Methods and compositions for conferring and/or enhancing herbicide tolerance using protoporphyrinogen oxidase or variant thereof

11466286 · 2022-10-11

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is technology for conferring enhanced herbicide tolerance and/or enhancing herbicide tolerance of plants and/or algae using a protoporphyrinogen oxidase derived from prokaryotes or its amino acid variants.

Claims

1. A polypeptide comprising: an amino acid sequence, which is modified from SEQ ID NO: 4 by at least one modification selected from the followings: (1) a substitution of V175 with C (Cys); (2) a substitution of V318 with M (Met); (3) a substitution of F337 with V (Val); (4) a substitution of L340 with T (Thr); and (5) a substitution of 1353 with T (Thr); and wherein the amino acid sequence is at least 90% identical with the full length SEQ ID NO: 4.

2. The polypeptide of claim 1, which is further modified by at least one modification selected from the followings: a substitution of A177 with C (Cys) or L (Leu), and a substitution of F373 with M (Met), I (Ile), L (Leu), or V (Val).

3. A polynucleotide encoding the polypeptide of claim 1.

4. A recombinant vector comprising the polynucleotide of claim 2.

5. A recombinant cell comprising the recombinant vector of claim 4.

6. A composition for conferring or enhancing herbicide tolerance of a plant or algae, comprising at least one selected from the group consisting of the polypeptide of claim 1; a polynucleotide encoding the polypeptide; a recombinant vector comprising the polynucleotide; and a recombinant cell comprising the recombinant vector.

7. The composition of claim 6, wherein the herbicide is an herbicide inhibiting protoporphyrinogen oxidase.

8. The composition of claim 7, wherein the herbicide is at least one selected from the group consisting of pyrimidinediones, diphenyl-ethers, phenylpyrazoles, N-phenylphthalimides, phenylesters, thiadiazoles, oxadiazoles, triazolinones, oxazolidinediones, pyraclonil, flufenpyr-ethyl and profluazol.

9. The composition of claim 8, wherein the herbicide is at least one selected from the group consisting of butafenacil, saflufenacil, benzfendizone, tiafenacil, fomesafen, oxyfluorfen, aclonifen, acifluorfen, bifenox, ethoxyfen, lactofen, chlomethoxyfen, chlorintrofen, fluoroglycofen-ethyl, halosafen, pyraflufen-ethyl, fluazolate, flumioxazin, cinidon-ethyl, flumiclorac-pentyl, fluthiacet, thidiazimin, oxadiargyl, oxadiazon, carfentrazone, sulfentrazone, azafenidin, pentoxazone, pyraclonil, flufenpyr-ethyl, profluazol, phenopylate, carbamate analogues of phenopylate, and agriculturally acceptable salt thereof.

10. A transformant of a plant or algae having herbicide tolerance, or a clone or progeny thereof, comprising the polypeptide of claim 1 or a polynucleotide encoding thereof.

11. The transformant, clone or progeny thereof of claim 10, wherein the transformant is plant cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or whole plant.

12. A method of preparing a plant or algae having herbicide tolerance, the method comprising transforming algae, or plant cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or whole plant, with the polypeptide of claim 1 or a polynucleotide encoding thereof, to prepare the plant or algae having herbicide tolerance.

13. A method of conferring or enhancing herbicide tolerance of a plant or algae, the method comprising transforming algae, or plant cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or whole plant, with the polypeptide of claim 1 or a polynucleotide encoding thereof.

14. A method of controlling weeds in a cropland, the method comprising, providing the cropland with a plant comprising the polypeptide of claim 1 or a polynucleotide encoding thereof, and applying an effective dosage of protoporphyrinogen oxidase-inhibiting herbicide to the cropland.

15. The method of claim 14, wherein the step of applying an effective dosage of protoporphyrinogen oxidase-inhibiting herbicide to the cropland is performed by applying an effective dosage of two or more kinds of protoporphyrinogen oxidase-inhibiting herbicides sequentially or simultaneously.

16. The method of claim 14, wherein the plant further comprises the second herbicide-tolerant polypeptide or a gene encoding thereof, and the step of applying an effective dosage of protoporphyrinogen oxidase-inhibiting herbicide to the cropland is performed by applying an effective dosage of the protoporphyrinogen oxidase-inhibiting herbicide and a second herbicide are applied sequentially or simultaneously.

17. A method of removing an undesired aquatic organism from a culture medium, the method comprising, providing a culture medium with algae comprising the polypeptide of claim 1 or a polynucleotide encoding thereof, and applying an effective dosage of protoporphyrinogen oxidase-inhibiting herbicide to the culture medium.

18. The method of claim 13, wherein the plant or algae further comprise a second herbicide-tolerant polypeptide or a gene encoding thereof, and tolerance to the second herbicide is conferred or enhanced.

19. The method of claim 18, wherein the second herbicide is selected from the group consisting of glyphosate, glufosinate, dicamba, 2,4-D (2,4-dichlorophenoxyacetic acid), isoxaflutole, ALS (acetolactate synthase)-inhibiting herbicide, photosystem II-inhibiting herbicide, phenylurea-based herbicide, bromoxynil-based herbicide, and combinations thereof.

20. The method of claim 18, wherein the second herbicide-tolerant polypeptide is at least one selected from the group consisting of, glyphosate herbicide-tolerant EPSPS (glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthase), GOX (glyphosate oxidase), GAT (glyphosate-N-acetyltransferase) or glyphosate decarboxylase; glufosinate herbicide-tolerant PAT (phosphinothricin-N-acetyltransferase); dicamba herbicide-tolerant DMO (Dicamba monooxygenase); 2,4-D (2,4-dichlorophenoxyacetic acid) herbicide-tolerant 2,4-D monooxygenase or AAD (aryloxyalkanoate Dioxygenase); ALS (acetolactate synthase)-inhibiting sulfonylurea-based herbicide-tolerant AHAS (acetohydroxyacid synthase), AHAS (acetohydroxyacid synthase) or Atahasl (acetohydroxyacid synthase large subunit); photosystem II-inhibiting herbicide-tolerant photosystem II protein D1; phenylurea herbicide-tolerant Cytochrome P450; plastid-inhibiting herbicide-tolerant HPPD (Hydroxylphenylpyruvate dioxygenase); bromoxynil herbicide-tolerant Nitrilase; and combinations thereof.

21. The method of claim 18, wherein the gene encoding the second herbicide-tolerant polypeptide is at least one selected from the group consisting of, glyphosate herbicide-tolerant cp4 epsps, epsps (AG), mepsps, 2mepsps, goxv247, gat4601 or gat4621 gene; glufosinate herbicide-tolerant bar or pat gene; dicamba herbicide-tolerant dmo gene; 2,4-D (2,4-Dichlorophenoxyacetic acid) herbicide-tolerant AAD-1 or AAD-12 gene; isoxaflutole herbicide-tolerant HPPDPF W336 gene; sulfonylurea herbicide-tolerant ALS, Csr1, Csr1-1, Csr1-2, GM-HRA, S4-HRA, Zm-HRA, SurA or SurB gene; photosystem II-inhibiting herbicide-tolerant psbA gene; phenylurea herbicide-tolerant CYP76B1 gene; bromoxynil herbicide-tolerant bxn gene; and combinations thereof.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 is the map of pACBB vector.

(2) FIG. 2 shows cell growth level after tiafenacil treatment at a concentration of 0 (micromole), 100 μM, or 400 μM, of PPO-deficient BT3 E. coli transformed with pACBB-eGFP vector control (V), PPO-susceptible Arabidopsis thaliana (A. thaliana) PPO1 gene (AtPPO1 WT), PPO-tolerant A. thaliana PPO1 mutant gene (AtPPO1 SLYM), CyPPO10 gene (Cy10 WT), and CyPPO13 gene (Cy13 WT), respectively.

(3) FIG. 3 is the map of pET303-CT-His vector.

(4) FIG. 4 shows the schematic diagram of a recombinant vector for a fusion protein wherein MBP (maltose binding protein) and PPO protein are fused.

(5) FIG. 5 is the map of pMAL-c2X vector.

(6) FIG. 6 is a schematic diagram exemplarily showing the structure of binary vector for plant transformation of CyPPO genes.

(7) FIG. 7 is the result of western blotting showing the expression level of CyPPO variant proteins in T.sub.2 A. thaliana transformed with CyPPO10 variant (F360I variant or F360M variant) or CyPPO13 variant (F373M variant) gene.

(8) FIG. 8 shows the injury level of A. thaliana transformant (T.sub.3) transformed with CyPPO10 or CyPPO13 wild type gene when treated with 1 μM of tiafenacil. Col-O means non-transgenic A. thaliana.

(9) FIG. 9 shows the injury level of A. thaliana transformant (T.sub.2) transformed with a genes encoding a CyPPO10 variant (F360C, F360I, F360L, F360M, F360V, F360T, A167C, A167L, A167L+F360M, or A167C+F360I) when treated with tiafenacil at a concentration of 1 μM, 5 μM, or 25 μM.

(10) FIG. 10 shows the injury level of A. thaliana transformant (T.sub.2) transformed with a gene encoding a CyPPO13 variant (A177C, F373C, F373I, F373M, A177L+F373L, or A177L+F373I) when treated with tiafenacil at a concentration of 1 μM or 10 μM.

(11) FIG. 11 shows cell growth level of PPO-deficient BT3 E. coli (ΔPPO) transformants transformed with CyPPO10 wild type gene (indicated as Cy10 WT), or various CyPPO10 mutant genes, when treated with tiafenacil at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM, and 200 μM, respectively.

(12) FIG. 12 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy10 WT or various CyPPO10 mutant genes, when treated with saflufenacil at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM, and 200 μM, respectively.

(13) FIG. 13 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy10 WT or various CyPPO10 mutant genes, when treated with fomesafen at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(14) FIG. 14 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy10 WT or various CyPPO10 mutant genes, when treated with acifluorfen at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(15) FIG. 15 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy10 WT or various CyPPO10 mutant genes, when treated with flumioxazin at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(16) FIG. 16 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy10 WT or various CyPPO10 mutant genes, when treated with sulfentrazone at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(17) FIG. 17 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy10 WT or various CyPPO10 mutant genes, when treated with pentoxazone at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(18) FIG. 18 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy10 WT or various CyPPO10 mutant genes, when treated with pyraflufen-ethyl at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(19) FIG. 19 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy10 WT or various CyPPO10 mutant genes, when treated with pyraclonil at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(20) FIG. 20 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with CyPPO13 wild type gene (indicated as Cy13 WT), or various CyPPO13 mutant genes, when treated with tiafenacil at a concentration of 0 μM, 5 μM, 25 μM, and 50 μM, respectively.

(21) FIG. 21 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy13 WT or various CyPPO13 mutant genes, when treated with saflufenacil at a concentration of 0 μM, 5 μM, 25 μM, and 50 μM, respectively.

(22) FIG. 22 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy13 WT or various CyPPO13 mutant genes, when treated with fomesafen at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(23) FIG. 23 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy13 WT or various CyPPO13 mutant genes, when treated with acifluorfen at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(24) FIG. 24 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy13 WT or various CyPPO13 mutant genes, when treated with flumioxazin at a concentration of 0 μM, 5 μM, 25 μM, and 50 μM, respectively.

