COMPOSITIONS AND METHODS FOR DETECTING RARE SEQUENCE VARIANTS

20250290136 ยท 2025-09-18

    Inventors

    Cpc classification

    International classification

    Abstract

    In some aspects, the present disclosure provides methods for identifying sequence variants in a nucleic acid sample. In some embodiments, a method comprises identifying sequence differences between sequencing reads and a reference sequence, and calling a sequence difference that occurs in at least two different circular polynucleotides, such as two circular polynucleotides having different junctions, as the sequence variant. In some aspects, the present disclosure provides compositions and systems useful in the described methods.

    Claims

    1-52. (canceled)

    53. A method of distinguishing a sequence variant from an error in a nucleic acid sample comprising a plurality of cell-free deoxyribonucleic acid (DNA) polynucleotides, each cell-free DNA polynucleotide of the plurality having a 5 end and a 3 end, the method comprising: (a) denaturing the plurality of cell-free DNA polynucleotides into a plurality of cell-free single-stranded DNA (ssDNA) polynucleotides; (b) joining an adapter polynucleotide to a 5 end, a 3 end, or both a 5 end and a 3 end of each of the cell-free ssDNA polynucleotides; (c) circularizing individual cell-free ssDNA polynucleotides of the plurality to form a plurality of circular ssDNA polynucleotides; (d) amplifying the circular ssDNA polynucleotides of (c) to produce a plurality of concatemers; (e) sequencing the amplified polynucleotides to produce a plurality of sequencing reads; and (f) identifying a sequence difference between sequencing reads and a reference sequence as the sequence variant only when the sequence difference occurs in at least two copies of the circular ssDNA polynucleotide in the concatemers and not when the sequence difference occurs in only one copy of the circular ssDNA polynucleotide in the concatemers distinguishing the sequence variant from the error.

    54. The method of claim 53, wherein at least a portion of the sequence of the adapter polynucleotide is known.

    55. The method of claim 53, wherein the adapter polynucleotide is a ssDNA polynucleotide or a labeled nucleotide.

    56. The method of claim 53, wherein an identical adapter polynucleotide is joined to both the 5 end and the 3 end of each of the cell-free ssDNA polynucleotides.

    57. The method of claim 53, wherein different adapter polynucleotides are joined to the 5 end and the 3 end of each of the cell-free ssDNA polynucleotides.

    58. The method of claim 53, wherein the adapter polynucleotide is used as a sequencing primer.

    59. The method of claim 53, wherein the circularizing is effected by subjecting the cell-free ssDNA polynucleotides to a ligation reaction using a ligase.

    60. The method of claim 59, wherein ligation is effected by a ligase, and the method further comprises degrading the ligase prior to the amplifying of (d).

    61. The method of claim 53, wherein the sequence variant is a single nucleotide polymorphism.

    62. The method of claim 53, wherein the reference sequence is a consensus sequence formed by aligning the sequencing reads with one another.

    63. The method of claim 53, wherein the reference sequence is a known reference sequence.

    64. The method of claim 53, wherein (d) comprises performing a primer extension reaction selected from the group consisting of, reverse transcription, polymerase chain reaction, isothermal amplification, and combinations thereof.

    65. The method of claim 53, wherein the amplifying is effected by using a polymerase having strand-displacement activity.

    66. The method of claim 53, wherein the amplifying comprises subjecting the circular polynucleotide to an amplification reaction mixture comprising random primers.

    67. The method of claim 53, wherein the amplifying comprises subjecting the circular polynucleotide to an amplification reaction mixture comprising one or more primers, each of which specifically hybridizes to a different target sequence via sequence complementarity.

    68. The method of claim 53, wherein the concatemers are subjected to the sequencing step without enrichment.

    69. The method of claim 53, further comprising performing an enrichment on the concatemers or derivatives thereof to enrich one or more target polynucleotides.

    70. The method of claim 69, wherein the enrichment comprises amplifying a target sequence comprising sequence A and sequence B oriented in a 5 to 3 direction in an amplification reaction mixture, the reaction mixture comprising: (a) the concatemers; (b) a first primer comprising sequence A, wherein the first primer specifically hybridizes to sequence A of the target sequence via sequence complementarity between sequence A and sequence A; (c) a second primer comprising sequence B, wherein the second primer specifically hybridizes to sequence B present in a complementary polynucleotide comprising a complement of the target sequence via sequence complementarity between B and B; and (d) a polymerase that extends the first primer and the second primer to produce amplified polynucleotides; wherein the distance between a 5 end of sequence A and a 3 end of sequence B of the target sequence is 75 nt or less; and wherein sequence A and sequence B are present in the cell-free polynucleotide.

    71. The method of claim 53, wherein the cell-free polynucleotide comprises cell-free tumor DNA.

    72. The method of claim 53, wherein identifying the sequence difference is performed by a computer system based on the sequencing reads and the reference sequence.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0021] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

    [0022] FIG. 1 depicts the schematic of one embodiment of methods according to the present disclosure. DNA strands are circularized and target specific primers corresponding to genes under investigation are added, along with polymerase, dNTPs, buffers, etc., such that rolling circle amplification (RCA) occurs to form concatamers (e.g. multimers) of the template DNA (e.g. a monomer). The concatamers are treated to synthesize the corresponding complementary strand, and then adapters are added to make sequencing libraries. This resulting library, which is then sequenced using standard technologies, will generally contain three species: nDNA (normal DNA) that does not contain a rare sequence variant (e.g. a mutation); nDNA that contains enzymatic sequencing errors, and DNA that contains multimers of real or actual sequence variants that were pre-existing in the sample polynucleotides before amplification. The presence of multiple copies of the effectively rare mutation allows the detection and identification of the sequence variant.

    [0023] FIG. 2 depicts a similar strategy as FIG. 1 but with the addition of adapters to facilitate polynucleotide circularization. FIG. 2 also shows the use of target specific primers.

    [0024] FIG. 3 is similar to FIG. 2 except adapter primers are used in amplification.

    [0025] FIG. 4 depicts three embodiments associated with the formation of circularized ccDNA. At the top, single-stranded DNA (ssDNA) is circularized in the absence of adapters, while the middle scheme depicts the use of adapters, and the bottom scheme utilizes two adapter oligos (yielding different sequences on each end) and may further include a splint oligo that hybridizes to both adapters to bring the two ends in proximity.

    [0026] FIG. 5 depicts an embodiment for circularizing specific targets through the use of a molecular clamp to bring the two ends of the single stranded DNA into spatial proximity for ligation.

    [0027] FIGS. 6A and 6B depict two schemes for the addition of adapters using blocked ends of the nucleic acids.

    [0028] FIGS. 7A, 7B, and 7C depict three different ways to prime a rolling circle amplification (RCA) reaction. FIG. 7A shows the use of target specific primers, e.g. the particular target genes or target sequences of interest. This generally results in only target sequences being amplified. FIG. 7B depicts the use of random primers to perform whole genome amplification (WGA), which will generally amplify all sample sequences, which then are bioinformatically sorted out during processing. FIG. 7C depicts the use of adapter primers when adapters are used, also resulting in general non-target-specific amplification.

    [0029] FIG. 8 depicts an example of double stranded DNA circularization and amplification, such that both strands are amplified, in accordance with an embodiment.

    [0030] FIGS. 9A, 9B, 9C, and 9D depict a variety of schemes to achieve complementary strand synthesis for subsequent sequencing. FIG. 9A depicts the use of random priming of the target strand, followed by ligation. FIG. 9B depicts the use of adapter priming of the target strand, similarly followed by ligation. FIG. 9C depicts the use of a loop adapter, wherein the adapter has two sections of sequences that are complementary, such that they hybridize with each other to create a loop (e.g. stem-loop structures). Upon ligation to the end of the concatamer, the free end of the loop serves as the primer for the complementary strand. FIG. 9D shows the use of hyper-branching random primers to achieve second strand synthesis.

    [0031] FIG. 10 shows a PCR method in accordance with an embodiment that promotes sequencing of circular polynucleotides or strands containing at least two copies of a target nucleic acid sequence, using a pair of primers that are oriented away from one another when aligned within a monomer of the target sequence (also referred to as back to back, e.g. oriented in two directions but not on the ends of the domain to be amplified). In some embodiments, these primer sets are used after concatamers are formed to promote amplicons to be higher multimers, e.g. dimers, trimers, etc., of the target sequence. Optionally, the method can further include a size selection to remove amplicons that are smaller than dimers.

    [0032] FIG. 11 depicts an embodiment in which back to back (B2B) primers are used with a touch up PCR step, such that amplification of short products (such as monomers) are less favored. In this case, the primers have two domains; a first domain that hybridizes to the target sequence (grey or black arrow) and a second domain that is a universal primer binding domain (bent rectangles; also sometimes referred to as an adapter) which does not hybridize to the original target sequence. In some embodiments, the first rounds of PCR are done with a low temperature annealing step, such that gene specific sequences bind. The low temperature run results in PCR products of various lengths, including short products. After a low number of rounds, the annealing temperature is raised, such that hybridization of the entire primer, both domains, is favored; as depicted these are found at the ends of the templates, while internal binding is less stable. Shorter products are thus less favored at the higher temperature with both domains than at the lower temperature or only a single domain.

    [0033] FIGS. 12A and 12B depict two different methods of sequencing library construction. FIG. 12A illustrates an example of the Illumina Nextera sample preparation system, by which DNA can be simultaneously fragmented and tagged with sequencing adapters in a single step. In FIG. 12B, concatemers are fragmented by sonication, followed by adding adapters to both ends (e.g. by use of kits by KAPA Biosystems), and PCR amplification. Other methods are available.

    [0034] FIGS. 13A-C provide an illustration of example advantages of back-to-back (B2B) primer design compared to traditional PCR primer design. Traditional PCR primer design (left) places the primers (arrows, A and B) in the region flanking a target sequence, which may be a hotspot for mutations (black stars), and they are typically at least 60 base pairs (bp) apart, resulting a typical footprint of about 100 bp. In this illustration, the B2B primer design (right) places primers on one side of the target sequence. The two B2B primers are facing to the opposite direction, any may overlap (e.g. about or less than about 12 bp, 10 bp, 5 bp, or less). Depending on B2B primer lengths, the total footprint in this illustration can be between 28-50 bp. Due to the larger footprint, fragmentation events are more likely to disrupt primer binding in the traditional design, leading to loss of sequence information, whether for linear fragments (13A), circularized DNA (13B), or amplification products (13C). Moreover, as illustrated in FIG. 13C, the B2B primer design captures junction sequences (also referred to as a natural barcode) which can be used to distinguish different polynucleotides.

    [0035] FIG. 14 Illustrates a method for generating templates for detecting sequence variants, in accordance with an embodiment (e.g. an example implementation of a process using circularized polynucleotides, also referred to herein as Nebula). DNA input is denatured into ssDNA, circularized by ligation, and non-circularized DNA is degraded by exonuclease digestion. Ligation efficiency is quantified by quantitative PCR (qPCR), comparing input DNA and circularized DNA amounts, typically yielding a ligation efficiency of at least about 80%. Circularized DNA is purified to exchange buffer, followed by whole genome amplification (WGA) with random primers and Phi29 polymerase. WGA products are purified, and products are fragmented (e.g. by sonication) into short fragments of about or less than about 400 bp. The on-target rate of amplified DNA is quantified by qPRC comparing the same amount of reference genome DNA to amplified DNA, typically showing an average on-target rate of about or more than about 95%.

    [0036] FIGS. 15A-C illustrate a further implementation of amplification with tailed B2B primers, and implementing a touch up second phase of PCR at a higher temperature. The B2B primers contain a sequence-specific region (thick black line) and an adapter sequence (open box). With a lower, phase-one annealing temperature, the target-specific sequence anneals to the template to yield an initial monomer, and PCR products contain tandem repeats (as shown in FIG. 15A). In a second amplification phase at a higher temperature, both target-specific and adapter sequence hybridization is favored over target-specific sequence hybridizing alone, decreasing the degree to which short products are preferentially produced (as shown in FIG. 15B). Without favoring the whole primer, internal annealing with the target-specific sequences rapidly increases the fraction of monomers (as shown in FIG. 15C, left).

    [0037] FIG. 16 illustrates a comparison between the background noise (frequency of variants) detected by target sequencing methods using a Q30 filter with (bottom line) and without (top line) requiring that a sequence difference occur on two different polynucleotides (e.g. identified by different junctions) to be counted as a variant. Application of this validation filter is also referred to herein as Firefly. Human genomic DNA (12878, Coriell Institute) was fragmented to 100-200 bp, and included a 2% spike-in of genomic DNA (19240, Coriell Institute) containing a known SNP (CYP2C19). The true variant signal (marked peak) was not significantly above background (top, light grey plot). Background noise was decreased to about 0.1 by applying the validation filter (lower, black plot).

    [0038] FIG. 17 illustrates detection of sequence variants spiked in at various low frequencies in the population of polynucleotides (2%, 0.2%, and 0.02%), which are nonetheless significantly above background, when applying a method of the disclosure.

    [0039] FIG. 18 illustrates results of an analysis of ligation efficiency and on-target rate of an embodiment of the disclosure.

    [0040] FIG. 19 illustrates the preservation of allele frequencies, and substantial absence of bias, in a method in accordance with an embodiment of the disclosure.

    [0041] FIG. 20 illustrates results for detection of sequence variants in a small input sample, in accordance with an embodiment.

    [0042] FIG. 21 illustrates an example of high background in results for detection of sequence variants obtained without requiring that a sequence difference occur on two different polynucleotides, according to standard sequencing methods.

    [0043] FIG. 22 provides graphs illustrating comparisons between GC content distributions of the genome and GC content distributions of sequencing results produced in accordance with a method in accordance with an embodiment of the disclosure (Nebula-Firefly; left), sequencing results using an alternative sequencing library construction kit (Rubicon, Rubicon Genomics; middle), and cell-free DNA (cfDNA) generally as reported in the literature for 32ng (right).

    [0044] FIG. 23 provides a graph illustrating the size distribution of input DNA obtained from sequencing reads of a method in accordance with an embodiment.

    [0045] FIG. 24 provides a graph illustrating uniform amplification across multiple targets by a random-priming method in accordance with an embodiment.

    [0046] FIGS. 25A and 25B illustrate embodiments for the formation of polynucleotide multimers having identifiable junctions, in the absence of circularization. Polynucleotides (such as polynucleotide fragments, or cell-free DNA) are joined to form multimers having non-natural junctions useful in distinguishing independent polynucleotides in accordance with embodiments of the disclosure (also referred to herein as auto-tag). In FIG. 25A, polynucleotides are joined directly to one another by blunt-end ligation. In FIG. 25B, polynucleotides are joined via one or more intervening adapter oligonucleotides, which may further comprise a barcode sequence. Multimers are then subjected to amplification by any of a variety of methods, such as by random primers (whole genome amplification), adapter primers, or one or more target specific primers or primer pairs. Processes for the formation of multimers having identifiable junctions from a plurality of separate polynucleotides is also referred to herein as Eclipse.

    [0047] FIG. 26 illustrates an example variation on the process FIGS. 25A and 25B. Polynucleotides (e.g. cfDNA, or other polynucleotide fragments) are end-repaired, A-tailed, and adapter ligated (e.g. using a standard kit, such as kits by KAPA Biosystems). Carrier DNA labeled with internal uracil (U) can be supplemented to raise total DNA input to desired levels (e.g. to about or more than about 20ng). A sequence variant to be detected is indicated by a star. When ligation is complete, carrier DNA can be degraded by addition of Uracil-Specific Excision Reagent (USER) enzyme, which is a mixture of Uracil DNA glycosylase (UDG) and the DNA glycosylase-lyase Endonuclease VIII.

    [0048] Products are purified to eliminate fragments of carrier DNA. Purified products are amplified (e.g. by PCR, using primers directed to adapter sequences). Any residual carrier DNA is not likely to be amplified due to degradation, and separation from an adapter on at least one end. Amplified products can be purified to remove short DNA fragments.

    [0049] FIG. 27 illustrates an example variation on the process of FIGS. 25A and 25B. Target specific amplification primers comprise a common 5 tail that functions as an adapter (grey arrow). Initial amplification (e.g. by PCR) proceeds for a few cycles (e.g. at least about 5, 10, or more cycles). PCR products can serve as primers as well, annealing to other PCR products (e.g. when annealing temperature is reduced in a second phase) to produce concatemers having identifiable junctions. The second phase can comprise a number of cycles (e.g. 5, 10, 15, 20, or more cycles), and may include a selection or variation of conditions that favor concatemer formation and amplification. Methods according to this schematic are also referred to as Relay Amp Seq, which may find particular use in a comparmentalized setting (e.g. in a droplet).

    [0050] FIGS. 28A-E illustrate non-limiting examples of methods for circularizing polynucleotides. In FIG. 28A, double-stranded polynucleotides (e.g. dsDNA) is denatured into single-strands, followed by direct circularization (e.g. self-joining ligation by CircLigase). In FIG. 28B, polynucleotides (e.g. DNA fragments) are end-repaired and A-tailed (adding single-based extension of adenosine to 3 ends) to improve ligation efficiency, followed by denaturation to single-strands, and circularization. In FIG. 28C, polynucleotides are end-repaired and A-tailed (if double-stranded), joined to adapters having a thymidine (T) extension, denatured into single-strands, and circularized. In FIG. 28D, polynucleotides are end-repaired and A-tailed (if double-stranded), both ends are ligated to an adapter having three elements (T extension for ligation, complementarity between adapters, and a 3 tail), strands are denatured, and single-stranded polynucleotides are circularized (facilitated by complementarity between the adapter sequences). In FIG. 28E, double-stranded polynucleotides are denatured to single-stranded form, and circularized in the presence of a molecular clamp that brings the ends of the polynucleotide closer together to facilitate joining.

    [0051] FIG. 29 illustrates an example workflow design of an amplification system for identifying sequence variants in accordance with methods of the disclosure, particularly with regard to circularized polynucleotides.

    [0052] FIG. 30 illustrates an example workflow design of an amplification system for identifying sequence variants in accordance with methods of the disclosure, particularly with regard to linear polynucleotide inputs without a circularization step.

    [0053] FIG. 31 provides a summary illustration of example workflows for identifying sequence variants in accordance with methods of the disclosure. Along the Eclipse (linear polynucleotide analysis) branch, analysis may include digital PCR (e.g. digital droplet PCR, ddPCR), real-time PCR, enrichment by probe capture (capture seq) with analysis of junction sequences (auto tag), sequencing based on inserted adapter sequences (barcoded insertion), or Relay Amp sequencing. Along the Nebula (circularized polynucleotide analysis), analysis may include digital PCR (e.g. digital droplet PCR, ddPCR), real-time PCR, enrichment by probe capture (capture seq) with analysis of junction sequences (natural barcode), enrichment by probe capture or targeted amplification (e.g. B2B amplification), and sequence analysis with a validation step of identifying a sequence variant as a difference occurring in two different polynucleotides (e.g. polynucleotides having different junctions).

    [0054] FIG. 32 is an illustration of a system according to an embodiment.

    [0055] FIG. 33 illustrates efficiency of the capture and the coverage along the target regions according to an example.>90% of the targeting bases are covered more than 20, and >50% of the targeted bases have>50 coverage.

    DETAILED DESCRIPTION OF THE INVENTION

    [0056] The practice of some embodiments disclosed herein employ, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See for example Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th Edition (2012); the series Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds.); the series Methods In Enzymology (Academic Press, Inc.), PCR 2: A Practical Approach (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual, and Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 6th Edition (R. I. Freshney, ed. (2010)).

    [0057] The term about or approximately means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, about can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, about can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term about meaning within an acceptable error range for the particular value should be assumed.

    [0058] The terms polynucleotide, nucleotide, nucleotide sequence, nucleic acid and oligonucleotide are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.

    [0059] In general, the term target polynucleotide refers to a nucleic acid molecule or polynucleotide in a starting population of nucleic acid molecules having a target sequence whose presence, amount, and/or nucleotide sequence, or changes in one or more of these, are desired to be determined. In general, the term target sequence refers to a nucleic acid sequence on a single strand of nucleic acid. The target sequence may be a portion of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA, miRNA, rRNA, or others. The target sequence may be a target sequence from a sample or a secondary target such as a product of an amplification reaction.

    [0060] In general, a nucleotide probe, probe, or tag oligonucleotide refers to a polynucleotide used for detecting or identifying its corresponding target polynucleotide in a hybridization reaction by hybridization with a corresponding target sequence. Thus, a nucleotide probe is hybridizable to one or more target polynucleotides. Tag oligonucleotides can be perfectly complementary to one or more target polynucleotides in a sample, or contain one or more nucleotides that are not complemented by a corresponding nucleotide in the one or more target polynucleotides in a sample.

    [0061] Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner according to base complementarity. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the enzymatic cleavage of a polynucleotide by an endonuclease. A second sequence that is complementary to a first sequence is referred to as the complement of the first sequence. The term hybridizable as applied to a polynucleotide refers to the ability of the polynucleotide to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues in a hybridization reaction.

    [0062] Complementarity refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. Substantially complementary as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions. Sequence identity, such as for the purpose of assessing percent complementarity, may be measured by any suitable alignment algorithm, including but not limited to the Needleman-Wunsch algorithm (see e.g. the EMBOSS Needle aligner available at www.ebi.ac.uk/Tools/psa/emboss_needle/nucleotide.html, optionally with default settings), the BLAST algorithm (see e.g. the BLAST alignment tool available at blast.ncbi.nlm.nih.gov/Blast.cgi, optionally with default settings), or the Smith-Waterman algorithm (see e.g. the EMBOSS Water aligner available at www.ebi.ac.uk/Tools/psa/emboss_water/nucleotide.html, optionally with default settings). Optimal alignment may be assessed using any suitable parameters of a chosen algorithm, including default parameters.

    [0063] In general, stringent conditions for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with a target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Technniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter Overview of principles of hybridization and the strategy of nucleic acid probe assay, Elsevier, N.Y.

    [0064] In one aspect, the disclosure provides a method of identifying a sequence variant, such as in a nucleic acid sample. In some embodiments, each polynucleotide of the plurality has a 5 end and a 3 end, and the method comprises: (a) circularizing individual polynucleotides of said plurality to form a plurality of circular polynucleotides, each of which having a junction between the 5 end and 3 end; (b) amplifying the circular polynucleotides of (a); (c) sequencing the amplified polynucleotides to produce a plurality of sequencing reads; (d) identifying sequence differences between sequencing reads and a reference sequence; and (e) calling a sequence difference that occurs in at least two circular polynucleotides having different junctions as the sequence variant. In some embodiments, the method comprises identifying sequence differences between sequencing reads and a reference sequence, and calling a sequence difference that occurs in at least two circular polynucleotides having different junctions as the sequence variant, wherein: (a) the sequencing reads correspond to amplification products of the at least two circular polynucleotides; and (b) each of the at least two circular polynucleotides comprises a different junction formed by ligating a 5end and 3end of the respective polynucleotides.

    [0065] In general, the term sequence variant refers to any variation in sequence relative to one or more reference sequences. Typically, the sequence variant occurs with a lower frequency than the reference sequence for a given population of individuals for whom the reference sequence is known. For example, a particular bacterial genus may have a consensus reference sequence for the 16S rRNA gene, but individual species within that genus may have one or more sequence variants within the gene (or a portion thereof) that are useful in identifying that species in a population of bacteria. As a further example, sequences for multiple individuals of the same species (or multiple sequencing reads for the same individual) may produce a consensus sequence when optimally aligned, and sequence variants with respect to that consensus may be used to identify mutants in the population indicative of dangerous contamination. In general, a consensus sequence refers to a nucleotide sequence that reflects the most common choice of base at each position in the sequence where the series of related nucleic acids has been subjected to intensive mathematical and/or sequence analysis, such as optimal sequence alignment according to any of a variety of sequence alignment algorithms. A variety of alignment algorithms are available, some of which are described herein. In some embodiments, the reference sequence is a single known reference sequence, such as the genomic sequence of a single individual. In some embodiments, the reference sequence is a consensus sequence formed by aligning multiple known sequences, such as the genomic sequence of multiple individuals serving as a reference population, or multiple sequencing reads of polynucleotides from the same individual. In some embodiments, the reference sequence is a consensus sequence formed by optimally aligning the sequences from a sample under analysis, such that a sequence variant represents a variation relative to corresponding sequences in the same sample. In some embodiments, the sequence variant occurs with a low frequency in the population (also referred to as a rare sequence variant). For example, the sequence variant may occur with a frequency of about or less than about 5%, 4%, 3%, 2%, 1.5%, 1%, 0.75%, 0.5%, 0.25%, 0.1%, 0.075%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.005%, 0.001%, or lower. In some embodiments, the sequence variant occurs with a frequency of about or less than about 0.1%.

