Plants and methods for increasing and decreasing synthesis of cannabinoids
11466283 · 2022-10-11
Assignee
Inventors
Cpc classification
C12N15/8243
CHEMISTRY; METALLURGY
C12N15/8213
CHEMISTRY; METALLURGY
International classification
Abstract
This disclosure relates to new plants and methods for increasing and decreasing synthesis of cannabinoids. The plants disclosed herein comprise unnatural ratios and concentrations of cannabinoids in plants of genus Cannabis. The methods disclosed herein comprise manipulating the biosynthetic pathway of cannabinoids to produce plants of genus Cannabis with unnatural ratios and concentrations of cannabinoids.
Claims
1. A plant of genus Cannabis, comprising: a total cannabinoid content; a modified genetic material within a genome of the plant of the genus Cannabis, wherein the modified genetic material comprises: a modified cannabidiolic acid (CBDA) synthase-encoding gene having a cut in the CBDA synthase-coding sequence, wherein the cut inhibits functionality of the CBDA synthase; a modified tetrahydrocannabinolic acid (THCA) synthase-encoding gene having a cut in the THCA synthase-coding sequence, wherein the cut inhibits functionality of the THCA synthase; and is obtained by SEQ ID NO: 6; and an increased cannabigerolic acid (CBGA) content relative to a control plant of the genus Cannabis that does not comprise the modified genetic material.
2. A method of producing the plant of genus Cannabis of claim 1, the method comprising: introducing the nucleotide sequence of SEQ ID NO: 6 into the plant.
3. The method of claim 2, wherein the method comprises introducing an RNA guide.
4. The method of claim 3, wherein the method comprises a CRISPR/Cas9 system.
Description
EXAMPLES
Example 1
(1) General considerations for the controlled synthesis of a cannabinoid in Cannabis sp. plants was accomplished via a multi-branched pathway. Enzymatic processes are responsible for each of the single branches. If the plant only produces a subset of these enzymes or gene products, the present multi-branched pathway may be specified for a single preferred synthesis product.
Example 2
(2) Disclosed herein is an illustrative example of enhancing the production of CBGA as the single cannabinoid of interest within a plant of genus Cannabis. The synthesis of CBGA in Cannabis sp. plants takes place at an intermediate step in the process of synthesizing THCA, CBDA, and/or CBCA. CBGA specifically serves as substrate that is utilized by specific cannabinoid synthesis enzymes, e.g., THCA-synthase, CBDA-synthase, and CBCA-synthase. These enzymes are efficient in converting CBGA into terminal products. Therefore, CBGA is never present in abundance when these enzymes are present.
(3) To enhance the production of CBGA, genomic editing techniques were used to reduce/eliminate the amount of functional cannabinoid synthesis enzymes produced within the plant. An alignment was made using mRNA sequences for THCA synthase, CBDA synthase, and CBCA synthase to find a CRISPR target sequence. These genes share significant amounts of sequence homology meaning a well-made alignment can cut the genes producing these enzymes simultaneously.
(4) When the sequence homology site was identified, an RNA expression cassette was designed in silico and developed as a synthetic dsDNA construct. The RNA expression construct consisted of a constitutive Pol III promoter (Arabidopsis thaliana U6) driving expression of a sgRNA molecule containing the target of interest.
(5) The synthetic dsDNA construct was ligated into an Agrobacterium plant transfection vector plasmid containing a second expression cassette. The second expression cassette confers expression of a eukaryotic codon optimized version of SpCas9 protein. The expression of SpCas9 is accomplished via a constitutively active CaMV35s promoter.
(6) The ligated plasmid containing both expression cassettes was transformed into E. coli and plated.
(7) Single colonies were isolated and grown for subsequent extraction via minipreparation of plasmid DNA. The plasmid isolated from this procedure was checked via sequencing, PCR, and gel electrophoresis. A single plasmid sample was isolated and checked. The plasmid was transformed into Agrobacterium tumefaciens. Single colonies were isolated. The Agrobacterium strain harbors a disarmed Ti plasmid that confers the virulence function during Agrobacterium mediated plant transfection. Selection for both plasmids was performed with two antibiotics, one relevant to each plasmid. Colonies were doubly selected this way were grown to quantities required for plant inoculation with dual antibiotic treatment on LB media.