(25) FIG. 25 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy13 WT or various CyPPO13 mutant genes, when treated with sulfentrazone at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(26) FIG. 26 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy13 WT or various CyPPO13 mutant genes, when treated with pentoxazone at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(27) FIG. 27 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy13 WT or various CyPPO13 mutant genes, when treated with pyraflufen-ethyl at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(28) FIG. 28 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy13 WT or various CyPPO13 mutant genes, when treated with pyraclonil at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(29) FIG. 29 shows cell growth level of PPO-deficient BT3 (ΔPPO) transformants transformed with Cy13 WT or various CyPPO13 mutant genes, when treated with oxadiazon at a concentration of 0 μM, 5 μM, 25 μM, 50 μM, 100 μM and 200 μM, respectively.

(30) FIG. 30 is the map of pET29b vector.

(31) FIGS. 31a to 31c show the results of seed germination of A. thaliana transformant transformed with CyPPO10 or CyPPO13 wild type gene or a mutant gene thereof, at 7.sup.th days after sowing on ½ MS medium containing various herbicides. Col-0 means non-transgenic A. thaliana.

(32) FIG. 32 shows the injury level of A. thaliana transformants (T.sub.3) transformed with a gene encoding a CyPPO10 variant (F360I, F360L, F360M, A167C+F360I, A167C+F360M, or V305M+F360M) when treated with 25 μM of tiafenacil or 100 μM of saflufenacil. Col-0 means non-transgenic A. thaliana.

(33) FIG. 33a shows the injury level of A. thaliana transformants (T.sub.3) transformed with a gene encoding a CyPPO10 variant (F360I or A167L+F360M), when treated with tiafenacil, saflufenacil, flumioxazin, or sulfentrazone at a concentration of 50 μM, respectively.

(34) FIG. 33b shows the injury level of A. thaliana transformants (T.sub.3) transformed with a gene encoding a CyPPO13 variant (A177L+F373L or A177L+F373I) when treated with saflufenacil, tiafenacil, flumioxazin, sulfentrazone, oxyfluorfen, or pyraclonil at a concentration of 50 μM, respectively. Col-0 means non-transgenic A. thaliana.

(35) FIG. 34 shows the injury level of A. thaliana transformants (T.sub.4) transformed with CyPPO10 F360I when treated with 15 μM of tiafenacil or 150 μM of saflufenacil.

(36) FIG. 35 shows the injury level of A. thaliana transformants (T.sub.5) transformed with CyPPO10 F360I when treated with 15 μM of tiafenacil or 150 μM of saflufenacil. Col-0 means non-transgenic A. thaliana.

(37) FIG. 36 is a western blot result showing expression of CyPPO10 F360I protein in A. thaliana transformants (T.sub.4 or T.sub.5) transformed with CyPPO10 F360I.

(38) FIG. 37 is the map of pB2GW7.0 binary vector.

(39) FIG. 38 shows the injury level in leaves of T.sub.0 soybean transformed with CyPPO10 A167L+F360M mutant gene when treated with 5 μM or 15 μM of tiafenacil. Kwangan soybean means non-transgenic soybean (cultivar).

(40) FIG. 39 provides southern blotting results showing the presence of transgene in CyPPO10 A167L+F360M transformed soybean.

(41) FIG. 40 shows herbicide tolerance of the T1 transgenic soybeans (CyPPO10 A167L+F360M) 5 days after spray treatment with 25 μM tiafenacil or 150 μM saflufenacil. Kwangan soybean means non-transgenic soybean (cultivar).

(42) FIG. 41 shows cell growth level of BT3 (ΔPPO) E. coli transformed with a mutant gene of CyPPO10 when cultured in herbicide-containing media.

MODE FOR INVENTION

(43) Hereinafter, the present invention will be described in detail by Examples. However, the following Examples are for illustrative purposes only, and the invention is not intended to be limited by the following Examples.

Example 1. Isolation of PPO Gene from Prokaryote

(44) PPO genes were collected using Genbank data base of Thermosynechococcus elongatus BP-1 and Synechococcus sp. JA-3-3Ab, and the PPO genes were synthesized with codon-optimized information for efficient herbicide resistance screening in BT3 E. coli. The synthesized PPO genes were amplified under the following conditions using primers of Table 1 to clone on pACBB vector.

(45) Fifty microliters (50 μl) of PCR reaction mixture was prepared by mixing 1 μl of template (synthetic DNA of each gene), 5 μl of 10× buffer, 1 μl of dNTP mixture (each 10 mM), 1 μl of a forward primer (refer to Table 1; 10 μM), 1 μl of a reverse primer (refer to Table 1; 10 μM), 40 μl of DDW, and 1 μl of Pfu-X (Solgent, 2.5 unit/μl), and amplification was performed under conditions of at 1 cycle of 94° C. for 4 minutes, 25 cycles of 94° C. for 30 seconds, 56° C. for 30 seconds and 72° C. for 1.5 minutes, and 1 cycle of 72° C. for 5 minutes.

(46) PPO isolated from Thermosynechococcus elongatus BP-1 was designated as CyPPO10, and PPO isolated from Synechococcus sp. JA-3-3Ab strain was designated as CyPPO13, respectively.

(47) TABLE-US-00002 TABLE 1 SEQ ID Strain Primer Sequence NO: Thermosynechococcus CyPPO10_BamHI F CCCCGGATCCATGATTGAAGTGGATGTG 8 elongatus GC CyPPO10_XhoI R CCCCCTCGAGTGATTGTCCACCAGCGA 9 GGT Synechococcus sp. CyPPO13_BamHI F CCCCGGATCCATGAACCCTGCTACCCCT 10 JA-3-3Ab GA CyPPO13_XhoI R CCCCCTCGAG CACCTGTGAT 11 AACAACTGCT

Example 2. Herbicide Tolerance by CyPPO10 and CyPPO13

(48) The herbicide tolerance by CyPPO10 and CyPPO13 was tested using PPO-deficient E. coli.

(49) After transforming PPO-deficient BT3 E. coli (ΔPPO) with CyPPO10 or CyPPO13, the transformed BT3 (ΔPPO) was cultured on LB agar plates containing PPO-inhibiting herbicide to examine the growth level of the transformed BT3 (ΔPPO). BT3 (ΔPPO) strain was obtained from Hokkaido University (Japan). The BT3 (ΔPPO) strain is deficient in hemG-type PPO and has kanamycin tolerance (refer to “Watanabe et al., Dual targeting of spinach protoporphyrinogen oxidase II to mitochondria and chloroplasts by alternative use of two in-frame inhibition codons, JBC 2001 276(23):20474-20481; Che et al., Molecular Characterization and Subcellular Localization of Protoporphyrinogen Oxidase in Spinach Chloroplasts, Plant Physiol. 2000 September; 124(1):59-70”).

(50) The specific test process was as follows:

(51) CyPPO10 and CyPPO13 genes were cloned in pACBB vector (Plasmid #32551; Addgene; refer to FIG. 1).

(52) Specifically, PCR products amplified in the Example 1 were treated with BamHI and XhoI restriction enzymes (New England Biolabs), and ligated with pACBB-eGFP vector which was treated with the same restriction enzymes.

(53) The treatment of restriction enzymes was conducted under the following conditions:

(54) 30 μl (microliter) of PCR product, 0.5 μl of BamHI and XhoI (New England Biolabs) respectively, 4 μl of 10× buffer, and 5.5 μl of water; Restriction enzyme reaction 37° C., 1 hr

(55) Ligation reaction was conducted under the following conditions:

(56) 0.5 μl of T4 DNA ligase (RBC), 1 μl of A buffer, 1 μl of B buffer, PCR products and vector which were treated with the restriction enzymes, total 10 μl; 22° C., 30 min.

(57) The cloned plasmid was added to 100 μl of BT3 competent cell (Hokkaido University; Japan) respectively, thereby transforming by a heat shock method. The transformed E. coli with each PPO gene was cultured in LB (Luria-Bertani) agar media comprising Chloramphenicol (Duchefa).

(58) For seed culture of E. coli transformed with respective genes, each single colony of E. coli transformant as provided above was cultured in 3 ml of LB broth containing chloramphenicol overnight (220 rpm, 37° C.), and 50 to 100 μl were subcultured in a new 3 ml of LB broth, and they were cultured until absorbance (OD.sub.600) became 0.5 to 1, and they were diluted with LB broth to absorbance (OD.sub.600) of 0.5. The diluted solution was serially diluted again 5 times by a factor of one tenth with LB broth. Thereafter, on the LB agar media (petri dish) containing tiafenacil at the concentration of 0 μM, 100 μM, and 400 μM, 10 μl of each diluted solution was dropped. The LB Agar media were incubated at 37° C., under light condition, and level of inhibiting growth was observed after 16 to 20 hours of incubation.

(59) For comparison, the same test was conducted using BT3 E. coli transformant transformed with pACBB-eGFP vector (Plasmid #32551; Addgene; refer to FIG. 1) (V; pACBB-eGFP vector); BT3 E. coli transformant transformed with the wild type Arabidopsis thaliana (A. thaliana) PPO1 gene (AtPPO1 WT, Wild type AtPPO1; PPO susceptible) (SEQ ID NO: 6); and BT3 E. coli transformant transformed with a A. thaliana mutant PPO1 gene encoding mutated AtPPO1 (AtPPO1 SLYM, SEQ ID NO: 7) amino acid substitutions of Y426M (the 426.sup.th amino acid residue, tyrosine, was substituted with methionine) and S305L (the 305.sup.th amino acid residue, serine, was substituted with leucine), based on the amino acid sequence of wild type AtPPO1 (SEQ ID NO: 5) (Li et al. Development of protoporphyrinogen oxidase as an efficient selection marker for Agrobacterium tumefaciens-mediated transformation of maize. Plant physiol. 2003 133:736-747).

(60) The obtained result was shown in FIG. 2. As shown in FIG. 2, on a medium containing no herbicide (tiafenacil 0 μM), the growth of BT3 transformant (V) transformed with pACBB-eGFP in which PPO gene was not introduced was not recovered, and the growth of BT3 transformants transformed with PPO susceptible A. thaliana PPO1 wild type gene (AtPPO1 WT), PPO tolerant A. thaliana PPO1 mutant gene (AtPPO1 SLYM), CyPPO10 gene (Cy10 WT), or CyPPO13 gene (Cy13 WT) was recovered, as each introduced gene functioned as the PPO enzyme in BT3. Such results demonstrate that both of CyPPO10 and CyPPO13 exerted normal PPO function.

(61) BT3 transformant (AtPPO1 WT) transformed with A. thaliana PPO1 wild type gene that is susceptible to tiafenacil, normally grew in a medium containing no herbicide (0 μM), but did not grow in a medium containing 100 μM of tiafenacil. BT3 transformant (AtPPO1 SLYM) transformed with A. thaliana PPO1 mutant gene that is tolerant to tiafenacil, gradually started to exhibit growth inhibition from 100 μM of tiafenacil and hardly grew at 400 μM. BT3 transformant transformed with CyPPO10 or CyPPO13 gene grew in the medium containing tiafenacil 100 μM at the similar level to that of the medium containing no tiafenacil, and also grew well even in the medium containing tiafenacil 400 μM. From such results, it was demonstrated that CyPPO10 and CyPPO13 gene can exhibit significantly higher tiafenacil tolerance compared to A. thaliana PPO1 wild type that is susceptible to tiafenacil, and similar or high level of tiafenacil tolerance compared to A. thaliana PPO1 mutant type having tiafenacil tolerance.

