Composition for treating or sensitizing interferon beta resistant cancer disease comprising cFLIP siRNA

Abstract

The present invention relates to a composition for treating or sensitizing interferon beta resistant cancer disease comprising cFLIP siRNA, and, more specifically, to a pharmaceutical composition for treating interferon beta resistant cancer disease, comprising, as an active ingredient: (a) an siRNA complementarily binding to mRNA of a cFLIP gene; and (b) a human interferon beta variant which comprises glycine-asparagine-isoleucine-treonine-valine sequence (GNITV) at C-terminus in a human natural interferon beta amino acid sequence shown in SEQ ID NO: 1, or has replaced the 27.sup.th arginine amino acid with threonine or serine, and to a composition for sensitizing interferon beta resistant cancer cells comprising cFLIP siRNA as an active ingredient. The composition of the present invention can be effectively used to develop an anticancer agent or anticancer adjuvant having a new mechanism to promote apoptosis and effectively sensitize cells for treatment, by lowering an expression level of cFLIP proteins in a cancer showing resistance to interferon beta or a cancer becoming resistant to interferon beta.

Claims

1. A composition comprising, as active ingredients: (a) siRNA which binds to mRNA of cFLIP gene in a complementary manner; and (b) a human interferon-beta mutant which comprises a glycine-asparagine-isoleucine-threonine-valine (GNITV) sequence at the C-terminus or in which threonine or serine is substituted for arginine at the 27th amino acid, in a wild-type human interferon-beta amino acid sequence defined by SEQ ID NO: 1, wherein the interferon-beta mutant is a fusion protein comprises any one amino acid sequence selected from the group consisting of SEQ ID NO: 18 to SEQ ID NO: 21.

2. The composition of claim 1, wherein the mRNA of the cFLIP gene comprises any one nucleotide sequence selected from the group consisting of SEQ ID NO: 7 and SEQ ID NO: 8.

3. The composition of claim 1, wherein the siRNA comprises any one nucleotide sequence selected from the group consisting of SEQ ID NO: 9 to SEQ ID NO: 13.

4. A method for treating an interferon-beta-resistant cancer disease, wherein the cancer is ovarian or gastric cancer the method comprising administering an effective amount of a composition to a subject in need thereof, wherein the composition comprises, as active ingredients: (a) siRNA which binds to mRNA of cFLIP gene in a complementary manner; and (b) a human interferon-beta mutant which comprises a glycine-asparagine-isoleucine-threonine-valine (GNITV) sequence at the C-terminus or in which threonine or serine is substituted for arginine at the 27th amino acid, in a wild-type human interferon-beta amino acid sequence defined by SEQ ID NO: 1, wherein the interferon-beta mutant comprises any one amino acid sequence selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 6 and SEQ ID NO: 18 to SEQ ID NO: 21, wherein the siRNA comprises any one nucleotide sequence selected from the group consisting of SEQ ID NO: 9 to SEQ ID NO: 13.

5. A method for sensitizing interferon-beta-resistant cancer cells, wherein the cells are ovarian or gastric cancer cells the method comprising administering to a subject in need thereof an effective amount of a composition comprising, as an active ingredient, siRNA which binds to mRNA of cFLIP gene in a complementary manner, wherein the siRNA comprises any one nucleotide sequence selected from the group consisting of SEQ ID NO: 9 to SEQ ID NO: 13, wherein the composition is administered simultaneously or sequentially with an interferon-beta mutant which comprises any one amino acid sequence selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 6 and SEQ ID NO: 18 to SEQ ID NO: 21.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows test results confirming the effects of Carbiferon in OVCAR-3 cell line as IFNβ-responsive cancer cells.

(2) FIG. 1A shows cell viability (bar graph; upper panel) and microscopic cell images (lower panel) according to the concentration and treatment time of Carbiferon. FIG. 1B shows qPCR results confirming the effects of Carbiferon (100 ng/ml) on the expression levels of death receptor-related genes. FIG. 1C shows western blot results confirming the effects of Carbiferon (100 ng/ml) on the expression levels of death receptor-related genes.

