, C0704, 04 C0704, C0704, C1203, C1203, C1203, C0801, C1701, C1701, C1701, C1203, G0101, G0101, G0101, C1701, G0104 G0103, G0103, G0101, G0104 G0104 G0103, G0104 ELP A0201, 17 0.7206 A0201, 19 0.7463 A0201,A 19 0.7463 A0201, 22 0.7562 A0201, 23 0.7593 DEF A0203, A0203, 0203,A02 A0202, A0202, VV A0205, A0205, 05,A0206 A0203, A0203, VT A0206, A0206, ,A0207,A A0204, A0204, V A0207, A0207, 2601,A68 A0205, A0205, (SEQ A2601, A2601, 02,B0801 A0206, A0206, ID A6802, A6802, ,B1302,B A0207, A0207, NO: B0801, B0801, 5101,B52 A0211, A0211, 8) B5101, B1302, 01,C0102 A2601, A2501, B5201, B5101, ,C0403,C A6802, A2601, C0102, B5201, 0501,C06 B0801, A6802, C0403, C0102, 02,C0704 B1302, B0801, C0602, C0403, ,G0101,G B5101, B1302, C0704, C0501, 0103,G01 B5201, B5101, G0101, C0602, 04 C0102, B5201, G0103, C0704, C0403, C0102, G0104 G0101, C0501, C0403, G0103, C0602, C0501, G0104 C0704, C0602, G0101, C0704, G0103, G0101, G0104 G0103, G0104 YLF A0201, 46 0.9958 A0201, 46 0.9958 A0201,A 47 0.9960 A0201, 48 0.9972 A0201, 50 0.9974 DES A0202, A0202, 0202,A02 A0202, A0202, GEF A0203, A0203, 03,A0204 A0203, A0203, KL A0204, A0204, ,A0205,A A0204, A0204, (SEQ A0205, A0205, 0206,A02 A0205, A0205, ID A0206, A0206, 07,A0211 A0206, A0206, NO: A0207, A0207, ,A2407,A A0207, A0207, 25) A0211, A0211, 2902,A32 A0211, A0211, A2407, A2407, 01,A6802 A2407, A2301, A2902, A2902, ,B0801,B A2902, A2407, A3201, A3201, 1301,B13 A3201, A2902, B0801, B0801, 02,B1502 A6802, A3201, B1301, B1301, ,B1510,B B0801, A6802, B1302, B1302, 1517,B35 B1301, B0801, B1502, B1502, 01,B3503 B1302, B1301, B1510, B1510, ,B3507,B B1502, B1302, B1517, B1517, 3801,B38 B1510, B1502, B3501, B3501, 02,B4601 B1517, B1510, B3503, B3503, ,B5201,B B3501, B1517, B3507, B3507, 5301,C01 B3503, B3501, B3801, B3801, 02,C0202 B3507, B3503, B3802, B3802, ,C0302,C B3801, B3507, B4601, B4601, 0303,C03 B3802, B3801, B5201, B5201, 04,C0401 B4601, B3802, B5301, B5301, ,C0403,C B5201, B4601, C0102, C0102, 0501,C06 B5301, B4901, C0202, C0202, 02,C0701 C0102, B5201, C0302, C0302, ,C0702,C C0202, B5301, C0303, C0303, 0704,C08 C0302, C0102, C0304, C0304, 01,C1402 C0303, C0202, C0401, C0401, ,C1403,C C0304, C0302, C0403, C0403, 1502,C16 C0401, C0303, C0501, C0501, 01,C1701 C0403, C0304, C0602, C0602, ,G0101,G C0501, C0401, C0701, C0701, 0103,G01 C0602, C0403, C0702, C0702, 04 C0701, C0501, C0704, C0704, C0702, C0602, C0801, C0801, C0704, C0701, C1402, C1402, C0801, C0702, C1403, C1403, C1203, C0704, C1502, C1502, C1402, C0801, C1601, C1601, C1403, C1203, C1701, C1701, C1502, C1402, G0101, G0101, C1601, C1403, G0103, G0103, C1701, C1502, G0104 G0104 G0101, C1601, G0103, C1701, G0104 G0101, G0103, G0104 Peps A6802, 86 1.0000 A6802, 86 1.0000 A6802,B 86 1.0000 A6802, 86 1.0000 A6802, 86 1.0000 Comb- B1302, B1302, 1302,B14 B1302, B1302, ined B1402, B1402, 02,B1801 B1402, B1402, B1801, B1801, ,B3701,B B1801, B1801, B3701, B3701, 4001,B40 B3701, B3701, B4001, B4001, 02,B4006 B4001, B4001, B4002, B4002, ,B4402,B B4002, B4002, B4006, B4006, 4403,B45 B4006, B4006, B4402, B4402, 01,B4901 B4402, B4402, B4403, B4403, ,B5001,B B4403, B4403, B4501, B4501, 5101,B52 B4501, B4501, B4901, B4901, 01,C0704 B4901, B4901, B5001, B5001, ,A0101,A B5001, B5001, B5101, B5101, 0202,A02 B5101, B5101, B5201, B5201, 07,A3601 B5201, B5201, C0704, C0704, ,B1301,B C0704, C0704, A0101, A0101, 1510,B15 A0101, A0101, A0202, A0202, 17,B1801 A0202, A0202, A0207, A0207, ,B3503,B A0207, A0206, A3601, A3601, 3507,B37 A3601, A0207, B1301, B1301, 01,B3801 B1301, A3601, B1510, B1510, ,B4001,B B1510, B1301, B1517, B1517, 4002,B44 B1517, B1510, B1801, B1801, 02,B4403 B1801, B1517, B3503, B3503, ,B4501,B B3503, B1801, B3701, B3507, 5001,B57 B3507, B3503, B3801, B3701, 03,B5801 B3701, B3507, B4001, B3801, ,C0704,C B3801, B3701, B4002, B4001, 0802,G01 B4001, B3801, B4402, B4002, 01,A0101 B4002, B3802, B4403, B4402, ,A0301,A B4402, B4001, B4501, B4403, 2501,A26 B4403, B4002, B5001, B4501, 01,A2902 B4501, B4402, B5703, B5001, ,A3002,A B5001, B4403, C0704, B5703, 3201,A36 B5703, B4501, C0802, B5801, 01,A6801 B5801, B4901, G0101, C0704, ,B1501,B C0501, B5001, A0101, C0802, 1502,B35 C0704, B5301, A0301, G0101, 01,B5301 C0802, B5703, A2501, A0101, ,A2501,A G0101, B5801, A2601, A0301, 2601,A34 A0101, C0501, A2902, A2501, 01,B1501 A0301, C0704, A3002, A2601, ,B1502,B A2501, C0802, A3201, A2902, 4601,C12 A2601, G0101, A3601, A3002, 02,B3503 A2902, A0101, A6801, A3201, ,B5101,C A3002, A0301, B1501, A3601, 0202,C03 A3201, A2501, B1502, A6801, 02,C0303 A3601, A2601, B3501, B1501, ,C0304,C A6801, A2902, B5301, B1502, 0501,C06 B1501, A3002, A2501, B3501, 02,C0704 B1502, A3201, A2601, B5301, ,C0801,C B3501, A3601, A3401, A2501, 0802,C12 B5301, A6801, B1501, A2601, 02,C1203 A2501, B1501, B1502, A3401, ,C1502,C A2601, B1502, B4601, B1501, 1601,A25 A3401, B3501, C1202, B1502, 01,A2902 B1501, B5301, B3503, B4601, ,B1501,B B1502, A2501, B5101, C1202, 1502,B15 B4601, A2601, C0202, B3503, 03,B3501 C1202, A3401, C0302, B5101, ,B3507,B B3503, B1501, C0303, C0202, 4601,B53 B5101, B1502, C0304, C0302, 01,C0202 C0202, B4601, C0501, C0303, ,C0302,C C0302, C1202, C0602, C0304, 0303,C03 C0303, B3503, C0704, C0501, 04,C0702 C0304, B5101, C0801, C0602, ,C1202,C C0501, C0202, C0802, C0704, 1203,C14 C0602, C0302, C1202, C0801, 02,C1403 C0704, C0303, C1203, C0802, ,C1601,B C0801, C0304, C1502, C1202, 3501,B35 C0802, C0501, C1601, C1203, 03,B3507 C1202, C0602, A2501, C1502, ,C0202,C C1203, C0704, A2902, C1601, 0302,C03 C1502, C0801, B1501, A2501, 03,C0304 C1601, C0802, B1502, A2902, ,C0403,C A2501, C1202, B1503, B1501, 0704,C08 A2902, C1203, B3501, B1502, 01,C1202 B1501, C1502, B3507, B1503, ,C1203,C B1502, C1601, B4601, B3501, 1601,C17 B1503, A2501, B5301, B3507, 01,A0201 B3501, A2601, C0202, B4601, ,A0205,A B3507, A2902, C0302, B5301, 0206,A68 B4601, B1501, C0303, C0202, 02,B1302 B5301, B1502, C0304, C0302, ,B5101,B C0202, B1503, C0702, C0303, 5301,C02 C0302, B3501, C1202, C0304, 02,C0602 C0303, B3507, C1203, C0702, ,C0704,C C0304, B4601, C1402, C1202, 0801,C12 C0702, B5301, C1403, C1203, 03,C1502 C1202, C0202, C1601, C1402, ,C1601,C C1203, C0302, B3501, C1403, 1701,A01 C1402, C0303, B3503, C1601, 01,A0301 C1403, C0304, B3507, B3501, ,A3002,B C1601, C0702, C0202, B3503, 1501,B15 B3501, C1202, C0302, B3507, 02,C1203 B3503, C1203, C0303, C0202, ,C1601,B B3507, C1402, C0304, C0302, 1502,B15 C0202, C1403, C0403, C0303, 03,B1801 C0302, C1601, C0704, C0304, ,B4002,B C0303, B3501, C0801, C0403, 4006,B44 C0304, B3503, C1202, C0704, 02,B4403 C0403, B3507, C1203, C0801, ,B0704,B C0704, C0202, C1601, C1202, 3503,B42 C0801, C0302, C1701, C1203, 01,B5802 C1202, C0303, A0201, C1601, ,C0102,C C1203, C0304, A0205, C1701, 0303,C03 C1601, C0403, A0206, A0201, 04,C0602 C1701, C0704, A6802, A0205, ,C0701,C A0201, C0801, B1302, A0206, 0704,C08 A0205, C1202, B5101, A6802, 01,C0802 A0206, C1203, B5301, B1302, ,C1202,C A6802, C1601, C0202, B5101, 1203,C16 B1302, C1701, C0602, B5301, 01,A0101 B5101, A0201, C0704, C0202, ,A0301,A B5301, A0205, C0801, C0602, 2902,A30 C0202, A0206, C1203, C0704, 02,A3601 C0602, A6802, C1502, C0801, ,B1501,B C0704, B1302, C1601, C1203, 1502,B15 C0801, B5101, C1701, C1502, 17,B1801 C1203, B5301, A0101, C1601, ,B5701,B C1502, C0202, A3002, C1701, 5703,B58 C1601, C0602, B1501, A0101, 01,C0202 C1701, C0704, B1502, A0301, ,C1202,C A0101, C0801, C1203, A3002, 1203,C16 A0301, C1203, C1601, B1501, 01,A0101 A2501, C1502, B1503, B1502, ,A2902,A A3002, C1601, B1801, C1203, 3601,B15 B1501, C1701, B4002, C1601, 01,B1517 B1502, A0101, B4006, B1502, ,B3507,B C1203, A0301, B4402, B1503, 4601,B53 C1601, A2501, B4403, B1801, 01,B5801 B1502, A3002, B0704, B4002, ,C0202,C B1503, A3601, B3503, B4006, 0302,C12 B1801, B1501, B4201, B4402, 02,C1203 B4002, B1502, B5802, B4403, ,C1601,B B4006, C1203, C0102, B0704, 1503,B57 B4402, C1601, C0303, B3503, 01,B5802 B4403, B1502, C0304, B4201, ,C1601,A B0704, B1503, C0602, B5802, 0211,A23 B3503, B1801, C0701, C0102, 01,A2407 B4201, B4002, C0704, C0303, ,A2501,A B5802, B4006, C0802, C0304, 2601,A29 C0102, B4402, C1202, C0602, 02,A3201 C0303, B4403, C1203, C0701, ,A3402,A C0304, B0704, C1601, C0704, 6802,B15 C0602, B3503, A0101, C0802, 02,B1801 C0701, B4201, A0301, C1202, ,B3501,B C0704, B5802, A2902, C1203, 3507,B46 C0801, C0102, A3002, C1601, 