Example 3. Determination of PPO Amino Acid Residues Interacting with PPO-Inhibiting Herbicides from PPO and PPO-Inhibiting Herbicide Complex

(62) In order to investigate the binding structure information of PPO protein and herbicide, tiafenacil, saflufenacil, flumioxazin, or sulfentrazone were used for test as representative examples of PPO-inhibiting herbicides. A gene encoding CyPPO10 protein was cloned into the pET29b vector (Catalog Number: 69872-3; EMD Biosciences; refer to FIG. 30) and expressed as a CyPPO10 protein using E. coli system. The expressed CyPPO10 protein was purified through nickel affinity chromatography, and crystallized with PPO-inhibiting herbicides. Then, using a synchrotron radiation accelerator, X-ray diffraction data of the 2.4 Å resolution of complexes of CyPPO10 and tiafenacil, saflufenacil, flumioxazin, or sulfentrazone were obtained, to identify the three-dimensional structure of the complex. Through such process, information for amino acid mutation position in CyPPO10 proteins conferring herbicide tolerance was collected.

(63) As a result of analysis of structure of CyPPO10 and tiafenacil complex, it was concluded that amino acids of N59, S60, R89, F161, V165, A167, Q184, P303, V305, F324, L327, I340, F360, and I408 of CyPPO10 protein (SEQ ID NO: 2) were interacted with tiafenacil.

(64) Using the binding information derived from the structure of CyPPO10-tiafenacil complex, amino acid residues that interact with tiafenacil in CyPPO13 (SEQ ID NO: 4) protein were identified by sequence homology analysis (NCBI BLAST, http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) between amino acids of CyPPO10 (SEQ ID NO: 2) and CyPPO13.

(65) As a result, it was comprehended that amino acids of R101, F171, V175, A177, G194, P316, V318, F337, L340, I353, and F373 positions of CyPPO13 protein (SEQ ID NO: 4) interacted with tiafenacil.

Example 4. Preparation of PPO Variants

(66) In order to enhance PPO-inhibiting herbicide tolerance of CyPPO10 and CyPPO13, both genes were mutated at the positions of amino acids interacting with herbicides, as identified in the Example 3, thereby preparing the mutated genes for increasing PPO-inhibiting herbicide tolerance.

(67) Mutant PPO genes were isolated and amplified by PCR under the following conditions using primers of Table 3:

(68) Materials

(69) Template (synthetic DNA of CyPPO10 or CyPPO13) 1 μl

(70) 10× buffer 5 μl

(71) dNTP mixture (10 mM each) 1 μl

(72) forward primer (10 μM) 1 μl

(73) reverse primer (10 μM) 1 μl

(74) DDW 40 μl

(75) Pfu-X (Solgent, 2.5 unit/μl) 1 μl

(76) Total 50 μl

(77) TABLE-US-00003 TABLE 2 PCR conditions 94° C. 4 min 94° C. 30 sec 25 cycles 56° C. 30 sec 72° C. 1.5 min 72° C. 5 min  4° C. 5 min

(78) TABLE-US-00004 TABLE 3 SEQ ID Strain Primer Sequence NO: Thermosynechococcus CyPPO10_XbaI F CCCCTCTAGAATGATTGAAGTGGATG 12 elongatus BP-1 TGGC CyPPO10_XhoI R CCCCCTCGAG TGATTGTCCA 13 CCAGCGAGGT Synechococcus sp. CyPPO13_XbaI F CCC TCTAGAATG AAC CCT GCT ACC 14 JA-3-3Ab CCT GA CyPPO13_XhoI R CCCCCTCGAG CACCTGTGAT 15 AACAACTGCT

(79) The amplified gene products and pET303-CT His vector (VT0163; Novagen; refer to FIG. 3) were cleaved with XbaI and XhoI, and then, pET303-CyPPO10 and pET303-CyPPO13 plasmids were prepared respectively using T4 DNA ligase (RBC, 3 unit/μl).

(80) Mutant genes of CyPPO10 and CyPPO13 were prepared by conducting PCR under the following conditions using primers of following Tables 5 and 6, and using the CyPPO10 and CyPPO13 which were cloned to the pET303-CT His vector as a template.

(81) Materials

(82) Template 1 μl

(83) 10× buffer 5 μl

(84) dNTP mixture (10 mM each) 1 μl

(85) forward primer (10 μM) 1 μl

(86) reverse primer (10 μM) 1 μl

(87) DDW 40 μl

(88) Pfu-X (Solgent, 2.5 unit/μl) 1 μl

(89) Total 50 μl

(90) TABLE-US-00005 TABLE 4 PCR conditions 94° C. 4 min 94° C. 30 sec 17~25 cycles 56~60° C.    30 sec 72° C. 3 min 72° C. 5 min  4° C. 5 min

(91) TABLE-US-00006 TABLE 5 List of primers for constructing CyPPO13 mutant gene Amino acid mutation of CyPPO10 Primer sequence (5′.fwdarw. 3′) F360M F: GTT TTT ACC TCT ATG ATA GGA GGT GCT ACT (SEQ ID NO: 16) R: AGC ACC TCC TAT CAT AGA GGT AAA AAC CTG (SEQ ID NO: 17) F360V F: GTT TTT ACC TCT GTT ATA GGA GGT GCT ACT (SEQ ID NO: 18) R: AGC ACC TCC TAT AAC AGA GGT AAA AAC CTG (SEQ ID NO: 19) F360I F: GTT TTT ACC TCT ATT ATA GGA GGT GCT ACT (SEQ ID NO: 20) R: AGC ACC TCC TAT AAT AGA GGT AAA AAC CTG (SEQ ID NO: 21) F360T F: GTT TTT ACC TCT ACT ATA GGA GGT GCT ACT (SEQ ID NO: 22) R: AGC TCC ACC AAT AGT AGA GGT AAA AAC CTG (SEQ ID NO: 23) F360L F: GTT TTT ACC TCT CTT ATA GGA GGT GCT ACT (SEQ ID NO: 24) R: AGC TCC ACC AAT AAG AGA GGT AAA AAC CTG (SEQ ID NO: 25) F360C F: GTT TTT ACC TCT TGT ATA GGA GGT GCT ACT (SEQ ID NO: 26) R: AGC TCC ACC AAT ACA AGA GGT AAA AAC CTG (SEQ ID NO: 27) A167C F: TCAGGAGTGTAC TGT GGAGATCCTCAACAG (SEQ ID NO: 28) R: TTGAGGATCTCC ACA GTACACTCCTGAAAC (SEQ ID NO: 29) A167L F: TCAGGAGTGTAC CTT GGAGATCCTCAACAG (SEQ ID NO: 30) R: TTGAGGATCTCC AAG GTACACTCCTGAAAC (SEQ ID NO: 31) P303L + F: ATACCTTAT CTT ACT CTT GCT TGT GTT GTG (SEQ ID NO: 32) V305L R: AACACAAGC AAG AGT AAG ATA AGG TAT (SEQ ID NO: 33) V305M F: CCTTATCCAACT ATG GCTTGTGTTGTGCTT (SEQ ID NO: 34) R: CACAACACAAGC CAT AGTTGGATAAGGTAT (SEQ ID NO: 35) N59T F: GAG CTT GGT CCA ACT AGT TTC GCT C (SEQ ID NO: 36) R: AGCGAAACT AGT TGGACCAAGCTCCCA (SEQ ID NO: 37) R89A F: CAC CTT CCA GCT TAT ATA TAC TGG AGG GGA (SEQ ID NO: 38) R: GTA TAT ATA AGC TGG AAG GTG CCT ATC TCC (SEQ ID NO: 39) V165S F: GTT TCA GGA TCA TAC GCT GGA GAT CCT CAA CAG (SEQ ID NO: 40) R: TCC AGC GTA TGA TCC TGA AAC AAA TGG TGC CAC (SEQ ID NO: 41) V305T F: CCTTATCCAACT ACT GCTTGTGTTGTGCTT (SEQ ID NO: 42) R: CACAACACAAGC AGT AGTTGGATAAGGTAT (SEQ ID NO: 43) S60T F: GGT CCA AAC ACT TTC GCT CCT ACT CCA GCA CTC (SEQ ID NO:44) R: AGG AGC GAA AGT GTT TGG ACC AAG CTC CCA CAC (SEQ ID NO: 45) I340T F: CTC GGA ACC ACC TGG TCT TCA TGC TTA TTC CCA (SEQ ID NO: 46) R: TGA AGA CCA GGT GGT TCC GAG TGT CCT TAT ACC (SEQ ID NO: 47) R89L F: CAC CTT CCA CTT TAT ATA TAC TGG AGG GGA (SEQ ID NO: 48) R: GTA TAT ATA AAG TGG AAG GTG CCT ATC TCC (SEQ ID NO: 49) R89V F: CAC CTT CCA GTT TAT ATA TAC TGG AGG GGA (SEQ ID NO: 50) R: GTA TAT ATA AAC TGG AAG GTG CCT ATC TCC (SEQ ID NO: 51) F161A F: AGATTGGTGGCACCAGCAGTTTCAGGAGTGTAC (SEQ ID NO: 52) R: GTACACTCCTGAAACTGCTGGTGCCACCAATCT (SEQ ID NO: 53) V165C F: CCATTTGTTTCAGGA TGCTACGCTGGAGATCCT (SEQ ID NO: 54) R: AGGATCTCCAGCGTAGCATCCTGAAACAAATGG (SEQ ID NO: 55) Q184G F: TTTAGAAGGATTGCTGGACTTGAGAAGTTGGGA (SEQ ID NO: 56) R: TCCCAACTTCTCAAGTCCAGCAATCCTTCTAAA (SEQ ID NO: 57) F324V F: TCAGTTAGACCTGGAGTTGGTGTTTTGGTGCCT (SEQ ID NO: 58) R: AGGCACCAAAACACCAACTCCAGGTCTAACTGA (SEQ ID NO: 59) L327T F: CCTGGATTTGGTGTTACCGTGCCTAGAGGACAA (SEQ ID NO: 60) R: TTGTCCTCTAGGCACGGTAACACCAAATCCAGG (SEQ ID NO: 61) A167I F: TCAGGAGTGTACATTGGAGATCCTCAACAG (SEQ ID NO: 62) R: TTGAGGATCTCCAATGTACACTCCTGAAAC (SEQ ID NO: 63) I408R F: AGAAGGGCTCGTCCACAATATATCGTTGGTTAC (SEQ ID NO: 64) R: TATTGTGGACGAGCCCTTCTCCAAACCTTC (SEQ ID NO: 65) I408W F: GGTTTGGAGAAGGGCTTGGCCACAATATATCGTTGG (SEQ ID NO: 66) R: CCAACGATATATTGTGGCCAAGCCCTTCTCCAAACC (SEQ ID NO: 67)