(3) FIG. 2 shows test results confirming the effects of Carbiferon in HeLa cell line as IFNβ-nonreponsive cancer cells.

(4) FIG. 2A shows cell viability (bar graph; upper panel) and microscopic cell images (lower panel) according to the concentration and treatment time of Carbiferon. FIG. 2B shows qPCR results confirming the effects of Carbiferon (100 ng/ml) on the expression levels of death receptor-related genes. FIG. 2C shows western blot results confirming the effects of Carbiferon (100 ng/ml) on the expression levels of death receptor-related genes.

(5) FIG. 3 shows test results confirming the changes in expression levels of cFLIP by Carbiferon (100 ng/ml) in IFNβ-responsive or -nonresponsive cancer cells.

(6) FIG. 3A shows western blot results of OVCAR-3 cell line, while FIG. 3B shows western blot results of HeLa cell line.

(7) FIG. 4 shows test results confirming the effect of the inhibition of cFLIP gene expression on the anticancer effect of Carbiferon in HeLa cell line.

(8) FIG. 4A shows the effect of cFLIP siRNA (a total of 10 nM) having mixed four types of nucleotide sequences on cell viability. FIG. 4B shows western blot results confirming the effect of the mixed cFLIP siRNA on caspase-8 levels.

(9) FIG. 5 shows a siRNA design for inhibiting the expression of cFLIP gene.

(10) FIG. 5A is a schematic diagram showing siRNA target sites for inhibiting the expression of both cFLIP long form (cFLIP.sub.L) and short form (cFLIP.sub.S). FIG. 5B shows nucleotide sequences of corresponding siRNA.

(11) FIG. 6 shows test results confirming cFLIP siRNA expression inhibitory ability in HeLa cell line.

(12) FIG. 6A shows western blot results showing cFLIP protein levels, which were observed after treatment with each type of siRNA (10 nM) for 48 hours. FIG. 6B shows qPCR results confirming the cFLIP mRNA level after treatment with each type of siRNA (20 nM) for 48 hours. The siRNAs marked by blue dotted lines represent primarily selected siRNAs. NC means negative control siRNA.

(13) FIG. 7 shows test results confirming the effects of primarily selected siRNAs in HeLa cell line.

(14) FIG. 7A shows cell viability in the treatment with corresponding siRNAs (10 nM) alone. FIG. 7B shows cell viability in the co-treatment with corresponding siRNAs (10 nM) and Carbiferon (100 ng/ml). The siRNAs marked by blue dotted lines represent secondarily selected siRNAs. NC means negative control siRNA.

(15) FIG. 8 shows test results confirming the effects of administration of secondarily selected siRNAs (10 nM) alone or together with an anticancer drug on cell viability in various cancer cell lines.

(16) FIG. 8A shows the results in SK-OV-3 cell line as ovarian cancer cells; FIG. 8B shows the results in SNU-216 cell line as gastric cancer cells; and FIG. 8C shows the results in NCI-N487 cell line as gastric cancer cells. NC means negative control siRNA. ACFP, which is an antibody-cytokine fusion protein, means a fusion protein in which Carbiferon is fused to a terminus of the heavy chain of Herceptin.

MODE FOR CARRYING OUT THE INVENTION

(17) Hereinafter, the present invention will be described in detail.

(18) However, the following examples are merely for illustrating the present invention and are not intended to limit the scope of the present invention.

Example 1

Differential Effects of Carbiferon According to IFNβ Resistance of Cancer Cells

(19) The anticancer effect of Carbiferon (R27T or the like) was compared in IFNβ-responsive cancer cells and IFNβ-nonresponsive resistant cancer cells (FIGS. 1 and 2).

(20) In order to investigate the cytotoxicity of Carbiferon, OVCAR-3 cells (1×10.sup.4 cells/well) or HeLa cells (5×10.sup.3 cells/well) were dispensed in each well of a 96-well plate, and then incubated at 37.5° C. in a 5% CO.sub.2 atmosphere for 24 hours. After 24 hours, the cell culture was removed, and the cells were treated with Carbiferon at concentrations of 10-1000 ng/ml, and then incubated for 24-72 hours. Thereafter, the culture was removed, followed by washing three times with PBS. WST reagent diluted to 1:10 was added at 100 μl per well, and then the cells were left at 37.5° C. in a 5% CO.sub.2 atmosphere for 2 hours. The absorbance was measured at a wavelength of 430 nm.