    [0066] A sequence variant can be any variation with respect to a reference sequence. A sequence variation may consist of a change in, insertion of, or deletion of a single nucleotide, or of a plurality of nucleotides (e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides). Where a sequence variant comprises two or more nucleotide differences, the nucleotides that are different may be contiguous with one another, or discontinuous. Non-limiting examples of types of sequence variants include single nucleotide polymorphisms (SNP), deletion/insertion polymorphisms (DIP), copy number variants (CNV), short tandem repeats (STR), simple sequence repeats (SSR), variable number of tandem repeats (VNTR), amplified fragment length polymorphisms (AFLP), retrotransposon-based insertion polymorphisms, sequence specific amplified polymorphism, and differences in epigenetic marks that can be detected as sequence variants (e.g. methylation differences).

    [0067] Nucleic acid samples that may be subjected to methods described herein can be derived from any suitable source. In some embodiments, the samples used are environmental samples. Environmental sample may be from any environmental source, for example, naturally occurring or artificial atmosphere, water systems, soil, or any other sample of interest. In some embodiments, the environmental samples may be obtained from, for example, atmospheric pathogen collection systems, sub-surface sediments, groundwater, ancient water deep within the ground, plant root-soil interface of grassland, coastal water and sewage treatment plants.

    [0068] Polynucleotides from a sample may be any of a variety of polynucleotides, including but not limited to, DNA, RNA, ribosomal RNA (rRNA), transfer RNA (tRNA), micro RNA (miRNA), messenger RNA (mRNA), fragments of any of these, or combinations of any two or more of these. In some embodiments, samples comprise DNA. In some embodiments, samples comprise genomic DNA. In some embodiments, samples comprise mitochondrial DNA, chloroplast DNA, plasmid DNA, bacterial artificial chromosomes, yeast artificial chromosomes, oligonucleotide tags, or combinations thereof. In some embodiments, the samples comprise DNA generated by amplification, such as by primer extension reactions using any suitable combination of primers and a DNA polymerase, including but not limited to polymerase chain reaction (PCR), reverse transcription, and combinations thereof Where the template for the primer extension reaction is RNA, the product of reverse transcription is referred to as complementary DNA (cDNA). Primers useful in primer extension reactions can comprise sequences specific to one or more targets, random sequences, partially random sequences, and combinations thereof. In general, sample polynucleotides comprise any polynucleotide present in a sample, which may or may not include target polynucleotides. The polynucleotides may be single-stranded, double-stranded, or a combination of these. In some embodiments, polynucleotides subjected to a method of the disclosure are single-stranded polynucleotides, which may or may not be in the presence of double-stranded polynucleotides. In some embodiments, the polynucleotides are single-stranded DNA. Single-stranded DNA (ssDNA) may be ssDNA that is isolated in a single-stranded form, or DNA that is isolated in double-stranded form and subsequently made single-stranded for the purpose of one or more steps in a method of the disclosure.

    [0069] In some embodiments, polynucleotides are subjected to subsequent steps (e.g. circularization and amplification) without an extraction step, and/or without a purification step. For example, a fluid sample may be treated to remove cells without an extraction step to produce a purified liquid sample and a cell sample, followed by isolation of DNA from the purified fluid sample. A variety of procedures for isolation of polynucleotides are available, such as by precipitation or non-specific binding to a substrate followed by washing the substrate to release bound polynucleotides. Where polynucleotides are isolated from a sample without a cellular extraction step, polynucleotides will largely be extracellular or cell-free polynucleotides, which may correspond to dead or damaged cells. The identity of such cells may be used to characterize the cells or population of cells from which they are derived, such as tumor cells (e.g. in cancer detection), fetal cells (e.g. in prenatal diagnostic), cells from transplanted tissue (e.g. in early detection of transplant failure), or members of a microbial community.

    [0070] If a sample is treated to extract polynucleotides, such as from cells in a sample, a variety of extraction methods are available. For example, nucleic acids can be purified by organic extraction with phenol, phenol/chloroform/isoamyl alcohol, or similar formulations, including TRIzol and TriReagent. Other non-limiting examples of extraction techniques include: (1) organic extraction followed by ethanol precipitation, e.g., using a phenol/chloroform organic reagent (Ausubel et al., 1993), with or without the use of an automated nucleic acid extractor, e.g., the Model 341 DNA Extractor available from Applied Biosystems (Foster City, Calif); (2) stationary phase adsorption methods (U.S. Pat. No. 5,234,809; Walsh et al., 1991); and (3) salt-induced nucleic acid precipitation methods (Miller et al., (1988), such precipitation methods being typically referred to as salting-out methods. Another example of nucleic acid isolation and/or purification includes the use of magnetic particles to which nucleic acids can specifically or non-specifically bind, followed by isolation of the beads using a magnet, and washing and eluting the nucleic acids from the beads (see e.g. U.S. Pat. No. 5,705,628). In some embodiments, the above isolation methods may be preceded by an enzyme digestion step to help eliminate unwanted protein from the sample, e.g., digestion with proteinase K, or other like proteases. See, e.g., U.S. Pat. No. 7,001,724. If desired, RNase inhibitors may be added to the lysis buffer. For certain cell or sample types, it may be desirable to add a protein denaturation/digestion step to the protocol. Purification methods may be directed to isolate DNA, RNA, or both. When both DNA and RNA are isolated together during or subsequent to an extraction procedure, further steps may be employed to purify one or both separately from the other. Sub-fractions of extracted nucleic acids can also be generated, for example, purification by size, sequence, or other physical or chemical characteristic. In addition to an initial nucleic acid isolation step, purification of nucleic acids can be performed after any step in the disclosed methods, such as to remove excess or unwanted reagents, reactants, or products. A variety of methods for determining the amount and/or purity of nucleic acids in a sample are available, such as by absorbance (e.g. absorbance of light at 260 nm, 280 nm, and a ratio of these) and detection of a label (e.g. fluorescent dyes and intercalating agents, such as SYBR green, SYBR blue, DAPI, propidium iodine, Hoechst stain, SYBR gold, ethidium bromide).

    [0071] Where desired, polynucleotides from a sample may be fragmented prior to further processing. Fragmentation may be accomplished by any of a variety of methods, including chemical, enzymatic, and mechanical fragmentation. In some embodiments, the fragments have an average or median length from about 10 to about 1,000 nucleotides in length, such as between 10-800, 10-500, 50-500, 90-200, or 50-150 nucleotides. In some embodiments, the fragments have an average or median length of about or less than about 100, 200, 300, 500, 600, 800, 1000, or 1500 nucleotides. In some embodiments, the fragments range from about 90-200 nucleotides, and/or have an average length of about 150 nucleotides. In some embodiments, the fragmentation is accomplished mechanically comprising subjecting sample polynucleotides to acoustic sonication. In some embodiments, the fragmentation comprises treating the sample polynucleotides with one or more enzymes under conditions suitable for the one or more enzymes to generate double-stranded nucleic acid breaks.

    [0072] Examples of enzymes useful in the generation of polynucleotide fragments include sequence specific and non-sequence specific nucleases. Non-limiting examples of nucleases include DNase I, Fragmentase, restriction endonucleases, variants thereof, and combinations thereof For example, digestion with DNase I can induce random double-stranded breaks in DNA in the absence of Mg++ and in the presence of Mn++. In some embodiments, fragmentation comprises treating the sample polynucleotides with one or more restriction endonucleases. Fragmentation can produce fragments having 5 overhangs, 3 overhangs, blunt ends, or a combination thereof. In some embodiments, such as when fragmentation comprises the use of one or more restriction endonucleases, cleavage of sample polynucleotides leaves overhangs having a predictable sequence. Fragmented polynucleotides may be subjected to a step of size selecting the fragments via standard methods such as column purification or isolation from an agarose gel.

    [0073] According to some embodiments, polynucleotides among the plurality of polynucleotides from a sample are circularized. Circularization can include joining the 5 end of a polynucleotide to the 3 end of the same polynucleotide, to the 3 end of another polynucleotide in the sample, or to the 3 end of a polynucleotide from a different source (e.g. an artificial polynucleotide, such as an oligonucleotide adapter). In some embodiments, the 5 end of a polynucleotide is joined to the 3 end of the same polynucleotide (also referred to as self-joining). In some embodiment, conditions of the circularization reaction are selected to favor self-joining of polynucleotides within a particular range of lengths, so as to produce a population of circularized polynucleotides of a particular average length.

    [0074] For example, circularization reaction conditions may be selected to favor self-joining of polynucleotides shorter than about 5000, 2500, 1000, 750, 500, 400, 300, 200, 150, 100, 50, or fewer nucleotides in length. In some embodiments, fragments having lengths between 50-5000 nucleotides, 100-2500 nucleotides, or 150-500 nucleotides are favored, such that the average length of circularized polynucleotides falls within the respective range. In some embodiments, 80% or more of the circularized fragments are between 50-500 nucleotides in length, such as between 50-200 nucleotides in length. Reaction conditions that may be optimized include the length of time allotted for a joining reaction, the concentration of various reagents, and the concentration of polynucleotides to be joined. In some embodiments, a circularization reactions preserves the distribution of fragment lengths present in a sample prior to circularization. For example, one or more of the mean, median, mode, and standard deviation of fragment lengths in a sample before circularization and of circularized polynucleotides are within 75%, 80%, 85%, 90%, 95%, or more of one another.

    [0075] Rather than preferentially forming self-joining circularization products, one or more adapter oligonucleotides are used, such that the 5 end and 3 end of a polynucleotide in the sample are joined by way of one or more intervening adapter oligonucleotides to form a circular polynucleotide. For example, the 5 end of a polynucleotide can be joined to the 3 end of an adapter, and the 5 end of the same adapter can be joined to the 3 end of the same polynucleotide. An adapter oligonucleotide includes any oligonucleotide having a sequence, at least a portion of which is known, that can be joined to a sample polynucleotide. Adapter oligonucleotides can comprise DNA, RNA, nucleotide analogues, non-canonical nucleotides, labeled nucleotides, modified nucleotides, or combinations thereof. Adapter oligonucleotides can be single-stranded, double-stranded, or partial duplex. In general, a partial-duplex adapter comprises one or more single-stranded regions and one or more double-stranded regions. Double-stranded adapters can comprise two separate oligonucleotides hybridized to one another (also referred to as an oligonucleotide duplex), and hybridization may leave one or more blunt ends, one or more 3 overhangs, one or more 5 overhangs, one or more bulges resulting from mismatched and/or unpaired nucleotides, or any combination of these. When two hybridized regions of an adapter are separated from one another by a non-hybridized region, a bubble structure results. Adapters of different kinds can be used in combination, such as adapters of different sequences. Different adapters can be joined to sample polynucleotides in sequential reactions or simultaneously. In some embodiments, identical adapters are added to both ends of a target polynucleotide. For example, first and second adapters can be added to the same reaction. Adapters can be manipulated prior to combining with sample polynucleotides. For example, terminal phosphates can be added or removed.

    [0076] Where adapter oligonucleotides are used, the adapter oligonucleotides can contain one or more of a variety of sequence elements, including but not limited to, one or more amplification primer annealing sequences or complements thereof, one or more sequencing primer annealing sequences or complements thereof, one or more barcode sequences, one or more common sequences shared among multiple different adapters or subsets of different adapters, one or more restriction enzyme recognition sites, one or more overhangs complementary to one or more target polynucleotide overhangs, one or more probe binding sites (e.g. for attachment to a sequencing platform, such as a flow cell for massive parallel sequencing, such as flow cells as developed by Illumina, Inc.), one or more random or near-random sequences (e.g. one or more nucleotides selected at random from a set of two or more different nucleotides at one or more positions, with each of the different nucleotides selected at one or more positions represented in a pool of adapters comprising the random sequence), and combinations thereof. In some cases, the adapters may be used to purify those circles that contain the adapters, for example by using beads (particularly magnetic beads for ease of handling) that are coated with oligonucleotides comprising a complementary sequence to the adapter, that can capture the closed circles with the correct adapters by hybridization thereto, wash away those circles that do not contain the adapters and any unligated components, and then release the captured circles from the beads. In addition, in some cases, the complex of the hybridized capture probe and the target circle can be directly used to generate concatamers, such as by direct rolling circle amplification (RCA). In some embodiments, the adapters in the circles can also be used as a sequencing primer. Two or more sequence elements can be non-adjacent to one another (e.g. separated by one or more nucleotides), adjacent to one another, partially overlapping, or completely overlapping. For example, an amplification primer annealing sequence can also serve as a sequencing primer annealing sequence. Sequence elements can be located at or near the 3 end, at or near the 5 end, or in the interior of the adapter oligonucleotide. A sequence element may be of any suitable length, such as about or less than about 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more nucleotides in length. Adapter oligonucleotides can have any suitable length, at least sufficient to accommodate the one or more sequence elements of which they are comprised. In some embodiments, adapters are about or less than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 200, or more nucleotides in length. In some embodiments, an adapter oligonucleotide is in the range of about 12 to 40 nucleotides in length, such as about 15 to 35 nucleotides in length.

    [0077] In some embodiments, the adapter oligonucleotides joined to fragmented polynucleotides from one sample comprise one or more sequences common to all adapter oligonucleotides and a barcode that is unique to the adapters joined to polynucleotides of that particular sample, such that the barcode sequence can be used to distinguish polynucleotides originating from one sample or adapter joining reaction from polynucleotides originating from another sample or adapter joining reaction. In some embodiments, an adapter oligonucleotide comprises a 5 overhang, a 3 overhang, or both that is complementary to one or more target polynucleotide overhangs. Complementary overhangs can be one or more nucleotides in length, including but not limited to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more nucleotides in length. Complementary overhangs may comprise a fixed sequence.

    [0078] Complementary overhangs of an adapter oligonucleotide may comprise a random sequence of one or more nucleotides, such that one or more nucleotides are selected at random from a set of two or more different nucleotides at one or more positions, with each of the different nucleotides selected at one or more positions represented in a pool of adapters with complementary overhangs comprising the random sequence. In some embodiments, an adapter overhang is complementary to a target polynucleotide overhang produced by restriction endonuclease digestion. In some embodiments, an adapter overhang consists of an adenine or a thymine.

    [0079] A variety of methods for circularizing polynucleotides are available. In some embodiments, circularization comprises an enzymatic reaction, such as use of a ligase (e.g. an RNA or DNA ligase). A variety of ligases are available, including, but not limited to, Circligase (Epicentre; Madison, WI), RNA ligase, T4 RNA Ligase 1 (ssRNA Ligase, which works on both DNA and RNA). In addition, T4 DNA ligase can also ligate ssDNA if no dsDNA templates are present, although this is generally a slow reaction. Other non-limiting examples of ligases include NAD-dependent ligases including Taq DNA ligase, Thermusfilformis DNA ligase, Escherichia coliDNA ligase, Tth DNA ligase, Thermus scotoductus DNA ligase (I and II), thermostable ligase, Ampligase thermostable DNA ligase, VanC-type ligase, 9 N DNA Ligase, Tsp DNA ligase, and novel ligases discovered by bioprospecting; ATP-dependent ligases including T4 RNA ligase, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Pfu DNA ligase, DNA ligase 1, DNA ligase III, DNA ligase IV, and novel ligases discovered by bioprospecting; and wild-type, mutant isoforms, and genetically engineered variants thereof. Where self-joining is desired, the concentration of polynucleotides and enzyme can adjusted to facilitate the formation of intramolecular circles rather than intermolecular structures. Reaction temperatures and times can be adjusted as well. In some embodiments, 60 C. is used to facilitate intramolecular circles. In some embodiments, reaction times are between 12-16 hours. Reaction conditions may be those specified by the manufacturer of the selected enzyme. In some embodiments, an exonuclease step can be included to digest any unligated nucleic acids after the circularization reaction. That is, closed circles do not contain a free 5 or 3 end, and thus the introduction of a 5 or 3 exonuclease will not digest the closed circles but will digest the unligated components. This may find particular use in multiplex systems.

    [0080] In general, joining ends of a polynucleotide to one-another to form a circular polynucleotide (either directly, or with one or more intermediate adapter oligonucleotides) produces a junction having a junction sequence. Where the 5 end and 3 end of a polynucleotide are joined via an adapter polynucleotide, the term junction can refer to a junction between the polynucleotide and the adapter (e.g. one of the 5 end junction or the 3 end junction), or to the junction between the 5 end and the 3 end of the polynucleotide as formed by and including the adapter polynucleotide. Where the 5 end and the 3 end of a polynucleotide are joined without an intervening adapter (e.g. the 5 end and 3 end of a single-stranded DNA), the term junction refers to the point at which these two ends are joined. A junction may be identified by the sequence of nucleotides comprising the junction (also referred to as the junction sequence). In some embodiments, samples comprise polynucleotides having a mixture of ends formed by natural degradation processes (such as cell lysis, cell death, and other processes by which DNA is released from a cell to its surrounding environment in which it may be further degraded, such as in cell-free polynucleotides), fragmentation that is a byproduct of sample processing (such as fixing, staining, and/or storage procedures), and fragmentation by methods that cleave DNA without restriction to specific target sequences (e.g. mechanical fragmentation, such as by sonication; non-sequence specific nuclease treatment, such as DNase I, fragmentase). Where samples comprise polynucleotides having a mixture of ends, the likelihood that two polynucleotides will have the same 5 end or 3 end is low, and the likelihood that two polynucleotides will independently have both the same 5 end and 3 end is extremely low. Accordingly, in some embodiments, junctions may be used to distinguish different polynucleotides, even where the two polynucleotides comprise a portion having the same target sequence. Where polynucleotide ends are joined without an intervening adapter, a junction sequence may be identified by alignment to a reference sequence. For example, where the order of two component sequences appears to be reversed with respect to the reference sequence, the point at which the reversal appears to occur may be an indication of a junction at that point. Where polynucleotide ends are joined via one or more adapter sequences, a junction may be identified by proximity to the known adapter sequence, or by alignment as above if a sequencing read is of sufficient length to obtain sequence from both the 5 and 3 ends of the circularized polynucleotide. In some embodiments, the formation of a particular junction is a sufficiently rare event such that it is unique among the circularized polynucleotides of a sample.

    [0081] FIG. 4 illustrates three non-limiting examples of methods of circularized polynucleotides. At the top, the polynucleotides are circularized in the absence of adapters, while the middle scheme depicts the use of adapters, and the bottom scheme utilizes two adapters. Where two adapters are used, one can be joined to the 5 end of the polynucleotide while the second adapter can be joined to the 3 end of the same polynucleotide. In some embodiments, adapter ligation may comprise use of two different adapters along with a splint nucleic acid that is complementary to the two adapters to facilitate ligation. Forked or Y adapters may also be used. Where two adapters are used, polynucleotides having the same adapter at both ends may be removed in subsequent steps due to self-annealing.

    [0082] FIG. 6 illustrates further non-limiting example methods of circularizing polynucleotides, such as single-stranded DNA. The adapter can be asymmetrically added to either the 5 or 3 end of a polynucleotide. As shown in FIG. 6A, the single-stranded DNA (ssDNA) has a free hydroxyl group at the 3 end, and the adapter has a blocked 3 end such that in the presence of a ligase, a preferred reaction joins the 3 end of the ssDNA to the 5 end of the adapter. In this embodiment, it can be useful to use agents such as polyethylene glycols (PEGs) to drive the intermolecular ligation of a single ssDNA fragment and a single adapter, prior to an intramolecular ligation to form a circle. The reverse order of ends can also be done (blocked 3, free 5, etc.). Once the linear ligation is accomplished, the ligated pieces can be treated with an enzyme to remove the blocking moiety, such as through the use of a kinase or other suitable enzymes or chemistries. Once the blocking moiety is removed, the addition of a circularization enzyme, such as CircLigase, allows an intramolecular reaction to form the circularized polynucleotide. As shown in FIG. 6B, by using a double-stranded adapter with one strand having a 5 or 3 end blocked, a double stranded structure can be formed, which upon ligation produces a double-stranded fragment with nicks. The two strands can then be separated, the clocking moiety removed, and the single-stranded fragment circularized to form a circularized polynucleotide.

    [0083] In some embodiments, molecular clamps are used to bring two ends of a polynucleotide (e.g. a single-stranded DNA) together in order to enhance the rate of intramolecular circularization. An example illustration of one such process is illustrated in FIG. 5. This can be done with or without adapters. The use of molecular clamps may be particularly useful in cases where the average polynucleotide fragment is greater than about 100 nucleotides in length. In some embodiments, the molecular clamp probe comprises three domains: a first domain, an intervening domain, and a second domain. The first and second domains will hybridize to first to corresponding sequences in a target polynucleotide via sequence complementarity. The intervening domain of the molecular clamp probe does not significantly hybridize with the target sequence. The hybridization of the clamp with the target polynucleotide thus brings the two ends of the target sequence into closer proximity, which facilitates the intramolecular circularization of the target sequence in the presence of a circularization enzyme. In some embodiments, this is additionally useful as the molecular clamp can serve as an amplification primer as well.

    [0084] After circularization, reaction products may be purified prior to amplification or sequencing to increase the relative concentration or purity of circularized polynucleotides available for participating in subsequence steps (e.g. by isolation of circular polynucleotides or removal of one or more other molecules in the reaction). For example, a circularization reaction or components thereof may be treated to remove single-stranded (non-circularized) polynucleotides, such as by treatment with an exonuclease. As a further example, a circularization reaction or portion thereof may be subjected to size exclusion chromatography, whereby small reagents are retained and discarded (e.g. unreacted adapters), or circularization products are retained and released in a separate volume. A variety of kits for cleaning up ligation reactions are available, such as kits provided by Zymo oligo purification kits made by Zymo Research. In some embodiments, purification comprises treatment to remove or degrade ligase used in the circularization reaction, and/or to purify circularized polynucleotides away from such ligase. In some embodiments, treatment to degrade ligase comprises treatment with a protease, such as proteinase K. Proteinase K treatment may follow manufacturer protocols, or standard protocols (e.g. as provided in Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th Edition (2012)). Protease treatment may also be followed by extraction and precipitation. In one example, circularized polynucleotides are purified by proteinase K (Qiagen) treatment in the presence of 0.1% SDS and 20 mM EDTA, extracted with 1:1 phenol/chloroform and chloroform, and precipitated with ethanol or isopropanol. In some embodiments, precipitation is in ethanol.

    [0085] Circularization may be followed directly by sequencing the circularized polynucleotides. Alternatively, sequencing may be preceded by one or more amplification reactions. In general, amplification refers to a process by which one or more copies are made of a target polynucleotide or a portion thereof A variety of methods of amplifying polynucleotides (e.g. DNA and/or RNA) are available. Amplification may be linear, exponential, or involve both linear and exponential phases in a multi-phase amplification process. Amplification methods may involve changes in temperature, such as a heat denaturation step, or may be isothermal processes that do not require heat denaturation. The polymerase chain reaction (PCR) uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of the target sequence. Denaturation of annealed nucleic acid strands may be achieved by the application of heat, increasing local metal ion concentrations (e.g. U.S. Pat. No. 6,277,605), ultrasound radiation (e.g. WO/2000/049176), application of voltage (e.g. U.S. Pat. Nos. 5,527,670, 6,033,850, 5,939,291, and 6,333,157), and application of an electromagnetic field in combination with primers bound to a magnetically-responsive material (e.g. U.S. Pat. No. 5,545,540). In a variation called RT-PCR, reverse transcriptase (RT) is used to make a complementary DNA (cDNA) from RNA, and the cDNA is then amplified by PCR to produce multiple copies of DNA (e.g. U.S. Pat. Nos. 5,322,770, 5,310,652). One example of an isothermal amplification method is strand displacement amplification, commonly referred to as SDA, which uses cycles of annealing pairs of primer sequences to opposite strands of a target sequence, primer extension in the presence of a dNTP to produce a duplex hemiphosphorothioated primer extension product, endonuclease-mediated nicking of a hemimodified restriction endonuclease recognition site, and polymerase-mediated primer extension from the 3 end of the nick to displace an existing strand and produce a strand for the next round of primer annealing, nicking and strand displacement, resulting in geometric amplification of product (e.g. U.S. Pat. Nos. 5,270,184, 5,455,166). Thermophilic SDA (tSDA) uses thermophilic endonucleases and polymerases at higher temperatures in essentially the same method (European Pat. No. 0 684 315). Other amplification methods include rolling circle amplification (RCA) (e.g., Lizardi, Rolling Circle Replication Reporter Systems, U.S. Pat. No. 5,854,033); helicase dependent amplification (HDA) (e.g., Kong et al., Helicase Dependent Amplification Nucleic Acids, U.S. Pat. Appln. Pub. No. US 2004-0058378 A1); and loop-mediated isothermal amplification (LAMP) (e.g., Notomi et al., Process for Synthesizing Nucleic Acid, U.S. Pat. No. 6,410,278). In some cases, isothermal amplification utilizes transcription by an RNA polymerase from a promoter sequence, such as may be incorporated into an oligonucleotide primer. Transcription-based amplification methods include nucleic acid sequence based amplification, also referred to as NASBA (e.g. U.S. Pat. No. 5,130,238); methods which rely on the use of an RNA replicase to amplify the probe molecule itself, commonly referred to as Q replicase (e.g., Lizardi, P. et al. (1988)BioTechnol. 6, 1197-1202); self-sustained sequence replication (e.g., Guatelli, J. et al. (1990) Proc. Natd. Acad. Sci. USA 87, 1874-1878; Landgren (1993) Trends in Genetics 9, 199-202; and HELEN H. LEE et al., NUCLEIC ACID AMPLIFICATION TECHNOLOGIES (1997)); and methods for generating additional transcription templates (e.g. U.S. Pat. Nos. 5,480,784, 5,399,491). Further methods of isothermal nucleic acid amplification include the use of primers containing non-canonical nucleotides (e.g. uracil or RNA nucleotides) in combination with an enzyme that cleaves nucleic acids at the non-canonical nucleotides (e.g. DNA glycosylase or RNaseH) to expose binding sites for additional primers (e.g. U.S. Pat. Nos. 6,251,639, 6,946,251, and 7,824,890). Isothermal amplification processes can be linear or exponential.