(92) TABLE-US-00007 TABLE 6 List of primers for constructing CyPPO13 mutant gene Amino acid mutation of CyPPO13 Primer sequence (5′.fwdarw. 3′) F373M F: TCATTTCTCAGT ATG TTAGGAGGTGCTACA (SEQ ID NO: 68) R: AGCACCTCCTAA CAT ACTGAGAAATGAGTG (SEQ ID NO: 69) F373V F: TCATTTCTCAGT GTT TTAGGAGGTGCTACA (SEQ ID NO: 70) R: AGCACCTCCTAA AAC ACTGAGAAATGAGTG (SEQ ID NO: 71) F373I F: TCATTTCTCAGT ATT TTAGGAGGTGCTACA (SEQ ID NO: 72) R: AGCACCTCCTAA AAT ACTGAGAAATGAGTG (SEQ ID NO: 73) F373T F: TCATTTCTCAGT ACT TTAGGAGGTGCTACA (SEQ ID NO: 74) R: AGCACCTCCTAA AGT ACTGAGAAATGAGTG (SEQ ID NO: 75) F373L F: TCATTTCTCAGT CTT TTAGGAGGTGCTACA (SEQ ID NO: 76) R: AGCACCTCCTAA AAG ACTGAGAAATGAGTG (SEQ ID NO: 77) F373C F: TCATTTCTCAGT TGT TTAGGAGGTGCTACA (SEQ ID NO: 78) R: AGCACCTCCTAA ACA ACTGAGAAATGAGTG (SEQ ID NO: 79) R101A F: AAGTTGCCAGCATATATCTACTGGGAGGGTGC (SEQ ID NO: 80) R: AGTAGATATATGCTGGCAACTTTGCATCAGCC (SEQ ID NO: 81) A177C F: TCA GGA GTT TAT TGT GGA GAT CCT GAT CAA (SEQ ID NO: 82) R: ATC AGG ATC TCC ACA ATA AAC TCC TGA TGT (SEQ ID NO: 83) A177L F: TCAGGAGTTTAT CTT GGAGATCCTGATCAA (SEQ ID NO: 84) R: ATCAGGATCTCC AAG ATAAACTCCTGATGT (SEQ ID NO: 85) A177I F: GGAGTTTATATTGGAGATCCTGATCAACTTAG (SEQ ID NO: 86) R: AGGATCTCCAATATAAACTCCTGATGTGAAAG (SEQ ID NO: 87) P316L + F: ATA CTC TAT CTT CCT CTT GCT GTT GTG GCT (SEQ ID NO: 88) V318L R: CAC AAC AGC AAG AGG AAG ATA GAG TAT TTC (SEQ ID NO: 89) V318L F: TATCCACCTCTTGCTGTTGTGGCTCTTGCATAC (SEQ ID NO: 90) R: CAACAGCAAGAGGTGGATAGAGTATTTCTGCC (SEQ ID NO: 91) V318M F: CTC TAT CCA CCT ATG GCT GTT GTG GCT CTT (SEQ ID NO: 92) R: AGC CAC AAC AGC CAT AGG TGG ATA GAG TAT (SEQ ID NO: 93) P316A + F: ATA CTC TAT GCT CCT CTT GCT GTT GTG GCT (SEQ ID NO: 94) V318L R: CAC AAC AGC AGC AGG AAG ATA GAG TAT TTC (SEQ ID NO: 95) F373N F: TTTCTCAGTAACTTAGGAGGTGCTACAGATGC (SEQ ID NO: 96) R: CCTCCTAAGTTACTGAGAAATGAGTGATAAC (SEQ ID NO: 97) F373H F: TTTCTCAGTCACTTAGGAGGTGCTACAGATGC (SEQ ID NO: 98) R: CCTCCTAAGTGACTGAGAAATGAGTGATAAC (SEQ ID NO: 99) G194Q F: GCTTTTCCTAGGGTGGCTCAGCTCGAAGAGAGATACGG (SEQ ID NO: 100) R: CCGTATCTCTCTTCGAGCTGAGCCACCCTAGGAAAAGC (SEQ ID NO: 101) G194K F: GCTTTTCCTAGGGTGGCTAAACTCGAAGAGAGATACGG (SEQ ID NO: 102) R: CCGTATCTCTCTTCGAGTTTAGCCACCCTAGGAAAAGC (SEQ ID NO: 103) G194R F: GCTTTTCCTAGGGTGGCTCGTCTCGAAGAGAGATACGG (SEQ ID NO: 104) R: CCGTATCTCTCTTCGAGACGAGCCACCCTAGGAAAAGC (SEQ ID NO: 105) G194E F: GCTTTTCCTAGGGTGGCTGAACTCGAAGAGAGATACGG (SEQ ID NO: 106) R: CCGTATCTCTCTTCGAGTTCAGCCACCCTAGGAAAAGC (SEQ ID NO: 107) G194M F: GCTTTTCCTAGGGTGGCTATGCTCGAAGAGAGATACGG (SEQ ID NO: 108) R: CCGTATCTCTCTTCGAGCATAGCCACCCTAGGAAAAGC (SEQ ID NO: 109) F337V F: CAGCCATTAAGAGGAGTGGGTCATCTCATCCC (SEQ ID NO: 110) R: GGGATGAGATGACCCACTCCTCTTAATGGCTG (SEQ ID NO: 111) L340T F: GAGGATTTGGTCATACCATCCCTAGGTCTCAAG (SEQ ID NO: 112) R: CTTGAGACCTAGGGATGGTATGACCAAATCCTC (SEQ ID NO: 113) I353T F: GAACCTTGGGTACTACCTGGGCTTCATGTTTG (SEQ ID NO: 114) R: CAAACATGAAGCCCAGGTAGTACCCAAGGTTC (SEQ ID NO: 115) F171A F: AGATTGGTGGAGCCTGCTACATCAGGAGTTTAT (SEQ ID NO: 116) R: ATAAACTCCTGATGTAGCAGGCTCCACCAATCT (SEQ ID NO: 117) R101A F: GATGCAAAGTTGCCAGCTTATATCTACTGGGAG (SEQ ID NO: 118) R: CTCCCAGTAGATATAAGCTGGCAACTTTGCATC (SEQ ID NO: 119) V175C F: CCTTTCACATCAGGATGTTATGCTGGAGATCCT (SEQ ID NO: 120) R: AGGATCTCCAGCATAACATCCTGATGTGAAAGG (SEQ ID NO: 121) V175L F: ACATCAGGATTGTATGCTGGAGATCCTGATC (SEQ ID NO: 122) R: TCCAGCATACAATCCTGATGTGAAAGGCTCCAC (SEQ ID NO: 123)

Example 5. PPO-Inhibiting Herbicide Tolerance of PPO and its Variants

(93) In order to enhance PPO-inhibiting herbicide tolerance of CyPPO10 and CyPPO13, the amino acids interacting with herbicide, as identified in the Example 3, were mutated. After PPO-deficient BT3 E. coli (ΔPPO) was transformed with a PPO gene having such mutation, and then cultured with PPO-inhibiting herbicide, to observe the growth of transformed E. coli, as follows:

(94) The pET303-CyPPO10 or pET303-CyPPO13 plasmids prepared in the Example 4, and plasmids containing each mutant gene, were transformed into BT3 competent cell by a heat shock method, and cultured in a LB agar medium containing ampicillin (100 μg/ml).

(95) For seed culture of BT3 transformants, a single colony thereof was cultured in 3 ml of LB broth (LPSS) containing ampicillin for 12 hours or more, and 50˜100 μl of the cultured solution was further cultured until absorbance (OD.sub.600) reaches 0.5 to 1. Then, the obtained cultured solution was diluted with LB broth to adjust absorbance (OD.sub.600) to 0.5, and was diluted again 5 times by a factor of one tenth with LB broth.

(96) LB (25 g/L), Bacto agar (12 g/L), ampicillin (100 μg/ml) and various herbicides (0˜200 μM) were mixed, to prepare herbicide-containing media.

(97) Ten microliters of the diluted solution were dropped on the herbicide-containing media, and the media were incubated with light for 16-20 hours at 37° C. The growth level and PPO-inhibiting herbicide tolerance of BT3 transformed with each gene were evaluated.

(98) Herbicides used in the test were listed in following Table 7:

(99) TABLE-US-00008 TABLE 7 Family Herbicide Pyrimidinedione-based herbicides Tiafenacil Saflufenacil Diphenyl ether-based herbicides Fomesafen Acifluorfen N-phenylphthalimides-based herbicides Flumioxazin Triazolinones-based herbicides Sulfentrazone Oxazolidinediones-based herbicides Pentoxazone Phenylpyrazoles-based herbicides Pyraflufen-ethyl Other herbicides Pyraclonil

(100) The herbicide tolerance was evaluated relatively compared to CyPPO wild type, and shown in following Tables 8 to 11 and FIGS. 11 to 29:

(101) TABLE-US-00009 TABLE 8 Tiafenacil Saflufenacil Acifluorfen Fomesafen CyPPO10 (up to (up to (up to (up to mutation 200 μM) 200 μM) 200 μM) 200 μM) CyPPO10 (wild type) − − − − F360C ++++ ++++ ++++ ++++ F360I ++++ ++++ ++++ ++++ F360L ++++ ++++ ++++ ++++ F360M ++++ ++++ ++++ ++++ F360V ++++ ++++ ++++ ++++ A167C +++ + ++++ ++++ A167L ++++ +++ ++++ ++++ P303L + V305L NT NT ++ + V305M ++ + +++ ++++ NT(Not tested)

(102) TABLE-US-00010 TABLE 9 Pentoxazone Pyraflufen-ethyl Pyraclonil Flumioxazin Sulfentrazone CyPPO10 (up to (up to (up to (up to (up to mutation 200 μM) 200 μM) 200 μM) 200 μM) 200 μM) CyPPO10 (wild type) − − − − − F360C ++++ ++++ ++++ ++++ ++++ F360I ++++ ++++ ++++ ++++ ++++ F360L ++++ ++++ ++++ ++++ ++++ F360M ++++ ++++ ++++ ++++ ++++ F360V ++++ ++++ ++++ NT ++++ A167C ++++ ++++ ++++ + ++ A167L ++++ ++++ ++++ ++++ +++ P303L + V305L ++++ + +++ NT NT V305M ++++ + +++ NT NT NT(Not tested)

(103) TABLE-US-00011 TABLE 10 Tiafenacil Saflufenacil Acifluorfen Fomesafen Pentoxazone CyPPO13 (up to (up to (up to (up to (up to mutation 50 μM) 50 μM) 200 μM) 200 μM) 200 μM) CyPPO13 − − − − − (wild type) F373C +++++ +++ +++ +++ ++++ F373I +++++ +++++ +++ +++ +++++ F373L +++++ +++++ +++ ++++ +++++ F373M +++++ +++ +++ ++++ +++++ F373T +++++ ++++ ++++ ++++ ++++ A177C NT + ++++ ++++ ++++ A177L ++ + ++++ ++++ ++++ V318M NT NT +++ ++ + P316A + V318L NT NT +++ − NT P316L + V318L NT NT +++ ++ NT NT(Not tested)

(104) TABLE-US-00012 TABLE 11 Pyraflufen-ethyl Pyraclonil Sulfentrazone Flumioxazin CyPPO13 (up to (up to (up to (up to mutation 200 μM) 200 μM) 200 μM) 50 μM) CyPPO13 − − − − F373C ++ +++++ − − F373I ++ +++++ ++++ ++++ F373L ++ +++++ ++++ ++++ F373M ++ +++++ ++++ +++ F373T ++++ ++++ + ++++ A177C +++++ ++++ ++++ − A177L +++++ +++ ++++ ++++ V318M ++ − + NT P316A + V318L + − − NT P316L + V318L + − + NT NT(Not tested)

(105) In the Tables 8 to 11, the level of herbicide tolerance of the wild type was represented by “−”, and the level of herbicide tolerance was graduated by representing the equal level of tolerance by “−”, and if higher, adding “+” to the max “+++++”.