(21) TABLE-US-00001 TABLE 1 Primers used in qPCR Forward Reverse DR4 gggtccacaagaccttcaagt tgcagctgagctaggtacga (SEQ ID NO: 22) (SEQ ID NO: 23) DR5 agacccttgtgctcgttgtc ttgttgggtgatcagagcag (SEQ ID NO: 24) (SEQ ID NO: 25) FASL cagtccaccccctgaaaaa ggaccttgagttggacttgc (SEQ ID NO: 26) (SEQ ID NO: 27) FAS atggccaattctgccataag tgactgtgcagtccctagctt (SEQ ID NO: 28) (SEQ ID NO: 29) TNF-α gacaagcctgtagcccatgt tctcagctccacgccatt (SEQ ID NO: 30) (SEQ ID NO: 31) Trail cctccagagagtagcagctcaca cagagccttttcattcttgga (SEQ ID NO: 32) (SEQ ID NO: 33)

(22) For the measurement of gene expression, OVCAR-3 or HeLa cells were treated with Carbiferon at a concentration of 100 ng/ml, and then incubated for 24-72 hours. Thereafter, the culture was removed, and PBS wash was carried out three times. The cells were collected, and then Trizol was utilized to extract RNA, on the basis of which cDNA was then synthesized. Thereafter, qPCR utilizing Tagman probe was performed using the synthesized cDNA as a template. Primer nucleotide sequences used in qPCR are shown in Table 1.

(23) In order to investigate the expression patterns of death receptor signaling molecules by Carbiferon, OVCAR-3 or HeLa cell line was treated with 100 ng/ml Carbiferon, and then incubated in the same manner as described above. The cell culture was washed three times with PBS, treated with 100 μl of RIPA buffer containing a protease inhibitor and a phosphatase inhibitor, and placed on ice for 30 minutes to lyse cells. The lysed cells were placed in a 1.5-mL tube, and centrifuged at 13,000 rpm at 4° C. Then, only the supernatant (lysate) was taken, and collected in a new tube. The concentrations of proteins of the lysate were quantified by BCA assay, and then 30 μg of the lysate was taken, mixed with 5× sample buffer, and boiled at 100° C. for 10 minutes to induce sufficient protein denaturation. The prepared sample, together with a marker, was loaded onto a 10% SDS-PAGE gel, and was allowed to flow out at 70 V for 30 minutes and 120 V for 1 hour. Thereafter, the gel was carefully separated, and placed on 3M paper, and then a polyvinylidene difluoride (PVDF) membrane was disposed thereon, and again covered with 3M paper. Thereafter, the membrane was immersed in 1× transfer buffer, followed by protein transfer at 100 V for 90 minutes. The membrane was blocked in tris-buffered saline-Tween 20 (TBS-T, 0.1% Tween 20) containing 5% BSA for 1 hour and 30 minutes, and then each antibody was prepared by dilution at 1:1000 in TBS-T. The membrane was immersed in the antibody diluted solution, followed by incubation with shaking at room temperature for 2 hours. After this procedure, the membrane was washed three times with TBS-T for 10 minutes, and a horseradish peroxidase (HRP)-conjugated secondary antibody was added thereto, followed by reaction for 1 hour. The membrane was again washed, treated with an enhanced chemiluminescence (ECL, Intron) reagent, and then developed on films. In FIG. 1C, FIG. 2C, and FIG. 3, Lane 1 represents a control, and Lanes 2, 3, and 4 represent 24 hour-, 48 hour-, and 72 hour-Carbiferon 100 ng/ml treatment groups, respectively.