    [0086] In some embodiments, amplification comprises rolling circle amplification (RCA). A typical RCA reaction mixture comprises one or more primers, a polymerase, and dNTPs, and produces concatemers. Typically, the polymerase in an RCA reaction is a polymerase having strand-displacement activity. A variety of such polymerases are available, non-limiting examples of which include exonuclease minus DNA Polymerase I large (Klenow) Fragment, Phi29 DNA polymerase, Taq DNA Polymerase and the like. In general, a concatemer is a polynucleotide amplification product comprising two or more copies of a target sequence from a template polynucleotide (e.g. about or more than about 2, 3, 4, 5, 6, 7, 8, 9,10, or more copies of the target sequence; in some embodiments, about or more than about 2 copies). Amplification primers may be of any suitable length, such as about or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, or more nucleotides, any portion or all of which may be complementary to the corresponding target sequence to which the primer hybridizes (e.g. about, or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more nucleotides). FIG. 7 depicts three non-limiting examples of suitable primers. FIG. 7A shows the use of no adapters and a target specific primer, which can be used for the detection of the presence or absence of a sequence variant within specific target sequences. In some embodiments, multiple target-specific primers for a plurality of targets are used in the same reaction. For example, target-specific primers for about or at least about 10, 50, 100, 150, 200, 250, 300, 400, 500, 1000, 2500, 5000, 10000, 15000, or more different target sequences may be used in a single amplification reaction in order to amplify a corresponding number of target sequences (if present) in parallel. Multiple target sequences may correspond to different portions of the same gene, different genes, or non-gene sequences. Where multiple primers target multiple target sequences in a single gene, primers may be spaced along the gene sequence (e.g. spaced apart by about or at least about 50 nucleotides, every 50-150 nucleotides, or every 50-100 nucleotides) in order to cover all or a specified portion of a target gene. In FIG. 7C illustrates use of a primer that hybridizes to an adapter sequence (which in some cases may be an adapter oligonucleotide itself).

    [0087] FIG. 7B illustrates an example of amplification by random primers. In general, a random primer comprises one or more random or near-random sequences (e.g. one or more nucleotides selected at random from a set of two or more different nucleotides at one or more positions, with each of the different nucleotides selected at one or more positions represented in a pool of adapters comprising the random sequence). In this way, polynucleotides (e.g. all or substantially all circularized polynucleotides) can be amplified in a sequence non-specific fashion. Such procedures may be referred to as whole genome amplification (WGA); however, typical WGA protocols (which do not involve a circularization step) do not efficiently amplify short polynucleotides, such as polynucleotide fragments contemplated by the present disclosure. For further illustrative discussion of WGA procedures, see for example Li et al (2006) J Mol. Diagn. 8(1):22-30.

    [0088] Where circularized polynucleotides are amplified prior to sequencing, amplified products may be subjected to sequencing directly without enrichment, or subsequent to one or more enrichment steps. Enrichment may comprise purifying one or more reaction components, such as by retention of amplification products or removal of one or more reagents. For example, amplification products may be purified by hybridization to a plurality of probes attached to a substrate, followed by release of captured polynucleotides, such as by a washing step. Alternatively, amplification products can be labeled with a member of a binding pair followed by binding to the other member of the binding pair attached to a substrate, and washing to release the amplification product. Possible substrates include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon, etc.), polysaccharides, nylon or nitrocellulose, ceramics, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, optical fiber bundles, and a variety of other polymers. In some embodiments, the substrate is in the form of a bead or other small, discrete particle, which may be a magnetic or paramagnetic bead to facilitate isolation through application of a magnetic field. In general, binding pair refers to one of a first and a second moiety, wherein the first and the second moiety have a specific binding affinity for each other. Suitable binding pairs include, but are not limited to, antigens/antibodies (for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)/anti-DNP, dansyl-X-anti-dansyl, Fluorescein/anti-fluorescein, lucifer yellow/anti-lucifer yellow, and rhodamine anti-rhodamine); biotin/avidin (or biotin/streptavidin); calmodulin binding protein (CBP)/calmodulin; hormone/hormone receptor; lectin/carbohydrate; peptide/cell membrane receptor; protein A/antibody; hapten/antihapten; enzyme/cofactor; and enzyme/substrate.

    [0089] In some embodiments, enrichment following amplification of circularized polynucleotides comprises one or more additional amplification reactions. In some embodiments, enrichment comprises amplifying a target sequence comprising sequence A and sequence B (oriented in a 5 to 3 direction) in an amplification reaction mixture comprising (a) the amplified polynucleotide; (b) a first primer comprising sequence A, wherein the first primer specifically hybridizes to sequence A of the target sequence via sequence complementarity between sequence A and sequence A; (c) a second primer comprising sequence B, wherein the second primer specifically hybridizes to sequence B present in a complementary polynucleotide comprising a complement of the target sequence via sequence complementarity between B and B; and (d) a polymerase that extends the first primer and the second primer to produce amplified polynucleotides; wherein the distance between the 5 end of sequence A and the 3 end of sequence B of the target sequence is 75nt or less. FIG. 10 illustrates an example arrangement of the first and second primer with respect to a target sequence in the context of a single repeat (which will typically not be amplified unless circular) and concatemers comprising multiple copies of the target sequence. Given the orientation of the primers with respect to a monomer of the target sequence, this arrangement may be referred to as back to back (B2B) or inverted primers. Amplification with B2B primers facilitates enrichment of circular and/or concatemeric amplification products. Moreover, this orientation combined with a relatively smaller footprint (total distance spanned by a pair of primers) permits amplification of a wider variety of fragmentation events around a target sequence, as a junction is less likely to occur between primers than in the arrangement of primers found in a typical amplification reaction (facing one another, spanning a target sequence). In some embodiments, the distance between the 5 end of sequence A and the 3 end of sequence B is about or less than about 200, 150, 100, 75, 50, 40, 30, 25, 20, 15, or fewer nucleotides. In some embodiments, sequence A is the complement of sequence B. In some embodiments, multiple pairs of B2B primers directed to a plurality of different target sequences are used in the same reaction to amplify a plurality of different target sequences in parallel (e.g. about or at least about 10, 50, 100, 150, 200, 250, 300, 400, 500, 1000, 2500, 5000, 10000, 15000, or more different target sequences). Primers can be of any suitable length, such as described elsewhere herein. Amplification may comprise any suitable amplification reaction under appropriate conditions, such as an amplification reaction described herein. In some embodiments, amplification is a polymerase chain reaction.

    [0090] In some embodiments, B2B primers comprise at least two sequence elements, a first element that hybridizes to a target sequence via sequence complementarity, and a 5 tail that does not hybridize to the target sequence during a first amplification phase at a first hybridization temperature during which the first element hybridizes (e.g. due to lack of sequence complementarity between the tail and the portion of the target sequence immediately 3 with respect to where the first element binds). For example, the first primer comprises sequence C 5 with respect to sequence A, the second primer comprises sequence D 5 with respect to sequence B, and neither sequence C nor sequence D hybridize to the plurality of concatemers during a first amplification phase at a first hybridization temperature. In some embodiments in which such tailed primers are used, amplification can comprise a first phase and a second phase; the first phase comprises a hybridization step at a first temperature, during which the first and second primers hybridize to the concatemers (or circularized polynucleotides) and primer extension; and the second phase comprises a hybridization step at a second temperature that is higher than the first temperature, during which the first and second primers hybridize to amplification products comprising extended first or second primers, or complements thereof, and primer extension. The higher temperature favors hybridization between along the first element and tail element of the primer in primer extension products over shorter fragments formed by hybridization between only the first element in a primer and an internal target sequence within a concatemer. Accordingly, the two-phase amplification may be used to reduce the extent to which short amplification products might otherwise be favored, thereby maintaining a relatively higher proportion of amplification products having two or more copies of a target sequence. For example, after 5 cycles (e.g. at least 5, 6, 7, 8, 9, 10, 15, 20, or more cycles) of hybridization at the second temperature and primer extension, at least 5% (e.g. at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, or more) of amplified polynucleotides in the reaction mixture comprise two or more copies of the target sequence. An illustration of an embodiment in accordance with this two-phase, tailed B2B primer amplification process is illustrated in FIG. 11.

    [0091] In some embodiments, enrichments comprises amplification under conditions that are skewed to increase the length of amplicons from concatemers. For example, the primer concentration can be lowered, such that not every priming site will hybridize a primer, thus making the PCR products longer. Similarly, decreasing the primer hybridization time during the cycles will similarly allow fewer primers to hybridize, thus also making the average PCR amplicon size increase. Furthermore, increasing the temperature and/or extension time of the cycles will similarly increase the average length of the PCR amplicons. Any combination of these techniques can be used.

    [0092] In some embodiments, particularly where an amplification with B2B primers has been performed, amplification products are treated to filter the resulting amplicons on the basis of size to reduce and/or eliminate the number of monomers a mixture comprising concatemers. This can be done using a variety of available techniques, including, but not limited to, fragment excision from gels and gel filtration (e.g. to enrich for fragments larger than about 300, 400, 500, or more nucleotides in length); as well as SPRI beads (Agencourt AMPure XP) for size selection by fine-tuning the binding buffer concentration. For example, the use of 0.6 binding buffer during mixing with DNA fragments may be used to preferentially bind DNA fragments larger than about 500 base pairs (bp).

    [0093] In some embodiments, where amplification result in single stranded concatamers, the single strands are converted to double stranded constructs either prior to or as part of the formation of sequencing libraries that are generated for sequencing reactions. A variety of suitable methods to generate a double stranded construct from a single stranded nucleic acid are available. A number of possible methods are depicted in FIG. 9, although a number of other methods can be used as well. As shown in FIG. 9A, for example, the use of random primers, polymerase, dNTPs and a ligase will result in double strands. FIG. 9B depicts the second strand synthesis when the concatamer contains adapter sequences, which can be used as the primers in the reaction. FIG. 9C depicts the use of a loop, where one terminus of the loop adapter is added to the terminus of the concatamers, wherein the loop adapter has a small section of self-hybridizing nucleic acids. In this case, the ligation of the loop adapter results in the loop that is self hybridized and serves as the polymerase primer template.

    [0094] FIG. 9D shows the use of hyper-branching primers, generally of the most use in cases where the target sequence is known, where multiple strands are formed, particularly when a polymerase with a strong strand displacement function is used.

    [0095] According to some embodiments, circularized polynucleotides (or amplification products thereof, which may have optionally been enriched) are subjected to a sequencing reaction to generate sequencing reads. Sequencing reads produced by such methods may be used in accordance with other methods disclosed herein. A variety of sequencing methodologies are available, particularly high-throughput sequencing methodologies. Examples include, without limitation, sequencing systems manufactured by Illumina (sequencing systems such as HiSeq and MiSeq), Life Technologies (Ion Torrent, SOLiD, etc.), Roche's 454 Life Sciences systems, Pacific Biosciences systems, etc. In some embodiments, sequencing comprises use of HiSeq and MiSeq systems to produce reads of about or more than about 50, 75, 100, 125, 150, 175, 200, 250, 300, or more nucleotides in length. In some embodiments, sequencing comprises a sequencing by synthesis process, where individual nucleotides are identified iteratively, as they are added to the growing primer extension product. Pyrosequencing is an example of a sequence by synthesis process that identifies the incorporation of a nucleotide by assaying the resulting synthesis mixture for the presence of by-products of the sequencing reaction, namely pyrophosphate. In particular, a primer/template/polymerase complex is contacted with a single type of nucleotide. If that nucleotide is incorporated, the polymerization reaction cleaves the nucleoside triphosphate between the a and 0 phosphates of the triphosphate chain, releasing pyrophosphate. The presence of released pyrophosphate is then identified using a chemiluminescent enzyme reporter system that converts the pyrophosphate, with AMP, into ATP, then measures ATP using a luciferase enzyme to produce measurable light signals. Where light is detected, the base is incorporated, where no light is detected, the base is not incorporated. Following appropriate washing steps, the various bases are cyclically contacted with the complex to sequentially identify subsequent bases in the template sequence. See, e.g., U.S. Pat. No. 6,210,891.

    [0096] In related sequencing processes, the primer/template/polymerase complex is immobilized upon a substrate and the complex is contacted with labeled nucleotides. The immobilization of the complex may be through the primer sequence, the template sequence and/or the polymerase enzyme, and may be covalent or noncovalent. For example, immobilization of the complex can be via a linkage between the polymerase or the primer and the substrate surface. In alternate configurations, the nucleotides are provided with and without removable terminator groups. Upon incorporation, the label is coupled with the complex and is thus detectable. In the case of terminator bearing nucleotides, all four different nucleotides, bearing individually identifiable labels, are contacted with the complex. Incorporation of the labeled nucleotide arrests extension, by virtue of the presence of the terminator, and adds the label to the complex, allowing identification of the incorporated nucleotide. The label and terminator are then removed from the incorporated nucleotide, and following appropriate washing steps, the process is repeated. In the case of non-terminated nucleotides, a single type of labeled nucleotide is added to the complex to determine whether it will be incorporated, as with pyrosequencing. Following removal of the label group on the nucleotide and appropriate washing steps, the various different nucleotides are cycled through the reaction mixture in the same process. See, e.g., U.S. Pat. No. 6,833,246, incorporated herein by reference in its entirety for all purposes. For example, the Illumina Genome Analyzer System is based on technology described in WO 98/44151, wherein DNA molecules are bound to a sequencing platform (flow cell) via an anchor probe binding site (otherwise referred to as a flow cell binding site) and amplified in situ on a glass slide. A solid surface on which DNA molecules are amplified typically comprise a plurality of first and second bound oligonucleotides, the first complementary to a sequence near or at one end of a target polynucleotide and the second complementary to a sequence near or at the other end of a target polynucleotide. This arrangement permits bridge amplification, such as described in US20140121116. The DNA molecules are then annealed to a sequencing primer and sequenced in parallel base-by-base using a reversible terminator approach. Hybridization of a sequencing primer may be preceded by cleavage of one strand of a double-stranded bridge polynucleotide at a cleavage site in one of the bound oligonucleotides anchoring the bridge, thus leaving one single strand not bound to the solid substrate that may be removed by denaturing, and the other strand bound and available for hybridization to a sequencing primer. Typically, the Illumina Genome Analyzer System utilizes flow-cells with 8 channels, generating sequencing reads of 18 to 36 bases in length, generating>1.3 Gbp of high quality data per run (see www.illumina.com).

    [0097] In yet a further sequence by synthesis process, the incorporation of differently labeled nucleotides is observed in real time as template dependent synthesis is carried out. In particular, an individual immobilized primer/template/polymerase complex is observed as fluorescently labeled nucleotides are incorporated, permitting real time identification of each added base as it is added. In this process, label groups are attached to a portion of the nucleotide that is cleaved during incorporation. For example, by attaching the label group to a portion of the phosphate chain removed during incorporation, i.e., a ,, or other terminal phosphate group on a nucleoside polyphosphate, the label is not incorporated into the nascent strand, and instead, natural DNA is produced. Observation of individual molecules typically involves the optical confinement of the complex within a very small illumination volume. By optically confining the complex, one creates a monitored region in which randomly diffusing nucleotides are present for a very short period of time, while incorporated nucleotides are retained within the observation volume for longer as they are being incorporated. This results in a characteristic signal associated with the incorporation event, which is also characterized by a signal profile that is characteristic of the base being added. In related aspects, interacting label components, such as fluorescent resonant energy transfer (FRET) dye pairs, are provided upon the polymerase or other portion of the complex and the incorporating nucleotide, such that the incorporation event puts the labeling components in interactive proximity, and a characteristic signal results, that is again, also characteristic of the base being incorporated (See, e.g., U.S. Pat. Nos. 6,917,726, 7,033,764, 7,052,847, 7,056,676, 7,170,050, 7,361,466, and 7,416,844; and US 20070134128).

    [0098] In some embodiments, the nucleic acids in the sample can be sequenced by ligation. This method typically uses a DNA ligase enzyme to identify the target sequence, for example, as used in the polony method and in the SOLiD technology (Applied Biosystems, now Invitrogen). In general, a pool of all possible oligonucleotides of a fixed length is provided, labeled according to the sequenced position. Oligonucleotides are annealed and ligated; the preferential ligation by DNA ligase for matching sequences results in a signal corresponding to the complementary sequence at that position.

    [0099] According to some embodiments, a sequence difference between sequencing reads and a reference sequence are called as a genuine sequence variant (e.g. existing in the sample prior to amplification or sequencing, and not a result of either of these processes) if it occurs in at least two different polynucleotides (e.g. two different circular polynucleotides, which can be distinguished as a result of having different junctions). Because sequence variants that are the result of amplification or sequencing errors are unlikely to be duplicated exactly (e.g. position and type) on two different polynucleotides comprising the same target sequence, adding this validation parameter greatly reduces the background of erroneous sequence variants, with a concurrent increase in the sensitivity and accuracy of detecting actual sequence variation in a sample. In some embodiments, a sequence variant having a frequency of about or less than about 5%, 4%, 3%, 2%, 1.5%, 1%, 0.75%, 0.5%, 0.25%, 0.1%, 0.075%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.005%, 0.001%, or lower is sufficiently above background to permit an accurate call. In some embodiments, the sequence variant occurs with a frequency of about or less than about 0.1%. In some embodiments, the frequency of a sequence variant is sufficiently above background when such frequency is statistically significantly above the background error rate (e.g. with a p-value of about or less than about 0.05, 0.01, 0.001, 0.0001, or lower). In some embodiments, the frequency of a sequence variant is sufficiently above background when such frequency is about or at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 25-fold, 50-fold, 100-fold, or more above the background error rate (e.g. at least 5-fold higher). In some embodiments, the background error rate in accurately determining the sequence at a given position is about or less than about 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, 0.0005%, or lower. In some embodiments, the error rate is lower than 0.001%.

    [0100] In some embodiments, identifying a genuine sequence variant (also referred to as calling or making a call) comprises optimally aligning one or more sequencing reads with a reference sequence to identify differences between the two, as well as to identify junctions. In general, alignment involves placing one sequence along another sequence, iteratively introducing gaps along each sequence, scoring how well the two sequences match, and preferably repeating for various positions along the reference. The best-scoring match is deemed to be the alignment and represents an inference about the degree of relationship between the sequences. In some embodiments, a reference sequence to which sequencing reads are compared is a reference genome, such as the genome of a member of the same species as the subject. A reference genome may be complete or incomplete. In some embodiments, a reference genome consists only of regions containing target polynucleotides, such as from a reference genome or from a consensus generated from sequencing reads under analysis. In some embodiments, a reference sequence comprises or consists of sequences of polynucleotides of one or more organisms, such as sequences from one or more bacteria, archaea, viruses, protists, fungi, or other organism. In some embodiments, the reference sequence consists of only a portion of a reference genome, such as regions corresponding to one or more target sequences under analysis (e.g. one or more genes, or portions thereof). For example, for detection of a pathogen (such as in the case of contamination detection), the reference genome is the entire genome of the pathogen (e.g. HIV, HPV, or a harmful bacterial strain, e.g. E. coli), or a portion thereof useful in identification, such as of a particular strain or serotype. In some embodiments, sequencing reads are aligned to multiple different reference sequences, such as to screen for multiple different organisms or strains.

    [0101] In a typical alignment, a base in a sequencing read alongside a non-matching base in the reference indicates that a substitution mutation has occurred at that point. Similarly, where one sequence includes a gap alongside a base in the other sequence, an insertion or deletion mutation (an indel) is inferred to have occurred. When it is desired to specify that one sequence is being aligned to one other, the alignment is sometimes called a pairwise alignment. Multiple sequence alignment generally refers to the alignment of two or more sequences, including, for example, by a series of pairwise alignments. In some embodiments, scoring an alignment involves setting values for the probabilities of substitutions and indels. When individual bases are aligned, a match or mismatch contributes to the alignment score by a substitution probability, which could be, for example, 1 for a match and 0.33 for a mismatch. An indel deducts from an alignment score by a gap penalty, which could be, for example, 1. Gap penalties and substitution probabilities can be based on empirical knowledge or a priori assumptions about how sequences mutate. Their values affect the resulting alignment. Examples of algorithms for performing alignments include, without limitation, the Smith-Waterman (SW) algorithm, the Needleman-Wunsch (NW) algorithm, algorithms based on the Burrows-Wheeler Transform (BWT), and hash function aligners such as Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (Illumina, San Diego, Calif), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). One exemplary alignment program, which implements a BWT approach, is Burrows-Wheeler Aligner (BWA) available from the SourceForge web site maintained by Geeknet (Fairfax, Va.). BWT typically occupies 2 bits of memory per nucleotide, making it possible to index nucleotide sequences as long as 4G base pairs with a typical desktop or laptop computer. The pre-processing includes the construction of BWT (i.e., indexing the reference) and the supporting auxiliary data structures. BWA includes two different algorithms, both based on BWT. Alignment by BWA can proceed using the algorithm bwa-short, designed for short queries up to about 200 by with low error rate (<3%) (Li H. and Durbin R. Bioinformatics, 25:1754-60 (2009)). The second algorithm, BWA-SW, is designed for long reads with more errors (Li H. and Durbin R. (2010). Fast and accurate long-read alignment with Burrows-Wheeler Transform. Bioinformatics, Epub.). The bwa-sw aligner is sometimes referred to as bwa-long, bwa long algorithm, or similar. An alignment program that implements a version of the Smith-Waterman algorithm is MUMmer, available from the SourceForge web site maintained by Geeknet (Fairfax, Va.). MUMmer is a system for rapidly aligning entire genomes, whether in complete or draft form (Kurtz, S., et al., Genome Biology, 5:R12 (2004); Delcher, A. L., et al., Nucl. Acids Res., 27:11 (1999)). For example, MUMmer 3.0 can find all 20-basepair or longer exact matches between a pair of 5-megabase genomes in 13.7 seconds, using 78 MB of memory, on a 2.4 GHz Linux desktop computer. MUMmer can also align incomplete genomes; it can easily handle the 100s or 1000s of contigs from a shotgun sequencing project, and will align them to another set of contigs or a genome using the NUCmer program included with the system. Other non-limiting examples of alignment programs include: BLAT from Kent Informatics (Santa Cruz, Calif) (Kent, W. J., Genome Research 4: 656-664 (2002)); SOAP2, from Beijing Genomics Institute (Beijing, Conn.) or BGI Americas Corporation (Cambridge, Mass.); Bowtie (Langmead, et al., Genome Biology, 10:R25 (2009)); Efficient Large-Scale Alignment of Nucleotide Databases (ELAND) or the ELANDv2 component of the Consensus Assessment of Sequence and Variation (CASAVA) software (Illumina, San Diego, Calif); RTG Investigator from Real Time Genomics, Inc. (San Francisco, Calif); Novoalign from Novocraft (Selangor, Malaysia); Exonerate, European Bioinformatics Institute (Hinxton, UK) (Slater, G., and Birney, E., BMC Bioinformatics 6:31(2005)), Clustal Omega, from University College Dublin (Dublin, Ireland) (Sievers F., et al., Mol Syst Biol 7, article 539 (2011)); ClustalW or ClustalX from University College Dublin (Dublin, Ireland) (Larkin M. A., et al., Bioinformatics, 23, 2947-2948 (2007)); and FASTA, European Bioinformatics Institute (Hinxton, UK) (Pearson W. R., et al., PNAS 85(8):2444-8 (1988); Lipman, D. J., Science 227(4693):1435-41 (1985)).