(106) FIGS. 11 to 19 (wild type and variants of CyPPO10) and FIGS. 20 to 29 (wild type and variants of CyPPO13) show the results of culturing E. coli transformed with CyPPO genes (wild type and variant type), and the concentration described on the top is concentration of herbicide treated. Six columns of each concentration were sequentially diluted 5 times by a factor of one tenth with the E. coli culture solution to the right, and the most left column is the result of E. coli culture solution OD600=0.5.

(107) As shown in Tables 8 to 11 and FIGS. 11 to 29, it was demonstrated that all the transformants transformed with mutant genes of CyPPO10 and CyPPO13 exhibited equal level or increased level of herbicide tolerance to various kinds of herbicides, compared to the transformant with wild type gene.

Example 6: Measurement of Enzyme Activity and IC.SUB.50 .Value by Herbicides of PPO

(108) The enzyme activities of PPO protein and PPO protein variants were examined, and inhibition assay by PPO-inhibiting herbicides was conducted. It was confirmed that the PPO protein has low water-solubility, but in case of being expressed as a fusion protein with MBP (maltose binding protein) (MBP-PPO), the PPO protein is able to be stably expressed as water-soluble form. Therefore, the wild type and variant proteins which were expressed in the form of fusion protein with MBP were used in the present test (refer to FIG. 4).

(109) In order to express wild type genes and mutant genes of CyPPO10 and CyPPO13 (refer to Example 1 and Example 4), those genes were introduced to pMAL-c2X vector (refer to FIG. 5) respectively, and then cloned to BL21 (DE3) E. coli (CodonPlus).

(110) The transformed E. coli were cultured under the following conditions to express introduced PPO genes:

(111) Induction: OD.sub.600=0.2, addition of IPTG to 0.3 mM final concentration;

(112) Expression temperature: 23° C., 200 rpm shaking culture;

(113) Expression time: 16 hrs;

(114) Culture scale: 200 ml/1,000 ml flask.

(115) Cell lysis and protein extraction were performed by the following process to the cultured E. coli cells:

(116) Extraction buffer: Column buffer (50 mM Tris-Cl, pH8.0, 200 mM NaCl) 5 ml buffer/g cell;

(117) Sonication: SONICS&MATERIALS VCX130 (130 watts);

(118) 15 sec ON, 10 sec OFF for 5 min on ice;

(119) Centrifugation under the condition of 4° C. for 20 minutes (20,000×g); and the supernatant obtained by the centrifugation was diluted at the ratio of 1:6 using column buffer.

(120) The following process for purification of PPO protein was performed in a 4° C. cold room. Amylose resin (New England Biolabs) was packed to 1.5×15 cm column (Bio-Rad Econo Columns 1.5×10 cm, glass chromatography column, max. vol), and the obtained protein extracts were loaded to the column at a flow rate of 0.2 ml/min. The column was washed with 3 column volumes of buffer, and the amount of protein in the washing solution was checked. When the protein was no longer detected, the washing was terminated. Then, the MBP-PPO protein was eluted with approximately 2 column volumes of buffer containing 20 mM maltose. The protein concentration of each eluent was determined and the elution was stopped when the protein was no longer detected. Ten microliter of each fraction was investigated for protein quantification and SDS-PAGE analysis. The highly pure fractions with PPO proteins were taken for enzyme activity assay.

(121) The enzyme activity of the purified wild type protein and variant proteins of CyPPO10 and CyPPO13 was measured by the following process.

(122) At first, a substrate of PPO protein, Protoporphyrinogen IX was synthesized. This process was performed in the space where nitrogen gas is streamed. 6 mg of protoporphyrin IX was dissolved in 20% (v/v) EtOH 20 ml, and stirred under dark condition for 30 minutes. The obtained protoporphyrinogen IX solution was put into a 15 ml screw tube in an amount of 800 and flushed with nitrogen gas for 5 minutes. To this, 1 g of sodium amalgam was added and vigorous shaking was performed for 2 minutes. The lid was open to exhaust hydrogen gas in the tube. Thereafter, the lid was closed and incubated for 3 minutes. The protoporphyrin IX solution was filtered using syringe and cellulose membrane filter. To 600 μl of the obtained protoporphyrin IX solution, 2M MOPS [3-(N-morpholino)propanesulfonic acid] was added in an amount of approximately 300 thereby adjusting pH to 8.0. To determine the enzyme activity of PPO protein, a reaction mixture was prepared with the following composition (based on 10 ml): 50 mM Tris-Cl (pH 8.0); 50 mM NaCl; 0.04% (v/v) Tween 20; 40 mM glucose (0.072 g); 5 units glucose oxidase (16.6 mg); and 10 units catalase (1 μl).

(123) Two hundred microliters (200 μl) of reaction mixture containing a purified PPO protein were placed in 96 well plates, and preincubated for 30 min at room temperature to reduce the oxygen concentration by the reaction of glucose oxidase-catalase. The mineral oil was layered and then the reaction was initiated by adding the substrate, protoporphyrin IX solution, to a final concentration of 50 μM. The reaction proceeded at room temperature for 30 min and the fluorescence of protoporphyrin IX was measured using Microplate reader (Sense, Hidex) (excitation: 405 nm; emission: 633 nm). To calculate the PPO enzyme activity, protoporphyrinogen IX solution was kept open in the air to oxidize the solution (overnight). To this, 2.7N HCl was added, and the absorbance at 408 nm was measured. A standard curve was generated using standard protoporphyrin IX, and the PPO activity was measured by calibration of protoporphyrin IX using the standard curve of protoporphyrin IX.

(124) The enzyme activity of the obtained PPO wildtype and variants was shown in Table 12.

(125) Meanwhile, Michaelis-Menten constant (Km) and the maximal velocity (Vmax) values of each enzyme were calculated in order to evaluate the kinetic parameters of PPO proteins (CyPPO10 and CyPPO13). The initial reaction velocity was measured where the reaction velocity was proportional to substrate concentration, and the amount of produced protoporphyrin IX which is an enzymatic reaction product was measured by time course at room temperature for 20 minutes. Km and Vmax values were calculated with the enzyme kinetics analysis program by Michaelis-Menten equation, and the plant PPO was used as a control group. The obtained result was shown in Table 12:

(126) TABLE-US-00013 TABLE 12 Amaranthus Classification CyPPO10 CyPPO13 AtPPO1 PPO1 Vmax (μM mg protein.sup.−1 min.sup.−1) 949.1 ± 64 341.4 ± 14 134.4 ± 19 57 ± 7

(127) As shown in Table 12, CyPPO10 and CyPPO13 have superior ability as a PPO enzyme than A. thaliana PPO1 (AtPPO1) and Amaranthus PPO1.

(128) The concentration of the PPO-inhibiting herbicides that inhibits the PPO enzyme activity by 50% (IC.sub.50) was measured for each herbicide. The final concentration of each herbicide was as follows:

(129) 0, 10, 50, 100, 250, 500, 1,000, 2,500, 5,000 nM

(130) The IC.sub.50 value was calculated as the concentration of the herbicide inhibiting the PPO enzyme activity to 50% before adding the herbicide at the above concentration to the above enzyme activity measurement process.

(131) The IC.sub.50 values of different herbicides were shown in the following Table 13.

(132) TABLE-US-00014 TABLE 13 IC.sub.50(nM) No. Mutation Activity (%) Tiafenacil Saflufenacil Fomesafen Butafenacil Flumioxazin Sulfentrazone CyPPO10 1 WT 100 21    9   15   8 NT NT 2 F360M 93 115 1,500   114   24 NT NT 3 F360I 67 799 3,916   191   268 3,323 NT 4 F360L 59 172 NT NT NT NT NT 5 F360V 56 307 NT NT NT NT NT 6 N59T + F360V 62 543 NT NT NT NT NT 7 R89A + F360M 67 931 5,000 5,000   674 1,216 5,000 8 R89A + F360I 38 2,153 5,000 5,000 1,323 5,000 5,000 9 R89A + F360L 30 1,000 NT NT NT 1,025 NT 10 V165S + F360M 78 435 NT NT NT 119 NT 11 V165S + F360I 63 818 NT NT NT NT NT 12 V165S + F360L 59 470 NT NT NT NT NT 13 V165S + F360V 52 929 NT NT NT NT NT 14 A167L + F360M 80 5,000 5,000 3,000 4,000 5,000 5,000 15 A167L + F360I 32 5,000 NT NT NT NT NT 16 A167C + F360M 90 4,500 5,000 1,900 2,500 4,000 5,000 17 A167C + F360I 48 4,500 NT NT NT NT NT 18 V305M + F360M 87 356 5,000   675   121   544 2,057 19 V305T + F360I 10 276 NT NT NT NT NT 20 R89A + 5 741 NT NT NT NT NT V305T + F360M 21 S60T + 17 2,720 NT NT NT NT NT V165S + F360M 22 S60T + 12 3,580 NT NT NT NT NT V165S + F360I 23 S60T + 5 2,000 NT NT NT NT NT I340T + F360I 24 R89V + F360I 57 242 NT NT NT NT NT 25 R89L + F360I 51 184 NT NT NT NT NT 26 A167I + F360M 85 5,000 5,000 5,000 5,000 5,000 5,000 27 V165C + F360M 93 2,169 NT NT NT NT NT 28 V305L + F360M 82 262 NT NT NT NT NT 29 V165C + 91 5,000 5,000 3,034 2,810 5,000 5,000 A167C + F360M 30 V165C + 75 5,000 5,000 3,741 5,000 5,000 5,000 A167I + F360M 31 V165C + 83 5,000 5,000 4,277 4,820 5,000 5,000 A167L + F360M 32 R89A + 7 5,000 NT NT NT NT NT A167L + F360M 33 I408R + F360M 5 5,000 NT NT NT NT NT 34 I408W + F360M 5 5,000 NT NT NT NT NT 35 R89A 83 104 NT NT NT NT NT 36 F161A 92 203 NT NT NT NT NT 37 V165C 99 97 NT NT NT NT NT 38 A167C 98 86 NT NT NT NT NT 39 A167L 95 792 NT NT NT NT NT 40 Q184G 97 79 NT NT NT NT NT 41 V305M 100 186 NT NT NT NT NT 42 F324V 59 140 NT NT NT NT NT 43 L327T 84 214 NT NT NT NT NT 44 I340T 19 216 NT NT NT NT NT 45 F360T 85 5,000 NT NT NT NT NT CyPPO13 1 WT 100 28   36   30   37 NT NT 2 F373M 98 56   481   77   18 NT NT 3 F373I 83 135 1,480 NT NT NT NT 4 F373L 82 141 1,470 NT NT NT NT 5 F373C 86 212 NT NT NT NT NT 6 F373V 83 339 NT NT NT NT NT 7 F373T 81 818 NT NT NT NT NT 8 F373H 26 114 NT NT NT NT NT 9 F373N 40 40 NT NT NT NT NT 10 R101A + F373M 55 615 5,000 NT NT   573 NT 11 A177C + F373M 77 336 4,500 NT NT NT NT 12 A177I + F373M 75 261 4,700 NT NT NT NT 13 A177L + F373M 75 1,122 5,000   690 2,500 5,000 5,000 14 A177L + F373I 66 1,630 5,000   315 5,000 5,000 5,000 15 A177L + F373L 68 5,000 5,000   464 5,000 5,000 5,000 16 V175L + F373M 93 203 1,375 NT NT NT NT 17 V318M + F373M 72 386 1,924 NT NT NT NT 18 A177L + F373T 62 4,700 5,000 3,000 4,000 5,000 5,000 19 A177L + F373V 49 5,000 5,000 1,229 5,000 5,000 5,000 20 A177C + F373T 80 3,900 NT NT NT NT NT 21 A177C + F373V 56 3,200 NT NT NT NT NT 22 G194E + F373M 32 64   261 NT NT   66 NT 23 G194Q + F373M 37 24   265 NT NT    5.2 NT 24 G194M + F373M 43 20   475 NT NT   53 NT 25 G194K + F373M 41 95   224 NT NT   128 NT 26 G194R + F373M 35 67   218 NT NT   81 NT 27 R101A 87 139 NT NT NT NT NT 28 F171A 70 70 NT NT NT NT NT 29 V175C 94 57 NT NT NT NT NT 30 A177C 98 113 NT NT NT NT NT 31 A177L 97 211 NT NT NT NT NT 32 V318M 81 211 NT NT NT NT NT 33 F337V 88 158 NT NT NT NT NT 34 E340T 83 443 NT NT NT NT NT 35 I353T 62 280 NT NT NT NT NT NT(Not Tested)