Example 3
(8) Disclosed herein is an illustrative example of inoculation on a small scale with a bacteria or vector made by the dual antibiotic treatment made in Example 2.
(9) Agrobacterium cells were collected from plates via scraping and suspended into inoculation media. The cells were resuspended to a target density of 0.02-0.5 OD.sub.600. The inoculation fluid consisted of ¼ MS plant media, ½ AB salts (17.2 mM K.sub.2HPO.sub.4, 8.3 mM NaH.sub.2PO.sub.4, 18.7 mM NH.sub.4Cl, 2 mM KCl), 0.3% sucrose, and 50 mM MES, 200 uM Acetosyringone at a pH of about 5.5. The cells were cultured in this inoculation mix for 2-6 hours at room temperature prior to plant inoculation.
(10) Cuttings or newly rooted clones of Cannabis sativa were submerged upside down in the Agrobacterium inoculation mixture and placed in a vacuum chamber. A light vacuum of −5 Hg was applied to the submerged plants for 30 seconds and the vacuum was slowly released. The treated plants were either rooted via rooting hormone or simply grown if already rooted. The adult plants were scored for chemical composition weeks later.
(11) The plants that resulted from these processes were intended to act both as production plants as well as vegetative propagation material for subsequent growth cycles.
Example 4
(12) Disclosed herein is an illustrative example of inoculation on a large scale with a bacteria or vector made by the dual antibiotic treatment made in Example 2.
(13) Adequate quantities of transformed Agrobacterium cells were grown on plates and harvested via scraping to produce 30 L of inoculation fluid at a density 0.02-0.1 OD.sub.600. The inoculation fluid consisted of deionized water with an adjusted pH of 5.5. Nursery flats with 60-70 plants each were supported via a magnetic metal rack in a steel vacuum chamber containing the inoculation fluid. The top ⅔rds of each plant was submerged in the inoculation fluid. A vacuum (−5 in Hg for 30 seconds) was applied to the chamber. The plants were removed from the vacuum chamber and grown in greenhouses for 1-2 weeks prior to planting outside in a commercial field. Chemical analysis was performed on these plants to score the effectiveness of the treatment.
(14) The plants that resulted from these processes were intended to act both as production plants as well as vegetative propagation material for subsequent growth cycles.
Example 5
(15) Disclosed herein is an illustrative example of modularity of enhancement protocol. The previous examples provide methods of how CBGA production can be enhanced in Cannabis plants. The same methodology with a different CRISPR cut site, alternate gene knockout, or knockdown procedure, can result in enhancing any cannabinoid of interest. For example: reducing only CBDA-synthase would result in more THCA and CBCA being produced, likewise reducing only THCA-synthase produces more CBDA and CBCA, and reducing THCA-synthase and CBD-synthase at the same time would boost the levels of CBCA and CBGA that are produced. Finally, by targeting other steps in the synthesis pathway such as the genes that are responsible for the prenylation, cyclization or polyketide synthesis steps; many other cannabinoids can be specified for enhanced production such as THCVA, CBDVA, CBCVA, CBGVA, etc.
(16) The above illustrative examples for CBGA enhancement is used to demonstrate a general method of this that can be applied to enhancing cannabinoid production for other cannabinoids disclosed herein in plants of genus Cannabis.
Example 6
(17) Disclosed herein is an illustrative example of growing plants of genus Cannabis with increased CBD production.
(18) A collection of plants (60,000) targeting enhanced production of CBD was created using the methodology described above in Example 4. The enhanced (i.e., modified) plants of genus Cannabis were grown on a 200-acre hemp farm in the eastern Colorado area, where they were evenly dispersed within a collection of natural, non-enhanced plants (control), with all of the plants exposed to identical growing conditions.
(19) To assess the differences between the enhanced plants and the control plants, cuttings from the plants top shoots were taken at random from 16 enhanced plants, which were evenly dispersed across the hemp farm. The CBD levels were measured for these 16 enhanced plants by extracting the plant cuttings with isopropanol, filtering away the insoluble plant material, and analyzing the extract via analytical SFC.
(20) The results showed that the CBD production in the enhanced plants were approximately doubled vis-a-vis the CBD production in the non-enhanced control plants, whereas the total potency of the enhanced plants remained unchanged.
Example 7
(21) Disclosed herein is an illustrative example of growing plants of genus Cannabis with increased CBG production.