01,C0202 C0802, C0303, A3601, A0101, ,C0302,C C1202, C0304, B1501, A0301, 1202,C14 C1203, C0602, B1502, A2902, 02,C1403 C1601, C0701, B1517, A3002, ,G0101,G A0101, C0704, B1801, A3601, 0104,A26 A0301, C0801, B5701, B1501, 01,A3002 A2902, C0802, B5703, B1502, ,A3201,A A3002, C1202, B5801, B1517, 3601,B15 A3601, C1203, C0202, B1801, 03,B1517 B1501, C1601, C1202, B5701, ,B1801,B B1502, A0101, C1203, B5703, 2705,B44 B1517, A0301, C1601, B5801, 02,B4403 B1801, A2501, A0101, C0202, ,B4601,B B5701, A2902, A2902, C1202, 5001,B57 B5703, A3002, A3601, C1203, 01,B5802 B5801, A3201, B1501, C1601, ,C0202,C C0202, A3601, B1517, A0101, 0602,C07 C1202, B1501, B3507, A2902, 01,C0702 C1203, B1502, B4601, A3601, ,C0704,C C1601, B1517, C0202, B1501, 1202,C15 A0101, B1801, C0302, B1517, 02,C1601 A2601, B5701, C1202, B3507, ,C1701,A A2902, B5703, C1203, B4601, 2501,A26 A3601, B5801, C1601, B5301, 01,A2902 B1501, C0202, B1503, B5801, ,A3002,A B1517, C1202, B5701, C0202, 3201,B15 B3507, C1203, B5802, C0302, 01,B1503 B4601, C1601, C1601, C1202, ,B1801,B B5301, A0101, A0211, C1203, 3501,B35 B5801, A2601, A2301, C1601, 07,B4402 C0202, A2902, A2407, B1503, ,B4403,B C0302, A3601, A2501, B5701, 4501,B50 C1202, B1501, A2601, B5802, 01,C0202 C1203, B1517, A2902, C1601, ,C1202,C C1601, B3507, A3201, A0211, 1402,C14 B1503, B4601, A3402, A2301, 03,unkno B5101, B5301, A6802, A2407, wn,C070 B5701, B5801, B1502, A2501, 4,C1502, B5802, C0202, B1801, A2601, unknown, C1601, C0302, B3507, A2902, A0201,A A0211, C1202, B4601, A3201, 0206,A02 A2301, C1203, C0202, A3402, 07,A6802 A2407, C1601, C1202, A6802, ,G0101,G A2501, B1503, C1402, B1502, 0103,G01 A2601, B5101, C1403, B1801, 04,A0101 A2902, B5701, G0101, B3501, ,A0201,A A3201, B5802, G0104, B3507, 0206,A02 A3401, C1601, A2601, B4601, 07,B5101 A3402, A0211, A3002, C0202, ,C0303,C A6802, A2301, A3201, C1202, 0304,C04 B1502, A2407, A3601, C1402, 01,C0403 B1801, A2501, B1503, C1403, ,C0501,C B3501, A2601, B1517, G0101, 0602,C07 B3507, A2902, B1801, G0104, 04,C0801 B4601, A3201, B2705, A2601, ,C0802,C C0202, A3401, B4403, A3002, 1203,C15 C0302, A3402, B4601, A3201, 02,C1701 C1202, A6802, B5001, A3601, ,A0201,A C1402, B1502, B5701, B1503, 0202,A02 C1403, B1801, B5802, B1517, 04,A0205 G0101, B3501, C0701, B1801, ,A0211,A G0104, B3507, C0702, B2705, 2301,B13 A2601, B4601, C0704, B4402, 01,B1402 A3002, C0202, C1202, B4403, ,B3801,C A3201, C0302, C1502, B4601, 0602,C07 A3601, C0403, C1601, B5001, 01,C0702 B1503, C1202, C1701, B5701, ,A2902,A B1517, C1402, A2501, B5802, 3002,A32 B1801, C1403, A2601, C0202, 01,B1503 B2705, G0101, A2902, C0602, ,B1517,B B4402, G0104, A3002, C0701, 2705,B46 B4403, A2601, A3201, C0702, 01,B5701 B4601, A3002, B1501, C0704, ,C0202,C B5001, A3201, B1503, C1202, 0602,C07 B5701, A3601, B1801, C1502, 01,C0702 B5802, B1503, B3501, C1601, ,C1203,G C0202, B1517, B3507, C1701, 0104,unk C0602, B1801, B4402, A2501, nown,A0 C0701, B2705, B4403, A2601, 201,A020 C0702, B4402, C0202, A2902, 2,A0203, C0704, B4403, C1202, A3002, A0204,A C1202, B4601, C1402, A3201, 0205,A02 C1203, B5001, C1403, B1501, 07,A0201 C1403, B5701, unkno B1503, ,A0202,A C1502, B5802, wn,C0 B1801, 0204,A02 C1601, C0202, 704,un B3501, 07,A0211 C1701, C0602, known, B3507, ,B0801,B G0103, C0701, A0201, B4402, 1301,C05 A2501, C0702, A0206, B4403, 01,C0802 A2601, C0704, A0207, B4501, ,G0101,G A2902, C1202, A6802, C0202, 0103,G01 A3002, C1203, G0101, C1202, 04,A0201 A3201, C1402, G0103, C1402, ,A0202,A B1501, C1403, G0104, C1403, 0203,A02 B1503, C1502, A0101, unkno 04,A0205 B1801, C1601, A0201, wn,C07 ,A0206,A B3501, C1701, A0206, 04,unk 0211,A68 B3507, G0103, A0207, nown, 02,B1302 B4402, A2501, C0303, A0201, ,B5201,C B4403, A2601, C0304, A0206, 1203,C15 B4501, A2902, C0401, A0207, 02,A0201 B5001, A3002, C0403, A6802, ,A0202,A C0202, A3201, C0501, G0101, 0203,A02 C1202, B1501, C0704, G0103, 04,A0205 C1402, B1503, C0801, G0104, ,A0206,A C1403, B1801, C0802, A0101, 0207,A02 unknow B3501, C1502, A0201, 11,A2501 n,C070 B3507, A0201, A0206, ,A2601,A 4,C150 B4402, A0202, A0207, 6802,B13 2,unkno B4403, A0204, C0303, 02,C0202 wn,A02 B4501, A0205, C0304, ,C0602,C 01,A02 B5001, A0211, C0401, 1203,C15 06,A02 C0202, A2301, C0403, 02,C1701 07,A68 C1202, B1402, C0501, ,A0201,A 02,G01 C1402, B3801, C0704, 0202,A02 01,G01 C1403, C0602, C0801, 03,A0204 03,G01 unkno C0701, C0802, ,A0207,B 04,A01 wn,B13 C0702, C1203, 1301,B13 01,A02 02,C07 A2902, C1502, 02,B3801 01,A02 04,C15 A3002, C1701, ,C0501,B 06,A02 02,unk A3201, A0201, 0702,B07 07,B51 nown, B1503, A0202, 04,B0801 01,C03 A0201, B2705, A0204, ,B1510,B 03,C03 A0206, B4601, A0205, 3501,B35 04,C04 A0207, B5701, A0211, 03,B3507 01,C04 A6802, C0202, A2301, ,B4001,B 03,C05 G0101, C0602, B1301, 4201,B55 01,C06 G0103, C0701, B1402, 01,B5502 02,C07 G0104, C0702, B3801, ,B5601,C 04,C08 A0101, G0104, C0602, 0102,C04 01,C08 A0201, unkno C0701, 03,C0704 02,C12 A0206, wn,A0 C0702, ,C0801,C 03,C15 A0207, 201,A0 A2902, 1701,unk 02,C17 B5101, 202,A0 A3002, nown,A0 01,A02 C0303, 203,A0 A3201, 201,A020 01,A02 C0304, 204,A0 B1503, 2,A0203, 02,A02 C0401, 207,A0 B2705, A0204,A 04,A02 C0403, 201,A0 B4601, 0205,A02 05,A02 C0501, 202,A0 B5701, 06,A0211 07,A02 C0602, 204,A0 C0202, ,A6802,B 11,A23 C0704, 207,A0 C0602, 1302,B40 01,B13 C0801, 211,B1 C0701, 06,B5101 01,B14 C0802, 301,C0 C0702, ,B5201,B 02,B38 C1203, 501,C0 C1203, 5401,B55 01,C06 C1502, 802,G0 G0104, 01,B5502 02,C07 C1701, 101,G0 unkno ,B5601,C 01,C07 A0201, 103,G0 wn,A0 0304,C07 02,A29 A0202, 104,A0 201,A0 04,C1203 02,A30 A0204, 201,A0 202,A0 ,C1701,G 02,A32 A0205, 202,A0 203,A0 0101,G01 01,B15 A0207, 203,A0 204,A0 03,G0104 01,B15 A0211, 204,A0 207,A0 ,A0201,A 03,B15 A2301, 205,A0 201,A0 0203,A02 17,B27 B1301, 206,A0 202,A0 05,A0206 05,B46 B1402, 211,A6 204,A0 ,A0207,A 01,B57 B3801, 802,C1 207,A0 2601,A68 01,C02 C0602, 203,C1 211,B0 02,B0801 02,C06 C0701, 502,A0 801,B1 ,B1302,B 02,C07 C0702, 201,A0 301,C0 5101,B52 01,C07 A0301, 202,A0 501,C0 01,C0102 02,C12 A2902, 203,A0 802,G0 ,C0403,C 03,G01 A3002, 204,A0 101,G0 0501,C06 04,unkn A3201, 205,A0 103,G0 02,C0704 own,A0 B1501, 206,A0 104,A0 ,G0101,G 201,A0 B1503, 207,A0 201,A0 0103,G01 202,A0 B1517, 211,A2 202,A0 04,A0201 203,A0 B2705, 501,A2 203,A0 ,A0202,A 204,A0 B4601, 601,A6 204,A0 0203,A02 205,A0 B5701, 802,B1 205,A0 04,A0205 207,C0 C0202, 302,C0 206,A0 ,A0206,A 102,A0 C0602, 202,C0 211,A6 0207,A02 201,A0 C0701, 602,C1 802,B5 11,A2407 202,A0 C0702, 203,C1 201,C1 ,A2902,A 204,A0 C1203, 502,C1 203,C1 3201,A68 205,A0 G0104, 701,A0 502,A0 02,B0801 207,A0 unkno 201,A0 201,A0 ,B1301,B 211,B0 wn,A0 202,A0 202,A0 1302,B15 801,B1 201,A0 203,A0 203,A0 02,B1510 301,C0 202,A0 204,A0 204,A0 ,B1517,B 501,C0 203,A0 207,B1 205,A0 3501,B35 802,G0 204,A0 301,B1 206,A0 03,B3507 101,G0 205,A0 302,B3 207,A0 ,B3801,B 103,G0 207,C0 801,C0 211,A2 3802,B46 104,A0 102,A0 501,B0 501,A2 01,B5201 201,A0 201,A0 702,B0 601,A6 ,B5301,C 202,A0 202,A0 704,B0 802,B1 0102,C02 203,A0 204,A0 801,B1 302,C0 02,C0302 204,A0 205,A0 510,B3 202,C0 ,C0303,C 205,A0 207,A0 503,B3 602,C1 0304,C04 206,A0 211,B0 507,B4 203,C1 01,C0403 211,A6 801,B1 201,B5 502,C1 ,C0501,C 802,B1 301,C0 501,B5 701,A0 0602,C07 302,B5 501,C0 502,B5 201,A0 01,C0702 201,C1 802,G0 601,C0 202,A0 ,C0704,C 203,C1 101,G0 403,C0 203,A0 0801,C14 502,A0 103,G0 704,C0 204,A0 02,C1403 201,A0 104,A0 801,C1 207,B1 ,C1502,C 202,A0 201,A0 701,un 301,B1 1601,C17 203,A0 202,A0 known, 302,B3 01,G0101 204,A0 203,A0 A0201, 801,C0 ,G0103,G 205,A0 204,A0 A0202, 501,B0 0104 206,A0 205,A0 A0203, 702,B0 207,A0 206,A0 A0204, 704,B0 211,A2 211,A6 A0205, 801,B1 501,A2 802,B1 A0206, 510,B3 601,A6 302,B5 A0211, 501,B3 802,B1 201,C1 A6802, 503,B3 302,C0 203,C1 B1302, 507,B4 202,C0 502,A0 B4006, 001,B4 602,C1 201,A0 B5101, 201,B5 203,C1 202,A0 B5201, 501,B5 502,C1 203,A0 B5401, 502,B5 701,A0 204,A0 B5501, 601,C0 201,A0 205,A0 B5502, 102,C0 202,A0 206,A0 B5601, 403,C0 203,A0 207,A0 C0304, 704,C0 204,A0 211,A2 C0704, 801,C1 207,B1 501,A2 C1203, 701,un 301,B1 601,A6 C1701, known, 302,B3 802,B1 G0101, A0201, 801,C0 302,C0 G0104, A0202, 102,C0 202,C0 A0201, A0203, 501,B0 602,C1 A0203, A0204, 702,B0 203,C1 A0205, A0205, 704,B0 502,C1 A0206, A0206, 801,B1 701,A0 A0207, A0211, 510,B3 201,A0 A2601, A6802, 501,B3 202,A0 A6802, B1302, 503,B3 203,A0 B0801, B4006, 507,B4 204,A0 B5101, B5101, 001,B4 