(24) As a result of investigating cell viability after OVCAR-3 cell line as IFNβ-responsive cancer cells was treated with Carbiferon as an IFNβ mutant at concentrations of 1, 10, 100, or 1000 ng/ml, and then incubated for 24-72 hours, it was observed that the cell viability of the OVCAR-3 cells significantly decreased dependent on the concentration of Carbiferon and with a longer incubation time (FIG. 1A). In addition, as a result of investigating the expression levels of DR4, DR5, FASL, FAS, TNF-α, and TRAIL involved in death receptor signaling, which is important in cell apoptosis, through qPCR (FIG. 1B) and western blot (FIG. 1C), their expression levels were significantly increased.

(25) In contrast, as a result of investigating the effects of Carbiferon when HeLa cell line as IFNβ-nonresponsive and resistant cancer cells was incubated in the same manner, it was observed that the cell viability was not significantly changed even at the highest concentration (FIG. 2A), but the death receptor signaling-related genes showed increased expression even in the HeLa cell line (FIG. 2B and FIG. 2C).

(26) Meanwhile, as a result of investigating the expression of cFLIP, which is a protein inhibiting cell apoptosis, in IFNβ-responsive OVCAR-3 cell line and IFNβ-nonresponsive HeLa cell line, it was observed that the level of the cFLIP proteins was increased only in HeLa cell line stimulated with Carbiferon (100 ng/ml) (FIG. 3). These results suggest that the inhibition of cFLIP protein expression may be used as a sensitizer for the treatment of an IFNβ-nonresponsive cancer disease.

Example 2

Effect of cFLIP Expression Inhibition on the Activity of Carbiferon

(27) The effect of the inhibition of cFLIP protein expression on the anticancer effect of Carbiferon in cancer cells was investigated using cFLIP siRNA (FIG. 4).

(28) In order to investigate the improvement in cytotoxic ability of Carbiferon by cFLIP inhibition, 1×10.sup.4 cells/well of HeLa cells were dispensed in a 24-well plate, and incubated at 37.5° C. in a 5% CO.sub.2 atmosphere for 24 hours. After 24 hours, the cell culture was removed, and then 10 nM cFLIP siRNA (Dharmacon, cat #LU-003772-00-0002) was mixed with Dharmafect transfection reagent, and the cells were treated with the mixture after the incubation at room temperature for 15 minutes. After 24-hour treatment, the culture was removed, and the cells were treated with 100 ng/ml of Carbiferon, and additionally incubated for 48 hours. Thereafter, the culture was removed, followed by washing three times with PBS, and then cell viability was measured (FIG. 4A) or protein expression was checked (FIG. 4B).

(29) In order to measure cell viability, WST reagent was mixed with the culture at 1:10, and then each well was treated with the mixture, and incubated at 37.5° C. in a 5% CO.sub.2 atmosphere for 2 hours. The absorbance was measured at a wavelength of 430 nm.

(30) For western blot for investigating protein expression, each well was treated with 100 μl of RIPA buffer containing a protease inhibitor and a phosphatase inhibitor, and placed on ice for 30 minutes to lyse cells. The lysed cells were placed in a 1.5-mL tube, and centrifuged at 13,000 rpm at 4° C., and then only the supernatant (lysate) was taken, and collected in a new tube. The concentrations of proteins of the lysate were quantified by BCA assay, and then 30 μg of the lysate was taken, mixed with 5× sample buffer, and boiled at 100° C. for 10 minutes to induce sufficient protein denaturation. The prepared sample, together with a marker, was loaded onto a 10% SDS-PAGE gel, and was subjected to electrophoresis at 70 V for 30 minutes and 120 V for 1 hour. Thereafter, the gel was carefully separated, and placed on 3M paper, and then a polyvinylidene difluoride (PVDF) membrane was disposed thereon, and again covered with 3M paper. Thereafter, the membrane was immersed in 1× transfer buffer, followed by protein transfer at 100 V for 90 minutes. The membrane was blocked in tris-buffered saline-Tween 20 (TBS-T, 0.1% Tween 20) containing 5% BSA for 1 hour and 30 minutes, and then each antibody was prepared by dilution at 1:1000 in TBS-T. The membrane was immersed in the antibody diluted solution, followed by reaction with shaking at room temperature for 2 hours. After this procedure, the membrane was washed three times with TBS-T for 10 minutes, and a horseradish peroxidase (HRP)-conjugated secondary antibody was added thereto, followed by reaction at room temperature for 1 hour. The membrane was again washed, treated with an enhanced chemiluminescence (ECL, Intron) reagent, and then developed on films. In FIG. 4B, Lane 1 represents a control, Lane 2 represents a Carbiferon alone treatment group, Lane 3 represents siRNA alone treatment group, and Lane 4 represents a Carbiferon and cFLIP siRNA co-treatment group.