    [0102] Typically, the sequencing data is acquired from large scale, parallel sequencing reactions. Many of the next generation high-throughput sequencing systems export data as FASTQ files, although other formats may be used. In some embodiments, sequences are analyzed to identify repeat unit length (e.g. the monomer length), the junction formed by circularization, and any true variation with respect to a reference sequence, typically through sequence alignment. Identifying the repeat unit length can include computing the regions of the repeated units, finding the reference loci of the sequences (e.g. when one or more sequences are particularly targeted for amplification, enrichment, and/or sequencing), the boundaries of each repeated region, and/or the number of repeats within each sequencing run. Sequence analysis can include analyzing sequence data for both strands of a duplex. As noted above, in some embodiments, an identical variant that appears the sequences of reads from different polynucleotides from the sample (e.g. circularized polynucleotides having different junctions) is considered a confirmed variant. In some embodiments, a sequence variant may also be considered a confirmed, or genuine, variant if it occurs in more than one repeated unit of the same polynucleotide, as the same sequence variation is likewise unlikely to occur at the same position in a repeated target sequence within the same concatemer. The quality score of a sequence may be considered in identifying variants and confirmed variants, for example, the sequence and bases with quality scores lower than a threshold may be filtered out. Other bioinformatics methods can be used to further increase the sensitivity and specificity of the variant calls.

    [0103] In some embodiments, statistical analyses may be applied to determination of variants (mutations) and quantitate the ratio of the variant in total DNA samples. Total measurement of a particular base can be calculated using the sequencing data. For example, from the alignment results calculated in previous steps, one can calculate the number of effective reads, that is, number of confirmed reads for each locus. The allele frequency of a variant can be normalized by the effective read count for the locus. The overall noise level, that is the average rate of observed variants across all loci, can be computed. The frequency of a variant and the overall noise level, combined with other factors, can be used to determine the confidence interval of the variant call. Statistical models such as Poisson distributions can be used to assess the confidence interval of the variant calls. The allele frequency of variants can also be used as an indicator of the relative quantity of the variant in the total sample.

    [0104] In some embodiments, a microbial contaminant is identified based on the calling step. For example, a particular sequence variant may indicate contamination by a potentially infectious microbe. Sequence variants may be identified within a highly conserved polynucleotide for the purpose of identifying a microbe. Exemplary highly conserved polynucleotides useful in the phylogenetic characterization and identification of microbes comprise nucleotide sequences found in the 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, 5.8S rRNA gene, 12S rRNA gene, 18S rRNA gene, 28S rRNA gene, gyrB gene, rpoB gene, fusA gene, recA gene, coxl gene and nifD gene. With eukaryotes, the rRNA gene can be nuclear, mitochondrial, or both. In some embodiments, sequence variants in the 16S-23S rRNA gene internal transcribed spacer (ITS) can be used for differentiation and identification of closely related taxa with or without the use of other rRNA genes. Due to structural constraints of 16S rRNA, specific regions throughout the gene have a highly conserved polynucleotide seqeuence although non-structural segments may have a high degree of variability.

    [0105] Identifying sequence variants can be used to identify operational taxonomic units (OTUs) that represent a subgenus, a genus, a subfamily, a family, a sub-order, an order, a sub-class, a class, a sub-phylum, a phylum, a sub-kingdom, or a kingdom, and optionally determine their frequency in a population. The detection of particular sequence variants can be used in detection presence, and optionally amount (relative or absolute) of a microbe indicative of contamination. Example applications include water quality testing for fecal or other contamination, testing for animal or human pathogens, pinpointing sources of water contamination, testing reclaimed or recycled water, testing sewage discharge streams including ocean discharge plumes, monitoring of aquaculture facilities for pathogens, monitoring beaches, swimming areas or other water related recreational facilities and predicting toxic alga blooms. Food monitoring applications include the periodic testing of production lines at food processing plants, surveying slaughter houses, inspecting the kitchens and food storage areas of restaurants, hospitals, schools, correctional facilities and other institutions for food borne pathogens such as E. coli strains O157:H7 or 0111:B4, Listeria monocytogenes, or Salmonella enterica subsp. enterica serovar Enteritidis. Shellfish and shellfish producing waters can be surveyed for alga responsible for paralytic shellfish poisoning, neurotoxic shellfish poisoning, diarrhetic shellfish poisoning and amnesic shellfish poisoning. Additionally, imported foodstuffs can be screened while in customs before release to ensure food security. Plant pathogen monitoring applications include horticulture and nursery monitoring for instance the monitoring for Phytophthora ramorum, the microorganism responsible for Sudden Oak Death, crop pathogen surveillance and disease management and forestry pathogen surveillance and disease management. Manufacturing environments for pharmaceuticals, medical devices, and other consumables or critical components where microbial contamination is a major safety concern can be surveyed for the presence of specific pathogens like Pseudomonas aeruginosa, or Staphylococcus aureus, the presence of more common microorganisms associated with humans, microorganisms associated with the presence of water or others that represent the bioburden that was previously identified in that particular environment or in similar ones. Similarly, the construction and assembly areas for sensitive equipment including space craft can be monitored for previously identified microorganism that are known to inhabit or are most commonly introduced into such environments.

    [0106] In one aspect, the disclosure provides a method of identifying a sequence variant in a nucleic acid sample comprising less than 50 ng of polynucleotides, each polynucleotide having a 5 end and a 3 end. In some embodiments, the method comprises: (a) circularizing with a ligase individual polynucleotides in said sample to form a plurality of circular polynucleotides; (b) upon separating said ligase from said circular polynucleotides, amplifying the circular polynucleotides to form concatemers; (c) sequencing the concatemers to produce a plurality of sequencing reads; (d) identifying sequence differences between the plurality of sequencing reads and a reference sequence; and (e) calling a sequence difference that occurs with a frequency of 0.05% or higher in said plurality of reads from said nucleic acid sample of less than 50ng polynucleotides as the sequence variant.

    [0107] The starting amount of polynucleotides in a sample may be small. In some embodiments, the amount of starting polynucleotides is less than 50 ng, such as less than 45 ng, 40 ng, 35 ng, 30 ng, 25 ng, 20 ng, 15 ng, 10 ng, 5 ng, 4 ng, 3 ng, 2 ng, 1 ng, 0.5 ng, 0.1 ng, or less. In some embodiments, the amount of starting polynucleotides is in the range of 0.1-100 ng, such as between 1-75 ng, 5-50 ng, or 10-20 ng. In general, lower starting material increases the importance of increases recovery from various processing steps. Processes that reduce the amount of polynucleotides in a sample for participation in a subsequent reaction decrease the sensitivity with which rare mutations can be detected. For example, methods described by Lou et al. (PNAS, 2013, 110 (49)) are expected to recover only 10-20% of the starting material. For large amounts of starting material (e.g. as purified from lab-cultured bacteria), this may not be a substantial obstacle. However, for samples where the starting material is substantially lower, recovery in this low range can be a substantial obstacle to detection of sufficiently rare variants. Accordingly, in some embodiments, sample recovery from one step to another in a method of the disclosure (e.g. the mass fraction of input into a circularization step available for input into a subsequent amplification step or sequencing step) is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, or more. Recovery from a particular step may be close to 100%. Recovery may be with respect to a particular form, such as recovery of circular polynucleotides from an input of non-circular polynucleotides.

    [0108] The polynucleotides may be from any suitable sample, such as a sample described herein with respect to the various aspects of the disclosure. Polynucleotides from a sample may be any of a variety of polynucleotides, including but not limited to, DNA, RNA, ribosomal RNA (rRNA), transfer RNA (tRNA), micro RNA (miRNA), messenger RNA (mRNA), fragments of any of these, or combinations of any two or more of these. In some embodiments, samples comprise DNA. In some embodiments, the polynucleotides are single-stranded, either as obtained or by way of treatment (e.g. denaturation). Further examples of suitable polynucleotides are described herein, such as with respect to any of the various aspects of the disclosure. In some embodiments, polynucleotides are subjected to subsequent steps (e.g. circularization and amplification) without an extraction step, and/or without a purification step. For example, a fluid sample may be treated to remove cells without an extraction step to produce a purified liquid sample and a cell sample, followed by isolation of DNA from the purified fluid sample. A variety of procedures for isolation of polynucleotides are available, such as by precipitation or non-specific binding to a substrate followed by washing the substrate to release bound polynucleotides. Where polynucleotides are isolated from a sample without a cellular extraction step, polynucleotides will largely be extracellular or cell-free polynucleotides, which may correspond to dead or damaged cells. The identity of such cells may be used to characterize the cells or population of cells from which they are derived, such as in a microbial community. If a sample is treated to extract polynucleotides, such as from cells in a sample, a variety of extraction methods are available, examples of which are provided herein (e.g. with regard to any of the various aspects of the disclosure).

    [0109] The sequence variant in the nucleic acid sample can be any of a variety of sequence variants. Multiple non-limiting examples of sequence variants are described herein, such as with respect to any of the various aspects of the disclosure. In some embodiments the sequence variant is a single nucleotide polymorphism (SNP). In some embodiments, the sequence variant occurs with a low frequency in the population (also referred to as a rare sequence variant). For example, the sequence variant may occur with a frequency of about or less than about 5%, 4%, 3%, 2%, 1.5%, 1%, 0.75%, 0.5%, 0.25%, 0.1%, 0.075%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.005%, 0.001%, or lower. In some embodiments, the sequence variant occurs with a frequency of about or less than about 0.1%.

    [0110] According to some embodiments, polynucleotides of a sample are circularized, such as by use of a ligiase. Circularization can include joining the 5 end of a polynucleotide to the 3 end of the same polynucleotide, to the 3 end of another polynucleotide in the sample, or to the 3 end of a polynucleotide from a different source (e.g. an artificial polynucleotide, such as an oligonucleotide adapter). In some embodiments, the 5 end of a polynucleotide is joined to the 3 end of the same polynucleotide (also referred to as self-joining). Non-limiting examples of circularization processes (e.g. with and without adapter oligonucleotides), reagents (e.g. types of adapters, use of ligases), reaction conditions (e.g. favoring self-joining), and optional additional processing (e.g. post-reaction purification) are provided herein, such as with regard to any of the various aspects of the disclosure.

    [0111] In general, joining ends of a polynucleotide to one-another to form a circular polynucleotide (either directly, or with one or more intermediate adapter oligonucleotides) produces a junction having a junction sequence. Where the 5 end and 3 end of a polynucleotide are joined via an adapter polynucleotide, the term junction can refer to a junction between the polynucleotide and the adapter (e.g. one of the 5 end junction or the 3 end junction), or to the junction between the 5 end and the 3 end of the polynucleotide as formed by and including the adapter polynucleotide. Where the 5 end and the 3 end of a polynucleotide are joined without an intervening adapter (e.g. the 5 end and 3 end of a single-stranded DNA), the term junction refers to the point at which these two ends are joined. A junction may be identified by the sequence of nucleotides comprising the junction (also referred to as the junction sequence). In some embodiments, samples comprise polynucleotides having a mixture of ends formed by natural degradation processes (such as cell lysis, cell death, and other processes by which DNA is released from a cell to its surrounding environment in which it may be further degraded, such as in cell-free polynucleotides), fragmentation that is a byproduct of sample processing (such as fixing, staining, and/or storage procedures), and fragmentation by methods that cleave DNA without restriction to specific target sequences (e.g. mechanical fragmentation, such as by sonication; non-sequence specific nuclease treatment, such as DNase I, fragmentase). Where samples comprise polynucleotides having a mixture of ends, the likelihood that two polynucleotides will have the same 5 end or 3 end is low, and the likelihood that two polynucleotides will independently have both the same 5 end and 3 end is extremely low. Accordingly, in some embodiments, junctions may be used to distinguish different polynucleotides, even where the two polynucleotides comprise a portion having the same target sequence. Where polynucleotide ends are joined without an intervening adapter, a junction sequence may be identified by alignment to a reference sequence. For example, where the order of two component sequences appears to be reversed with respect to the reference sequence, the point at which the reversal appears to occur may be an indication of a junction at that point. Where polynucleotide ends are joined via one or more adapter sequences, a junction may be identified by proximity to the known adapter sequence, or by alignment as above if a sequencing read is of sufficient length to obtain sequence from both the 5 and 3 ends of the circularized polynucleotide. In some embodiments, the formation of a particular junction is a sufficiently rare event such that it is unique among the circularized polynucleotides of a sample.

    [0112] After circularization, reaction products may be purified prior to amplification or sequencing to increase the relative concentration or purity of circularized polynucleotides available for participating in subsequence steps (e.g. by isolation of circular polynucleotides or removal of one or more other molecules in the reaction). For example, a circularization reaction or components thereof may be treated to remove single-stranded (non-circularized) polynucleotides, such as by treatment with an exonuclease. As a further example, a circularization reaction or portion thereof may be subjected to size exclusion chromatography, whereby small reagents are retained and discarded (e.g. unreacted adapters), or circularization products are retained and released in a separate volume. A variety of kits for cleaning up ligation reactions are available, such as kits provided by Zymo oligo purification kits made by Zymo Research. In some embodiments, purification comprises treatment to remove or degrade ligase used in the circularization reaction, and/or to purify circularized polynucleotides away from such ligase. In some embodiments, treatment to degrade ligase comprises treatment with a protease. Suitable proteases are available from prokaryotes, viruses, and eukaryotes. Examples of proteases include proteinase K (from Tritirachium album), pronase E (from Streptomyces griseus), Bacillus polymyxa protease, theromolysin (from thermophilic bacteria), trypsin, subtilisin, furin, and the like. In some embodiments, the protease is proteinase K. Protease treatment may follow manufacturer protocols, or subjected to standard conditions (e.g. as provided in Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th Edition (2012)). Protease treatment may also be followed by extraction and precipitation. In one example, circularized polynucleotides are purified by proteinase K (Qiagen) treatment in the presence of 0.1% SDS and 20 mM EDTA, extracted with 1:1 phenol/chloroform and chloroform, and precipitated with ethanol or isopropanol. In some embodiments, precipitation is in ethanol.

    [0113] As described with respect to other aspects of the disclosure, circularization may be followed directly by sequencing the circularized polynucleotides. Alternatively, sequencing may be preceded by one or more amplification reactions. A variety of methods of amplifying polynucleotides (e.g. DNA and/or RNA) are available. Amplification may be linear, exponential, or involve both linear and exponential phases in a multi-phase amplification process. Amplification methods may involve changes in temperature, such as a heat denaturation step, or may be isothermal processes that do not require heat denaturation. Non-limiting examples of suitable amplification processes are described herein, such as with regard to any of the various aspects of the disclosure. In some embodiments, amplification comprises rolling circle amplification (RCA). As described elsewhere herein, a typical RCA reaction mixture comprises one or more primers, a polymerase, and dNTPs, and produces concatemers. Typically, the polymerase in an RCA reaction is a polymerase having strand-displacement activity. A variety of such polymerases are available, non-limiting examples of which include exonuclease minus DNA Polymerase I large (Klenow) Fragment, Phi29 DNA polymerase, Taq DNA Polymerase and the like. In general, a concatemer is a polynucleotide amplification product comprising two or more copies of a target sequence from a template polynucleotide (e.g. about or more than about 2, 3, 4, 5, 6, 7, 8, 9,10, or more copies of the target sequence; in some embodiments, about or more than about 2 copies). Amplification primers may be of any suitable length, such as about or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, or more nucleotides, any portion or all of which may be complementary to the corresponding target sequence to which the primer hybridizes (e.g. about, or at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more nucleotides). Examples of various RCA processes are described herein, such as the use of random primers, target-specific primers, and adapter-targeted primers, some of which are illustrated in FIG. 7.

    [0114] Where circularized polynucleotides are amplified prior to sequencing (e.g. to produce concatemers), amplified products may be subjected to sequencing directly without enrichment, or subsequent to one or more enrichment steps. Non-limiting examples of suitable enrichment processes are described herein, such as with respect to any of the various aspects of the disclosure (e.g. use of B2B primers for a second amplification step). According to some embodiments, circularized polynucleotides (or amplification products thereof, which may have optionally been enriched) are subjected to a sequencing reaction to generate sequencing reads. Sequencing reads produced by such methods may be used in accordance with other methods disclosed herein. A variety of sequencing methodologies are available, particularly high-throughput sequencing methodologies. Examples include, without limitation, sequencing systems manufactured by Illumina (sequencing systems such as HiSeq and MiSeq), Life Technologies (Ion Torrent, SOLiD, etc.), Roche's 454 Life Sciences systems, Pacific Biosciences systems, etc. In some embodiments, sequencing comprises use of HiSeq and MiSeq systems to produce reads of about or more than about 50, 75, 100, 125, 150, 175, 200, 250, 300, or more nucleotides in length. Additional non-limiting examples of amplification platforms and methodologies are described herein, such as with respect to any of the various aspects of the disclosure.

    [0115] According to some embodiments, a sequence difference between sequencing reads and a reference sequence are called as a genuine sequence variant (e.g. existing in the sample prior to amplification or sequencing, and not a result of either of these processes) if it occurs in at least two different polynucleotides (e.g. two different circular polynucleotides, which can be distinguished as a result of having different junctions). Because sequence variants that are the result of amplification or sequencing errors are unlikely to be duplicated exactly (e.g. position and type) on two different polynucleotides comprising the same target sequence, adding this validation parameter greatly reduces the background of erroneous sequence variants, with a concurrent increase in the sensitivity and accuracy of detecting actual sequence variation in a sample. In some embodiments, a sequence variant having a frequency of about or less than about 5%, 4%, 3%, 2%, 1.5%, 1%, 0.75%, 0.5%, 0.25%, 0.1%, 0.075%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.005%, 0.001%, or lower is sufficiently above background to permit an accurate call. In some embodiments, the sequence variant occurs with a frequency of about or less than about 0.1%. In some embodiments, the method comprises calling as a genuine sequence variant, those sequence differences having a frequency in the range of about 0.0005% to about 3%, such as between 0.001%-2%, or 0.01%-1%. In some embodiments, the frequency of a sequence variant is sufficiently above background when such frequency is statistically significantly above the background error rate (e.g. with a p-value of about or less than about 0.05, 0.01, 0.001, 0.0001, or lower). In some embodiments, the frequency of a sequence variant is sufficiently above background when such frequency is about or at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 25-fold, 50-fold, 100-fold, or more above the background error rate (e.g. at least 5-fold higher). In some embodiments, the background error rate in accurately determining the sequence at a given position is about or less than about 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, 0.0005%, or lower. In some embodiments, the error rate is lower than 0.001%. Methods for determining frequency and error rate are described herein, such as with regard to any of the various aspects of the disclosure.

    [0116] In some embodiments, identifying a genuine sequence variant (also referred to as calling or making a call) comprises optimally aligning one or more sequencing reads with a reference sequence to identify differences between the two, as well as to identify junctions. In general, alignment involves placing one sequence along another sequence, iteratively introducing gaps along each sequence, scoring how well the two sequences match, and preferably repeating for various positions along the reference. The best-scoring match is deemed to be the alignment and represents an inference about the degree of relationship between the sequences. A variety of alignment algorithms and aligners implementing them are available, non-limiting examples of which are described herein, such as with respect to any of the various aspects of the disclosure. In some embodiments, a reference sequence to which sequencing reads are compared is a known reference sequence, such as a reference genome (e.g. the genome of a member of the same species as the subject). A reference genome may be complete or incomplete. In some embodiments, a reference genome consists only of regions containing target polynucleotides, such as from a reference genome or from a consensus generated from sequencing reads under analysis. In some embodiments, a reference sequence comprises or consists of sequences of polynucleotides of one or more organisms, such as sequences from one or more bacteria, archaea, viruses, protists, fungi, or other organism. In some embodiments, the reference sequence consists of only a portion of a reference genome, such as regions corresponding to one or more target sequences under analysis (e.g. one or more genes, or portions thereof). For example, for detection of a pathogen (such as in the case of contamination detection), the reference genome is the entire genome of the pathogen (e.g. HIV, HPV, or a harmful bacterial strain, e.g. E. coli), or a portion thereof useful in identification, such as of a particular strain or serotype. In some embodiments, sequencing reads are aligned to multiple different reference sequences, such as to screen for multiple different organisms or strains. Additional non-limiting examples of reference sequences with respect to which sequence differences may be identified (and sequence variants called) are described herein, such as with respect to any of the various aspects of the disclosure.

    [0117] In one aspect, the disclosure provides a method of amplifying in a reaction mixture a plurality of different concatemers comprising two or more copies of a target sequence, wherein the target sequence comprises sequence A and sequence B oriented in a 5 to 3 direction. In some embodiments, the method comprises subjecting the reaction mixture to a nucleic acid amplification reaction, wherein the reaction mixture comprises: (a) the plurality of concatemers, wherein individual concatemers in the plurality comprise different junctions formed by circularizing individual polynucleotides having a 5 end and a 3 end; (b) a first primer comprising sequence A, wherein the first primer specifically hybridizes to sequence A of the target sequence via sequence complementarity between sequence A and sequence A; (c) a second primer comprising sequence B, wherein the second primer specifically hybridizes to sequence B present in a complementary polynucleotide comprising a complement of the target sequence via sequence complementarity between sequence B and B; and (d) a polymerase that extends the first primer and the second primer to produce amplified polynucleotides; wherein the distance between the 5 end of sequence A and the 3 end of sequence B of the target sequence is 75nt or less.

    [0118] In a related aspect, the disclosure provides a method of amplifying in a reaction mixture a plurality of different circular polynucleotides comprising a target sequence, wherein the target sequence comprises sequence A and sequence B oriented in a 5 to 3 direction. In some embodiments, the method comprises subjecting the reaction mixture to a nucleic acid amplification reaction, wherein the reaction mixture comprises: (a) the plurality of circular polynucleotides, wherein individual circular polynucleotides in the plurality comprise different junctions formed by circularizing individual polynucleotides having a 5 end and a 3 end; (b) a first primer comprising sequence A, wherein the first primer specifically hybridizes to sequence A of the target sequence via sequence complementarity between sequence A and sequence A; (c) a second primer comprising sequence B, wherein the second primer specifically hybridizes to sequence B present in a complementary polynucleotide comprising a complement of the target sequence via sequence complementarity between sequence B and B; and (d) a polymerase that extends the first primer and the second primer to produce amplified polynucleotides; wherein sequence A and sequence B are endogenous sequences, and the distance between the 5 end of sequence A and the 3 end of sequence B of the target sequence is 75nt or less.

    [0119] Whether amplifying circular polynucleotides or concatemers, such polynucleotides may be from any suitable sample sources (either directly, or indirectly, such as by amplification). A variety of suitable sample sources, optional extraction processes, types of polynucleotides, and types of sequence variants are described herein, such as with respect to any of the various aspects of the disclosure. Circular polynucleotides may be derived from circularizing non-circular polynucleotides.

    [0120] Non-limiting examples of circularization processes (e.g. with and without adapter oligonucleotides), reagents (e.g. types of adapters, use of ligases), reaction conditions (e.g. favoring self-joining), optional additional processing (e.g. post-reaction purification), and the junctions formed thereby are provided herein, such as with regard to any of the various aspects of the disclosure. Concatemers may be derived from amplification of circular polynucleotides. A variety of methods of amplifying polynucleotides (e.g. DNA and/or RNA) are available, non-limiting examples of which have also been described herein. In some embodiments, concatemers are generated by rolling circle amplification of circular polynucleotides.

    [0121] FIG. 10 illustrates an example arrangement of the first and second primer with respect to a target sequence in the context of a single repeat (which will typically not be amplified unless circular) and concatemers comprising multiple copies of the target sequence. As noted with regard to other aspects described herein, this arrangement of primers may be referred to as back to back (B2B) or inverted primers. Amplification with B2B primers facilitates enrichment of circular and/or concatemeric templates. Moreover, this orientation combined with a relatively smaller footprint (total distance spanned by a pair of primers) permits amplification of a wider variety of fragmentation events around a target sequence, as a junction is less likely to occur between primers than in the arrangement of primers found in atypical amplification reaction (facing one another, spanning a target sequence). In some embodiments, the distance between the 5 end of sequence A and the 3 end of sequence B is about or less than about 200, 150, 100, 75, 50, 40, 30, 25, 20, 15, or fewer nucleotides. In some embodiments, sequence A is the complement of sequence B. In some embodiments, multiple pairs of B2B primers directed to a plurality of different target sequences are used in the same reaction to amplify a plurality of different target sequences in parallel (e.g. about or at least about 10, 50, 100, 150, 200, 250, 300, 400, 500, 1000, 2500, 5000, 10000, 15000, or more different target sequences). Primers can be of any suitable length, such as described elsewhere herein. Amplification may comprise any suitable amplification reaction under appropriate conditions, such as an amplification reaction described herein. In some embodiments, amplification is a polymerase chain reaction.