207,B1 B5201, B5201, 201,B5 301,B1 C0102, B5401, 501,B5 302,B3 C0403, B5501, 502,B5 801,C0 C0602, B5502, 601,C0 102,C0 C0704, B5601, 102,C0 501,B0 G0101, C0304, 403,C0 702,B0 G0103, C0704, 704,C0 704,B0 G0104, C1203, 801,C1 801,B1 A0201, C1701, 701,unk 510,B3 A0202, G0101, nown,A 501,B3 A0203, G0103, 0201,A 503,B3 A0204, G0104, 0202,A 507,B4 A0205, A0201, 0203,A 001,B4 A0206, A0203, 0204,A 201,B5 A0207, A0205, 0205,A 501,B5 A0211, A0206, 0206,A 502,B5 A2407, A0207, 0211,A 601,C0 A2902, A2601, 6802,B 102,C0 A3201, A6802, 1302,B 403,C0 B0801, B0801, 4006,B 704,C0 B1301, B1302, 5101,B 801,C1 B1302, B5101, 5201,B 701,un B1502, B5201, 5401,B known, B1510, C0102, 5501,B A0201, B1517, C0403, 5502,B A0202, B3501, C0501, 5601,C A0203, B3503, C0602, 0304,C A0204, B3507, C0704, 0704,C A0205, B3801, G0101, 1203,C A0206, B3802, G0103, 1701,G A0211, B4601, G0104, 0101,G A6802, B5201, A0201, 0103,G B1302, B5301, A0202, 0104,A B4006, C0102, A0203, 0201,A B5101, C0202, A0204, 0202,A B5201, C0302, A0205, 0203,A B5401, C0303, A0206, 0204,A B5501, C0304, A0207, 0205,A B5502, C0401, A0211, 0206,A B5601, C0403, A2407, 0207,A C0304, C0501, A2902, 0211,A C0704, C0602, A3201, 2601,A C0801, C0701, B0801, 6802,B C1203, C0702, B1301, 0801,B C1701, C0704, B1302, 1302,B G0101, C0801, B1502, 5101,B G0103, C1402, B1510, 5201,C G0104, C1403, B1517, 0102,C A0201, C1502, B3501, 0403,C A0202, C1601, B3503, 0501,C A0203, C1701, B3507, 0602,C A0204, G0101, B3801, 0704,G A0205, G0103, B3802, 0101,G A0206, G0104 B4601, 0103,G A0207, B5201, 0104,A A0211, B5301, 0201,A A2501, C0102, 0202,A A2601, C0202, 0203,A A6802, C0302, 0204,A B0801, C0303, 0205,A B1302, C0304, 0206,A B5101, C0401, 0207,A B5201, C0403, 0211,A C0102, C0501, 2407,A C0403, C0602, 2902,A C0501, C0701, 3201,A C0602, C0702, 6802,B C0704, C0704, 0801,B G0101, C0801, 1301,B G0103, C1402, 1302,B G0104, C1403, 1502,B A0201, C1502, 1510,B A0202, C1601, 1517,B A0203, C1701, 3501,B A0204, G0101, 3503,B A0205, G0103, 3507,B A0206, G0104 3801,B A0207, 3802,B A0211, 4601,B A2301, 5201,B A2407, 5301,C A2902, 0102,C A3201, 0202,C A6802, 0302,C B0801, 0303,C B1301, 0304,C B1302, 0401,C B1502, 0403,C B1510, 0501,C B1517, 0602,C B3501, 0701,C B3503, 0702,C B3507, 0704,C B3801, 0801,C B3802, 1203,C B4601, 1402,C B4901, 1403,C B5201, 1502,C B5301, 1601,C C0102, 1701,G C0202, 0101,G C0302, 0103,G C0303, 0104 C0304, C0401, C0403, C0501, C0602, C0701, C0702, C0704, C0801, C1203, C1402, C1403, C1502, C1601, C1701, G0101, G0103, G0104
(440) To validate the binding of the HLA-I peptides to the predicted alleles, biochemical binding measurement with 30 synthetic peptides and 5 purified HLA alleles not present in the two profiled cell lines was performed. These measurements confirmed binding for 5 of 9 (56%) HLA-I peptides predicted at a threshold of % rank <=0.5 and 12 of 29 (41%) peptides predicted at a threshold of % rank <=2 (
(441) Discussion
(442) This Example at least provides a view of SARS-COV-2 HLA-I peptides that are endogenously processed and presented by infected cells. Although this Example profiled two cell lines, it uncovers multiple insights into SARS-COV-2 antigen presentation that can extend beyond the nine HLA alleles tested here: (i) A substantial fraction, 9 of 36 (25%), of viral peptides detected are derived from internal out-of-frame ORFs in S (S.iORF1/2) and N (ORF9b). Remarkably, HLA-I peptides from the non-canonical ORFs were more immunogenic than the canonical HLA-I peptides in immunized mice and convalescence COVID-19 patients shown by both pooled ELISpot assays and multiplexed tetramer experiments. These observations imply that current interrogation of T cell responses in COVID-19 patients, which focus on the canonical viral ORFs (Grifoni et al., 2020a; Weiskopf et al., 2020), exclude an important source of virus-derived HLA-I epitopes. (ii) A large fraction of HLA-I peptides detected were from non-structural proteins (nsps). Earlier studies focused mostly on T cell responses toward S, N, M and E, which biased results toward structural proteins. Together with recent studies that expanded their epitope pools to include non-structural proteins (Dan et al., 2020; Kared et al., 2021; Tarke et al., 2020), it is shown that nsps are an integral part of the T cell response to SARS-COV-2. (iii) The timing of SARS-COV-2 protein expression appears to be a key determinant for antigen presentation and immunogenicity. Proteins expressed earlier in infection (3hpi) were more likely to be presented on the HLA-I complex and elicit a T cell response in COVID-19 patients. Together, these insights can inform the design of future peptide pools to allow more comprehensive characterization of T cell responses in COVID-19 patients.
(443) Recent findings in the field highlights the need to look beyond antibodies for strategies to lasting protection from COVID-19 (Ledford, 2021), and to consider T cell epitopes. Several SARS-COV-2 variants have emerged associated with a reported reduction in neutralizing antibodies efficiencies. Importantly, recent studies found however that CD8+ T cell responses in convalescent patients and mRNA vaccines are not substantially affected by mutations found in prominent SARS-COV-2 variants (Redd et al., 2021; Tarke et al., 2021). Thus, integrating T cell epitopes into the next generation of vaccines has the potential to provide prolonged protection in the presence of an evolving virus. This work reveals that ORF9b is an important source for T cell epitopes that remained not well characterized for months of intensive research of SARS-COV-2 T cell immunity. Although relatively short (97 aa), we detected six HLA-I peptides (16%) from ORF9b in both A549 and HEK293T cells and found that ORF9b derived HLA-I peptides bind to at least four different alleles in the population using biochemical affinity measurements (A*02:01, B*18:01, B*44:03 and A*26:01). In this Example, two A*02:01 peptides, ELPDEFVVVTV (SEQ ID NO: 8) and SLEDKAFQL (SEQ ID NO: 7), were identified which elicit CD8+ T cell responses in convalescent patients, demonstrating that ORF9b is translated and presented on HLA-I in-vivo during the course of COVID-19. Moreover, ORF9b is among the few viral proteins that are detected early in infection and achieve high expression, two traits that correlate with HLA-I presentation and immunogenicity. In addition, this study highlights ELPDEFVVVTV (SEQ ID NO: 8) as a promising T cell epitope. It binds both A*02:01 and A*26:01 (IC.sub.50=1.6 nM and IC.sub.50=72, respectively, Table 4), elicits strong T cell responses in immunized mice and COVID-19 patients (
(444) These analyses demonstrate that synthetic approaches aiming at enhancing the expression of canonical ORFs, some of which are utilized in current vaccine strategies, can inadvertently eliminate or alter the production of HLA-I peptides derived from overlapping reading frames. Several of these findings-the large fraction of HLA-I peptides detected from internal out-of-frame ORFs, their strong affinity to biochemically purified HLA, the observed immunogenicity in mice and COVID-19 patients, the detection of memory and effector T cells reacting to ELPDEFVVVTV (SEQ ID NO: 8) from ORF9b and the homology of its TCR sequences across different patientssuggest that accounting for these ORFs may considerably contribute to the induction of effective memory T cells in response to SARS-COV-2 vaccines. Researchers may need to carefully examine the effects of sequence manipulation and codon optimization on the amino acids encoded by these ORFs with emphasis on the regions encoding the HLA-I peptides. In broader terms, many viral genomes have evolved to increase their coding capacity by utilizing overlapping ORFs and programmed frameshifting (Ketteler, 2012). Thus, these findings suggest a more general principle in vaccine design according to which optimizing expression of desired antigens using codon optimization can be at the expense of CD8+ response if the same region encodes a source protein for T cell epitopes in an alternative frame. Combining insights from ribosome profiling and HLA-I immunopeptidomics can uncover the presence of non-canonical peptides that will enable more informed decisions in vaccine design.