(22) A collection of plants (30,000-40,000) targeting enhanced production of CBG was created using the methodology describe above in Example 4. The enhanced (i.e., modified) plants were grown on a 30-acre hemp farm in the eastern Colorado area, where they were evenly dispersed within a collection of natural, non-enhanced plants (control), with all of the plants exposed to identical growing conditions.
(23) To assess the differences between the enhanced plants and the control plants, cuttings from the plants top shoots were taken at random from 16 enhanced plants, which were evenly dispersed across the hemp farm. The CBG levels were measured for these 16 enhanced plants by extracting the plant cuttings with isopropanol, filtering away the insoluble plant material, and analyzing the extract via analytical SFC.
(24) The results showed that the CBG production in the enhanced plants of genus Cannabis were approximately doubled vis-a-vis the CBG production in the non-enhanced control plants of genus Cannabis, whereas the total potency of the enhanced plants remained unchanged.
Example 8
(25) Disclosed herein is one illustrative example of THCA synthase and CBDA synthase double CRISPR cut via homology for insertion into a vector, called the “Ebbu” vector.
(26) Below is an illustrative example for the design of a sgRNA molecule for cutting both THCA and CBDA synthase coding sequence. A single cut was used based on high levels of homology between the genes. The position was at 452 bp in reverse compliment orientation, at the end of PAM sequence from the start codon based on current working alignment of the THCA and CBDA synthases.
(27) Original grab from aln. for RevComp. (CCN) site
(28) TABLE-US-00001 (SEQ ID NO: 1) GCCGGAGCTA CCCTTGGAGA AGTTTATTAT TGGG
Annotation of Above:
(29) TABLE-US-00002 (SEQ ID NO: 2) PAMrc: CCG; GAGCTACCCTTGGAGAAGTT TATTATTGGG (SEQ ID NO: 3) SumRevC: CCGGAGCTACCCTTGGAGAAGTT (SEQ ID NO: 4) SumInCutOrient: AACTTCTCCAAGGGTAGCTCCGG
Annotation of Correct Orientation: gRNA PAM
(30) TABLE-US-00003 (SEQ ID NO: 4) AACTTCTCCAAGGGTAGCTC CGG
The Following Sequence was Added to the CRISPR Cassette:
(31) TABLE-US-00004 (SEQ ID NO: 5) AACTTCTCCAAGGGTAGCTC
NCBI BLAST OK/No: Yes, No Other Genes with Homology.
Sequence for Assembly:
(32) TABLE-US-00005 (SEQ ID NO: 6) CACAATTCCACACAACATACGAGCCCTTTTTTTCTTCTTCTTCGTTCATA CAGTTTTTTTTTGTTTATCAGCTTACATTTTCTTGAACCGTAGCTTTCGT TTTCTTCTTTTTAACTTTCCATTCGGAGTTTTTGTATCTTGTTTCATAGT TTGTCCCAGGATTAGAATGATTAGGCATCGAACCTTCAAGAATTTGATTG AATAAAACATCTTCATTCTTAAGATATGAAGATAATCTTCAAAAGGCCCC TGGGAATCTGAAAGAAGAGAAGCAGGCCCATTTATATGGGAAAGAACAAT AGTATTTCTTATATAGGCCCATTTAAGTTGAAAACAATCTTCAAAAGTCC CACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATACAGCTAGAGTC GAAGTAGTGATTGAACTTCTCCAAGGGTAGCTCGTTTTAGAGCTAGAAAT AGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTA AGCGGAGAATTAAGGGAGTCACG
(33) Although the present invention herein has been described with reference to various exemplary embodiments, it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention. Those having skill in the art would recognize that various modifications to the exemplary embodiments may be made, without departing from the scope of the invention.
(34) Moreover, it should be understood that various features and/or characteristics of different embodiments herein may be combined with one another. It is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the scope of the invention.
(35) Furthermore, other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a scope and spirit being indicated by the claims.
(36) Finally, it is noted that, as used in this specification and the appended claims, the singular forms “a,” “an,” and “the,” include plural referents unless expressly and unequivocally limited to one referent, and vice versa. As used herein, the term “include” or “comprising” and its grammatical variants are intended to be non-limiting, such that recitation of an item or items is not to the exclusion of other like items that can be substituted or added to the recited item(s).