    [0122] In some embodiments, B2B primers comprise at least two sequence elements, a first element that hybridizes to a target sequence via sequence complementarity, and a 5 tail that does not hybridize to the target sequence during a first amplification phase at a first hybridization temperature during which the first element hybridizes (e.g. due to lack of sequence complementarity between the tail and the portion of the target sequence immediately 3 with respect to where the first element binds). For example, the first primer comprises sequence C 5 with respect to sequence A, the second primer comprises sequence D 5 with respect to sequence B, and neither sequence C nor sequence D hybridize to the plurality of concatemers (or circular polynucleotides) during a first amplification phase at a first hybridization temperature. In some embodiments in which such tailed primers are used, amplification can comprise a first phase and a second phase; the first phase comprises a hybridization step at a first temperature, during which the first and second primers hybridize to the concatemers (or circular polynucleotides) and primer extension; and the second phase comprises a hybridization step at a second temperature that is higher than the first temperature, during which the first and second primers hybridize to amplification products comprising extended first or second primers, or complements thereof, and primer extension. The number of amplification cycles at each of the two temperatures can be adjusted based on the products desired. Typically, the first temperature will be used for a relatively low number of cycles, such as about or less than about 15, 10, 9, 8, 7, 6, 5, or fewer cycles. The number of cycles at the higher temperature can be selected independently of the number of cycles at the first temperature, but will typically be as many or more cycles, such as about or at least about 5, 6, 7, 8, 9, 10, 15, 20, 25, or more cycles. The higher temperature favors hybridization between along the first element and tail element of the primer in primer extension products over shorter fragments formed by hybridization between only the first element in a primer and an internal target sequence within a concatemer. Accordingly, the two-phase amplification may be used to reduce the extent to which short amplification products might otherwise be favored, thereby maintaining a relatively higher proportion of amplification products having two or more copies of a target sequence. For example, after 5 cycles (e.g. at least 5, 6, 7, 8, 9, 10, 15, 20, or more cycles) of hybridization at the second temperature and primer extension, at least 5% (e.g. at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, or more) of amplified polynucleotides in the reaction mixture comprise two or more copies of the target sequence. An illustration of an embodiment in accordance with this two-phase, tailed B2B primer amplification process is illustrated in FIG. 11.

    [0123] In some embodiments, amplification is under conditions that are skewed to increase the length of amplicons from concatemers. For example, the primer concentration can be lowered, such that not every priming site will hybridize a primer, thus making the PCR products longer. Similarly, decreasing the primer hybridization time during the cycles will similarly allow fewer primers to hybridize, thus also making the average PCR amplicon size increase. Furthermore, increasing the temperature and/or extension time of the cycles will similarly increase the average length of the PCR amplicons. Any combination of these techniques can be used.

    [0124] In some embodiments, particularly where an amplification with B2B primers has been performed, amplification products are treated to filter the resulting amplicons on the basis of size to reduce and/or eliminate the number of monomers a mixture comprising concatemers. This can be done using a variety of available techniques, including, but not limited to, fragment excision from gels and gel filtration (e.g. to enrich for fragments larger than about 300, 400, 500, or more nucleotides in length); as well as SPRI beads (Agencourt AMPure XP) for size selection by fine-tuning the binding buffer concentration. For example, the use of 0.6 binding buffer during mixing with DNA fragments may be used to preferentially bind DNA fragments larger than about 500 base pairs (bp).

    [0125] In some embodiments, the first primer comprises sequence C 5 with respect to sequence A, the second primer comprises sequence D 5 with respect to sequence B, and neither sequence C nor sequence D hybridize to the plurality of circular polynucleotides during a first amplification phase at a first hybridization temperature. Amplification may comprise a first phase and a second phase; wherein the first phase comprises a hybridization step at a first temperature, during which the first and second primer hybridize to the circular polynucleotides or amplification products thereof prior to primer extension; and the second phase comprises a hybridization step at a second temperature that is higher than the first temperature, during which the first and second primers hybridize to amplification products comprising extended first or second primers or complements thereof For example, the first temperature may be selected as about or more than about the Tm of sequence A, sequence B, or the average of these, or a temperature that is greater than 1 C., 2 C., 3 C., 4 C., 5 C., 6 C., 7 C., 8 C., 9 C., 10 C., or higher than one of these Tm's. In this example, the second temperature may be selected to be about or more than about the Tm of the combined sequence (A+C), the combine sequence (B+D), or the average of these, or a temperature that is greater than 1 C., 2 C., 3 C., 4 C., 5 C., 6 C., 7 C., 8 C., 9 C., 10 C., or higher than one of these Tm's. The term Tm is also referred to as the melting temperature, and generally represents the temperature at which 50% of an oligonucleotide consisting of a reference sequence (which may in fact be a sub-sequence within a larger polynucleotide) and its complementary sequence are hybridized (or separated). In general, Tm increases with increasing length, and as such, the Tm of sequence A is expected to be lower than the Tm of combination sequence (A+C).

    [0126] In one aspect, the disclosure provides a reaction mixture for performing a method in accordance with methods of the disclosure. The reaction mixture can comprise one or more of the various components as described herein with respect to any of the various methods, including reaction mixtures described in methods described herein. In some embodiments, the reaction mixture is a mixture for amplifying a plurality of different concatemers comprising two or more copies of a target sequence, or a circular polynucleotide comprising one or more copies of the target sequences (e.g. a circular monomer), wherein the target sequence comprises sequence A and sequence B oriented in a 5 to 3 direction, the reaction mixture comprising: (a) the plurality of concatemers (or circular polynucleotides), wherein individual concatemers (or circular polynucleotides) in the plurality comprise different junctions formed by circularizing individual polynucleotides having a 5 end and a 3 end; (b) a first primer comprising sequence A, wherein the first primer specifically hybridizes to sequence A of the target sequence via sequence complementarity between sequence A and sequence A; (c) a second primer comprising sequence B, wherein the second primer specifically hybridizes to sequence B present in a complementary polynucleotide comprising a complement of the target sequence via sequence complementarity between B and B; and; (d) a polymerase that extends the first primer and the second primer to produce amplified polynucleotides; wherein the distance between the 5 end of sequence A and the 3 end of sequence B of the target sequence is 75nt or less.

    [0127] Samples, polynucleotides, primers, polymerases, other reagents, and reaction conditions can be any of those described herein, such as with regard to any of the various aspects, which may be included in the reaction mixture in any suitable combination. In some embodiments, the first primer comprises sequence C 5 with respect to sequence A, the second primer comprises sequence D 5 with respect to sequence B, and neither sequence C nor sequence D hybridizes to the two or more concatemers during a first amplification step in an amplification reaction.

    [0128] In one aspect, the disclosure provides compositions useful in or produced by methods described herein, such as in any of the various other aspects of the disclosure. In some embodiments, the composition comprises a plurality of circularized polynucleotides that are single-stranded and substantially free of ligase. In some embodiments, the composition comprises a plurality of concatemers, wherein the plurality of concatemers correspond to a group of 10000 or fewer target polynucleotides, and further wherein individual concatemers in the plurality are characterized in that: (a) they comprise two or more copies of a sequence repeat, wherein all of said copies correspond to the same target polynucleotide; and (b) the junction between the two or more copies of the sequence repeat of one individual concatemer is different from that of another individual concatemer in said composition. Samples, polynucleotides, primers, polymerases, and other reagents can be any of those described herein, such as with regard to any of the various aspects, which may be included in the composition in any suitable combination. The composition may comprise one or more pairs of primers, such as B2B primers described herein, designed to amplify one or more target sequences.

    [0129] Compositions may be provided in the form of kits. Reagents and other materials in a kit may be contained in any suitable container, and may be in an immediately usable form or require combination with other reagents in the kit or reagents supplied by a user (e.g. dilution of a concentrated composition or reconstitution of a lyophilized composition). A kit may provide buffers, non-limiting examples of which include sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof Kits may further comprise instructions for the performance of one or more methods described herein with respect to any of the various aspects. Instructions can be provided in one or more languages (e.g. 2, 3, 4, 5, or more languages).

    [0130] In one aspect, the disclosure provides a system for detecting a sequence variant. In some embodiments, the system comprises (a) a computer configured to receive a user request to perform a detection reaction on a sample; (b) an amplification system that performs a nucleic acid amplification reaction on the sample or a portion thereof in response to the user request, wherein the amplification reaction comprises the steps of (i) circularizing individual polynucleotides to form a plurality of circular polynucleotides, each of which having a junction between the 5 end and 3 end; and (ii) amplifying the circular polynucleotides; (c) a sequencing system that generates sequencing reads for polynucleotides amplified by the amplification system, identifies sequence differences between sequencing reads and a reference sequence, and calls a sequence difference that occurs in at least two circular polynucleotides having different junctions as the sequence variant; and (d) a report generator that sends a report to a recipient, wherein the report contains results for detection of the sequence variant. In some embodiments, the recipient is the user. FIG. 32 illustrates a non-limiting example of a system useful in the methods of the present disclosure.

    [0131] A computer for use in the system can comprise one or more processors. Processors may be associated with one or more controllers, calculation units, and/or other units of a computer system, or implanted in firmware as desired. If implemented in software, the routines may be stored in any computer readable memory such as in RAM, ROM, flash memory, a magnetic disk, a laser disk, or other suitable storage medium. Likewise, this software may be delivered to a computing device via any known delivery method including, for example, over a communication channel such as a telephone line, the internet, a wireless connection, etc., or via a transportable medium, such as a computer readable disk, flash drive, etc. The various steps may be implemented as various blocks, operations, tools, modules and techniques which, in turn, may be implemented in hardware, firmware, software, or any combination of hardware, firmware, and/or software. When implemented in hardware, some or all of the blocks, operations, techniques, etc. may be implemented in, for example, a custom integrated circuit (IC), an application specific integrated circuit (ASIC), a field programmable logic array (FPGA), a programmable logic array (PLA), etc. A client-server, relational database architecture can be used in embodiments of the system. A client-server architecture is a network architecture in which each computer or process on the network is either a client or a server.

    [0132] Server computers are typically powerful computers dedicated to managing disk drives (file servers), printers (print servers), or network traffic (network servers). Client computers include PCs (personal computers) or workstations on which users run applications, as well as example output devices as disclosed herein. Client computers rely on server computers for resources, such as files, devices, and even processing power. In some embodiments, the server computer handles all of the database functionality. The client computer can have software that handles all the front-end data management and can also receive data input from users.

    [0133] The system can be configured to receive a user request to perform a detection reaction on a sample. The user request may be direct or indirect. Examples of direct request include those transmitted by way of an input device, such as a keyboard, mouse, or touch screen). Examples of indirect requests include transmission via a communication medium, such as over the internet (either wired or wireless).

    [0134] The system can further comprise an amplification system that performs a nucleic acid amplification reaction on the sample or a portion thereof in response to the user request. A variety of methods of amplifying polynucleotides (e.g. DNA and/or RNA) are available. Amplification may be linear, exponential, or involve both linear and exponential phases in a multi-phase amplification process. Amplification methods may involve changes in temperature, such as a heat denaturation step, or may be isothermal processes that do not require heat denaturation. Non-limiting examples of suitable amplification processes are described herein, such as with regard to any of the various aspects of the disclosure. In some embodiments, amplification comprises rolling circle amplification (RCA).

    [0135] A variety of systems for amplifying polynucleotides are available, and may vary based on the type of amplification reaction to be performed. For example, for amplification methods that comprise cycles of temperature changes, the amplification system may comprise a thermocycler. An amplification system can comprise a real-time amplification and detection instrument, such as systems manufactured by Applied Biosystems, Roche, and Strategene. In some embodiments, the amplification reaction comprises the steps of (i) circularizing individual polynucleotides to form a plurality of circular polynucleotides, each of which having a junction between the 5 end and 3 end; and (ii) amplifying the circular polynucleotides. Samples, polynucleotides, primers, polymerases, and other reagents can be any of those described herein, such as with regard to any of the various aspects.

    [0136] Non-limiting examples of circularization processes (e.g. with and without adapter oligonucleotides), reagents (e.g. types of adapters, use of ligases), reaction conditions (e.g. favoring self-joining), optional additional processing (e.g. post-reaction purification), and the junctions formed thereby are provided herein, such as with regard to any of the various aspects of the disclosure. Systems can be selected and or designed to execute any such methods.

    [0137] Systems may further comprise a sequencing system that generates sequencing reads for polynucleotides amplified by the amplification system, identifies sequence differences between sequencing reads and a reference sequence, and calls a sequence difference that occurs in at least two circular polynucleotides having different junctions as the sequence variant. The sequencing system and the amplification system may be the same, or comprise overlapping equipment. For example, both the amplification system and sequencing system may utilize the same thermocycler. A variety of sequencing platforms for use in the system are available, and may be selected based on the selected sequencing method. Examples of sequencing methods are described herein. Amplification and sequencing may involve the use of liquid handlers. Several commercially available liquid handling systems can be utilized to run the automation of these processes (see for example liquid handlers from Perkin-Elmer, Beckman Coulter, Caliper Life Sciences, Tecan, Eppendorf, Apricot Design, Velocity 11 as examples). A variety of automated sequencing machines are commercially available, and include sequencers manufactured by Life Technologies (SOLiD platform, and pH-based detection), Roche (454 platform), Illumina (e.g. flow cell based systems, such as Genome Analyzer devices).

    [0138] Transfer between 2, 3, 4, 5, or more automated devices (e.g. between one or more of a liquid handler and a sequencing device) may be manual or automated.

    [0139] Methods for identifying sequence differences and calling sequence variants with respect to a reference sequence are described herein, such as with regard to any of the various aspects of the disclosure. The sequencing system will typically comprise software for performing these steps in response to an input of sequencing data and input of desired parameters (e.g. selection of a reference genome). Examples of alignment algorithms and aligners implementing these algorithms are described herein, and may form part of the sequencing system.

    [0140] The system can further comprise a report generator that sends a report to a recipient, wherein the report contains results for detection of the sequence variant. A report may be generated in real-time, such as during a sequencing read or while sequencing data is being analyzed, with periodic updates as the process progresses. In addition, or alternatively, a report may be generated at the conclusion of the analysis. The report may be generated automatically, such when the sequencing system completes the step of calling all sequence variants. In some embodiments, the report is generated in response to instructions from a user. In addition to the results of detection of the sequence variant, a report may also contain an analysis based on the one or more sequence variants.

    [0141] For example, where one or more sequence variants are associated with a particular contaminant or phenotype, the report may include information concerning this association, such as a likelihood that the contaminant or phenotype is present, at what level, and optionally a suggestion based on this information (e.g. additional tests, monitoring, or remedial measures). The report can take any of a variety of forms. It is envisioned that data relating to the present disclosure can be transmitted over such networks or connections (or any other suitable means for transmitting information, including but not limited to mailing a physical report, such as a print-out) for reception and/or for review by a receiver. The receiver can be but is not limited to an individual, or electronic system (e.g. one or more computers, and/or one or more servers).

    [0142] In one aspect, the disclosure provides a computer-readable medium comprising codes that, upon execution by one or more processors, implement a method of detecting a sequence variant. In some embodiments, the implemented method comprises: (a) receiving a customer request to perform a detection reaction on a sample; (b) performing a nucleic acid amplification reaction on the sample or a portion thereof in response to the customer request, wherein the amplification reaction comprises the steps of (i) circularizing individual polynucleotides to form a plurality of circular polynucleotides, each of which having a junction between the 5 end and 3 end; and (ii) amplifying the circular polynucleotides; (c) performing a sequencing analysis comprising the steps of (i) generating sequencing reads for polynucleotides amplified in the amplification reaction; (ii) identifying sequence differences between sequencing reads and a reference sequence; and (iii) calling a sequence difference that occurs in at least two circular polynucleotides having different junctions as the sequence variant; and (d) generating a report that contains results for detection of the sequence variant.

    [0143] A machine readable medium comprising computer-executable code may take many forms, including but not limited to, a tangible storage medium, a carrier wave medium or physical transmission medium. Non-volatile storage media include, for example, optical or magnetic disks, such as any of the storage devices in any computers) or the like, such as may be used to implement the databases, etc. Volatile storage media include dynamic memory, such as main memory of such a computer platform. Tangible transmission media include coaxial cables; copper wire and fiber optics, including the wires that comprise a bus within a computer system. Carrier-wave transmission media may take the form of electric or electromagnetic signals, or acoustic or light waves such as those generated during radio frequency (RF) and infrared (IR) data communications. Common forms of computer-readable media therefore include for example: a floppy disk, a flexible disk, hard disk, magnetic tape, any other magnetic medium, a CD-ROM, DVD or DVD-ROM, any other optical medium, punch cards paper tape, any other physical storage medium with patterns of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other memory chip or cartridge, a carrier wave transporting data or instructions, cables or links transporting such a carrier wave, or any other medium from which a computer may read programming code and/or data. Many of these forms of computer readable media may be involved in carrying one or more sequences of one or more instructions to a processor for execution.

    [0144] The subject computer-executable code can be executed on any suitable device comprising a processor, including a server, a PC, or a mobile device such as a smartphone or tablet. Any controller or computer optionally includes a monitor, which can be a cathode ray tube (CRT) display, a flat panel display (e.g., active matrix liquid crystal display, liquid crystal display, etc.), or others.

    [0145] Computer circuitry is often placed in a box, which includes numerous integrated circuit chips, such as a microprocessor, memory, interface circuits, and others. The box also optionally includes a hard disk drive, a floppy disk drive, a high capacity removable drive such as a writeable CD-ROM, and other common peripheral elements. Inputting devices such as a keyboard, mouse, or touch-sensitive screen, optionally provide for input from a user. The computer can include appropriate software for receiving user instructions, either in the form of user input into a set of parameter fields, e.g., in a GUI, or in the form of preprogrammed instructions, e.g., preprogrammed for a variety of different specific operations.

    [0146] In some embodiments of any of the various aspects disclosed herein, the methods, compositions, and systems have therapeutic applications, such as in the characterization of a patient sample and optionally diagnosis of a condition of a subject. Therapeutic applications may also include informing the selection of therapies to which a patient may be most responsive (also referred to as theranostics), and actual treatment of a subject in need thereof, based on the results of a method described herein. In particular, methods and compositions disclosed herein may be used to diagnose tumor presence, progression and/or metastasis of tumors, especially when the polynucleotides analyzed comprise or consist of cfDNA, ctDNA, or fragmented tumor DNA. In some embodiments, a subject is monitored for treatment efficacy. For example, by monitoring ctDNA over time, a decrease in ctDNA can be used as an indication of efficacious treatment, while increases can facilitate selection of different treatments or different dosages. Other uses include evaluations of organ rejection in transplant recipients (where increases in the amount of circulating DNA corresponding to the transplant donor genome is used as an early indicator of transplant rejection), and genotyping/isotyping of pathogen infections, such as viral or bacterial infections. Detection of sequence variants in circulating fetal DNA may be used to diagnose a condition of a fetus.

    [0147] As used herein, treatment or treating, or palliating or ameliorating are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit. By therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested. Typically, prophylactic benefit includes reducing the incidence and/or worsening of one or more diseases, conditions, or symptoms under treatment (e.g. as between treated and untreated populations, or between treated and untreated states of a subject). Improving a treatment outcome may include diagnosing a condition of a subject in order to identify the subject as one that will or will not benefit from treatment with one or more therapeutic agents, or other therapeutic intervention (such as surgery). In such diagnostic applications, the overall rate of successful treatment with the one or more therapeutic agents may be improved, relative to its effectiveness among patients grouped without diagnosis according to a method of the present disclosure (e.g. an improvement in a measure of therapeutic efficacy by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more).

    [0148] The terms subject, individual, and patient are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells, and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.

    [0149] The terms therapeutic agent, therapeutic capable agent or treatment agent are used interchangeably and refer to a molecule or compound that confers some beneficial effect upon administration to a subject. The beneficial effect includes enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.

    [0150] In some embodiments of the various methods described herein, the sample is from a subject.

    [0151] A subject can be any organism, non-limiting examples of which include plants, animals, fungi, protists, monerans, viruses, mitochondria, and chloroplasts. Sample polynucleotides can be isolated from a subject, such as a cell sample, tissue sample, bodily fluid sample, or organ sample (or cell cultures derived from any of these), including, for example, cultured cell lines, biopsy, blood sample, cheek swab, or fluid sample containing a cell (e.g. saliva). In some cases, the sample does not comprise intact cells, is treated to remove cells, or polynucleotides are isolated without a cellular extractions step (e.g. to isolate cell-free polynucleotides, such as cell-free DNA). Other examples of sample sources include those from blood, urine, feces, nares, the lungs, the gut, other bodily fluids or excretions, materials derived therefrom, or combinations thereof. The subject may be an animal, including but not limited to, a cow, a pig, a mouse, a rat, a chicken, a cat, a dog, etc., and is usually a mammal, such as a human. In some embodiments, the sample comprises tumor cells, such as in a sample of tumor tissue from a subject. In some embodiments, the sample is a blood sample or a portion thereof (e.g. blood plasma or serum). Serum and plasma may be of particular interest, due to the relative enrichment for tumor DNA associated with the higher rate of malignant cell death among such tissues. A sample may be a fresh sample, or a sample subjected to one or more storage processes (e.g. paraffin-embedded samples, particularly formalin-fixed paraffin-embedded (FFPE) sample). In some embodiments, a sample from a single individual is divided into multiple separate samples (e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10, or more separate samples) that are subjected to methods of the disclosure independently, such as analysis in duplicate, triplicate, quadruplicate, or more. Where a sample is from a subject, the reference sequence may also be derived from the subject, such as a consensus sequence from the sample under analysis or the sequence of polynucleotides from another sample or tissue of the same subject. For example, a blood sample may be analyzed for ctDNA mutations, while cellular DNA from another sample (e.g. buccal or skin sample) is analyzed to determine the reference sequence.

    [0152] Polynucleotides may be extracted from a sample, with or without extraction from cells in a sample, according to any suitable method. A variety of kits are available for extraction of polynucleotides, selection of which may depend on the type of sample, or the type of nucleic acid to be isolated. Examples of extraction methods are provided herein, such as those described with respect to any of the various aspects disclosed herein. In one example, the sample may be a blood sample, such as a sample collected in an EDTA tube (e.g. BD Vacutainer). Plasma can be separated from the peripheral blood cells by centrifugation (e.g. 10 minutes at 1900g at 4 C.). Plasma separation performed in this way on a 6 mL blood sample will typically yield 2.5 to 3 mL of plasma. Circulating cell-free DNA can be extracted from a plasma sample, such as by using a QIAmp Circulating Nucleic Acid Kit (Qiagene), according the manufacturer's protocol. DNA may then be quantified (e.g. on an Agilent 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent)). As an example, yield of circulating DNA from such a plasma sample from a healthy person may range from 1 ng to 10 ng per mL of plasma, with significantly more in cancer patient samples.

    [0153] Polynucleotides can also be derived from stored samples, such frozen or archived samples. One common method for storing samples is to formalin-fix and paraffin-embed them. However, this process is also associated with degradation of nucleic acids. Polynucleotides processed and analyzed from an FFPE sample may include short polynucleotides, such as fragments in the range of 50-200 base pairs, or shorter. A number of techniques exist for the purification of nucleic acids from fixed paraffin-embedded samples, such as those described in WO2007133703, and methods described by Foss, et al Diagnostic Molecular Pathology, (1994) 3:148-155 and Paska, C., et al Diagnostic Molecular Pathology, (2004) 13:234-240. Commercially available kits may be used for purifying polynucleotides from FFPE samples, such as Ambion's Recoverall Total Nucleic acid Isolation kit. Typical methods start with a step that removes the paraffin from the tissue via extraction with Xylene or other organic solvent, followed by treatment with heat and a protease like proteinase K which cleaves the tissue and proteins and helps to release the genomic material from the tissue. The released nucleic acids can then be captured on a membrane or precipitated from solution, washed to removed impurities and for the case of mRNA isolation, a DNase treatment step is sometimes added to degrade unwanted DNA. Other methods for extracting FFPE DNA are available and can be used in the methods of the present disclosure.