(445) In contrast to ORF9b, the T cell assays did not uncover significant reactivity to peptides from S.iORF1/2 in convalescent COVID-19 patients. This finding is surprising given that GLITLSYHL (SEQ ID NO: 5) and MLLGSMLYM (SEQ ID NO: 4) had the highest affinity to HLA-A*02:01 among all HLA-I peptides tested (<0.5 nM,
(446) These results hint that viruses may evolve to attenuate HLA-I presentation of highly abundant proteins. While N is among the most immunogenic proteins in COVID-19 patients, it elicits lower T cell responses than S (Grifoni et al., 2020a; Tarke et al., 2020) even though its source protein abundance is about 100-fold higher (
(447) Proteomics analyses of infected cells show that SARS-COV-2 may interfere with the presentation of HLA-I peptides and the expression of ubiquitination and immune signaling pathway proteins. It was found that SARS-COV-2 infection leads to a significant decrease in POMP and of ubiquitination pathway protein expression. By impacting ubiquitin mediated proteasomal degradation and immune signaling proteins, SARS-COV-2 may reduce the precursors for downstream processing and HLA-I presentation and alter the immune response. Moreover, it has been shown in vitro that disrupted IFN signaling can result from SARS-COV-2 infection (Chen et al., 2020a), which aligns with our observations of JAK1 depletion in both cell lines post infection and reports of a delayed IFN response observed in COVID-19 patients (Acharya et al., 2020).
(448) In summary, this Example at least uncovers not previously characterized SARS-COV-2 HLA-I peptides from out-of-frame ORFs in SARS-COV-2 genome and highlights the contribution of these viral epitopes to the immune response in a mouse model and convalescent COVID-19 patients. These new CD8+ T cell targets and the insights into HLA-I presentation in infected cells will enable a more precise selection of peptides for COVID-19 immune monitoring and vaccine development.
(449) Methods
(450) Cell Culture
(451) Human embryonic kidney HEK293T cells, human lung A549 cells, and African green monkey kidney Vero E6 cells were maintained at 37 C. and 5% CO2 in DMEM containing 10% FBS. Stable HEK293T and A549 cells expressing human ACE2 and TMPRSS2 were generated by transducing them with lentivirus particles carrying these two cDNAs.
(452) SARS-COV-2 Virus Stock Preparation
(453) The 2019-nCOV/USA-WA1/2020 isolate (NCBI accession number: MN985325) of SARS-COV-2 was obtained from the Centers for Disease Control and Prevention and BEI Resources. To generate the virus P1 stock, Vero E6 cells were infected with this isolate for 1 h at 37 C., removed the virus inoculum, rinsed the cell monolayer with 1PBS, and added DMEM supplemented with 2% FBS. Three days later, when the cytopathic effect of the virus became visible, the culture medium was harvested, passed through a 0.2u filter, and stored at 80 C. To generate the virus P2 stock, Vero E6 cells were infected with the P1 stock at a multiplicity of infection (MOI) of 0.1 plaque forming units (PFU)/cell and the culture medium was harvested three days later using the same protocol as for the P1 stock. All experiments in this study were performed using the P2 stock.
(454) Quantification of Virus Infectivity by Immunofluorescence
(455) A549 and 293T cells expressing ACE2 and TMPRSS2 were infected with SARS-COV-2 (Washington isolate) at an MOI of 3 for indicated times (3, 6, 12, 18, and 24 hpi). After infection, supernatants were removed, and cells were fixed with 4% paraformaldehyde for 30 minutes at room temperature. Cells were then permeabilized with 0.1% of triton-X100 in PBS for 10 minutes and hybridized with Anti-SARS-COV Nucleocapsid (N) Protein (RABBIT) polyclonal antibody (1:2000, Rockland, #200-401-A50) at 4 C. overnight. Alexa Fluor 568 goat anti rabbit antibody (Invitrogen, A11011) were used as the secondary antibody for labelling virus infected cells. Finally, DAPI was added to label the nuclei. Immunofluorescent images were taken using an EVOS microscope with 10 lens and infection rates were calculated with ImageJ.
(456) Plaque Assay
(457) Vero E6 cells were used to determine the titer of our virus stock and to evaluate SARS-CoV-2 inactivation following lysis of infected cells in our HLA-IP buffer. Briefly, Vero E6 cells were seeded into a 12-well plate at a density of 2.510.sup.5 cells per well, and the next day, infected them with serial 10-fold dilutions of the virus stock (for titration) or the A549 lysates (for the inactivation assay) for 1 h at 37 C. 1 ml per well of the overlay medium containing 2DMEM (Gibco: #12800017) supplemented with 4% FBS was added and mixed at a 1:1 ratio with 1.2% Avicel (DuPont; RC-581) to obtain the final concentrations of 2% and 0.6% for FBS and Avicel, respectively. Three days later, the overlay medium was removed, the cell monolayer was removed with 1PBS and the cells were fixed with 4% paraformaldehyde for 30 minutes at room temperature. 0.1% crystal violet was used to visualize the plaques.
(458) Immunoprecipitation of HLA-I Peptide Complexes
(459) Cells engineered to express SARS-COV-2 entry factors were seeded into nine 15 cm dishes (three dishes per time point) at a density of 15 million cells per dish for A549 cells and 20 million cells per dish for HEK293T cells. The next day, the cells were infected with SARS-COV-2 at a multiplicity of infection (MOI) of 3. To synchronize infection, the virus was bound to target cells in a small volume of opti-MEM on ice for one hour, followed by addition of DMEM/2% FBS and switching to 37 C. At 3, 6, 12, 18, and 24 h post-infection, the cells from three dishes were scraped into 2.5 ml/dish of cold lysis buffer (20 mM Tris, pH 8.0, 100 mM NaCl, 6 mM MgCl.sub.2, 1 mM EDTA, 60 mM Octyl -d-glucopyranoside, 0.2 mM Iodoacetamide, 1.5% Triton X-100, 50Complete Protease Inhibitor Tablet-EDTA free and PMSF) obtaining a total of 9 ml lysate. This lysate was split into 6 eppendorf tubes, with each tube receiving 1.5 ml volume, and incubated on ice for 15 min with 1 ul of Benzonase (Thomas Scientific, E1014-25KU) to degrade nucleic acid. The lysates were then centrifuged at 4,000 rpm for 22 min at 4 C. and the supernatants were transferred to another set of six eppendorf tubes containing a mixture of pre-washed beads (Millipore Sigma, GE17-0886-01) and 50 ul of an MHC class I antibody (W6/32) (Santa Cruz Biotechnology, sc-32235). The immune complexes were captured on the beads by incubating on a rotor at 4 C. for 3 hr. The unbound lysates were kept for whole proteomics analysis while the beads were washed to remove non-specifically bound material. In total, nine washing steps were performed; one wash with 1 mL of cold lysis wash buffer (20 mM Tris, pH 8.0, 100 mM NaCl, 6 mM MgCl.sub.2, 1 mM EDTA, 60 mM Octyl -d-glucopyranoside, 0.2 mM Iodoacetamide, 1.5% Triton X-100), four washes with 1 mL of cold complete wash buffer (20 mM Tris, pH 8.0, 100 mM NaCl, 1 mM EDTA, 60 mM Octyl -d-glucopyranoside, 0.2 mM Iodoacetamide), and four washes with 20 mM Tris pH 8.0 buffer. Dry beads were stored at 80 C. until mass-spectrometry analysis was performed.
(460) HLA-I Immunopeptidome LC-MS/MS Data Generation
(461) HLA peptides were eluted and desalted from beads as described previously (Sarkizova et al., 2020). After the primary elution step, HLA peptides were reconstituted in 3% ACN/5% FA and subjected to microscaled basic reverse phase separation. Briefly, peptides were loaded on Stage-tips with 2 punches of SDB-XC material (Empore 3M) and eluted in three fractions with increasing concentrations of ACN (5%, 10% and 30% in 0.1% NH.sub.4OH, pH 10). For the time course experiment, one third of a pool of 6 IPs (for 12|18|24 h) or a pool of 2 IPs (for 3|6|24hpi) was also labeled with TMT6 (Thermo Fisher Scientific, lot #UC280588, A549: 12 h: 126, 3 h: 127, 18 h: 128, 129: 6 h, 24 h: 130, HEK293T: 3 h: 126, 12 h: 127, 6 h: 128, 18 h: 129, 24 h: 131) (Thompson et al., 2003), combined and desalted on a C18 Stage-tip, and then eluted into three fractions using basic reversed phase fractionation with increasing concentrations of ACN (10%, 15% and 50%) in 5 mM ammonium formate (pH 10). Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (25-30 cm, 1.9 m C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 m inner diameter, 10 m emitter (New Objective)). Peptides were eluted with a linear gradient (EasyNanoLC 1200, Thermo Fisher Scientific) ranging from 6-30% Solvent B (0.1% FA in 90% ACN) over 84 min, 30-90% B over 9 min and held at 90% B for 5 min at 200 nl/min. MS/MS were acquired on a Thermo Orbitrap Exploris 480 equipped with FAIMS (Thermo Fisher Scientific) in data dependent acquisition. FAIMS CVs were set to 50 and 70 with a cycle time of 1.5s per FAIMS experiment. MS2 fill time was set to 100 ms, collision energy was 29CE or 32CE for TMT respectively.
(462) Whole Proteome LC-MS/MS Data Generation
(463) 200 L aliquot of HLA IP supernatants were reduced for 30 minutes with 5 mM DTT (Pierce DTT: A39255) and alkylated with 10 mM IAA (Sigma IAA: A3221-10VL) for 45 minutes both at 25 C. on a shaker (1000 rpm). Protein precipitation using methanol/chloroform was then performed. Briefly, methanol was added at a volume of 4 that of HLA IP supernatant aliquot. This was followed by a 1 volume of chloroform and 3 volume of water. The sample was mixed by vortexing and incubated at 20 C. for 1.5 hours. Samples were then centrifuged at 14,000 rpm for 10 minutes and the upper liquid layer was removed leaving a protein pellet. The pellet was rinsed with 3 volume of methanol, vortexed lightly, and centrifuged at 14,000 rpm for 10 minutes. Supernatant was removed and discarded without disturbing the pellet. Pellets were resuspended in 100 mM triethylammonium bicarbonate (pH 8.5) (TEAB). Samples were digested with LysC (1:50) for 2 h on a shaker (1000 rpm) at 25 C., followed by trypsin (1:50) overnight. Samples were acidified by 1% formic acid final concentration and dried. Samples were reconstituted 4.5 mM ammonium formate (pH 10) in 2% (vol/vol) acetonitrile and separated into four fractions using basic reversed phase fractionation on a C-18 Stage-tip. Fractions were eluted at 5%, 12.5%, 15%, and 50% ACN/4.5 mM ammonium formate (pH 10) and dried. Fractions were reconstituted in 3% ACN/5% FA, and 1 g was used for LC-MS/MS analysis. MS/MS were acquired on a Thermo Orbitrap Exploris 480 (Thermo Fisher Scientific) in data dependent acquisition with FAIMS (MS2 isolation width 0.7m/z, cycle time 0.8, collision energy 30% for each CV) and without (MS2 isolation width 0.7m/z, top20 scans, collision energy 30%). Uninfected 1 g single shot samples were analyzed similarly. For the time course experiment, the samples (12 h, 18 h, 24 h) were not fractionated and 1 g was used for LC-MS/MS analysis, as described above except that FAIMS with 50, 65, and 85 CV was applied.