(31) The IFNβ mutant, Carbiferon, activates death receptor signaling systems in cancer cells, resulting in causing cell apoptosis by caspase-3. In order to inhibit the expression of cFLIP protein, four types of cFLIP siRNA on the market (Dharmacon, cat #LU-003772-00-0002) were mixed, and HeLa cells were treated with the mixture. Then, cell viability was measured in the presence or absence of Carbiferon (FIG. 4A). It was confirmed through western blot that the expression of both long-form cFLIP and short-form cFLIP was almost completely inhibited by cFLIP siRNA (FIG. 4B, cFLIPL and cFLIPS). As a result, the cell viability in the treatment with only Carbiferon (100 ng/ml) or only cFLIP siRNA (10 nM) was insignificantly different from that of the control group, but the cell viability in the co-treatment with Carbiferon and cFLIP siRNA was reduced by about 50% compared with that of the control group. In addition, western blot results confirmed the presence of activated cleaved caspase-8, which is important in cell apoptosis, only in the co-treatment group with Carbiferon and cFLIP siRNA. The results above indicate that the inhibition of cFLIP expression by cFLIP siRNA can effectively promote cell apoptosis by Carbiferon in IFNβ-nonresponsive cells.

Example 3

Selection of cFLIP siRNA for Sensitizing IFNβ-Resistant Cancer Cells

(32) An optimal siRNA for sensitizing cell apoptotic effects of IFNβ or Carbiferon in IFNβ-nonresponsive cancer cells was designed and selected.

(33) Since long-form cFLIP and short-form cFLIP execute the same functions with respect to cell apoptosis, siRNA capable of inhibiting the expression of both two types of cFLIP is most preferable, and therefore the locations and sequences of suitable target sequences of cFLIP were determined (FIG. 5). First, seven types of siRNA were selected using siDirect version 2.0 program, and two types of siRNA on the market were additionally included (Dharmacon).

(34) In order to investigate cFLIP inhibitory ability of the designed cFLIP siRNA, HeLa cells were dispensed, and incubated at 37.5° C. in a 5% CO.sub.2 environment for 24 hours. After 24 hours, the cell culture was removed, and 10 nM siRNA was mixed with Dharmafect transfection reagent, and the cells were treated with the mixture after the incubation at room temperature for 15 minutes. After 48 hours, the culture was removed, and western blot was performed by the same method as in the foregoing example. In FIG. 6A, Lane 1 represents Mock, Lane 2 represents negative control siRNA (NC siRNA), and Lanes 3 to 11 represent designed cFLIP siRNA treatment groups. Trizol was utilized to extract RNA from the cells, which were obtained by transformation with 20 nM siRNA and incubation in the same manner, and then cDNA was synthesized on the basis of the extracted RNA. In addition, qPCR utilizing Tagman probe was performed using the synthesized cDNA as a template (FIG. 6B).

(35) HeLa cell line as IFNβ-nonresponsive cells were treated with the selected siRNAs for 48 hours, and then protein levels of cFLIP long form (cFLIP.sub.L) and cFLIP short form (cFLIP.sub.S) were investigated by western blot (FIG. 6A). The cFLIP.sub.L and cFLIP.sub.S proteins were not detected in all of the cells treated with nine (9) types of siRNA as targets of analysis. In addition, it was observed that the cFLIP mRNA levels measured by qPCR were reduced by about 50% or more in the cells treated with siRNAs compared with the control group. The five types of siRNA, D-513, 211, 262, 404, and 480, which were confirmed to have excellent cFLIP expression inhibitory ability on the basis of qPCR and western blot results, were primarily selected.