    [0154] In some embodiments, the plurality of polynucleotides comprise cell-free polynucletides, such as cell-free DNA (cfDNA) or circulating tumor DNA (ctDNA). Cell-free DNA circulates in both healthy and diseased individuals. cfDNA from tumors (ctDNA) is not confined to any specific cancer type, but appears to be a common finding across different malignancies. According to some measurements, the free circulating DNA concentration in plasma is about 14-18 ng/ml in control subjects and about 180-318 ng/ml in patients with neoplasias. Apoptotic and necrotic cell death contribute to cell-free circulating DNA in bodily fluids. For example, significantly increased circulating DNA levels have been observed in plasma of prostate cancer patients and other prostate diseases, such as Benign Prostate Hyperplasia and Prostatits. In addition, circulating tumor DNA is present in fluids originating from the organs where the primary tumor occurs. Thus, breast cancer detection can be achieved in ductal lavages; colorectal cancer detection in stool; lung cancer detection in sputum, and prostate cancer detection in urine or ejaculate. Cell-free DNA may be obtained from a variety of sources. One common source is blood samples of a subject. However, cfDNA or other fragmented DNA may be derived from a variety of other sources. For example, urine and stool samples can be a source of cfDNA, including ctDNA.

    [0155] In some embodiments, polynucleotides are subjected to subsequent steps (e.g. circularization and amplification) without an extraction step, and/or without a purification step. For example, a fluid sample may be treated to remove cells without an extraction step to produce a purified liquid sample and a cell sample, followed by isolation of DNA from the purified fluid sample. A variety of procedures for isolation of polynucleotides are available, such as by precipitation or non-specific binding to a substrate followed by washing the substrate to release bound polynucleotides. Where polynucleotides are isolated from a sample without a cellular extraction step, polynucleotides will largely be extracellular or cell-free polynucleotides. For example, cell-free polynucleotides may include cell-free DNA (also called circulating DNA). In some embodiments, the circulating DNA is circulating tumor DNA (ctDNA) from tumor cells, such as from a body fluid or excretion (e.g. blood sample). Tumors frequently show apoptosis or necrosis, such that tumor nucleic acids are released into the body, including the blood stream of a subject, through a variety of mechanisms, in different forms and at different levels. Typically, the size of the ctDNA can range between higher concentrations of smaller fragments, generally 70 to 200 nucleotides in length, to lower concentrations of large fragments of up to thousands kilobases.

    [0156] In some embodiments of any of the various aspects described herein, detecting a sequence variant comprises detecting mutations (e.g. rare somatic mutations) with respect to a reference sequence or in a background of no mutations, where the sequence variant is correlated with disease. In general, sequence variants for which there is statistical, biological, and/or functional evidence of association with a disease or trait are referred to as causal genetic variants. A single causal genetic variant can be associated with more than one disease or trait. In some embodiments, a causal genetic variant can be associated with a Mendelian trait, a non-Mendelian trait, or both. Causal genetic variants can manifest as variations in a polynucleotide, such 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more sequence differences (such as between a polynucleotide comprising the causal genetic variant and a polynucleotide lacking the causal genetic variant at the same relative genomic position). Non-limiting examples of types of causal genetic variants include single nucleotide polymorphisms (SNP), deletion/insertion polymorphisms (DIP), copy number variants (CNV), short tandem repeats (STR), restriction fragment length polymorphisms (RFLP), simple sequence repeats (SSR), variable number of tandem repeats (VNTR), randomly amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLP), inter-retrotransposon amplified polymorphisms (IRAP), long and short interspersed elements (LINE/SINE), long tandem repeats (LTR), mobile elements, retrotransposon microsatellite amplified polymorphisms, retrotransposon-based insertion polymorphisms, sequence specific amplified polymorphism, and heritable epigenetic modification (for example, DNA methylation). A causal genetic variant may also be a set of closely related causal genetic variants. Some causal genetic variants may exert influence as sequence variations in RNA polynucleotides. At this level, some causal genetic variants are also indicated by the presence or absence of a species of RNA polynucleotides. Also, some causal genetic variants result in sequence variations in protein polypeptides. A number of causal genetic variants have been reported. An example of a causal genetic variant that is a SNP is the Hb S variant of hemoglobin that causes sickle cell anemia. An example of a causal genetic variant that is a DIP is the delta508 mutation of the CFTR gene which causes cystic fibrosis. An example of a causal genetic variant that is a CNV is trisomy 21, which causes Down's syndrome. An example of a causal genetic variant that is an STR is tandem repeat that causes Huntington's disease. Non-limiting examples of causal genetic variants and diseases with which they are associated are provided in Table 4. Additional non-limiting examples of causal genetic variants are described in WO2014015084. Further examples of genes in which mutations are associated with diseases, and in which sequence variants may be detected according to a method of the disclosure, are provided in Table 5.