(464) LC-MS/MS Data Interpretation
(465) Peptide sequences were interpreted from MS/MS spectra using Spectrum Mill (v 7.1 pre-release) to search against a RefSeq-based sequence database containing 41,457 proteins mapped to the human reference genome (hg38) obtained via the UCSC Table Browser (https://genome.ucsc.edu/cgi-bin/hgTables) on Jun. 29, 2018, with the addition of 13 proteins encoded in the human mitochondrial genome, 264 common laboratory contaminant proteins, 553 human non-canonical small open reading frames, 28 SARS-COV2 proteins obtained from RefSeq derived from the original Wuhan-Hu-1 China isolate NC_045512.2 (https://www.ncbi.nlm.nih.gov/nuccore/1798174254) (Wu et al., 2020), and 23 novel unannotated virus ORFs whose translation is supported by Ribo-seq (Finkel et al., 2020b) for a total of 42,337 proteins. Amongst the 28 annotated SARS-COV2 proteins we opted to omit the full length polyproteins ORF1a and ORF1ab, to simplify peptide-to-protein assignment, and instead represented ORF1ab as the mature 16 individual non-structural proteins that result from proteolytic processing of the 1a and 1ab polyproteins. The D614G variant of the SARS-Cov2 Spike protein that is commonly observed in European and American virus isolates was further added.
(466) For immunopeptidome data MS/MS spectra were excluded from searching if they did not have a precursor MH+ in the range of 600-4000, had a precursor charge >5, or had a minimum of <5 detected peaks. Merging of similar spectra with the same precursor m/z acquired in the same chromatographic peak was disabled. Prior to searches, all MS/MS spectra had to pass the spectral quality filter with a sequence tag length >1 (i.e., minimum of 3 masses separated by the in-chain masses of 2 amino acids) based on HLA v3 peak detection. MS/MS search parameters included: ESI-QEXACTIVE-HCD-HLA-v3 scoring parameters; no-enzyme specificity; fixed modification: carbamidomethylation of cysteine; variable modifications: cysteinylation of cysteine, oxidation of methionine, deamidation of asparagine, acetylation of protein N-termini, and pyroglutamic acid at peptide N-terminal glutamine; precursor mass shift range of 18 to 81 Da; precursor mass tolerance of 10 ppm; product mass tolerance of 10 ppm, and a minimum matched peak intensity of 30%. Peptide spectrum matches (PSMs) for individual spectra were automatically designated as confidently assigned using the Spectrum Mill auto-validation module to apply target-decoy based FDR estimation at the PSM level of <1.5% FDR. For the TMT-labeled time course experiments, two parameters were revised: the MH+ range filter was 800-6000, and TMT labeling was required at lysine, but peptide N-termini were allowed to be either labeled or unlabeled. Relative abundances of peptides in the time-course experiments were determined in Spectrum Mill using TMT reporter ion intensity ratios from each PSM. TMT reporter ion intensities for the 3 time points split across two plexes were not corrected for isotopic impurities because the respective adjacent intervening labels were not included. Each peptide-level TMT ratio was calculated as the median of all PSMs contributing to that peptide. PSMs were excluded from the calculation that lacked a TMT label, or had a negative delta forward-reverse identification score (half of all false-positive identifications). Intensity values for each time point were normalized to the 24 h time point to compare between the 12|18|24 h and 3|6|24 h plex.
(467) For whole proteome data MS/MS spectra were excluded from searching if they did not have a precursor MH+ in the range of 600-6000, had a precursor charge >5, had a minimum of <5 detected peaks, or failed the spectral quality filter with a sequence tag length >0 (i.e., minimum of 2 masses separated by the in-chain masses of 1 amino acid) based on ESI-QEXACTIVE-HCD-v4-30-20 peak detection. Similar spectra with the same precursor m/z acquired in the same chromatographic peak were merged. MS/MS search parameters included: ESI-QEXACTIVE-HCD-v4-30-20 scoring parameters; Trypsin allow P specificity with a maximum of 4 missed cleavages; fixed modification: carbamidomethylation of cysteine and seleno-cysteine; variable modifications: oxidation of methionine, deamidation of asparagine, acetylation of protein N-termini, pyroglutamic acid at peptide N-terminal glutamine, and pyro-carbamidomethylation at peptide N-terminal cysteine; precursor mass shift range of 18 to 64 Da; precursor mass tolerance of 20 ppm; product mass tolerance of 20 ppm, and a minimum matched peak intensity of 30%. Peptide spectrum matches (PSMs) for individual spectra were automatically designated as confidently assigned using the Spectrum Mill auto-validation module to apply target-decoy based FDR estimation at the PSM level of <1.0% FDR. Protein level data was summarized by top uses shared (SGT) peptide grouping and non-human contaminants were removed. SARS-COV-2 derived proteins were manually filtered to include identifications with >6% sequence coverage and at least 2 or more unique peptides. Postfiltering, intensity-based absolute quantification (iBAQ) was performed on the whole proteome LC-MS/MS as described in (Schwanhusser et al., 2011). Briefly, iBAQ values were calculated as follows: log 10 (totalIntensity/numObservableTrypticPeptides), the total precursor ion intensity for each protein was calculated in Spectrum Mill as the sum of the precursor ion chromatographic peak areas (in MS1 spectra) for each precursor ion with a peptide spectrum match (MS/MS spectrum) to the protein, and the numObservableTrypticPeptides for each protein was calculated using the Spectrum Mill Protein Database utility as the number of tryptic peptides with length 8-40 amino acids, with no missed cleavages allowed. Of note, S coverage was 55% in the HEK293T and 44% in the A549 post 24 hour fractionated data, which may be due to the high levels of glycosylation. Lower peptide coverage may lead to underestimation of S protein in our data. Both log 10 transformed total intensity and iBAQ values were median normalized by subtracting sample specific medians and adding global medians for each abundance metrics and reported in Tables 6A-6B and data not shown.
(468) To evaluate post infection protein level changes for a large set of proteins across cell lines and timepoints (
(469) Validation of Peptide Identifications
(470) Peptide identifications were validated using synthetic peptides. Synthetic peptides were obtained from Genscript, at purity >90% purity and dissolved to 10 mM in DMSO. For LC-MS/MS measurements, peptides were pooled and further diluted with 0.1% FA/3% ACN to load 120 fmol/l on column. One aliquot of synthetic peptides was also TMT labeled as described above. LC-MS/MS measurements were performed as described above. For plots, peak intensities in the experimental and the synthetic spectrum were normalized to the highest peak.
(471) RNA-Seq of SARS-COV-2 Infected Cells
(472) A549 and HEK293T cells were seeded into 6-well plates at a density of 510.sup.5 cells per well (one well per condition). After 11-24 h, the cells were infected with SARS-COV-2 at an MOI of 3. At 12, 18 and 24 h post-infection, the cells were lysed in Trizol (Thermo, 15596026), and the total RNA was isolated using standard phenol chloroform extraction. Standard Illumina TruSeq Stranded mRNA (LT) was performed using 500 ng of total RNA (illumina, FC-122-2101). Oligo-dT beads were used to capture polyA-tailed RNA, followed by fragmentation and priming of the captured RNA (8 minutes at 94 C.). Immediately first strand cDNA synthesis was performed. Second strand cDNA synthesis was performed using second strand marking master and DNA polymerase 1 and RNase H. cDNA was adenylated at the 3 ends followed immediately by RNA end ligation single-index adapters (AR001-AR012). Library amplification was performed for 12-15 cycles under standard illumina library PCR conditions. Library quantitation was performed using Agilent 2200 TapeStation D1000 ScreenTape (Agilent, 5067-5582). RNA sequencing was performed on the NextSeq 550 System using a NextSeq V2.5 High Output 75 cycle kit (illumina, 20024906) or 150 cycles kit (illumina, 20024907) for paired-end sequencing (70nt of each end).
(473) RNA Sequencing Reads Alignment
(474) Sequencing reads were mapped to SARS-COV-2 genome (RefSeq NC_045512.2) and human transcriptome (Gencode v32). Alignment was performed using Bowtie version 1.2.2 (Langmead et al., 2009) with a maximum of two mismatches per read. The fraction of human and viral reads was determined based on the total number of reads aligned to either SARS-COV-2 or human transcripts.
(475) In-Vitro MHC-Peptide Binding Assay
(476) Classical competition assays, based on the inhibition of binding of a high affinity radiolabeled ligand to purified MHC molecules, were utilized to quantitatively measure peptide binding to HLA-A and -B class I MHC molecules. The assays were performed, and MHC purified, as detailed previously (Sidney et al., 2013). Briefly, 0.1-1 nM of radiolabeled peptide was co-incubated at room temperature with 1 M to 1 nM of purified MHC in the presence of a cocktail of protease inhibitors and 1 M B2-microglobulin. MHC bound radioactivity was determined following a two-day incubation by capturing MHC/peptide complexes on W6/32 (anti-class I) antibody coated Lumitrac 600 plates (Greiner Bio-one, Frickenhausen, Germany), and measuring bound cpm on the TopCount (Packard Instrument Co., Meriden, CT) microscintillation counter. The concentration of peptide yielding 50% inhibition of the binding of the radiolabeled peptide was calculated. Under the conditions utilized, where [label]< [MHC] and IC.sub.50[MHC], the measured IC.sub.50 values are reasonable approximations of the true Kd values (Cheng and Prusoff, 1973; Gulukota et al., 1997). Each competitor peptide was tested at six different concentrations covering a 100,000-fold dose range, and in three or more independent experiments. As a positive control, the unlabeled version of the radiolabeled probe was also tested in each experiment.
(477) HLA-A02 Transgenic Mice Immunization
(478) Mice. HLA-A2 transgenic AAD mice were used in the experiments (B6. Cg-Immp2 [.sup.Tg(HLA-A/H2-D)2Enge/J). These animals express a chimeric molecule, which contains peptide-binding 1 and 2 domains of the HLA-A2.1 molecule and the 3 domain of the mouse H-2 D.sup.d molecule, under the control of the HLA-A2.1 promoter in addition to mouse MHC H-2.sup.b. These animals allow the testing of human T cell immune responses to HLA-A2 presented antigens. Animals were maintained and bred in the animal facility at Dana Farber Cancer Institute in compliance with the Institutional Animal Care and Use Committee.
(479) Vaccinations. Five mice were immunized subcutaneously in the flank with a vaccine. The vaccine contained nine COVID19 peptides (50 g each peptide per mice) emulsified in Complete Freunds Adjuvant (CFA BD Bioscience/Difco) supplemented with 20 g PolyIC/LC (Hiltonol/Oncovir). 10 days post-vaccination, animals were euthanized using CO2, and Spleens were removed for Elispot assays.
(480) Mouse Interferon-gamma Elispot assays. Elispot was performed using red blood cell-depleted mouse splenocytes (200,000 cells/well) co-incubated with the individual COVID19 peptides (10 g/ml) in triplicate in Elispot plates (Millipore, Billerica, MA) for 18 h. Interferon- (IFN) secretion was detected using capture and detection antibodies as described (Mabtech AB, Nacka Strand, Sweden) and imaged using an ImmunoSpot Series Analyzer (Cellular Technology, Ltd, Cleveland, OH). HLA-A*02:01 restricted HIV-GAG peptide and non-stimulated wells were used as negative controls. Spot numbers were normalized by removing the average background spot numbers calculated from negative control wells. AntiCD3 (2C11 BD BioScience) and PHA was used as a positive control. 55 spot-forming units/10.sup.6 cells and a 3-fold increase over baseline is used as a threshold for positive responses. Methods were described in detail previously (Keskin et al., 2015).