(133) As shown in Table 13, CyPPO protein variants exhibit more increased IC.sub.50 values, compared to wild type CyPPO protein. Such results demonstrate that the amino acid mutations at certain positions of PPO protein can lead to increase in herbicide tolerance. Although the present data showed that CyPPO protein variants have reduced enzyme activity compared to the wild type, it might be caused by the different conditions of the protein folding, and/or hydrophobicity of recombinants PPOs compared to the native PPOs. While the native PPOs are hydrophobic and localize to the membranes of chloroplasts in plants, the recombinant PPOs produced in E. coli are hydrophilic containing a MBP as a fusion partner. Thus, when PPO variants are properly assembled and localized in chloroplasts membrane of plants, the enzyme activity would not be affected drastically.

Example 7. Generation of A. thaliana Transformants Using CyPPO and its Variants and PPO-Inhibiting Herbicide Tolerance Test

(134) 7-1. Construction of A. thaliana Transformation Vectors and Transformation of A. thaliana

(135) A. thaliana was transformed with a binary vector having ORF of a selectable marker, bar gene (glufosinate-tolerant), and that of each encoding gene of CyPPO10 or CyPPO13 variants. The transgenic plant was examined for cross-tolerance towards glufosinate and PPO-inhibiting herbicides. The bar gene was also used to examine whether the transgene was stably inherited during generations. NOS promoter and E9 terminator were used for bar gene expression.

(136) In order to express CyPPO10, CyPPO10 variants, CyPPO13 and CyPPO13 variants, respectively in a plant, CaMV35S promoter and NOS terminator were used. Encoding genes of CyPPO10, CyPPO10 variants, CyPPO13 and CyPPO13 variants were cloned using XhoI and BamHI restriction enzymes. For identification of expressed protein, hemagglutinin (HA) tag was fused to the 3′-terminal region using BamHI and SacI restriction enzymes. NOS terminator was inserted after HA tag, thereby terminating transcription of PPO gene. In addition, in order to transit proteins to chloroplast, transit peptide (TP) of AtPPO1 gene (SEQ ID NO: 10) was inserted in front of 5′ of the inserted gene using XbaI and XhoI restriction enzymes. The transit peptide region inserted in the vector was represented by SEQ ID NO: 27 and the inserted HA tag sequence was represented by SEQ ID NO: 28. A schematic diagram of the plant transformation binary vector is shown in FIG. 6.

(137) Each constructed vector above was introduced to Agrobacterium tumefaciens GV3101 competent cell by a freeze-thaw method. To prepare Agrobacterium GV3101 competent cell, Agrobacterium GV3101 strain was seed-cultured in 5 ml LB media under the condition of 30° C. and 200 rpm for 12 hrs. The culture medium was inoculated to 200 ml LB media, and then cultured at 200 rpm for 3-4 hrs at 30° C., and centrifuged at 3000×g for 20 minutes at 4° C. The pellet was washed with sterile distilled water, and resuspended in 20 ml LB media. Snap frozen 200 μl aliquots with liquid nitrogen were stored in a deep freezer.

(138) Each transformed Agrobacterium was cultured in an antibiotic medium (LB agar containing spectinomycin) and screened. The screened colony was liquid cultured in LB broth. After Agrobacterium was harvested from the culture medium, it was resuspended in 5% (w/v) sucrose, 0.05% (v/v) Silwet L-77 solution (Momentive performance materials company) at an absorbance (OD.sub.600) of 0.8. By Floral dipping method, Col-0 ecotype A. thaliana wild type was transformed, and then the seed (T.sub.1) was harvested 1-2 months later.

(139) Bar gene in the binary vector was used for screening of individual transformants. The obtained T.sub.1 seeds were sown in ½ MS media (2.25 g/L MS salt, 10 g/L sucrose, 7 g/L Agar) supplemented with 25 μM glufosinate, and the surviving plants were selected after 7 days of sowing, and transplanted into soil.

(140) In order to examine PPO-inhibiting herbicide tolerance of the transgenic plants, 4-week-old plants were evenly sprayed with 100 ml of 1 μM tiafenacil solution (0.05% Silwet L-77) per 40×60 cm area (0.24 m.sup.2). While wild type A. thaliana (Col-0 ecotype; Columbia-0 ecotype) completely died within 7 days after treatment, each transformant showed no damage to PPO-inhibiting herbicide treatment.

(141) The T.sub.2 seeds harvested from surviving plants were sown to ½ MS media (2.25 g/L MS salt, 10 g/L sucrose, 7 g/L Agar) supplemented with 25 μM glufosinate, and after 1 week, surviving plants were transplanted into soil.

(142) To confirm the copy number of each line, the segregation ratios were investigated with T.sub.2 seeds.

(143) Tiafenacil tolerance of 4-week-old transformants was confirmed by spraying 100 ml of tiafenacil solution (1 μM, 5 μM, 10 μM or 25 μM tiafenacil+0.05% Silwet L-77) per 40×60 cm area (0.24 m.sup.2). T.sub.3 seeds were harvested from tiafenacil-tolerant T.sub.2 plants.

(144) The seeds were selected in a ½ MS medium containing 25 μM glufosinate, and the lines in which all individuals were glufosinate-tolerant were judged as homolines.

(145) 7-2. Seed Germination

(146) Herbicide tolerance of A. thaliana transformants introduced with wild type or variant genes of CyPPO10 and CyPPO13 was confirmed.

(147) T.sub.3 generation seeds of each transformant were sown in ½ MS media containing herbicides. Col-0 ecotype (wild type Arabidopsis) seeds were used as a control. The kinds of herbicides and concentration are as follows:

(148) FIG. 31a: 25 μM gufosinate (PPT), 70 nM tiafenacil, 100 nM saflufenacil, 25 μM glufosinate+70 nM tiafenacil, or 25 μM glufosinate+30 nM tiafenacil+40 nM saflufenacil;

(149) FIGS. 31b and 31c: 25 μM glufosinate (PPT), 0.1 μM or 1 μM tiafenacil, 0.3 μM or 3 μM saflufenacil, 0.1 μM or 1 μM flumioxazin, 0.5 μM or 5 μM pyraclonil, or 1 μM or 10 μM sulfentrazone.

(150) The results of seed germination in 7 days after sowing were shown in FIGS. 31a, 31b, and 31c. In FIGS. 31a to 31c, 10-3 refers to CyPPO10 wild type, 10FM-4-7 to the CyPPO10 F360M transgenic line, 10FL-1-9 to the CyPPO10 F360L transgenic line, 10FC-3-5 to the CyPPO10 F360C transgenic line, 10AC-5-4 to the CyPPO10 A167C transgenic line, 13-1 to CyPPO13 wild type, 13FM-3-1 to the CyPPO13 F373M transgenic line, 13FC-1-1 to the CyPPO13 F373C transgenic line, 13FI-2-1 to the CyPPO13 F373I transgenic line, 13AC-1-3 to the CyPPO13 A177C transgenic line, CyPPO13_ALFL to the CyPPO13 A177L+F373L transgenic line, and CyPPO13_ALFI to the CyPPO13 A177L+F373I transgenic line, respectively.

(151) As shown in FIGS. 31a to 31c, while the wild type A. thaliana (Col-0 ecotype) germinated in the ½ MS medium containing no herbicide, it did not germinate in the ½ MS medium containing herbicides. Therefore, germination test on the medium containing herbicides is useful to evaluate herbicide tolerance.

(152) Meanwhile, transformed A. thaliana T.sub.3 lines in which CyPPO10 wild type, CyPPO10 mutant genes (F360M, F360I, F360L, F360C, A167C), CyPPO13 wild type or CyPPO13 mutant genes (F373M, F373C, F373I, A177C, A177L+F373L, A177L+F373I) germinated in the media containing herbicides (containing 25 μM glufosinate, 25 μM glufosinate+70 nM tiafenacil, or 25 μM glufosinate+30 nM tiafenacil+40 nM saflufenacil). These results indicate that bar gene (glufosinate-tolerant gene) and CyPPO genes (PPO-inhibiting herbicide-tolerant gene) functioned as herbicide tolerant traits simultaneously and independently in the transgenic plants.

(153) As shown in 31a to 31c, in the media containing various kinds and various concentrations of PPO-inhibiting herbicides, the transformed A. thaliana normally germinated and survived, while Col-0 did not normally germinate. Such result showed that transformed A. thaliana was conferred tolerance or retained enhanced tolerance to various PPO-inhibiting herbicides by the inserted genes of transformants.

(154) 7-3. Investigation of CyPPO Protein Expression in CyPPO Genes-Introduced A. thaliana (T.sub.2)

(155) Each protein expression was investigated in A. thaliana transformants (T.sub.2) in which genes encoding CyPPO10, CyPPO10 variants (F360I or F360M), CyPPO13, or CyPPO13 variant (F373M) were inserted, respectively.

(156) Four-week-old A. thaliana transformant leaves were ground with liquid nitrogen, and the protein was extracted by adding protein extraction buffer (0.05 M Tris-Cl pH7.5, 0.1 M NaCl, 0.01 M EDTA, 1% Triton X-100, 1 mM DTT). Then, western blotting was conducted using anti-HA antibody (Santa cruz). The expressed proteins in the transformants were detected using HA tag. To compare the amount of proteins loaded, the amount of RuBisCO large subunit was confirmed by Coomassie blue staining. Two independent lines per each variant were tested, and Col-0 was used as a control.

(157) The result was shown in FIG. 7. All the A. thaliana transformants introduced with CyPPO10 variant (F360I variant or F360M variant) or CyPPO13 variant (F373M variant) genes exhibited successful expression of the PPO proteins.

(158) 7-4. Verification of Herbicide Tolerance of Transformed A. thaliana (T.sub.2 or T.sub.3)

(159) Herbicide tolerance was tested with A. thaliana transformants (T.sub.2 or T.sub.3) in which genes encoding CyPPO10, CyPPO10 variant (F360C, F360I, F360L, F360M, F360V, F360T, A167C, A167L, A167L+F360M, A167C+F360M, A167C+F360I, or V305M+F360M), CyPPO13, or CyPPO13 variant (A177C, F373C, F373I, F373M, A177L+F373I, or A177L+F373L) were introduced respectively.