    TABLE-US-00001 TABLE 4 Disease Gene Variant Name 21-Hydroxylase CYP21A2 F306 + t Deficiency 21-Hydroxylase CYP21A2 F306 + t Deficiency 21-Hydroxylase CYP21A3 g.655A/C > G Deficiency 21-Hydroxylase CYP21A4 g.655A/C > G Deficiency 21-Hydroxylase CYP21A6 G110del8nt Deficiency 21-Hydroxylase CYP21A5 G110del8nt Deficiency 21-Hydroxylase CYP21A7 I172N, rs34607927 Deficiency 21-Hydroxylase CYP21A2 I236N Deficiency 21-Hydroxylase CYP21A2 M239K, rs6476 Deficiency 21-Hydroxylase CYP21A2 P30L Deficiency 21-Hydroxylase CYP21A2 P453S Deficiency 21-Hydroxylase CYP21A2 Q318X Deficiency 21-Hydroxylase CYP21A2 R356W Deficiency 21-Hydroxylase CYP21A2 V237E, rs12530380 Deficiency 21-Hydroxylase CYP21A2 V281L, rs6471 Deficiency ABCC8-Related ABCC8 3992 9G > A Hyperinsulinism ABCC8-Related ABCC8 delF1388 Hyperinsulinism ABCC8-Related ABCC8 delF1388 Hyperinsulinism ABCC8-Related ABCC8 V187D Hyperinsulinism Achondroplasia FGFR3 G375C Achondroplasia FGFR3 G380R, rs28931614 Achromatopsia CNGB3 c.1148delC Achromatopsia CNGB3 c.1148delC Achromatopsia CNGB3 c.819-826del8 Achromatopsia CNGB3 c.819-826del8 Achromatopsia CNGB3 c.886-896del11insT Achromatopsia CNGB3 c.886-896del11insT Achromatopsia CNGB3 c.991-3T > G Achromatopsia CNGB3 p.Arg403Gln Achromatopsia CNGB3 p.Glu336X Adenosine AMPD1 P48L Monophosphate Deaminase 1 Adenosine AMPD1 Q12X, rs17602729 Monophosphate Deaminase 1 Agenesis of Corpus SLC12A6 c.2436delG Callosum with Neuronopathy Agenesis of Corpus SLC12A6 c.2436delG Callosum with Neuronopathy Alkaptonuria HGD c.174delA Alkaptonuria HGD c.174delA Alkaptonuria HGD c.457_458insG Alkaptonuria HGD c.457_458insG Alkaptonuria HGD G161R Alkaptonuria HGD G270R Alkaptonuria HGD IVS1 1G > A Alkaptonuria HGD IVS5 + 1G > A Alkaptonuria HGD Met368 Val Alkaptonuria HGD P230S Alkaptonuria HGD S47L Alkaptonuria HGD V300G Alpha-1-Antitrypsin SERPINA1 Arg101His, rs709932 Deficiency Alpha-1-Antitrypsin SERPINA1 Glu264Val Deficiency Alpha-1-Antitrypsin SERPINA1 Glu342Lys, rs28929474 Deficiency Alpha-1-Antitrypsin SERPINA1 Glu376Asp, rs1303 Deficiency Alpha-Mannosidosis MAN2B1 IVS14 + 1G > C Alpha-Mannosidosis MAN2B1 p.L809P Alpha-Mannosidosis MAN2B1 p.R750W Alpha-Sarcoglycanopathy SGCA R77C, rs28933693 Alpha-Thalassemia HBA2 H19D Alpha-Thalassemia HBA1 HbQ Alpha-Thalassemia HBA1, HBA2 3.7 kb (type I) deletion alpha-2 Alpha-Thalassemia HBA1, HBA2 3.7 kb (type I) deletion alpha-2 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1086, --(SEA); deletion of ~20 kb including both alpha-globin genes alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1086, --(SEA); deletion of ~20 kb including both alpha-globin genes alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1087, --(MED-I); deletion of ~17.5 kb including both alpha-globin genes alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1087, --(MED-I); deletion of ~17.5 kb including both alpha-globin genes alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1088, -(alpha)20.5; this 20.5 kb deletion involves alpha2 and the 5 end of alphal; alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1088, -(alpha)20.5; this 20.5 kb deletion involves alpha2 and the 5 end of alphal; alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1094, --(FIL); a deletion of 30-34 kb involving the alphal, alpha2, and zeta genes alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1094, --(FIL); a deletion of 30-34 kb involving the alphal, alpha2, and zeta genes alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1095, --(THAI); a deletion of 34-38 kb involving the alphal, alpha2, and zeta genes alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1095, --(THAI); a deletion of 34-38 kb involving the alphal, alpha2, and zeta genes alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1097, --(MED-II); a deletion of 26.5 kb involving the two alpha and zeta genes alpha-Thal-1 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 1097, --(MED-II); a deletion of 26.5 kb involving the two alpha and zeta genes alpha-Thal-1 Alpha-Thalassemia HBA2 HbVar database id # 187 Alpha-Thalassemia HBA2 HbVar database id # 2598, IVS I-5 (G > A) Alpha-Thalassemia HBA1, HBA2 HbVar database id # 703 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 704 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 705, Hb Koya Dora Alpha-Thalassemia HBA1, HBA2 HbVar database id # 707, rs41412046 Alpha-Thalassemia HBA1 HbVar database id # 87 Alpha-Thalassemia HBA1, HBA2 HbVar database id # 969, Poly A (A->G); AATAAA->AATGAA beta+ Alpha-Thalassemia HBA1, HBA2 HbVar database id # 971, Poly A (A->G); AATAAA->AATAAG beta+ Alpha-Thalassemia HBA2 MIT Alpha-Thalassemia HBA1 W14X Angiotensin II Receptor, AGTR1 A1166C Type 1 Apolipoprotein E APOE p.C112R, rs429358 Genotyping Apolipoprotein E APOE p.R158C, rs7412 Genotyping Argininosuccinicaciduria ASL R385C ARSACS SACS 5254C > T ARSACS SACS 6594delT ARSACS SACS 6594delT Aspartylglycosaminuria AGA c.199_200delGA Aspartylglycosaminuria AGA c.199_200delGA Aspartylglycosaminuria AGA C163S Ataxia with Vitamin E TTPA 744delA Deficiency Ataxia with Vitamin E TTPA 744delA Deficiency Ataxia-Telangiectasia ATM R35X Autoimmune AIRE c.1163_1164insA Polyendocrinopathy Syndrome Type 1 Autoimmune AIRE c.1163_1164insA Polyendocrinopathy Syndrome Type 1 Autoimmune AIRE c.769C > T Polyendocrinopathy Syndrome Type 1 Autoimmune AIRE c.967_979del Polyendocrinopathy Syndrome Type 1 Autoimmune AIRE c.967_979del Polyendocrinopathy Syndrome Type 1 Autoimmune AIRE Y85C Polyendocrinopathy Syndrome Type 1 Bardet-Biedl Syndrome BBS1 M390R Bardet-Biedl Syndrome BBS10 p.C91LfsX4 Bardet-Biedl Syndrome BBS10 p.C91LfsX4 Best Vitelliform Macular BEST1 c.G383C Dystrophy Beta-Sarcoglycanopathy SGCB S114F Beta-Thalassemia HBB 28 (A->G) beta + Beta-Thalassemia HBB 29 (A->G) beta + Beta-Thalassemia HBB 29A > G Beta-Thalassemia HBB 30 (T->A) beta + Beta-Thalassemia HBB 87 (C->G) beta + Beta-Thalassemia HBB 88C > T Beta-Thalassemia HBB CAP + 1 (A->C) beta + Beta-Thalassemia HBB Codon 15 (G->A); TGG(Trp)->TAG(stop codon) beta0, rs34716011 Beta-Thalassemia HBB Codon 15 (G->A); TGG(Trp)->TAG(stop codon) beta0, rs34716011 Beta-Thalassemia HBB Codon 16 (C); GGC(Gly)->GG-beta0 Beta-Thalassemia HBB Codon 16 (C); GGC(Gly)->GG-beta0 Beta-Thalassemia HBB Codon 17 (A->T); AAG(Lys)->TAG(stop codon) beta0 Beta-Thalassemia HBB Codon 24 (T->A); GGT(Gly)->GGA(Gly) beta + Beta-Thal assemia HBB Codon 39 (C->T); CAG(Gln)->TAG(stop codon) beta0 Beta-Thalassemia HBB Codon 5 (CT); CCT(Pro)->C--beta0 Beta-Thal assemia HBB Codon 5 (CT); CCT(Pro)->C--beta0 Beta-Thalassemia HBB Codon 6 (A); GAG(Glu)->G-G beta0 Beta-Thalassemia HBB Codon 6 (A); GAG(Glu)->G-G beta0 Beta-Thalassemia HBB Codon 8 (AA); AAG(Lys)->--G beta0 Beta-Thalassemia HBB Codon 8 (AA); AAG(Lys)->--G beta0 Beta-Thalassemia HBB Codons 41/42 (TTCT); TTCTTT(Phe-Phe)->----TT beta0 Beta-Thalassemia HBB Codons 41/42 (TTCT); TTCTTT(Phe-Phe)->----TT beta0 Beta-Thalassemia HBB Codons 71/72 (+A); TTT AGT(Phe Ser)->TTT A AGT; beta0 Beta-Thalassemia HBB Codons 71/72 (+A); TTT AGT(Phe Ser)->TTT A AGT; beta0 Beta-Thalassemia HBB Codons 8/9 (+G); AAG TCT(Lys;Ser)->AAG G TCT beta0 Beta-Thal assemia HBB Codons 8/9 (+G); AAG TCT(Lys;Ser)->AAG G TCT beta0 Beta-Thal assemia HBB HbVar database id # 889, IVS-II-654 (C->T); AAGGCAATA- > AAG.sup.GTAATA beta + (severe) Beta-Thal assemia HBB HbVar database id # 890, IVS-II-705 (T->G); GATGTAAGA- > GAG.sup.GTAAGA beta + Beta-Thalassemia HBB HbVar database id # 891, IVS-II-745 (C->G); CAGCTACCAT (SEQ ID NO: 1)->CAG.sup.GTACCAT (SEQ ID NO: 2) beta + Beta-Thalassemia HBB HbVar database id # 979, 619 bp deletion beta0 Beta-Thalassemia HBB 619 bp deletion beta0 Beta-Thalassemia HBB IVS-I-1 (G->A); AG.sup.GTTGGT->AGATTGGT beta0 Beta-Thalassemia HBB IVS-I-1 (G->T); AG.sup.TTGGT->AGTTTGGT beta0 Beta-Thalassemia HBB IVS-I-110 (G->A) beta+; the mutation is 21 nucleotides 5 to the acceptor splice site AG.sup.GC Beta-Thalassemia HBB IVS-I-5 (G->C) beta + (severe) Beta-Thalassemia HBB IVS-II-1 (G->A); beta0 Beta-Thalassemia HBB IVS-II-844 (C->G); beta + Beta-Thalassemia HBB IVS1 + 6T > C Beta-Thalassemia HBB IVS11-849A > C Beta-Thalassemia HBB IVS11-849A > G Biotinidase Deficiency BTD A171T, rs13073139 Biotinidase Deficiency BTD D252G, rs28934601 Biotinidase Deficiency BTD D444H, rs13078881 Biotinidase Deficiency BTD F403V Biotinidase Deficiency BTD G98:d7i3 Biotinidase Deficiency BTD G98:d7i3 Biotinidase Deficiency BTD Q456H Biotinidase Deficiency BTD R157H Biotinidase Deficiency BTD R538C Blau Syndrome NOD2 E383K Blau Syndrome NOD2 L469F Blau Syndrome NOD2 R334Q Blau Syndrome NOD2 R334W Bloom Syndrome BLM 2407insT Bloom Syndrome BLM 2407insT Bloom Syndrome BLM 736delATCTGAinsTAGATTC (2281del6/ins7) Bloom Syndrome BLM 736delATCTGAinsTAGATTC (2281del6/ins7) BRCA1 Hereditary BRCA1 185delAG Breast/Ovarian Cancer BRCA1 Hereditary BRCA1 185delAG Breast/Ovarian Cancer BRCA1 Hereditary BRCA1 5382insC Breast/Ovarian Cancer BRCA1 Hereditary BRCA1 5382insC Breast/Ovarian Cancer BRCA1 Hereditary BRCA1 Tyr978X Breast/Ovarian Cancer BRCA2 Hereditary BRCA2 6174delT Breast/Ovarian Cancer BRCA2 Hereditary BRCA2 6174delT Breast/Ovarian Cancer BRCA2 Hereditary BRCA2 8765delAG Breast/Ovarian Cancer BRCA2 Hereditary BRCA2 8765delAG Breast/Ovarian Cancer Canavan Disease ASPA A305E (914C > A), rs28940574 Canavan Disease ASPA E285A (854A > C), rs28940279 Canavan Disease ASPA IVS2 2A > G(433 2A > G) Canavan Disease ASPA Y231X (693C > A) Carnitine CPTIA G710E Palmitoyltransferase IA Deficiency Carnitine CPTIA P479L Palmitoyltransferase IA Deficiency Carnitine CPT2 G549D Palmitoyltransferase II Deficiency Carnitine CPT2 L178F 534 ins/25 bp del Palmitoyltransferase II Deficiency Carnitine CPT2 L178F 534 ins/25 bp del Palmitoyltransferase II Deficiency Carnitine CPT2 P227L Palmitoyltransferase II Deficiency Carnitine CPT2 P50H Palmitoyltransferase II Deficiency Carnitine CPT2 P604S Palmitoyltransferase II Deficiency Carnitine CPT2 Q413fs Palmitoyltransferase II Deficiency Carnitine CPT2 Q413fs Palmitoyltransferase II Deficiency Carnitine CPT2 Q550R Palmitoyltransferase II Deficiency Carnitine CPT2 R124X Palmitoyltransferase II Deficiency Carnitine CPT2 R503C Palmitoyltransferase II Deficiency Carnitine CPT2 R631C Palmitoyltransferase II Deficiency Carnitine CPT2 S113L Palmitoyltransferase II Deficiency Carnitine CPT2 s38fs Palmitoyltransferase II Deficiency Carnitine CPT2 s38fs Palmitoyltransferase II Deficiency Carnitine CPT2 Y628S, rs28936673 Palmitoyltransferase II Deficiency Cartilage-Hair RMRP g.262G > T Hypoplasia Cartilage-Hair RMPR g.70A > G Hypoplasia CFTR-Related Disorders CFTR 1811 + 1.6kbA->G CFTR-Related Disorders CFTR 2183AA > G CFTR-Related Disorders CFTR 2183AA > G CFTR-Related Disorders CFTR 3849 + 10kbC > T CFTR-Related Disorders CFTR A455E CFTR-Related Disorders CFTR A559T CFTR-Related Disorders CFTR C524X CFTR-Related Disorders CFTR 574delA, 574delA CFTR-Related Disorders CFTR 574delA, 574delA CFTR-Related Disorders CFTR 2108delA, 2108delA CFTR-Related Disorders CFTR 2108delA, 2108delA CFTR-Related Disorders CFTR 3171delC, 3171delC CFTR-Related Disorders CFTR 3171delC, 3171delC CFTR-Related Disorders CFTR 621 + 1G->T CFTR-Related Disorders CFTR 2105 2117del13insAGAAA CFTR-Related Disorders CFTR 2105 2117del13insAGAAA CFTR-Related Disorders CFTR 711 + 1G->T CFTR-Related Disorders CFTR 711 + 5G->A CFTR-Related Disorders CFTR 712 1G->T CFTR-Related Disorders CFTR 1288insTA, 1288insTA CFTR-Related Disorders CFTR 1288insTA, 1288insTA CFTR-Related Disorders CFTR 936delTA CFTR-Related Disorders CFTR 936delTA CFTR-Related Disorders CFTR [delta]F311 CFTR-Related Disorders CFTR [delta]F311 CFTR-Related Disorders CFTR 1078delT, 1078delT CFTR-Related Disorders CFTR 1078delT, 1078delT CFTR-Related Disorders CFTR 1161delC, 1161delC CFTR-Related Disorders CFTR 1161delC, 1161delC CFTR-Related Disorders CFTR 1609delCA, 1609delCA CFTR-Related Disorders CFTR 1609delCA, 1609delCA CFTR-Related Disorders CFTR [delta]I507 CFTR-Related Disorders CFTR [delta]I507 CFTR-Related Disorders CFTR rs332, [delta]F508 CFTR-Related Disorders CFTR rs332, [delta]F508 CFTR-Related Disorders CFTR 1677delTA, 1677delTA CFTR-Related Disorders CFTR 1677delTA, 1677delTA CFTR-Related Disorders CFTR 1717 1G->A CFTR-Related Disorders CFTR 1812 1G->A CFTR-Related Disorders CFTR 1898 + 1G->A CFTR-Related Disorders CFTR 1898 + 1G->T CFTR-Related Disorders CFTR 1898 + 5G->T CFTR-Related Disorders CFTR 1949del84, 1949del84 CFTR-Related Disorders CFTR 1949de184, 1949del84 CFTR-Related Disorders CFTR 2043delG, 2043delG CFTR-Related Disorders CFTR 2043delG, 2043delG CFTR-Related Disorders CFTR 2055del9->A CFTR-Related Disorders CFTR 2055del9->A CFTR-Related Disorders CFTR 2143delT, 2143delT CFTR-Related Disorders CFTR 2143delT, 2143delT CFTR-Related Disorders CFTR 2184delA, 2184delA CFTR-Related Disorders CFTR 2184delA, 2184delA CFTR-Related Disorders CFTR 2184insA, 2184insA CFTR-Related Disorders CFTR 2184insA, 2184insA CFTR-Related Disorders CFTR 2307insA, 2307insA CFTR-Related Disorders CFTR 2307insA, 2307insA CFTR-Related Disorders CFTR 296 + 12T->C CFTR-Related Disorders CFTR 2789 + 5G->A CFTR-Related Disorders CFTR 2869insG, 2869insG CFTR-Related Disorders CFTR 2869insG, 2869insG CFTR-Related Disorders CFTR 3120G->A CFTR-Related Disorders CFTR 3120 + 1G->A CFTR-Related Disorders CFTR 3272 26A->G CFTR-Related Disorders CFTR 3659delC, 3659delC CFTR-Related Disorders CFTR 3659delC, 3659delC CFTR-Related Disorders CFTR 3667del4, 3667del4 CFTR-Related Disorders CFTR 3667del4, 3667del4 CFTR-Related Disorders CFTR 3791delC, 3791delC CFTR-Related Disorders CFTR 3791delC, 3791delC CFTR-Related Disorders CFTR 3821delT, 3821delT CFTR-Related Disorders CFTR 3821delT, 3821delT CFTR-Related Disorders CFTR 3905insT, 3905insT CFTR-Related Disorders CFTR 3905insT, 3905insT CFTR-Related Disorders CFTR 4016insT, 4016insT CFTR-Related Disorders CFTR 4016insT, 4016insT CFTR-Related Disorders CFTR 394delTT, 394delTT CFTR-Related Disorders CFTR 394delTT, 394delTT CFTR-Related Disorders CFTR 405 + 1G->A CFTR-Related Disorders CFTR 405 + 3A->C CFTR-Related Disorders CFTR 444delA CFTR-Related Disorders CFTR 444delA CFTR-Related Disorders CFTR 3876delA, 3876delA CFTR-Related Disorders CFTR 3876delA, 3876delA CFTR-Related Disorders CFTR 457TAT->G CFTR-Related Disorders CFTR 457TAT->G CFTR-Related Disorders CFTR 3199del6, 3199del6 CFTR-Related Disorders CFTR 3199del6, 3199del6 CFTR-Related Disorders CFTR 406 1G->A CFTR-Related Disorders CFTR 663delT, 663delT CFTR-Related Disorders CFTR 663delT, 663delT CFTR-Related Disorders CFTR 935delA, 935delA CFTR-Related Disorders CFTR 935delA, 935delA CFTR-Related Disorders CFTR CFTR dele2, 3 (21 kb) CFTR-Related Disorders CFTR CFTR dele2, 3 (21 kb) CFTR-Related Disorders CFTR D1152H CFTR-Related Disorders CFTR E60X CFTR-Related Disorders CFTR E92X CFTR-Related Disorders CFTR F508C, rs1800093 CFTR-Related Disorders CFTR G178R CFTR-Related Disorders CFTR G330X CFTR-Related Disorders CFTR G480C CFTR-Related Disorders CFTR G542X CFTR-Related Disorders CFTR G551D CFTR-Related Disorders CFTR G622D CFTR-Related Disorders CFTR G85E CFTR-Related Disorders CFTR G91R CFTR-Related Disorders CFTR I148T, rs35516286 CFTR-Related Disorders CFTR I506V CFTR-Related Disorders CFTR IVS8-5T CFTR-Related Disorders CFTR IVS8-7T CFTR-Related Disorders CFTR IVS8-9T CFTR-Related Disorders CFTR K710X CFTR-Related Disorders CFTR L206W CFTR-Related Disorders CFTR M1101K, rs36210737 CFTR-Related Disorders CFTR N1303K CFTR-Related Disorders CFTR P574H CFTR-Related Disorders CFTR Q1238X CFTR-Related Disorders CFTR Q359K/T360K_wt CFTR-Related Disorders CFTR Q493X CFTR-Related Disorders CFTR Q552X CFTR-Related Disorders CFTR Q890X CFTR-Related Disorders CFTR R1066C CFTR-Related Disorders CFTR R1070Q CFTR-Related Disorders CFTR R1158X CFTR-Related Disorders CFTR R1162X CFTR-Related Disorders CFTR R117C CFTR-Related Disorders CFTR R117H CFTR-Related Disorders CFTR R1283M CFTR-Related Disorders CFTR R334W CFTR-Related Disorders CFTR R347H CFTR-Related Disorders CFTR R347P CFTR-Related Disorders CFTR R352Q CFTR-Related Disorders CFTR R553X CFTR-Related Disorders CFTR R560T CFTR-Related Disorders CFTR R709X CFTR-Related Disorders CFTR R75X CFTR-Related Disorders CFTR R764X CFTR-Related Disorders CFTR S1196X CFTR-Related Disorders CFTR S1235R, rs34911792 CFTR-Related Disorders CFTR S1251N CFTR-Related Disorders CFTR S1255X CFTR-Related Disorders CFTR S364P CFTR-Related Disorders CFTR S549I CFTR-Related Disorders CFTR S549N CFTR-Related Disorders CFTR S549R CFTR-Related Disorders CFTR S549R CFTR-Related Disorders CFTR T338I CFTR-Related Disorders CFTR V520F CFTR-Related Disorders CFTR W1089X CFTR-Related Disorders CFTR W1204X CFTR-Related Disorders CFTR W1204X CFTR-Related Disorders CFTR W1282X CFTR-Related Disorders CFTR Y1092X CFTR-Related Disorders CFTR Y122X Choroideremia CHM c.1609 + 2dupT Choroideremia CHM c.1609 + 2dupT CLN3-Related Neuronal CLN3 c.461_677del Ceroid-Lipofuscinosis CLN3-Related Neuronal CLN3 c.461_677del Ceroid-Lipofuscinosis CLN3-Related Neuronal CLN3 c.791_1056del Ceroid-Lipofuscinosis CLN3-Related Neuronal CLN3 c.791_1056del Ceroid-Lipofuscinosis CLN5-Related Neuronal CLN5 c.1175_1176delAT Ceroid-Lipofuscinosis CLN5-Related Neuronal CLN5 c.1175_1176delAT Ceroid-Lipofuscinosis CLN5-Related Neuronal CLN5 c.225G > A Ceroid-Lipofuscinosis CLN8-Related Neuronal CLN8 c.70C > G Ceroid-Lipofuscinosis Cohen Syndrome VPS13B c.3348_3349delCT Cohen Syndrome VPS13B c.3348_3349delCT Congenital Cataracts, CTDP1 IVS6 + 389C > T Facial Dysmorphism, and Neuropathy Congenital Disorder of PMM2 p.F119L Glycosylation Ia Congenital Disorder of PMM2 p.R141H Glycosylation Ia Congenital Disorder of MPI R295H, rs28928906 Glycosylation Ib Congenital Finnish NPHS1 c.121_122del Nephrosis Congenital Finnish NPHS1 c.121_122del Nephrosis Congenital Finnish NPHS1 c.3325C > T Nephrosis Crohn Disease NOD2 3020 ins C Crohn Disease NOD2 3020 ins C Crohn Disease NOD2 G908R, rs2066845 Crohn Disease NOD2 R702W, rs2066844 Cystinosis CTNS 1035insC Cystinosis CTNS 1035insC Cystinosis CTNS 537del21 Cystinosis CTNS 537del21 Cystinosis CTNS 57 kb deletion Cystinosis CTNS 57 kb deletion Cystinosis CTNS D205N Cystinosis CTNS L158P Cystinosis CTNS W138X DFNA 9 (COCH) COCH P51S Diabetes and Hearing mtDNA 3234A > G Loss Diabetes and Hearing mtDNA 3271T > C Loss Diabetes and Hearing mtDNA G8363A Loss Diabetes and Hearing mtDNA T14709C Loss Early-Onset Primary TORIA 904_906delGAG Dystonia (DYT1) Early-Onset Primary TORIA 904_906delGAG Dystonia (DYT1) Epidermolysis Bullosa LAMB3 3024delT Junctional, Herlitz- Pearson Type Epidermolysis Bullosa LAMB3 3024delT Junctional, Herlitz- Pearson Type Epidermolysis Bullosa LAMB3 p.Q243X Junctional, Herlitz- Pearson Type Epidermolysis Bullosa LAMB3 R144X Junctional, Herlitz- Pearson Type Epidermolysis Bullosa LAMB3 R42X Junctional, Herlitz- Pearson Type Epidermolysis Bullosa LAMB3 R635X Junctional, Herlitz- Pearson Type Epidermolysis Bullosa LAMA3 R650X Junctional, Herlitz- Pearson Type Epidermolysis Bullosa LAMC2 R95X Junctional, Herlitz- Pearson Type Factor V Leiden F5 H1299R Thrombophilia Factor V Leiden F5 R506Q, rs6025 Thrombophilia Factor V R2 Mutation F5 rs6027 Thrombophilia Factor XI Deficiency F11 E117X (576G > T) Factor XI Deficiency F11 F283L (1074T > C) Factor XI Deficiency F11 IVS14 + 1G > A Factor XI Deficiency F11 IVS14del14 Factor XI Deficiency F11 IVS14del14 Factor XIII Deficiency F13A1 V34L, rs5985 Familial Adenomatous APC I1307K, rs1801155 Polyposis Familial Dysautonomia IKBKAP 2507 + 6T > C Familial Dysautonomia IKBKAP P914L Familial Dysautonomia IKBKAP R696P Familial APOB R3500Q, rs5742904 Hypercholesterolemia Type B Familial APOB R3500W Hypercholesterolemia Type B Familial APOB R3531C, rs12713559 Hypercholesterolemia Type B Familial Mediterranean MEFV A744S (2230G > T) Fever Familial Mediterranean MEFV delI692 (del2076_2078) Fever Familial Mediterranean MEFV delI692 (del2076_2078) Fever Familial Mediterranean MEFV E148Q (442 G > C), rs3743930 Fever Familial Mediterranean MEFV E167D (501 G > C) Fever Familial Mediterranean MEFV F479L (1437 C > G) Fever Familial Mediterranean MEFV K695R (2084A > G) Fever Familial Mediterranean MEFV M680I (2040G > C) Fever Familial Mediterranean MEFV M694I (2082G > A), rs28940578 Fever Familial Mediterranean MEEFV M694V (2080A > G) Fever Familial Mediterranean MEFV P369S (1105 C > T), rs11466023 Fever Familial Mediterranean MEFV R408Q (1223G > A), rs11466024 Fever Familial Mediterranean MEFV R653H (1958G > A) Fever Familial Mediterranean MEFV R761H (2282G > A) Fever Familial Mediterranean MEFV T2671 (800 C > T) Fever Familial Mediterranean MEFV V726A (2177T > C), rs28940579 Fever FANCC-Related Fanconi FANCC 322delG Anemia FANCC-Related Fanconi FANCC 322delG Anemia FANCC-Related Fanconi FANCC IVS4 + 4A > T(711 + 4A > T) Anemia FANCC-Related Fanconi FANCC Q13X (37C > T) Anemia FANCC-Related Fanconi FANCC R547X Anemia FGFR1-Related FGFR1 P252R Craniosynostosis FGFR2-Related FGFR2 P253R Craniosynostosis FGFR2-Related FGFR2 S252W Craniosynostosis FGFR3-Related FGFR3 A391E, rs28931615 Craniosynostosis FGFR3-Related FGFR3 P250R, rs4647924 Craniosynostosis Free Sialic Acid Storage SLC17A5 c.1007_1008delTA Disorders Free Sialic Acid Storage SLC17A5 c.1007_1008delTA Disorders Free Sialic Acid Storage SLC17A5 c.115C > T Disorders Frontotemporal Dementia MAPT IVS10 + 16 with Parkinsonism-17 Frontotemporal Dementia MAPT P301L with Parkinsonism-17 Frontotemporal Dementia MAPT P301S with Parkinsonism-17 Frontotemporal Dementia MAPT R406W with Parkinsonism-17 Fumarase deficiency FH c.1431_1433dupAAA Fumarase deficiency FH c.1431_1433dupAAA Galactosemia GALT 5.0Kb gene deletion Galactosemia GALT 5.0Kb gene deletion Galactosemia GALT 5UTR 119del Galactosemia GALT 5UTR 119del Galactosemia GALT IVS2 2 A > G Galactosemia GALT K285N Galactosemia GALT L195PT > C Galactosemia GALT L218L Galactosemia GALT N314D, rs2070074 Galactosemia GALT Phe171Ser Galactosemia GALT Q169K Galactosemia GALT Q188R Galactosemia GALT S135L Galactosemia GALT T138M C > T Galactosemia GALT X380R Galactosemia GALT Y209C A > G Gaucher Disease GBA 1035insG Gaucher Disease GBA 1035insG Gaucher Disease GBA 84insG Gaucher Disease GBA 84insG Gaucher Disease GBA D409H, rs1064651 Gaucher Disease GBA D409V Gaucher Disease GBA IVS2(+1)G > A Gaucher Disease GBA L444P (1448T > C), rs35095275 Gaucher Disease GBA N370S Gaucher Disease GBA R463C Gaucher Disease GBA R463H Gaucher Disease GBA R496H (1604G > A) Gaucher Disease GBA V394L GJB2-Related DFNA 3 GJB2 167delT Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNA 3 GJB2 167delT Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNA 3 GJB2 235delC Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNA 3 GJB2 235delC Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNA 3 GJB2 35delG Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNA 3 GJB2 35delG Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNA 3 GJB2 IVS1 + 1G > A Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 101delAG Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 313del14 Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 313del14 Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 delE120 Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 delE120 Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 M34T, rs35887622 Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 Q124X Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 R184P Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 V37I Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 W24X Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 W77R Nonsyndromic Hearing Loss and Deafness GJB2-Related DFNB 1 GJB2 W77X Nonsyndromic Hearing Loss and Deafness Glucose-6-Phosphate G6PD A335V Dehydrogenase Deficiency Glucose-6-Phosphate G6PD R459L Dehydrogenase Deficiency Glucose-6-Phosphate G6PD R459P Dehydrogenase Deficiency Glucose-6-Phosphate G6PD rs1050828, rs1050828 Dehydrogenase Deficiency Glucose-6-Phosphate G6PD rs1050829, rs1050829 Dehydrogenase Deficiency Glucose-6-Phosphate G6PD rs5030868, rs5030868 Dehydrogenase Deficiency Glutaricacidemia Type 1 GCDH A421V Glutaricacidemia Type 1 GCDH R402W Glycogen Storage G6PC 459insTA Disease Type 1a Glycogen Storage G6PC 459insTA Disease Type 1a Glycogen Storage G6PC 727G/T Disease Type 1a Glycogen Storage G6PC del F327 Disease Type 1a Glycogen Storage G6PC del F327 Disease Type 1a Glycogen Storage G6PC G188R Disease Type 1a Glycogen Storage G6PC G270V Disease Type 1a Glycogen Storage G6PC Q242X Disease Type 1a Glycogen Storage G6PC Q27fsdelC Disease Type 1a Glycogen Storage G6PC Q27fsdelC Disease Type 1a Glycogen Storage G6PC Q347X Disease Type 1a Glycogen Storage G6PC R83C Disease Type 1a Glycogen Storage G6PC R83H Disease Type 1a Glycogen Storage G6PT1 1211delCT Disease Type 1b Glycogen Storage G6PT1 A367T Disease Type 1b Glycogen Storage G6PT1 G339C Disease Type 1b Glycogen Storage G6PT1 G339D Disease Type 1b Glycogen Storage G6PT1 W118R Disease Type 1b Glycogen Storage GAA Arg854X Disease Type II Glycogen Storage GAA Asp645Glu, rs28940868 Disease Type II Glycogen Storage GAA IVS1(13t > g) Disease Type II Glycogen Storage AGL 1484delT Disease Type III Glycogen Storage AGL 1484delT Disease Type III Glycogen Storage AGL 17delAG Disease Type III Glycogen Storage AGL 17delAG Disease Type III Glycogen Storage AGL Q6X Disease Type III Glycogen Storage PYGM G204S Disease Type V Glycogen Storage PYGM K542T Disease Type V Glycogen Storage PYGM K542X Disease Type V Glycogen Storage PYGM R49X Disease Type V GNE-Related Myopathies GNE M712T, rs28937594 Gracile Syndrome BCS1L c.232A > G, rs28937590 Hemoglobin S Beta- HBB c.19G > A Thal assemia Hemoglobin S Beta- HBB c.20A > T Thal assemia Hemoglobin S Beta- HBB c.79G > A Thal assemia Hemoglobin S Beta- HBB Hb CS Thalassemia Hemoglobin S Beta- HBB Hb D Thalassemia Hemoglobin S Beta- HBB Hb O Thalassemia Hereditary Fructose ALDOB A149P, rs1800546 Intolerance Hereditary Fructose ALDOB A174D Intolerance Hereditary Fructose ALDOB Delta4E4 Intolerance Hereditary Fructose ALDOB Delta4E4 Intolerance Hereditary Fructose ALDOB N334K Intolerance Hereditary Fructose ALDOB Y203X Intolerance Hereditary Pancreatitis PRSS1 A16V Hereditary Pancreatitis SPINK1 MIT Hereditary Pancreatitis PRSS1 N29I Hereditary Pancreatitis SPINK1 N34S, rs17107315 Hereditary Pancreatitis PRSS1 R122C Hereditary Pancreatitis PRSS1 R122H Hereditary Thymine- DPYD rs3918290 Uraciluria Hexosaminidase A HEXA 1278insTATC Deficiency Hexosaminidase A HEXA 1278insTATC Deficiency Hexosaminidase A HEXA G269S (805G > A) Deficiency Hexosaminidase A HEXA IVS12 + 1G > C Deficiency Hexosamini dase A HEXA IVS7 + 1G > A Deficiency Hexosaminidase A HEXA IVS9 + 1G > A Deficiency Hexosaminidase A HEXA R178C Deficiency Hexosaminidase A HEXA R178H Deficiency Hexosaminidase A HEXA R247W (739C > T) Deficiency Hexosaminidase A HEXA R249W (745C > T) Deficiency HFE-Associated HFE E168Q Hereditary Hemochromatosis HFE-Associated HFE E168X Hereditary Hemochromatosis HFE-Associated HFE HM971246, H63H Hereditary Hemochromatosis HFE-Associated HFE P160delC Hereditary Hemochromatosis HFE-Associated HFE P160delC Hereditary Hemochromatosis HFE-Associated HFE Q127H, rs28934595 Hereditary Hemochromatosis HFE-Associated HFE Q283P Hereditary Hemochromatosis HFE-Associated HFE rs1799945, rs1799945 Hereditary Hemochromatosis HFE-Associated HFE rs1800562, rs1800562 Hereditary Hemochromatosis HFE-Associated HFE rs1800730, rs1800730 Hereditary Hemochromatosis HFE-Associated HFE V53M Hereditary Hemochromatosis HFE-Associated HFE V59M Hereditary Hemochromatosis HFE-Associated HFE W169X Hereditary Hemochromatosis Hidrotic Ectodermal GJB6 A88V, rs28937872 Dysplasia 2 Hidrotic Ectodermal GJB6 G11R Dysplasia 2 Hidrotic Ectodermal GJB6 V37E Dysplasia 2 Homocystinuria Caused CBS G307S 919G->A by Cystathionine Beta- Synthase Deficiency Homocystinuria Caused CBS I278T 833T->C, rs5742905 by Cystathionine Beta- Synthase Deficiency Hyperkalemic Periodic SCN4A I693T Paralysis Type 1 Hyperkalemic Periodic SCN4A L689I Paralysis Type 1 Hyperkalemic Periodic SCN4A L689V Paralysis Type 1 Hyperkalemic Periodic SCN4A M1360V Paralysis Type 1 Hyperkalemic Periodic SCN4A M1592V Paralysis Type 1 Hyperkalemic Periodic SCN4A p.A1156T Paralysis Type 1 Hyperkalemic Periodic SCN4A p.M1370V Paralysis Type 1 Hyperkalemic Periodic SCN4A p.R1448C Paralysis Type 1 Hyperkalemic Periodic SCN4A p.T1313M Paralysis Type 1 Hyperkalemic Periodic SCN4A R675G Paralysis Type 1 Hyperkalemic Periodic SCN4A R675Q Paralysis Type 1 Hyperkalemic Periodic SCN4A R675W Paralysis Type 1 Hyperkalemic Periodic SCN4A T704M Paralysis Type 1 Hyperkalemic Periodic SCN4A V781I Paralysis Type 1 Hyperornithinemia- SLC25A15 F188del Hyperammonemia- Homocitrullinuria Syndrome Hyperornithinemia- SLC25A15 F188del Hyperammonemia- Homocitrullinuria Syndrome Hyperoxaluria, Primary, AGXT 33insC Type 1 Hyperoxaluria, Primary, AGXT 33insC Type 1 Hyperoxaluria, Primary, AGXT F152I Type 1 Hyperoxaluria, Primary, AGXT G170R Type 1 Hyperoxaluria, Primary, AGXT I244T Type 1 Hyperoxaluria, Primary, GRHPR 103delG Type 2 Hyperoxaluria, Primary, GRHPR 103delG Type 2 Hypochondroplasia FGFR3 Asn328Ile Hypochondroplasia FGFR3 I538V Hypochondroplasia FGFR3 K650M Hypochondroplasia FGFR3 K650N 1950G > T Hypochondroplasia FGFR3 K650Q Hypochondroplasia FGFR3 N540K 1620C > A Hypochondroplasia FGFR3 N540S Hypochondroplasia FGFR3 N540T Hypokalemic Periodic CACNAIS R528G Paralysis Type 1 Hypokalemic Periodic CACNAIS R528H Paralysis Type 1 Hypokalemic Periodic CACNAIS rs28930068, rs28930068 Paralysis Type 1 Hypokalemic Periodic CACNAIS rs28930069, rs28930069 Paralysis Type 1 Hypokalemic Periodic SCN4A R669H Paralysis Type 2 Hypokalemic Periodic SCN4A R672C Paralysis Type 2 Hypokalemic Periodic SCN4A R672G Paralysis Type 2 Hypokalemic Periodic SCN4A R672H Paralysis Type 2 Hypokalemic Periodic SCN4A R672S Paralysis Type 2 Hypophosphatasia ALPL Asp361 Val Hypophosphatasia ALPL c.1559delT Hypophosphatasia ALPL c.1559delT Hypophosphatasia ALPL E174K Hypophosphatasia ALPL G317D Hypophosphatasia ALPL Phe310Leu Isovaleric Acidemia IVD A282V Isovaleric Acidemia IVD rs28940889 Krabbe Disease GALC EX11 17DEL Krabbe Disease GALC EX11 17DEL Krabbe Disease GALC G270D Krabbe Disease GALC rs1805078, rs1805078 Krabbe Disease GALC rs398607 Leber Hereditary Optic mtDNA 14484T > C Neuropathy Leber Hereditary Optic mtDNA 15257G > A Neuropathy Leber Hereditary Optic mtDNA G14459A Neuropathy Leber Hereditary Optic mtDNA G3460A Neuropathy Leber Hereditary Optic mtDNA m.11778G > A Neuropathy Leber Hereditary Optic mtDNA m.13708G > A Neuropathy Leber Hereditary Optic mtDNA m.15812G > A Neuropathy Leber Hereditary Optic mtDNA m.3394T > C Neuropathy Leber Hereditary Optic mtDNA m.4216T > C Neuropathy Leber Hereditary Optic mtDNA m.4917A > G Neuropathy Leigh Syndrome, French- LRPPRC A354V Canadian Type LGMD2I FKRP L276I, rs28937900 Long Chain 3- HADHA E474Q c.1528G > C Hydroxyacyl-CoA Dehydrogenase Deficiency Long Chain 3- HADHA Q342X 1132C > T Hydroxyacyl-CoA Dehydrogenase Deficiency Maple Syrup Urine BCKDHA Y438N Disease Type 1A Maple Syrup Urine BCKDHB E372X Disease Type 1B Maple Syrup Urine BCKDHB G278S Disease Type 1B Maple Syrup Urine BCKDHB R183P Disease Type 1B McCune-Albright GNAS R201C Syndrome McCune-Albright GNAS R201G Syndrome McCune-Albright GNAS R201H Syndrome Medium Chain Acyl- ACADM 244insT Coenzyme A Dehydrogenase Deficiency Medium Chain Acyl- ACADM 244insT Coenzyme A Dehydrogenase Deficiency Medium Chain Acyl- ACADM 250C > T Coenzyme A Dehydrogenase Deficiency Medium Chain Acyl- ACADM 583G > A Coenzyme A Dehydrogenase Deficiency Medium Chain Acyl- ACADM 616C > T Coenzyme A Dehydrogenase Deficiency Medium Chain Acyl- ACADM 617G > A Coenzyme A Dehydrogenase Deficiency Medium Chain Acyl- ACADM 799G > A Coenzyme A Dehydrogenase Deficiency Medium Chain Acyl- ACADM K304E Coenzyme A Dehydrogenase Deficiency Medium Chain Acyl- ACADM Y42H Coenzyme A Dehydrogenase Deficiency Megalencephalic MLC1 135insC Leukoencephalopathy with Subcortical Cysts Megalencephalic MLC1 135insC Leukoencephalopathy with Subcortical Cysts MELAS mtDNA 3243A > G MELAS mtDNA 3250T > C MELAS mtDNA 3252A > G MELAS mtDNA A12770G MELAS mtDNA C3256T MELAS mtDNA G13513A MELAS mtDNA T3291C MELAS mtDNA T8356C MELAS mtDNA T9957C MERRF mtDNA 8361G > A MERRF mtDNA A8296G MERRF mtDNA m. 8344A > G Metachromatic ARSA c.459 + 1G > A Leukodystrophy Metachromatic ARSA p.P426L, rs28940893 Leukodystrophy Metachromatic ARSA p.T274M Leukodystrophy Metachromatic ARSA P377L Leukodystrophy Mitochondrial mtDNA A3260T Cardiomyopathy Mitochondrial mtDNA A4300G Cardiomyopathy Mitochondrial mtDNA C3303T Cardiomyopathy Mitochondrial mtDNA T9997C Cardiomyopathy Mitochondrial DNA- mtDNA 5537insT Associated Leigh Syndrome and NARP Mitochondrial DNA- mtDNA 5537insT Associated Leigh Syndrome and NARP Mitochondrial DNA- mtDNA 8993T > C Associated Leigh Syndrome and NARP Mitochondrial DNA- mtDNA 8993T > G Associated Leigh Syndrome and NARP Mitochondrial DNA- mtDNA C11777A Associated Leigh Syndrome and NARP Mitochondrial DNA- mtDNA T10158C Associated Leigh Syndrome and NARP Mitochondrial DNA- mtDNA T10191C Associated Leigh Syndrome and NARP Mitochondrial DNA- mtDNA T8851C Associated Leigh Syndrome and NARP Mitochondrial DNA- mtDNA T9176C Associated Leigh Syndrome and NARP Mitochondrial DNA- mtDNA T9176G Associated Leigh Syndrome and NARP MTHFR Deficiency MTHFR 1298A > C MTHFR Deficiency MTHFR rs1801133, rs1801133 MTRNR1-Related mtDNA 1095T > C Hearing Loss and Deafness MTRNR1-Related mtDNA 1494C > T Hearing Loss and Deafness MTRNR1-Related mtDNA 1555A > G Hearing Loss and Deafness MTRNR1-Related mtDNA 961T > G Hearing Loss and Deafness MTRNR1-Related mtDNA A7445G Hearing Loss and Deafness MTTS1-Related Hearing mtDNA 7443A > G Loss and Deafness MTTS1-Related Hearing mtDNA 7444G > A Loss and Deafness MTTS1-Related Hearing mtDNA 7472insC Loss and Deafness MTTS1-Related Hearing mtDNA 7472insC Loss and Deafness MTTS1-Related Hearing mtDNA 7510T > C Loss and Deafness MTTS1-Related Hearing mtDNA 7511T > C Loss and Deafness MTTS1-Related Hearing mtDNA 7512T > C Loss and Deafness Mucolipidosis IV MCOLN1 delEx1 3 Ex7 (511 > 6944del) Mucolipidosis IV MCOLN1 delEx1 3 Ex7 (511 > 6944del) Mucolipidosis IV MCOLNI IVS 2A > G Mucopolysaccharidosis IDUA c.46_57del Type I Mucopolysaccharidosis IDUA c.46_57del Type I Mucopolysaccharidosis IDUA p.A327P Type I Mucopolysaccharidosis IDUA p.P533R Type I Mucopolysaccharidosis IDUA Q70X Type I Mucopolysaccharidosis IDUA W402X Type I Mucopolysaccharidosis SGSH p.R245H Type IIIA Mucopolysaccharidosis SGSH p.R74C Type IIIA Mucopolysaccharidosis SGSH p.S66W Type IIIA Mucopolysaccharidosis GUSB p.D152N Type VII Multiple Endocrine RET 2047T > A Neoplasia Type 2 Multiple Endocrine RET 2047T > A Neoplasia Type 2 Multiple Endocrine RET 2047T > C Neoplasia Type 2 Multiple Endocrine RET 2047T > G Neoplasia Type 2 Multiple Endocrine RET 2048G > A Neoplasia Type 2 Multiple Endocrine RET A883F 2647 G > T Neoplasia Type 2 Multiple Endocrine RET Glu768Asp G > C Neoplasia Type 2 Multiple Endocrine RET M918T Neoplasia Type 2 Muscle-Eye-Brain POMGNT1 c.1539 + 1G > A Disease MYH-Associated MUTYH c.1376C > A Polyposis MYH-Associated MUTYH c.494A > G, rs34612342 Polyposis MYH-Associated GENE_SYMBOL_TBD rs36053993, rs36053993 Polyposis Niemann-Pick Disease SMPD1 c.990delC Due to Sphingomyelinase Deficiency Niemann-Pick Disease SMPD1 c.990delC Due to Sphingomyelinase Deficiency Niemann-Pick Disease SMPD1 fsP330 Due to Sphingomyelinase Deficiency Niemann-Pick Disease SMPD1 fsP330 Due to Sphingomyelinase Deficiency Niemann-Pick Disease SMPD1 L302P Due to Sphingomyelinase Deficiency Niemann-Pick Disease SMPD1 R496L Due to Sphingomyelinase Deficiency Niemann-Pick Disease SMPD1 R608del Due to Sphingomyelinase Deficiency Niemann-Pick Disease NPC1 I1061T Type C1 Nijmegen Breakage NBN 657del5 Syndrome Nijmegen Breakage NBN 657del5 Syndrome Pallister-Hall Syndrome GLI3 2012delG Pallister-Hall Syndrome GLI3 2012delG Pallister-Hall Syndrome GLI3 2023delG Pallister-Hall Syndrome GLI3 2023delG Pendred Syndrome SLC26A4 1197delT Pendred Syndrome SLC26A4 1197delT Pendred Syndrome SLC26A4 E384G Pendred Syndrome SLC26A4 IV58 + 1(G->A) Pendred Syndrome SLC26A4 L236P Pendred Syndrome SLC26A4 T416P Peroxisomal Bifunctional HSD17B4 c.302 + 1G > C Enzyme Deficiency Peroxisomal Bifunctional HSD17B4 c.303 1G > A Enzyme Deficiency Pervasive Developmental NLGN4X D396X Disorders Pervasive Developmental NLGN4X D396X Disorders Pervasive Developmental NLGN4X NLGN4X:1253delAG Disorders Pervasive Developmental NLGN4X NLGN4X:1253delAG Disorders Pervasive Developmental NLGN3 R451C Disorders Phenylalanine PAH G272X Hydroxylase Deficiency Phenylalanine PAH I65T Hydroxylase Deficiency Phenylalanine PAH IVS12 + 1G > T Hydroxylase Deficiency Phenylalanine PAH L48S, rs5030841 Hydroxylase Deficiency Phenylalanine PAH R158Q, rs5030843 Hydroxylase Deficiency Phenylalanine PAH R252W, rs5030847 Hydroxylase Deficiency Phenylalanine PAH R261Q, rs5030849 Hydroxylase Deficiency Phenylalanine PAH R408Q, rs5030859 Hydroxylase Deficiency Phenylalanine PAH R408W, rs5030858 Hydroxylase Deficiency Phenylalanine PAH rs5030855 Hydroxylase Deficiency Phenylalanine PAH rs5030861 Hydroxylase Deficiency Phenylalanine PAH Y414C, rs5030860 Hydroxylase Deficiency Plasminogen Activator SERPINE1 844 G > A Inhibitor I Plasminogen Activator SERPINE1 4G/5G Inhibitor I Polycystic Kidney PKHD1 c.10412T > G Disease, Autosomal Recessive Polycystic Kidney PKHD1 c.107C > T Disease, Autosomal Recessive Polycystic Kidney PKHD1 c.1486C > T Disease, Autosomal Recessive Polycystic Kidney PKHD1 c.5895dupA Disease, Autosomal Recessive Polycystic Kidney PKHD1 c.5895dupA Disease, Autosomal Recessive Polycystic Kidney PKHD1 c.9689del A Disease, Autosomal Recessive Polycystic Kidney PKHD1 c.9689delA Disease, Autosomal Recessive PPT1-Related Neuronal PPT1 c.364A > T Ceroid-Lipofuscinosis PPT1-Related Neuronal PPT1 p.L10X Ceroid-Lipofuscinosis PPT1-Related Neuronal PPT1 p.R151X Ceroid-Lipofuscinosis PPT1-Related Neuronal PPT1 T75P Ceroid-Lipofuscinosis PROP1-related pituitary PROP1 301 302delAG hormome deficiency PROP1-related pituitary PROP1 301 302delAG hormome deficiency Prothrombin F2 rs1799963 Thrombophilia Prothrombin F2 rs6025, rs6025 Thrombophilia Pseudovitamin D CYP27B1 7bp duplication in exon8 Deficiency Rickets Pseudovitamin D CYP27B1 7bp duplication in exon8 Deficiency Rickets Pseudovitamin D CYP27B1 958delG Deficiency Rickets Pseudovitamin D CYP27B1 958delG Deficiency Rickets Rett Syndrome MECP2 806delG Rett Syndrome MECP2 806delG Rett Syndrome MECP2 A140V, rs28934908 Rett Syndrome MECP2 P152R Rett Syndrome MECP2 P225R Rett Syndrome MECP2 R106W, rs28934907 Rett Syndrome MECP2 R133C Rett Syndrome MECP2 R168X Rett Syndrome MECP2 R255X Rett Syndrome MECP2 R270X Rett Syndrome MECP2 R294X Rett Syndrome MECP2 R306C, rs28935468 Rett Syndrome MECP2 S134C Rett Syndrome MECP2 T158M, rs28934906 Rhizomelic PEX7 p.A218V Chondrodysplasia Punctata Type 1 Rhizomelic PEX7 p.G217R Chondrodysplasia Punctata Type 1 Rhizomelic PEX7 p.L292X, rs1805137 Chondrodysplasia Punctata Type 1 Short Chain Acyl-CoA ACADS c.511C > T, rs1800556 Dehydrogenase Deficiency Short Chain Acyl-CoA ACADS c.625G > A Dehydrogenase Dehydrogenase ACADS R107C Deficiency Shwachman-Diamond SBDS 183_184TA > CT Syndrome Shwachman-Diamond SBDS 183_184TA > CT Syndrome Shwachman-Diamond SBDS 258 + 2T > C Syndrome Sjogren-Larsson ALDH3A2 c.943C > T Syndrome Smith-Lemli-Opitz DHCR7 C380Y Syndrome Smith-Lemli-Opitz DHCR7 IVS8 1G > C Syndrome Smith-Lemli-Opitz DHCR7 L109P Syndrome Smith-Lemli-Opitz DHCR7 L157P Syndrome Smith-Lemli-Opitz DHCR7 R352Q Syndrome Smith-Lemli-Opitz DHCR7 R352W Syndrome Smith-Lemli-Opitz DHCR7 R404C Syndrome Smith-Lemli-Opitz DHCR7 R446Q Syndrome Smith-Lemli-Opitz DHCR7 T93M Syndrome Smith-Lemli-Opitz DHCR7 V326L Syndrome Smith-Lemli-Opitz DHCR7 W151X Syndrome Smith-Lemli-Opitz DHCR7 W151X Syndrome Spastic Paraplegia 13 HSPD1 V72I Sulfate Transporter- SLC26A2 340delV Related Osteochondrodysplasia Sulfate Transporter- SLC26A2 340delV Related Osteochondrodysplasia Sulfate Transporter- SLC26A2 c.837C > T Related Osteochondrodysplasia Sulfate Transporter- SLC26A2 C653S Related Osteochondrodysplasia Sulfate Transporter- SLC26A2 IVS1 + 2T > C Related Osteochondrodysplasia Sulfate Transporter- SLC26A2 R178X Related Osteochondrodysplasia TFR2-Related Hereditary TFR2 AVAQ594 597del Hemochromatosis TFR2-Related Hereditary TFR2 AVAQ594 597del Hemochromatosis TFR2-Related Hereditary TFR2 E60X Hemochromatosis TFR2-Related Hereditary TFR2 E60X Hemochromatosis TFR2-Related Hereditary TFR2 M172K Hemochromatosis TFR2-Related Hereditary TFR2 Y250X Hemochromatosis Thanatophoric Dysplasia FGFR3 G370C Thanatophoric Dysplasia FGFR3 K650E Thanatophoric Dysplasia FGFR3 R248C Thanatophoric Dysplasia FGFR3 S249C Thanatophoric Dysplasia FGFR3 S371C Thanatophoric Dysplasia FGFR3 X807C A > T Thanatophoric Dysplasia FGFR3 X807G Thanatophoric Dysplasia FGFR3 X807L Thanatophoric Dysplasia FGFR3 X807R Thanatophoric Dysplasia FGFR3 X807S Thanatophoric Dysplasia FGFR3 X807W Thanatophoric Dysplasia FGFR3 Y373C TPP1-Related Neuronal TPP1 c.509 1G > A Ceroid-Lipofuscinosis TPP1-Related Neuronal TPP1 c.509 1G > C Ceroid-Lipofuscinosis TPP1-Related Neuronal TPP1 G284V Ceroid-Lipofuscinosis TPP1-Related Neuronal TPP1 p.R208X Ceroid-Lipofuscinosis Transthyretin TTR c.148G > A Amyloidosis Tyrosine Hydroxylase- TH L205P Deficient DRD Tyrosine Hydroxylase- TH R202H Deficient DRD Tyrosinemia Type I FAH E357X Tyrosinemia Type I FAH IVS12 + 5 G > A Tyrosinemia Type I FAH IVS7 6 T > G Tyrosinemia Type I FAH IVS8 1G > C Tyrosinemia Type I FAH p.W262X Tyrosinemia Type I FAH P261L Tyrosinemia Type I FAH Q64H Wilson Disease ATP7B 1340del4 Wilson Disease ATP7B 3402delC Wilson Disease ATP7B 3402delC Wilson Disease ATP7B H1069Q Wilson Disease ATP7B R778G Wilson Disease ATP7B W779X Wilson Disease ATP7B W779X X-Linked Juvenile RS1 E72K Retinoschisis X-Linked Juvenile RS1 G109R Retinoschisis X-Linked Juvenile RS1 G74V Retinoschisis Zellweger Syndrome PEX1 c.2097_2098insT Spectrum Zellweger Syndrome PEX1 c.2097_2098insT Spectrum Zellweger Syndrome PEX1 c.2916delA Spectrum Zellweger Syndrome PEX1 c.2916delA Spectrum Zellweger Syndrome PEX1 p.G843D Spectrum