(481) Pooled Peptides IFN ELISPOT Assay with Convalescent COVID-19 PBMCs
(482) Peripheral blood samples were collected from COVID-19 convalescent patients and PBMC were isolated using ficoll density gradient centrifugation. PBMC were plated out in serum free T cell assay media at 2.5e5 cells per well in a Human IFNg single color ELISpot plate (ImmunoSpot). The canonical and non canonical pools (Table 7) and a commercial nucleocapsid overlapping peptide pool (JPT peptide Technologies) were added to duplicate wells at a concentration of 2 ug/ml of each peptide. A negative control well (to which just the equivalent concentration of DMSO was added) was used to assess background IFNg secretion. Cells were incubated for 16-20 hours at 37 degrees C. before developing according to manufacturer's instructions. Spots were counted using an ImmunoSpot CoreS6 ELISpot counter (ImmunoSpot). The negative control background was subtracted from the antigen wells and the results are shown as spot forming units (SFU) per 2.5e5 PBMC. A spot cut off of 8 after background subtraction is used here to denote a positive response.
(483) Multiplexed Tetramer Assay and Single Cell Sequencing
(484) Production of tetramer library pools. HLA-A*02:01, and HLA-B*07:02 extracellular domains were expressed in E. coli and refolded along with beta-2-microglobulin and UV-labile place-holder peptides KILGFVFJV (SEQ ID NO: 213), and AARGJTLAM (SEQ ID NO: 214), respectively (Altman and Davis, 2016). The MHC monomer was then purified by size exclusion chromatography (SEC). MHC tetramers were produced by mixing alkylated MHC monomers and azidylated streptavidin in 0.5 mM copper sulfate, 2.5 mM BTTAA and 5 mM ascorbic acid for up to 4 h on ice, followed by purification of highly multimeric fractions by SEC. Individual peptide exchange reactions containing 500 nM MHC tetramer and 60 M peptide were exposed to long-wave UV (366 nm) at a distance of 2-5 cm for 30 min at 4 C., followed by 30 min incubation at 30 C. A biotinylated oligonucleotide barcode (Integrated DNA Technologies) was added to each individual reaction followed by 30 minute incubation at 4 C. Individual tetramer reactions were then pooled and concentrated using 30 kDa molecular weight cut-off centrifugal filter units (Amicon).
(485) Cell Staining. Peripheral blood mononuclear cells (PBMCs) from convalescent COVID-19 positive donors or unexposed donors were obtained from Precision 4 Medicine (USA), the Massachusetts Consortium on Pathogen Readiness (MassCPR), or CTL (USA), all under appropriate informed consent. PBMCs were thawed, and CD8+ T cells were enriched by magnetic-activated cell sorting (MACS) using a CD8+ T Cell Isolation Kit (Miltenyi) following the manufacturer's protocol. The CD8+ T cells were then stained with 1 nM final concentration tetramer library in the presence of 2 mg/mL salmon sperm DNA in PBS with 0.5% BSA solution for 20 minutes. Cells were then labeled with anti-TCR ADT (IP26, BioLegend) for 15 minutes followed by washing. Tetramer bound cells were then labeled with PE conjugated anti-DKDDDDK-Flag antibody (BioLegend) followed by dead cell discrimination using 7-amino-actinomycin D (7-AAD). The live, tetramer positive cells were sorted using a Sony MA900 Sorter (Sony).
(486) Single-cell Sequencing. Tetramer positive cells were counted by Nexcelom Cellometer (Lawrence, MA, USA) using AOPI stain following manufacturer's recommended conditions. Single-cell encapsulations were generated utilizing 5 v1 Gem beads from 10 Genomics (Pleasanton, CA, USA) on a 10 Chromium controller and downstream TCR, and Surface marker libraries were made following manufacturer recommended conditions. All libraries were quantified on a BioRad CFX 384 (Hercules, CA, USA) using Kapa Biosystems (Wilmington, MA, USA) library quantified kits and pooled at an equimolar ratio. TCRs, surface markers, and tetramer generated libraries were sequenced on Illumina (San Diego, CA, USA) NextSeq550 instruments.
(487) Initial analysis and preprocessing. Hydrogel-based RNA-seq data were analyzed using the Cell Ranger package from 10 Genomics (v3.1.0) with the GRCh38 human expression reference (v3.0.0). Except where noted, Scanpy (v1.6.0, (Wolf et al., 2018)) was used to perform the subsequent single cell analyses. Any exogenous control cells identified by TCR clonotype were removed before further gene expression processing. Hydrogels that contain UMIs for less than 300 genes were excluded. Genes that were detected in less than 3 cells were also excluded from further analysis. The following additional quality control thresholds were also enforced. To remove data generated from cells likely to be damaged, upper thresholds were set for percent UMIs arising from mitochondrial genes (13%). To exclude data likely arising from multiple cells captured in a single drop, upper thresholds were set for total UMI counts based on individual distributions from each encapsulation (from 1500 to 3000 UMIs). A lower threshold of 10% was set for UMIs arising from ribosomal protein genes. Finally, an upper threshold of 5% of UMIs was set for the MALAT1 gene. Any hydrogel outside of any of the thresholds was omitted from further analysis. A total of 15,683 hydrogels were carried forward. Gene expression data were normalized to counts per 10,000 UMIs per cell (CP10K) followed by log 1p transformation: In (CP10K+1).
(488) Scoring pMHC-TCR interactions. Tetramer data analysis was performed using Python 3.7.3. For each single-cell encapsulation, tetramer UMI counts (columns) were matrixed by cell (rows) and log-transformed. The matrix was then Z-score transformed row-wise and subsequently, median-centered by column. Means were calculated by clonotype, and those with a value greater than 4 were characterized as positive interactions.
(489) Clustering and Automated Annotation. Highly variable genes were identified (1,567) and scaled to have a mean of zero and unit variance. They were then provided to scanorama (v1.7, (Hie et al., 2019)) to perform batch integration and dimension reduction. These data were used to generate the nearest neighbor graph which was in turn used to generate a UMAP representation that was used for Leiden clustering. The hydrogel data (not scaled to mean zero, unit variance, and before extraction of highly variable genes) were labeled with cluster membership and provided to SingleR (v1.4.0, (Aran et al., 2019)) using the following references from Celldex (v1.0.0, (Aran et al., 2019)): MonacoImmuneData, DatabaseImmuneCellExpressionData, and BlueprintEncodeData. SingleR was used to annotate the clusters with their best-fit match from the cell types in the references. Clusters that yielded cell types other than types of the T Cell lineage were removed from consideration and the process was repeated starting from the batch integration step. The best-fit annotations from SingleR after the second round of clustering and annotation were assigned as putative labels for each Leiden cluster.
(490) Scoring Clusters with Functional Gene Panels. In order to provide corroboration for the SingleR best-fit annotations and further evidence as to the phenotype of the clusters, gene panels representing functional categories (Nave, Effector, Memory, Exhaustion, Proliferation) were used to score each hydrogel's expression profiles using scanpy's score_genes function (Wolf et al., 2018) which compares the mean expression values of the target gene set against a larger set of randomly chosen genes that represent background expression levels. The gene panels for each class were (Su et al., 2020): Nave-TCF7, LEF1, CCR7; Effector-GZMB, PRF1, GNLY; MemoryAQP3, CD69, GZMK; Exhaustion-PDCD1, TIGIT, LAG3; ProliferationMKI67, TYMS. The gene expression matrix for all hydrogels were first imputed using the MAGIC algorithm (v2.0.4, (van Dijk et al., 2018)). These functional scores were the only data generated from imputed expression values.
(491) HLA-I Antigen Presentation Prediction
(492) HLAthena, a prediction tool trained on endogenous LC-MS/MS-identified epitope data, was used to predict HLA class I presentation for all unique 8-11mer SARS-Cov-2 peptides across 31 HLA-A, 40 HLA-B and 21 HLA-C alleles (Sarkizova et al., 2020).
(493) HLA Allele Frequencies and Coverage Estimates
(494) World frequencies of HLA-A,-B, and -C allele in Table 8B are based on a meta-analysis of high-resolution HLA allele frequency data describing 497 population samples representing approximately 66,800 individuals from throughout the world (Solberg et al., 2008), downloaded from http://pypop.org/popdata/2008/byfreq-A.php.html, http://pypop.org/popdata/2008/byfreq-B.php.html, http://www.pypop.org/popdata/2008/byfreq-C.php. Subpopulation frequencies for AFA, API, EUR, HIS, and USA were obtained from supplementary data in (Poran et al., 2020).
(495) The cumulative phenotypic frequency (CPF) of peptides was calculated using CPF=1(1.sub.iCp.sub.i).sup.2, assuming Hardy-Weinberg proportions for the HLA genotypes (Dawson et al., 2001), where p.sub.i is the population frequency of the i.sup.th alleles within a subset of HLA-A,-B, or C alleles, denoted C. Coverage across HLA-A,-B, and -C alleles was calculated similarly: CPF=1(1.sub.iA p.sub.i).sup.2*(1.sub.iB p.sub.i).sup.2*(1.sub.iCp.sub.i).sup.2, where A, B, and C denote a subset of HLA-A, -B, and/or -C alleles for which the coverage is computed, as recently done in (Poran et al., 2020).