(36) The effect of the primarily selected cFLIP siRNAs on cell apoptotic effects of Carbiferon was further investigated using HeLa cell line. First, in order to investigate the effect of each siRNA on cell apoptosis, the cells were treated with each siRNA alone without Carbiferon, and cell viability was measured in the same manner as in the foregoing example (FIG. 7A). HeLa cells were inoculated on a plate, treated with siRNA (final concentration: 10 nM) after 24 hours, and subjected to WST assay after additional 24 hours. As a result, it was observed that cell viability was decreased, and thus even siRNA alone showed cytotoxicity, that is, a cell apoptosis inducing effect.

(37) Next, the effect of co-treatment with cFLIP siRNA and Carbiferon was investigated (FIG. 7B). HeLa cell line was treated with siRNA (final concentration: 10 nM) 24 hours after inoculation, and treated with Carbiferon (100 ng/ml) after additional 24 hours, and then cell viability after 24 hours was measured. It was observed that the co-treatment with Carbiferon and siRNA had a synergistic effect in lowering the cell viability of the HeLa cell line compared with the treatment with only siRNA. Out of the siRNAs analyzed for the effects of the co-treatment with Carbiferon, 404 cFLIP siRNA and 480 cFLIP siRNA, which had the best effects, were secondarily selected.

Example 4

Effect of Co-Treatment with cFLIP siRNA and Carbiferon in Various Cancer Cell Lines

(38) The sensitization effect of the finally selected 404 cFLIP siRNA and 480 cFLIP siRNA on IFNβ-nonreponsive cancer cells was investigated using various cancer cell lines (FIG. 8).

(39) In order to investigate cell apoptotic ability by co-treatment of the selected cFLIP siRNAs together and Carbiferon or ACFP, SK-OV-3, SNU-216, and NCI-N87 cells were dispensed at 1×10.sup.4 cells/well in a 24-well plate, and incubated at 37.5° C. in a 5% CO.sub.2 environment for 24 hours. ACFP is a fusion protein in which Carbiferon (R27T) is fused to a terminus of the heavy chain of Herceptin. After 24 hours, the cell culture was removed, and 10 nM siRNA was mixed with Dharmafect transfection reagent, and the cells were treated with the mixture after the incubation at room temperature for 15 minutes. After 24-hour treatment, the culture was removed, and the cells were treated with 100 ng/ml of Carbiferon, ACFP, and Herceptin and additionally incubated for 48 hours. Thereafter, the culture was removed, followed by washing three times with PBS. Then, WST reagent was mixed with the culture at 1:10, and each well were treated with the mixture, and incubated at 37.5° C. in a 5% CO.sub.2 atmosphere for 2 hours. The absorbance was measured at a wavelength of 430 nm. The cell lines used in the present example were confirmed that they do not respond to IFNβ at all (SNU-216) or have very low sensitivity to IFNβ (SK-OV-3 or NCI-N87), in comparison with cells normally responding to IFNβ (Data not shown).

(40) The effects of cFLIP siRNAs in SK-OV-3 cell line as ovarian cancer cells (FIG. 8A), SNU-216 cell line as gastric cancer cells (FIG. 8B), and NCI-N87 cell line as gastric cancer cells (FIG. 8C) were investigated by measuring cell viability. In cases where the cells were not treated with siRNA, ACFP, which is a fusion protein in which Carbiferon and Herceptin are bound, was more effective in reducing cancer cell viability than Herceptin alone. Furthermore, it was observed that the cell apoptotic effects of ACFP and Carbiferon were further enhanced when the cells were treated with cFLIP siRNA and ACPF or Carbiferon.

INDUSTRIAL APPLICATION

(41) As set forth above, the composition of the present invention can be favorably used to develop a novel mechanism of anticancer drug or adjuvant, which attains an effective sensitization and treatment by lowering the expression levels of cFLIP proteins in cancers showing resistance to interferon-beta or cancers having resistance to interferon-beta, thereby effectively sensitizing cancer.