(160) After treatment with tiafenacil solution (1 μM tiafenacil+0.05% (v/v) Silwet L-77) to CyPPO10 or CyPPO13 transformants (T.sub.3) in the amount of 100 ml per 40×60 cm area (0.24 m.sup.2), injury level of the plant was judged at the 7.sup.th day. For comparison, the same test was conducted using the wild type A. thaliana (Col-0 ecotype).

(161) The result was shown in FIG. 8.

(162) In addition, after treatment with 100 ml of tiafenacil solution (1 μM, 5 μM, 10 μM, or 25 μM tiafenacil+0.05% (v/v) Silwet L-77) per 40×60 cm area (0.24 m.sup.2) to transformants (T.sub.2) with genes encoding CyPPO10 variant (F360C, F360I, F360L, F360M, F360V, F360T, A167C, A167L, A167L+F360M, or A167C+F360I) or CyPPO13 variant (A177C, F373C, F373I, F373M, A177L+F373I, or A177L+F373L), injury level of the plant was judged at the 7.sup.th day.

(163) The result was shown in FIG. 9 (CyPPO10 variant gene-introduced T.sub.2 transformants) and FIG. 10 (CyPPO13 variant gene-introduced T.sub.2 transformants).

(164) In addition, the injury level (Injury index) of each line after tiafenacil treatment in FIGS. 8 to 10 was shown in the following Table 14 as numerical index.

(165) TABLE-US-00015 TABLE 14 T.sub.2 Injury Index (injury level) Line No. Tiafenacil Average injury index Col-0 1 μM 5 CyPPO10 Wild type 1 μM 0.5 F360C 3 1 μM 0.3 5 μM 0.9 F360I 7 1 μM 0 5 μM 0.1 F360L 3 1 μM 0 5 μM 0.3 F360M 4 1 μM 0.1 5 μM 0.3 F360V 4 1 μM 0 5 μM 0.3 F360T 3 1 μM 2.6 A167C 3 1 μM 0 A167L 3 1 μM 0.2 A167L + F360M 12 25 μM 2 A167C + F360I 19 25 μM 2 CyPPO13 Wild type 1 μM 0.5 A177C 1 1 μM 0 F373C 2 1 μM 0.1 F373I 2 1 μM 0.1 F373M 2 1 μM 0 A177L + F373I 9 10 μM 1.5 A177L + F373L 7 10 μM 0

(166) After treatment with tiafenacil solution (25 μM tiafenacil+0.05% (v/v) Silwet L-77) or saflufenacil solution (100 μM saflufenacil+0.05% (v/v) Silwet L-77) in the amount of 100 ml per 40×60 cm area (0.24 m.sup.2) to transformants (T.sub.3) in which genes encoding CyPPO10 variant (F360I, F360L, F360M, A167C+F360I, A167C+F360M, or V305M+F360M) were introduced, injury level of the plants was judged at the 7.sup.th day.

(167) The result of T.sub.3 transformants introduced with CyPPO10 variant encoding genes was shown in FIG. 32.

(168) In addition, the injury level (Injury index) by tiafenacil or saflufenacil treatment of CyPPO10 mutant gene-introduced A. thaliana transformants was shown in the following Table 15 as numerical index.

(169) TABLE-US-00016 TABLE 15 T.sub.3 Injury Index (injury level) Average Average Line No. Tiafenacil injury index Saflufenacil injury index Col-0 25 μM 5 100 μM 5 CyPPO10 F360I 7-2 25 μM 1 100 μM 1.1 10-2  100 μM 0 F360M 4-7 25 μM 2 F360L 3-2 25 μM 1 A167C + F360I  1-4 25 μM 2  A167C + F360M 4-5 25 μM 2 V305M + F360M 6-5 25 μM 2

(170) The Table 14 and 15 showed the average of injury levels of tested individuals (10 to 20 individuals) according to the criteria of the following Table 16.

(171) TABLE-US-00017 TABLE 16 Definition of injury level Injury index Symptom 0 No damage 1 Dried leaf end or less than 20% scorched 2 Over 20% and less than 30% of the plant was scorched 2.5 Over 30% and less than 50% of the plant was scorched 3 Over 50% and less than 70% of the plant was scorched 4 Over 70% of the plant was scorched 5 The whole plant was dried and died

(172) The tolerance level of A. thaliana transformants (T.sub.3) introduced with CyPPO10 mutant genes (F360I or A167L+F360M) or CyPPO13 mutant genes (A177L+F373L or A177L+F373I) was confirmed at the 7.sup.th day after treating tiafenacil, saflufenacil, flumioxazin, or sulfentrazone (50 μM each). For comparison, A. thaliana wild type or A. thaliana PPO1 SLYM (AtPPO1 SLYM, S305L+Y426M) transformants (T.sub.3) known for PPO-inhibiting herbicide tolerance was tested as the same condition.

(173) In the tolerance experiment with various herbicides, 100 ml of 50 μM concentration of each herbicide was evenly sprayed per a 40×60 cm area (0.24 m.sup.2). The molecular weight (MW) of tiafenacil, saflufenacil, flumioxazin and sulfentrazone is 511.87, 500.85, 354.34 and 387.18, respectively. The converted treatment dosages correspond to 106.7 g ai/ha of tiafenacil, 104.4 g ai/ha of saflufenacil, 73.8 g ai/ha of flumioxazin and 80.7 g ai/ha of sulfentrazone.

(174) The result was shown in FIGS. 33a and 33b.

(175) In addition, the injury level (Injury index) of transformants was shown in FIG. 33 and Table 17 as numerical index.

(176) TABLE-US-00018 TABLE 17 T3 Injury Index (injury level) Cy10 FI AtPPO1 SLYM Cy10 ALFM Tiafenacil 1 4 1 Saflufenacil 0 0-1 0-1 Flumioxazin 0-1 4-5 1 Sulfentrazone 0-1 0-1 1

(177) In FIG. 33a and Table 17, Cy10 FI, AtPPO1 SLYM, Cy10 ALFM represented the transformants of CyPPO10 F360I, S305L+Y426M of AtPPO1 (control), and CyPPO10 A167L+F360M, respectively.

(178) In FIG. 33b, Col-0, Cy13 ALFL and Cy13 ALFI represented the wild type, transformants of CyPPO13 A177L+F373L and CyPPO13 A177L+F373I, respectively.

(179) As shown in FIG. 33a, transformants of mutant gene have equal or more tolerance than AtPPO1 SLYM. It was demonstrated that all of CyPPO10 FI and CyPPO10 ALFM conferred higher level of tolerance to various herbicides compared to the AtPPO1 SLYM.

(180) As shown in Table 14 and FIG. 8, almost all of the transformants with CyPPO10 wild type, its variant genes, CyPPO13 wild type, or its variant genes grew after 1 μM tiafenacil treatment while wild type A. thaliana (Col-0) died.

(181) In addition, as shown in Table 15 and 17, FIGS. 9 to 10, and FIGS. 32 to 33, CyPPO10 or CyPPO13 variant gene-introduced A. thaliana transformants exhibited no or weak level of damage after over 5 μM of tiafenacil treatment. The result showed that herbicide tolerance of A. thaliana was conferred and/or enhanced by introduction of CyPPO10, CyPPO13, or their mutant gene.

(182) It was demonstrated that herbicide tolerance was maintained T.sub.2 to T.sub.3 generations, which indicates that herbicide tolerance was stably transferred even if generation progresses.

(183) From this result, the CyPPO variants are expected to give various PPO-inhibition herbicide tolerances to other plants as well as A. thaliana.

(184) 7-5. Confirmation of Transgene Stability During Generation Passage

(185) In this Example, whether introduced genes in A. thaliana were stably inherited during generations was confirmed.

(186) T.sub.3 lines 7-2, 10-2, and 10-5 transformant transformed with CyPPO10 F360I were further developed to T.sub.4, T.sub.5 generation, and thereby tiafenacil or saflufenacil tolerance and the expression of introduced genes in T.sub.4 and T.sub.5 generations of each line were confirmed.

(187) Protein Extraction

(188) Proteins were extracted from plants of each generation. After grinding seedling using liquid nitrogen, protein extraction buffer (0.05 M Tris-Cl pH7.5, 0.1 M NaCl, 0.01 M EDTA, 1% Triton X-100, 1 mM DTT) was added and the total protein was extracted. After the extracted protein was transferred to PVDF membrane following electrophoresis, western blotting was conducted using anti-HA antibody (Santacruz).

(189) Confirmation of Herbicide Tolerance

(190) One hundred milliliters of herbicide solution containing 15 μM of tiafenacil or 150 μM of saflufenacil were evenly sprayed in the 40×60 cm area (0.24 m.sup.2) to A. thaliana 4 weeks after transplanting. The herbicide injury level was observed at the 7.sup.th day after the treatment.

(191) The result of herbicide tolerance was shown in FIG. 34 (T.sub.4) and FIG. 35 (T.sub.5), and the injury level (Injury index) of transformants by herbicides was shown in Table 18.

(192) TABLE-US-00019 TABLE 18 T.sub.4 and T.sub.5 Injury Index (injury level) CyPPO10 F360I T.sub.4 T.sub.5 Tiafenacil 0.5 0.5 Saflufenacil 0 1

(193) While the negative control (Col-0; A. thaliana wild type) was susceptible to the herbicides treatment, T.sub.4 and T.sub.5 A. thaliana transformants of CyPPO10 F360I were tolerant.

(194) In addition, the western blotting analysis for transgene expression was shown in FIG. 36. The CyPPO10 F360I protein was detected only in all T.sub.4 and T.sub.5 generations of transformants Therefore it was demonstrated that herbicide tolerance by introduction of

(195) CyPPO10 variants was stably inherited and maintained through T.sub.4 and T.sub.5 generations.

Example 8. Construction of Soybean Transformants Using CyPPO and its Variants and PPO-Inhibiting Herbicide Tolerance Test

(196) 8-1. A Recombinant Vector for Soybean Transformation and Construction of Soybean Transformants Using the Same

(197) A vector for soybean plant transformation to confer tiafenacil tolerance by expressing CyPPO10 A167L+F360M gene was constructed.

(198) Specifically, the CyPPO10 A167L+F360M gene combined with the transit peptide of A. thaliana PPO1 gene was amplified by PCR using the vector used for A. thaliana transformation (refer to FIG. 6) as a template. The amplified product was cloned using pENTR Directional TOPO cloning kits (Invitrogen), and transformed to DH5 alpha competent cell (Invitrogen). Then, the cloned gene was moved to a vector, pB2GW7.0 binary vector (FIG. 37) for plant transformation, using Gateway LR Clonase II Enzyme Mix (Invitrogen) kit. After mixing pENTR/D-TOPO vector in which CyPPO10 A167L+F360M gene was cloned, TE buffer, and LR Clonase II enzyme mix, it was incubated at 25° C. for 1 hr. After Proteinase K solution (Invitrogen) was added to the reaction mixture, it was incubated for 10 minutes at 37° C., and transformed to DH5 alpha competent cell.

(199) Agrobacterium EHA105 was electro-transformed with the binary vector constructed as above.

(200) Kwangan soybean plants were used for the construction of soybean transformants

(201) After removing seed coat from soybean seed, hypocotyl was cut and wounded 7-8 times by surgical scalpel (#11 blade). Approximately 50 pieces of explants were mixed with transformed A. tumefaciens EHA105 (Hood et al., New Agrobacterium helper plasmids for gene transfer to plants (EHA105). Trans Res. 1993 2:208-218), and the mixture was sonicated for 20 seconds and then incubated for 30 minutes for inoculation. It was placed on CCM (Co-cultivation media; 0.32 g/L Gamborg B5, 4.26 g/L MES, 30 g/L sucrose, 0.7% agar). Then, it was co-cultured in a growth chamber (25° C., 18 h light/6 h dark) for 5 days.