(496) References for Example 2
(497) Abelin, J. G., Keskin, D. B., Sarkizova, S., Hartigan, C. R., Zhang, W., Sidney, J., Stevens, J., Lane, W., Zhang, G. L., Eisenhaure, T. M., et al. (2017). Mass Spectrometry Profiling of HLA-Associated Peptidomes in Mono-allelic Cells Enables More Accurate Epitope Prediction. Immunity 46, 315-326. Abelin, J. G., Harjanto, D., Malloy, M., Suri, P., Colson, T., Goulding, S. P., Creech, A. L., Serrano, L. R., Nasir, G., Nasrullah, Y., et al. (2019). Defining HLA-II Ligand Processing and Binding Rules with Mass Spectrometry Enhances Cancer Epitope Prediction. Immunity 51, 766-779.e17. Acharya, D., Liu, G., and Gack, M. U. (2020). Dysregulation of type I interferon responses in COVID-19. Nat. Rev. Immunol. 20, 397-398. Altman, J. D., and Davis, M. M. (2016). MHC-Peptide Tetramers to Visualize Antigen-Specific T Cells. Curr. Protoc. Immunol. 115, 17.3.1-17.3.44. Altmann, D. M., and Boyton, R. J. (2020). SARS-COV-2 T cell immunity: Specificity, function, durability, and role in protection. Sci Immunol 5. Aran, D., Looney, A. P., Liu, L., Wu, E., Fong, V., Hsu, A., Chak, S., Naikawadi, R. P., Wolters, P. J., Abate, A. R., et al. (2019). Reference-based analysis of lung single-cell sequencing reveals a transitional profibrotic macrophage. Nat. Immunol. 20, 163-172. Bassani-Sternberg, M., and Gfeller, D. (2016). Unsupervised HLA Peptidome Deconvolution Improves Ligand Prediction Accuracy and Predicts Cooperative Effects in Peptide-HLA Interactions. The Journal of Immunology 197, 2492-2499. Burdette, D. L., Monroe, K. M., Sotelo-Troha, K., Iwig, J. S., Eckert, B., Hyodo, M., Hayakawa, Y., and Vance, R. E. (2011). STING is a direct innate immune sensor of cyclic di-GMP. Nature 478, 515-518. Callaway, E. (2020). The race for coronavirus vaccines: a graphical guide. Nature 580, 576-577. Campbell, K. M., Steiner, G., Wells, D. K., Ribas, A., and Kalbasi, A. (2020). Prediction of SARS-CoV-2 epitopes across 9360 HLA class I alleles. bioRxiv. Chen, D.-Y., Khan, N., Close, B. J., Goel, R. K., Blum, B., Tavares, A. H., Kenney, D., Conway, H. L., Ewoldt, J. K., Kapell, S., et al. (2020a). SARS-COV-2 desensitizes host cells to interferon through inhibition of the JAK-STAT pathway. bioRxiv. Chen, J., Brunner, A.-D., Cogan, J. Z., Nuez, J. K., Fields, A. P., Adamson, B., Itzhak, D. N., Li, J. Y., Mann, M., Leonetti, M. D., et al. (2020b). Pervasive functional translation of noncanonical human open reading frames. Science 367, 1140-1146. Cheng, Y., and Prusoff, W. H. (1973). Relationship between the inhibition constant (K1) and the concentration of inhibitor which causes 50 percent inhibition (150) of an enzymatic reaction. Biochem. Pharmacol. 22, 3099-3108. Chong, C., Marino, F., Pak, H., Racle, J., Daniel, R. T., Mller, M., Gfeller, D., Coukos, G., and Bassani-Sternberg, M. (2018). High-throughput and Sensitive Immunopeptidomics Platform Reveals Profound Interferony-Mediated Remodeling of the Human Leukocyte Antigen (HLA) Ligandome. Mol. Cell. Proteomics 17, 533-548. Croft, N. P., Smith, S. A., Wong, Y. C., Tan, C. T., Dudek, N. L., Flesch, I. E. A., Lin, L. C. W., Tscharke, D. C., and Purcell, A. W. (2013). Kinetics of antigen expression and epitope presentation during virus infection. PLOS Pathog. 9, e1003129. Dan, J. M., Mateus, J., Kato, Y., Hastie, K. M., Yu, E. D., Faliti, C. E., Grifoni, A., Ramirez, S. I., Haupt, S., Frazier, A., et al. (2020). Immunological memory to SARS-COV-2 assessed for up to eight months after infection. bioRxiv. Dawson, D. V., Ozgur, M., Sari, K., Ghanayem, M., and Kostyu, D. D. (2001). Ramifications of HLA class I polymorphism and population genetics for vaccine development. Genet. Epidemiol. 20, 87-106. Demmers, L. C., Heck, A. J. R., and Wu, W. (2019). Pre-fractionation Extends but also Creates a Bias in the Detectable HLA Class I Ligandome. J. Proteome Res. 18, 1634-1643. van Dijk, D., Sharma, R., Nainys, J., Yim, K., Kathail, P., Carr, A. J., Burdziak, C., Moon, K. R., Chaffer, C. L., Pattabiraman, D., et al. (2018). Recovering Gene Interactions from Single-Cell Data Using Data Diffusion. Cell 174, 716-729.e27. Dominguez Andres, A., Feng, Y., Campos, A. R., Yin, J., Yang, C.-C., James, B., Murad, R., Kim, H., Deshpande, A. J., Gordon, D. E., et al. (2020). SARS-COV-2 ORF9c Is a Membrane-Associated Protein that Suppresses Antiviral Responses in Cells. bioRxiv. Dutta, N. K., Mazumdar, K., and Gordy, J. T. (2020). The Nucleocapsid Protein of SARS-COV-2: a Target for Vaccine Development. J. Virol. 94. Erhard, F., Halenius, A., Zimmermann, C., L'Hernault, A., Kowalewski, D. J., Weekes, M. P., Stevanovic, S., Zimmer, R., and Dlken, L. (2018). Improved Ribo-seq enables identification of cryptic translation events. Nat. Methods 15, 363-366. Ferretti, A. P., Kula, T., Wang, Y., Nguyen, D. M. V., Weinheimer, A., Dunlap, G. S., Xu, Q., Nabilsi, N., Perullo, C. R., Cristofaro, A. W., et al. (2020). Unbiased Screens Show CD8+ T Cells of COVID-19 Patients Recognize Shared Epitopes in SARS-COV-2 that Largely Reside outside the Spike Protein. Immunity 53, 1095-1107.e3. Finkel, Y., Schmiedel, D., Tai-Schmiedel, J., Nachshon, A., Winkler, R., Dobesova, M., Schwartz, M., Mandelboim, O., and Stern-Ginossar, N. (2020a). Comprehensive annotations of human herpesvirus 6A and 6B genomes reveal novel and conserved genomic features. Elife 9. Finkel, Y., Mizrahi, O., and Nachshon, A. (2020b). The coding capacity of SARS-COV-2. bioRxiv. Gallagher, K., and Maus, M. V. Evaluation of SARS-COV-2-specific T cell responses against wild type and spike variants using standardized IFNg release assays. In Preparation. Girdlestone, J. (1995). Regulation of HLA class I loci by interferons. Immunobiology 193, 229-237. Gordon, D. E., Jang, G. M., Bouhaddou, M., Xu, J., Obernier, K., White, K. M., O'Meara, M. J., Rezelj, V. V., Guo, J. Z., Swaney, D. L., et al. (2020). A SARS-COV-2 protein interaction map reveals targets for drug repurposing. Nature 583, 459-468. Gragert, L., Madbouly, A., Freeman, J., and Maiers, M. (2013). Six-locus high resolution HLA haplotype frequencies derived from mixed-resolution DNA typing for the entire US donor registry. Hum. Immunol. 74, 1313-1320. Grifoni, A., Weiskopf, D., Ramirez, S. I., Mateus, J., Dan, J. M., Moderbacher, C. R., Rawlings, S. A., Sutherland, A., Premkumar, L., Jadi, R. S., et al. (2020a). Targets of T Cell Responses to SARS-COV-2 Coronavirus in Humans with COVID-19 Disease and Unexposed Individuals. Cell 181, 1489-1501.e15. Grifoni, A., Sidney, J., Zhang, Y., Scheuermann, R. H., Peters, B., and Sette, A. (2020b). A Sequence Homology and Bioinformatic Approach Can Predict Candidate Targets for Immune Responses to SARS-COV-2. Cell Host Microbe 27, 671-680.e2. Gulukota, K., Sidney, J., Sette, A., and DeLisi, C. (1997). Two complementary methods for predicting peptides binding major histocompatibility complex molecules. J. Mol. Biol. 267, 1258-1267. Habel, J. R., Nguyen, T. H. O., van de Sandt, C. E., Juno, J. A., Chaurasia, P., Wragg, K., Koutsakos, M., Hensen, L., Jia, X., Chua, B., et al. (2020). Suboptimal SARS-COV-2-specific CD8+ T cell response associated with the prominent HLA-A*02:01 phenotype. Proceedings of the National Academy of Sciences 117, 24384-24391. Hansen, T. H., and Bouvier, M. (2009). MHC class I antigen presentation: learning from viral evasion strategies. Nat. Rev. Immunol. 9, 503-513. Hickman, H. D., Mays, J. W., Gibbs, J., Kosik, I., Magadn, J. G., Takeda, K., Das, S., Reynoso, G. V., Ngudiankama, B. F., Wei, J., et al. (2018). Influenza A Virus Negative Strand RNA Is Translated for CD8+ T Cell Immunosurveillance. J. Immunol. 201, 1222-1228. Hie, B., Bryson, B., and Berger, B. (2019). Efficient integration of heterogeneous single-cell transcriptomes using Scanorama. Nat. Biotechnol. 37, 685-691. Ingolia, N. T., Ghaemmaghami, S., Newman, J. R. S., and Weissman, J. S. (2009). Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 324, 218-223. Ingolia, N. T., Lareau, L. F., and Weissman, J. S. (2011). Ribosome profiling of mouse embryonic stem cells reveals the complexity and dynamics of mammalian proteomes. Cell 147, 789-802. Ingolia, N. T., Brar, G. A., Stern-Ginossar, N., Harris, M. S., Talhouarne, G. J. S., Jackson, S. E., Wills, M. R., and Weissman, J. S. (2014). Ribosome profiling reveals pervasive translation outside of annotated protein-coding genes. Cell Rep. 8, 1365-1379. Jackson, L. A., Anderson, E. J., Rouphael, N. G., Roberts, P. C., Makhene, M., Coler, R. N., Mccullough, M. P., Chappell, J. D., Denison, M. R., Stevens, L. J., et al. (2020). An mRNA vaccine against SARS-COV-2-preliminary report. N. Engl. J. Med. Javitt, A., Barnea, E., Kramer, M. P., Wolf-Levy, H., Levin, Y., Admon, A., and Merbl, Y. (2019). Pro-inflammatory Cytokines Alter the Immunopeptidome Landscape by Modulation of HLA-B Expression. Front. Immunol. 10, 141. Kared, H., Redd, A. D., Bloch, E. M., Bonny, T. S., Sumatoh, H. R., Kairi, F., Carbajo, D., Abel, B., Newell, E. W., Bettinotti, M., et al. (2021). SARS-COV-2-specific CD8+ T cell responses in convalescent COVID-19 individuals. J. Clin. Invest. Keskin, D. B., Reinhold, B. B., Zhang, G. L., Ivanov, A. R., Karger, B. L., and Reinherz, E. L. (2015). Physical detection of influenza A epitopes identifies a stealth subset on human lung epithelium evading natural CD8 immunity. Proc. Natl. Acad. Sci. U.S.A 112, 2151-2156. Ketteler, R. (2012). On programmed ribosomal frameshifting: the alternative proteomes. Front. Genet. 3, 242. Kim, D., Lee, J.-Y., Yang, J.-S., Kim, J. W., Kim, V. N., and Chang, H. (2020). The Architecture of SARS-COV-2 Transcriptome. Cell 181, 914-921.e10. Langmead, B., Trapnell, C., Pop, M., and Salzberg, S. L. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25. Le Bert, N., Tan, A. T., Kunasegaran, K., Tham, C. Y. L., Hafezi, M., Chia, A., Chng, M. H. Y., Lin, M., Tan, N., Linster, M., et al. (2020). SARS-COV-2-specific T cell immunity in cases of COVID-19 and SARS, and uninfected controls. Nature. Ledford, H. (2021). How killer T cells could boost COVID immunity in face of new variants. Nature. Lu, R., Zhao, X., Li, J., Niu, P., Yang, B., Wu, H., Wang, W., Song, H., Huang, B., Zhu, N., et al. (2020). Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet 395, 565-574. Lunemann, S., Schbel, A., Kah, J., Fittje, P., Hlzemer, A., Langeneckert, A. E., Hess, L. U., Poch, T., Martrus, G., Garcia-Beltran, W. F., et al. (2018). Interactions Between KIR3DS1 and HLA-F Activate Natural Killer Cells to Control HCV Replication in Cell Culture. Gastroenterology 155, 1366-1371.e3. Maness, N.J., Walsh, A. D., Piaskowski, S. M., Furlott, J., Kolar, H. L., Bean, A. T., Wilson, N. A., and Watkins, D. I. (2010). CD8+ T cell recognition of cryptic epitopes is a ubiquitous feature of AIDS virus infection. J. Virol. 84, 11569-11574. McMurtrey, C. P., Lelic, A., Piazza, P., Chakrabarti, A. K., Yablonsky, E. J., Wahl, A., Bardet, W., Eckerd, A., Cook, R. L., Hess, R., et al. (2008). Epitope discovery in West Nile virus infection: Identification and immune recognition of viral epitopes. Proc. Natl. Acad. Sci. U.S.A 105, 2981-2986. Moderbacher, C. R., Ramirez, S. I., Dan, J. M., Grifoni, A., Hastie, K. M., Weiskopf, D., Belanger, S., Abbott, R. K., Kim, C., Choi, J., et al. (2020). Antigen-specific adaptive immunity to SARS-CoV-2 in acute COVID-19 and associations with age and disease severity. Cell. Monteil, V., Kwon, H., Prado, P., Hagelkrys, A., Wimmer, R. A., Stahl, M., Leopoldi, A., Garreta, E., Hurtado Del Pozo, C., Prosper, F., et al. (2020). Inhibition of SARS-COV-2 Infections in Engineered Human Tissues Using Clinical-Grade Soluble Human ACE2. Cell 181, 905-913.e7. Mulligan, M. J., Lyke, K. E., Kitchin, N., Absalon, J., Gurtman, A., Lockhart, S., Neuzil, K., Raabe, V., Bailey, R., Swanson, K. A., et al. (2020). Phase 1/2 study of COVID-19 RNA vaccine BNT162b1 in adults. Nature. Neefjes, J., Jongsma, M. L. M., Paul, P., and Bakke, O. (2011). Towards a systems understanding of MHC class I and MHC class II antigen presentation. Nat. Rev. Immunol. 11, 823-836. Nguyen, A., David, J. K., Maden, S. K., Wood, M. A., Weeder, B. R., Nellore, A., and Thompson, R. F. (2020). Human leukocyte antigen susceptibility map for SARS-COV-2. J. Virol. Ouspenskaia, T., Law, T., Clauser, K. R., and Klaeger, S. (2020). Thousands of novel unannotated proteins expand the MHC I immunopeptidome in cancer. bioRxiv. Poran, A., Harjanto, D., Malloy, M., Arieta, C. M., Rothenberg, D. A., Lenkala, D., van Buuren, M. M., Addona, T. A., Rooney, M. S., Srinivasan, L., et al. (2020). Sequence-based prediction of SARS-COV-2 vaccine targets using a mass spectrometry-based bioinformatics predictor identifies immunogenic T cell epitopes. Genome Med. 12, 70. Puelles, V. G., Ltgehetmann, M., Lindenmeyer, M. T., Sperhake, J. P., Wong, M. N., Allweiss, L., Chilla, S., Heinemann, A., Wanner, N., Liu, S., et al. (2020). Multiorgan and Renal Tropism of SARS-COV-2. N. Engl. J. Med. 383, 590-592. Redd, A. D., Nardin, A., Kared, H., Bloch, E. M., Pekosz, A., Laeyendecker, O., Abel, B., Fehlings, M., Quinn, T. C., and Tobian, A. A. (2021). CD8+ T cell responses in COVID-19 convalescent individuals target conserved epitopes from multiple prominent SARS-COV-2 circulating variants. medRxiv. Rucevic, M., Kourjian, G., Boucau, J., Blatnik, R., Garcia Bertran, W., Berberich, M. J., Walker, B. D., Riemer, A. B., and Le Gall, S. (2016). Analysis of Major Histocompatibility Complex-Bound HIV Peptides Identified from Various Cell Types Reveals Common Nested Peptides and Novel T Cell Responses. J. Virol. 90, 8605-8620. Ruiz Cuevas, M. V., Hardy, M.-P., Holl, J., Bonneil, ., Durette, C., Courcelles, M., Lanoix, J., Ct, C., Staudt, L. M., Lemieux, S., et al. (2021). Most non-canonical proteins uniquely populate the proteome or immunopeptidome. Cell Rep. 34, 108815. Sarkizova, S., Klaeger, S., Le, P. M., Li, L. W., Oliveira, G., Keshishian, H., Hartigan, C. R., Zhang, W., Braun, D. A., Ligon, K. L., et al. (2020). A large peptidome dataset improves HLA class I epitope prediction across most of the human population. Nat. Biotechnol. 38, 199-209. Schellens, I. M., Meiring, H. D., Hoof, I., Spijkers, S. N., Poelen, M. C. M., van Gaans-van den Brink, J. A. M., Costa, A. I., Vennema, H., Kemir, C., van Baarle, D., et al. (2015). Measles Virus Epitope Presentation by HLA: Novel Insights into Epitope Selection, Dominance, and Microvariation. Front. Immunol. 6, 546. Schmidt, N., Lareau, C. A., Keshishian, H., Ganskih, S., Schneider, C., Hennig, T., Melanson, R., Werner, S., Wei, Y., Zimmer, M., et al. (2020). The SARS-COV-2 RNA-protein interactome in infected human cells. Nat Microbiol. Schwanhusser, B., Busse, D., Li, N., Dittmar, G., Schuchhardt, J., Wolf, J., Chen, W., and Selbach, M. (2011). Global quantification of mammalian gene expression control. Nature 473, 337-342. Sekine, T., Perez-Potti, A., Rivera-Ballesteros, O., Strlin, K., Gorin, J.-B., Olsson, A., Llewellyn-Lacey, S., Kamal, H., Bogdanovic, G., Muschiol, S., et al. (2020). Robust T cell immunity in convalescent individuals with asymptomatic or mild COVID-19. Shomuradova, A. S., Vagida, M. S., Sheetikov, S. A., Zornikova, K. V., Kiryukhin, D., Titov, A., Peshkova, J. O., Khmelevskaya, A., Dianov, D. V., Malasheva, M., et al. (2020). Zornikova, Dmitry Kiryukhin, Aleksei Titov, Iuliia O. Peshkova, Alexandra Khmelevskaya, Dmitry V. Dianov, Maria Malasheva, Anton Shmelev, Yana Serdyuk, Dmitry V. Bagaev, Anastasia Pivnyuk, Dmitrii S. Shcherbinin, Alexandra V. Maleeva, Naina T. Shakirova, Artem Pilunov, Dmitry B. Malko, Ekaterina G. Khamaganova, Bella Biderman, Alexander Ivanov, Mikhail Shugay, Grigory A. Efimov SARS-COV-2 Epitopes Are Recognized by a Public and Diverse Repertoire of Human T Cell Receptors. Immunity 53, 1245-12575. Sidney, J., Southwood, S., Moore, C., Oseroff, C., Pinilla, C., Grey, H. M., and Sette, A. (2013). Measurement of MHC/peptide interactions by gel filtration or monoclonal antibody capture. Curr. Protoc. Immunol. Chapter 18, Unit 18.3. Solberg, O.D., Mack, S., Lancaster, A. K., Single, R. M., Tsai, Y., Sanchez-Mazas, A., and Thomson, G. (2008). Balancing selection and heterogeneity across the classical human leukocyte antigen loci: a meta-analytic review of 497 population studies. Hum. Immunol. 69, 443-464. Sonenberg, N., and Hinnebusch, A. G. (2009). Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell 136, 731-745. Starck, S. R., and Shastri, N. (2016). Nowhere to hide: unconventional translation yields cryptic peptides for immune surveillance. Immunol. Rev. 272, 8-16. Stern-Ginossar, N., Weisburd, B., Michalski, A., Le, V. T. K., Hein, M. Y., Huang, S.-X., Ma, M., Shen, B., Qian, S.-B., Hengel, H., et al. (2012). Decoding human cytomegalovirus. Science 338, 1088-1093. Stukalov, A., Girault, V., Grass, V., Bergant, V., Karayel, O., Urban, C., Haas, D. A., Huang, Y., Oubraham, L., Wang, A., et al. (2020). Multi-level proteomics reveals host-perturbation strategies of SARS-COV-2 and SARS-COV. Su, Y., Chen, D., Yuan, D., Lausted, C., Choi, J., Dai, C. L., Voillet, V., Duvvuri, V. R., Scherler, K., Troisch, P., et al. (2020). Multi-Omics Resolves a Sharp Disease-State Shift between Mild and Moderate COVID-19. Cell 183, 1479-1495.e20. Takagi, A., and Matsui, M. (2020). Identification of HLA-A*02:01-Restricted Candidate Epitopes Derived from the Nonstructural Polyprotein la of SARS-COV-2 That May Be Natural Targets of CD8 T Cell Recognition In Vivo. Journal of Virology 95. Tarke, A., Sidney, J., Kidd, C. K., Dan, J. M., Ramirez, S. I., Yu, E. D., Mateus, J., da Silva Antunes, R., Moore, E., Rubiro, P., et al. (2020). Comprehensive analysis of T cell immunodominance and immunoprevalence of SARS-COV-2 epitopes in COVID-19 cases. bioRxiv. Tarke, A., Sidney, J., Methot, N., Zhang, Y., Dan, J. M., Goodwin, B., Rubiro, P., Sutherland, A., da Silva Antunes, R., Frazier, A., et al. (2021). Negligible impact of SARS-COV-2 variants on CD4+ and CD8+ T cell reactivity in COVID-19 exposed donors and vaccinees. Ternette, N., Yang, H., Partridge, T., Llano, A., Cedeo, S., Fischer, R., Charles, P. D., Dudek, N. L., Mothe, B., Crespo, M., et al. (2016). Defining the HLA class I-associated viral antigen repertoire from HIV-1-infected human cells. Eur. J. Immunol. 46, 60-69. Thompson, A., Schfer, J., Kuhn, K., Kienle, S., Schwarz, J., Schmidt, G., Neumann, T., Johnstone, R., Mohammed, A. K. A., and Hamon, C. (2003). Tandem mass tags: a novel quantification strategy for comparative analysis of complex protein mixtures by MS/MS. Anal. Chem. 75, 1895-1904. Tyanova, S., Temu, T., Sinitcyn, P., Carlson, A., Hein, M. Y., Geiger, T., Mann, M., and Cox, J. (2016). The Perseus computational platform for comprehensive analysis of (prote) omics data. Nat. Methods 13, 731-740. Wainwright, S. D., Biro, P. A., and Holmes, C. H. (2000). HLA-F is a predominantly empty, intracellular, TAP-associated MHC class Ib protein with a restricted expression pattern. J. Immunol. 164, 319-328. Weiskopf, D., Schmitz, K. S., Raadsen, M. P., Grifoni, A., Okba, N. M. A., Endeman, H., van den Akker, J. P. C., Molenkamp, R., Koopmans, M. P. G., van Gorp, E. C. M., et al. (2020). Phenotype and kinetics of SARS-COV-2-specific T cells in COVID-19 patients with acute respiratory distress syndrome. Science Immunology 5, eabd2071. Wolf, F. A., Angerer, P., and Theis, F. J. (2018). SCANPY: large-scale single-cell gene expression data analysis. Genome Biol. 19, 15. Wu, F., Zhao, S., Yu, B., Chen, Y.-M., Wang, W., Song, Z.-G., Hu, Y., Tao, Z.-W., Tian, J.-H., Pei, Y.-Y., et al. (2020). A new coronavirus associated with human respiratory disease in China. Nature 579, 265-269. Wu, T., Guan, J., Handel, A., Tscharke, D. C., Sidney, J., Sette, A., Wakim, L. M., Sng, X. Y. X., Thomas, P. G., Croft, N. P., et al. (2019). Quantification of epitope abundance reveals the effect of direct and cross-presentation on influenza CTL responses. Nat. Commun. 10, 2846. Yang, N., Gibbs, J. S., Hickman, H. D., Reynoso, G. V., Ghosh, A. K., Bennink, J. R., and Yewdell, J. W. (2016). Defining Viral Defective Ribosomal Products: Standard and Alternative Translation Initiation Events Generate a Common Peptide from Influenza A Virus M2 and Ml mRNAs. The Journal of Immunology 196, 3608-3617. Zhu, M.-S., Pan, Y., Chen, H.-Q., Shen, Y., Wang, X.-C., Sun, Y.-J., and Tao, K.-H. (2004). Induction of SARS-nucleoprotein-specific immune response by use of DNA vaccine. Immunol. Lett. 92, 237-243.
***
(498) Various modifications and variations of the described methods, pharmaceutical compositions, and kits of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure come within known customary practice within the art to which the invention pertains and may be applied to the essential features herein before set forth.