(202) After that, it was washed for 10 minutes in liquid ½ SIM (shoot induction media; 3.2 g/L Gamborg B5, 1.67 mg/L BA, 3 mM MES, 0.8% (w/v) agar, 3% (w/v) sucrose, 250 mg/L cefotaxime, 50 mg/L vancomycin, 100 mg/L ticarcillin, pH 5.6) and was placed on SIM without antibiotics and cultured in the growth chamber (25° C., 18 h light/6 h dark) for 2 weeks.

(203) The shoot-induced explants were transplanted on SIM-1 (SIM media supplemented with 10 mg/L DL-phosphinothricin, pH 5.6).

(204) The browned shoots were transplanted on SEM (shoot elongation media; 4.4 g/L MS salt, 3 mM MES, 0.5 mg/L GA3, 50 mg/L Asparagine, 100 mg/L pyroglutamic acid, 0.1 mg/L IAA, 1 mg/L zeatin, 3% (w/v) sucrose, 0.8% (w/v) agar, 250 mg/L cefotaxime, 50 mg/L vancomycin, 100 mg/L ticarcillin, 5 mg/L DL-phosphinothricin, pH 5.6). The elongated shoots over height 4 cm were transferred on RIM (root induction medium; 4.4 g/L MS salt, 3 mM MES, 3% sucrose, 0.8% Agar, 50 mg/L cefotaxime, 50 mg/L vancomycin, 50 mg/L ticarcillin, 25 mg/L asparagine, 25 mg/L pyroglutamic acid, pH 5.6).

(205) When the roots grew sufficiently, the plants were moved to bed soil (Bioplug No. 2, Farmhannong) mixed with vermiculite in 2:1 (v/v). After 10 days, leaves were painted with 100 mg/L DL-phosphinothricin.

(206) 8-2. Verification of Herbicide Tolerance of Transformed Soybeans

(207) Five micromolar or 15 μM of tiafenacil was painted to the leaves of lines No. 2 of CyPPO10 A167L+F360M transformed soybean (T.sub.0 generation) and non-transformed soybean (Kwangan; wild type soybean, control) 2-3 times with a brush. tiafenacil solution contains 0.05% (v/v) Silwet L-77 as a surfactant.

(208) As shown in FIG. 38, Kwangan (non-transformed soybean) exhibited severe damage 7 days after 5 μM tiafenacil treatment, but CyPPO10 A167L+F360M transformed soybean showed no damage even after the treatment of 15 μM tiafenacil.

(209) Meanwhile, tiafenacil or saflufenacil was treated to T.sub.1 generation of CyPPO10 A167L+F360M transformant line No. 2 at the stage of V2-3. The 100 ml of 25 μM tiafenacil or 150 μM saflufenacil was evenly sprayed on the area of 40×60 cm (0.24 m.sup.2), and the damage level was evaluated 5 days after spray.

(210) In FIG. 40, Kwangan soybean was used as a control. Compared to control, CyPPO10 A167L+F360M (10ALFM) transformant soybean showed no damage even after the treatment of a relatively high concentration of tiafenacil or saflufenacil.

(211) 8-3. Confirmation of the Number of Inserted Genes in Transformed Soybeans

(212) The genomic DNA was extracted in 250 mg of leaf tissues of CyPPO10 A167L+F360M transformed lines No. 2 or No. 23, to analyze the copy number of the transgene.

(213) The genomic DNA was extracted using CTAB buffer method. After grinding leaf tissues using a pestle and a mortar in liquid nitrogen, 1.25 ml of DNA isolation buffer (2% (w/v) CTAB, 1.5 M NaCl, 25 mM EDTA, 0.2% (v/v) beta-mercaptoethanol, 100 mM Tris-Cl (pH 8.0)) was added and vortexed. After heating at 60° C. for 1 hour, 1 volume of chloroform:isoamyl alcohol (24:1) was added and mixed by inverting. After centrifugation at 7000×g for 10 minutes at 4° C., supernatant was transferred to a new tube, and 2.5 volume of ethanol was mixed. After centrifugation at 5000×g for 5 minutes at 4° C., supernatant was discarded and the pellet was dissolved with TE buffer (LPSS). After adding 20 μg/ml RNase A (Bioneer), it was incubated at 37° C. for 30 minutes. After adding 1 volume of phenol:chloroform (1:1), it was mixed and centrifuged at 10,000×g for 10 minutes at 4° C. Supernatant was transferred to a new tube, and then 1 volume chloroform:isoamyl alcohol (24:1) was added and mixed. After centrifugation at 10,000×g for 10 minutes at 4° C., supernatant was transferred to a new tube and 0.1 volume of NaOAc (pH 5.2) and 2 volume of ethanol were added and mixed. After centrifugation at 5,000×g for 5 minutes at 4° C., it was washed with 70% ethanol. After air dry, genomic DNA was dissolved with an appropriate amount of TE buffer.

(214) The 10˜40 μg of extracted DNA was digested overnight using EcoRI (Enzynomics).

(215) Then, after 0.8% (w/v) Agarose gel electrophoresis (50 V), gel was treated as follows:

(216) 1) depurination: 0.25 N HCl, 15 min shaking

(217) 2) denaturation: 0.5 M NaOH, 1.5 M NaCl, 30 min shaking

(218) 3) neutralization: 0.5 M Tris(pH 7.5), 1.5 M NaCl, 20 min shaking

(219) Thereafter, DNA fragments were moved to nitrocellulose membrane using a capillary transfer method, cross linking was performed using UV Crosslinker (UVC-508; ULTRA LUM Inc.).

(220) Hybridization was performed by the following method: The nitrocellulose membrane was dipped in DIG Easyhybridization solution (Roche), and incubated at 42° C. for 3 hrs. Then, the solution was discarded, substituted with a fresh DIG Easyhybridization solution with DIG-labelled probe, and incubated for 16-18 hours at 42° C.

(221) The probe (DIG-labeled CyPPO8-M probe) was labelled by PCR reaction as follows:

(222) Probe PCR

(223) The DIG-labeled bar gene was amplified using DIG dUTP (Jena bioscience), and the primers used then were as follows:

(224) TABLE-US-00020 Forward primer for bar probe: (SEQ ID NO: 124) 5′- TTC CGT ACC GAG CCG CAG GA-3′ Reverse primer for bar probe: (SEQ ID NO: 125) 5′- CGT TGG GCA GCC CGA TGA CA-3′

(225) PCR: Using Solgent e-Taq Kit

(226) Conditions: 95° C. for 5 min, 35 cycles of 94° C. for 30 sec, 60° C. for 30 sec, and 72° C. for 30 sec, and 72° C. for 2 min

(227) After hybridization, membrane was washed in low stringency washing buffer (2×SSC, 0.1% SDS) and high stringency washing buffer (0.5×SSC, 0.1% SDS). Southern blotting signal was detected as follows:

(228) 1) shaking for 30 minutes after adding blocking buffer (Roche) to the membrane

(229) 2) shaking for 30 minutes after adding DIG antibody (anti-digoxigenin-AP Fab fragments, Roche)

(230) 3) shaking for 15 minutes in washing buffer (Roche)

(231) 4) shaking for 3 minutes after adding detection buffer (Roche)

(232) 5) After applying CDP-Star (Roche) on the membrane, developing the blot on x-ray film.

(233) For a negative control, the genomic DNA of non-transformed Kwangan soybean plants was used for southern blotting.

(234) In FIG. 39, the number of bands shown on the film means the number of transgenes. Since one band was observed in CyPPO10 A167L+F360M transformant line No. 2 or No. 23 lines, it was determined that each transgenic plant had a single copy transgene.

Example 9: Activity Test of Mutated Genes Having Sequence Homology to PPO Variant

(235) Error-prone PCR was conducted under the following conditions using CyPPO plasmid (pACBB vector) as a template, thereby inducing random mutations in CyPPO:

(236) TABLE-US-00021 Template 0.5 μl 10X buffer 5 μl 10 mM MnCl.sub.2 1.5 μl dNTP 5 μl e-Taq(Solgent Inc.) 1 μl forward primer (100 μM) 0.5 μl reverse primer (100 μM) 0.5 μl DDW 36 μl total 50 μl

(237) 10× buffer: 100 mM Tris-Cl, pH8.3; 500 mM KCl, 70 mM MgCl.sub.2, 0.1% (w/v) gelatin

(238) dNTP: 10 mM dATP, 10 mM dGTP, 100 mM dCTP, 100 mM dTTP

(239) 94° C. 3 min; (94° C. 30 sec, 57° C. 30 sec, 72° C. 1.5 min, 72° C. 5 min) 35 cycles

(240) Primer Sequences:

(241) TABLE-US-00022 CyPPO10_BamHI F (SEQ ID NO: 126) ccccggatccATGATTGAAGTGGATGTGGCTA CyPPO10_XhoI R (SEQ ID NO: 127) ccccctcgagTGATTGTCCACCAGCGAGGTAAG CyPPO13_BamHI F (SEQ ID NO: 128) ccccggatccATGAACCCTGCTACCCCTGAAC CyPPO13_XhoI R (SEQ ID NO: 129) ccccctcgagCACCTGTGATAACAACTGCTGAG

(242) The obtained error-prone PCR product was electrophoresed in agarose gel and then cleaned up from gel, and pACBB vector and PCR product were digested by BamHI and XhoI restriction enzymes. The digested vector and PCR product electrophoresed in agarose gel were cleaned up, and ligation was conducted. Ligation product was transformed into BT3 competent cell, and mutated CyPPO genes from growing BT3 colonies were sequenced. BT3 confirmed to have mutated CyPPO genes were spotted on LB plate comprising various concentrations (0 μM, 50 μM, 100 μM, and 200 μM) of tiafenacil or saflufenacil, thereby investigating the growth of E. coli, and testing the level of herbicide tolerance.

(243) Among the mutated clones, a clone having the following mutations was used for this herbicide tolerance test:

(244) CyPPO10m-6: comprising 9 amino acid mutations (E225G, G258S, Q266L, T336I, V356F, F360M, A364D, R406G, W419R); nucleic acid sequence—SEQ ID NO: 130, amino acid sequence—SEQ ID NO: 131 (98% sequence homology to the amino acid sequence of wild type CyPPO10)

(245) BT3 cells transformed with the mutant genes of CyPPO10 were cultured in herbicide-contained medium, and cell growth inhibition was measured. In FIG. 41, ‘AtPPO1 WY refers to wild type PPO1 of A. thaliana,’ AtPPO1 SLYM′ to mutant PPO1 (Y426M+S305L) of A. thaliana, ‘CyPPO10 WT’ to wild type CyPPO10, and ‘CyPPO10m-6’ to mutated CyPPO10 as described above, respectively.

(246) As shown in FIG. 41, the cells transformed with the CyPPO10 mutants having the sequence homology of 98% or higher to that of the wild type CyPPO10 display cell viability similar to that of cells with wild type CyPPO10, even the case in the medium containing high concentration (up to 200 μM) of tiafenacil or saflufenacil. This result demonstrates that the CyPPO10 mutants having the sequence homology of 98% or higher can retain herbicide tolerance (viability in herbicide containing media) of the wild type.