    TABLE-US-00002 TABLE 5 Disease/Disorder Gene(s) Neoplasia PTEN; ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4; Notch1; Notch2; Notch3; Notch4; AKT; AKT2; AKT3; HIF; HIF1a; HIF3a; Met; HRG; Bcl2; PPAR alpha; PPAR gamma; WT1 (Wilms Tumor); FGF Receptor Family members (5 members: 1, 2, 3, 4, 5); CDKN2a: APC; RB (retinoblastoma); MEN1; VHL; BRCA1; BRCA2; AR (Androgen Receptor); TSG101; IGF; IGF Receptor; Igf1 (4 variants); Igf2 (3 variants); Igf 1 Receptor; Igf 2 Receptor; Bax; Bcl2; caspases family (9 members: 1, 2, 3, 4, 6, 7, 8, 9, 12); Kras; Apc Age-related Abcr; Ccl2; Cc2; cp (ceruloplasmin); Timp3; Macular cathepsinD; Vldlr; Ccr2 Degeneration Schizophrenia Neuregulin1 (Nrg1); Erb4 (receptor for Neuregulin); Complexin1 (Cplx1); Tph1 Tryptophan hydroxylase; Tph2 Tryptophan hydroxylase 2; Neurexin 1; GSK3; GSK3a; GSK3b Trinucleotide HTT (Huntington's Dx); SBMA/SMAX1/AR Repeat (Kennedy's Dx); FXN/X25 (Friedrich's Ataxia); Disorders ATX3 (Machado-Joseph's Dx); ATXN1 and ATXN2 (spinocerebellar ataxias); DMPK. (myotonie dystrophy); Atrophin-1 and Atnl (DRPLA Dx); CBP (Creb-BP-global instability); VLDLR (Alzheimer's); Atxn7; Atxn10 Fragile X FMR2; FXR1; FXR2; mGLUR5 Syndrome Secretase APH-1 (alpha and beta); Presenilin (Psen1); Related nicastrin (Ncstn); PEN-2 Disorders Prion-related Prp disorders ALS SOD1; ALS2; STEX; FUS; TARDBP; VEGF (VEGF-a; VEGF-b; VEGF-c) Drug addiction Prkce (alcohol); Drd2; Drd4; ABAT (alcohol); GRIA2; Grm5; Grin1; Htr1b; Grin2a; Drd3; Pdyn; Grial (alcohol) Autism Mecp2; BZRAP1, MDGA2; SemaSA, Neurexin 1; Fragile X (FMR2(AFF2); FXR1, FXR2; Mglur5) Alzheimer's E1; CHIP; UCH; UBB; Tau; LRP; PICALM; Disease Clusterin; PS1; SORL1; CR1; Vldlr; Uba1; Uba3; CHIP28 (Aqp1, Aquaporin 1); Uchl1; Uch13; APP Inflammation IL-10; IL-1 (IL-1a; IL-1b); IL-13; 11-17 (IL-17a (CTLA8); IL-17b; IL-17c; IL-17d; IL-17f); II-23; Cx3cr1; ptpn22; TNFa; NOD2/CARD15 for IBD; IL-6; IL-12 (IL-12a; IL-12b); CTLA4; Cx3cl1 Parkinson's x-Synuclein; DJ-1; LRRK2; Parkin; PINK1 Disease

    [0157] In some embodiments, a method further comprises the step of diagnosing a subject based on a calling step, such as diagnosing the subject with a disease associated with a detected causal genetic variant, or reporting a likelihood that the patient has or will develop such disease. Examples of diseases, associated genes, and associated sequence variants are provided herein. In some embodiments, a result is reported via a report generator, such as described herein.

    [0158] In some embodiments, one or more causal genetic variants are sequence variants associated with a particular type or stage of cancer, or of cancer having a particular characteristic (e.g. metastatic potential, drug resistance, drug responsiveness). In some embodiments, the disclosure provides methods for the determination of prognosis, such as where certain mutations are known to be associated with patient outcomes. For example, ctDNA has been shown to be a belier biomarker for breast cancer prognosis than the traditional cancer antigen 53 (CA-53) and enumeration of circulating tumor cells (see e.g. Dawson, et al., N Engl J Med 368:1199 (20 13)). Additionally, the methods of the present disclosure can be used in therapeutic decisions, guidance and monitoring, as well as development and clinical trials of cancer therapies. For example, treatment efficacy can be monitored by comparing patient ctDNA samples from before, during, and after treatment with particular therapies such as molecular targeted therapies (monoclonal drugs), chemotherapeutic drugs, radiation protocols, etc. or combinations of these. For example, the ctDNA can be monitored to see if certain mutations increase or decrease, new mutations appear, etc., after treatment, which can allow a physician to alter a treatment (continue, stop or change treatment, for example) in a much shorter period of time than afforded by methods of monitoring that track patient symptoms. In some embodiments, a method further comprises the step of diagnosing a subject based on a calling step, such as diagnosing the subject with a particular stage or type of cancer associated with a detected sequence variant, or reporting a likelihood that the patient has or will develop such cancer.

    [0159] For example, for therapies that are specifically targeted to patients on the basis of molecular markers (e.g. Herceptin and her2/neu status), patients are tested to find out if certain mutations are present in their tumor, and these mutations can be used to predict response or resistance to the therapy and guide the decision whether to use the therapy. Therefore, detecting and monitoring ctDNA during the course of treatment can be very useful in guiding treatment selections. Some primary (before treatment) or secondary (after treatment) cancer mutations are found to be responsible for the resistance of cancers to some therapies (Misale et al., Nature 486(7404):532 (2012)).

    [0160] A variety of sequence variants that are associated with one or more kinds of cancer that may be useful in diagnosis, prognosis, or treatment decisions are known. Suitable target sequences of oncological significance that find use in the methods of the disclosure include, but are not limited to, alterations in the TP53 gene, the ALK gene, the KRAS gene, the PIK3CA gene, the BRAF gene, the EGFR gene, and the KIT gene. A target sequence the may be specifically amplified, and/or specifically analyzed for sequence variants may be all or part of a cancer-associated gene. In some embodiments, one or more sequence variants are identified in the TP53 gene. TP53 is one of the most frequently mutated genes in human cancers, for example, TP53 mutations are found in 45% of ovarian cancers, 43% of large intestinal cancers, and 42% of cancers of the upper aerodigestive track (see e.g. M. Olivier, et, al. TP53Mutations in Human Cancers: Origins, Consequences, and Clinical Use. Cold Spring Harb Perspect Biol. 2010 January; 2(1). Characterization of the mutation status ofTP53 can aid in clinical diagnosis, provide prognostic value, and influence treatment for cancer patients. For example, TP53 mutations may be used as a predictor of a poor prognosis for patients in CNS tumors derived from glial cells and a predictor of rapid disease progression in patients with chronic lymphocytic leukemia (see e.g. McLendon R E, et al. Cancer. 2005 Oct. 15; 1 04(8): 1693-9; Dicker F, et al. Leukemia. 2009 January;23(1):117-24). Sequence variation can occur anywhere within the gene. Thus, all or part of the TP53 gene can be evaluated herein. That is, as described elsewhere herein, when target specific components (e.g. target specific primers) are used, a plurality of TP53 specific sequences can be used, for example to amplify and detect fragments spanning the gene, rather than just one or more selected subsequences (such as mutation hot spots) as may be used for selected targets. Alternatively, target-specific primers may be designed that hybridize upstream or downstream of one or more selected subsequences (such a nucleotide or nucleotide region associated with an increased rate of mutation among a class of subjects, also encompassed by the term hot spot). Standard primers spanning such a subsequence may be designed, and/or B2B primers that hybridize upstream or downstream of such a subsequence may be designed.

    [0161] In some embodiments, one or more sequence variants are identified in the all or part of the ALK gene. ALK fusions have been reported in as many as 7% of lung tumors, some of which are associated with EGFR tyrosine kinase inhibitor (TKI) resistance (see e.g. Shaw et al., J Clin Oncol. Sep. 10, 2009; 27(26): 4247-4253). Up to 2013, several different point mutations spanning across the entire ALK tyrosine kinase domain have been found in patients with secondary resistance to the ALK tyrosine kinase inhibitor (TKI) (Katayama R 2012 Sci Transl Med. 2012 Feb. 8; 4(120)). Thus, mutation detection in ALK gene can be used to aid cancer therapy decisions.

    [0162] In some embodiments, one or more sequence variants are identified in the all or part of the KRAS gene. Approximately 15-25% of patients with lung adenocarcinoma and 40% of patients with colorectal cancer have been reported as harboring tumor associated KRAS mutations (see e.g. Neuman 2009, Pathol Res Pract. 2009; 205(12):858-62). Most of the mutations are located at codons 12, 13, and 61 of the KRAS gene. These mutations activate KRAS signaling pathways, which trigger growth and proliferation of tumor cells. Some studies indicate that patients with tumors harboring mutations in KRAS are unlikely to benefit from anti-EGFR antibody therapy alone or in combination with chemotherapy (see e.g. Amado et al. 2008 J Clin On col. 2008 Apr. 1; 26(1 0): 1626-34, Bokemeyer et al. 2009 J Clin Oncol. 2009 Feb. 10; 27(5):663-71). One particular hot spot for sequence variation that may be targeted for identifying sequence variation is at position 35 of the gene. Identification of KRAS sequence variants can be used in treatment selection, such as in treatment selection for a subject with colorectal cancer.

    [0163] In some embodiments, one or more sequence variants are identified in the all or part of the PIK3CA gene. Somatic mutations in PIK3CA have been frequently found in various type of cancers, for example, in 10-30% of colorectal cancers (see e.g. Samuels et al. 2004 Science. 2004 Apr. 23; 304(5670):554.). These mutations are most commonly located within two hotspot areas within exon 9 (the helical domain) and exon 20 (the kinase domain), which may be specifically targeted for amplification and/or analysis for the detection sequence variants. Position 3140 may also be specifically targeted.

    [0164] In some embodiments, one or more sequence variants are identified in the all or part of the BRAF gene. Near 50% of all malignant melanomas have been reported as harboring somatic mutations in BRAF (see e.g. Maldonado et al., J Natl Cancer Inst. 2003 Dec. 17; 95(24):1878-90).

    [0165] BRAF mutations are found in all melanoma subtypes but are most frequent in melanomas derived from skin without chronic sun-induced damage. Among the most common BRAF mutations in melanoma are missense mutations V600E, which substitutes valine at position 600 with glutamine. BRAF V600E mutations are associated with clinical benefit of BRAF inhibitor therapy. Detection of BRAF mutation can be used in melanoma treatment selection and studies of the resistance to the targeted therapy.

    [0166] In some embodiments, one or more sequence variants are identified in the all or part of the EGFR gene. EGFR mutations are frequently associated with Non-Small Cell Lung Cancer (about 10% in the US and 35% in East Asia; see e.g. Pao et al., Proc Natl Acad Sci US A. 2004 Sep. 7; 101(36):13306-11). These mutations typically occur within EGFR exons 18-21, and are usually heterozygous. Approximately 90% of these mutations are exon 19 deletions or exon 21 L858R point mutations.

    [0167] In some embodiments, one or more sequence variants are identified in the all or part of the KIT gene. Near 85% of Gastrointestinal Stromal Tumor (GIST) have been reported as harboring KIT mutations (see e.g. Heinrich et al. 2003 J Clin Oncol. 2003 Dec I;21 (23):4342-9). The majority of KIT mutations are found in juxtamembrane domain (exon 11, 70%), extracellular dimerization motif(exon 9, 10-15%), tyrosine kinase I (TKI) domain (exon 13, 1-3%), and tyrosine kinase 2 (TK2) domain and activation loop (exon 17, 1-3%). Secondary KIT mutations are commonly identified after target therapy imatinib and after patients have developed resistance to the therapy.

    [0168] Additional non-limiting examples of genes associated with cancer, all or a portion of which may be analyzed for sequence variants according to a method described herein include, but are not limited to PTEN; ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4; Notchl; Notch2; Notch3; Notch4; AKT; AKT2; AKT3; HIF; HIFla; HIF3a; Met; HRG; Bcl2; PPAR alpha; PPAR gamma; WT1 (Wilms Tumor); FGF Receptor Family members (5 members: 1, 2, 3, 4, 5); CDKN2a; APC; RB (retinoblastoma); MEN1; VHL; BRCA1; BRCA2; AR; (Androgen Receptor); TSG101; IGF; IGF Receptor; Igfl (4 variants); Igf2 (3 variants); Igf 1 Receptor; Igf 2 Receptor; Bax; Bcl2; caspases family (9 members: 1, 2, 3, 4, 6, 7, 8, 9, 12); Kras; and Apc. Further examples are provided elsewhere herein. Examples of cancers that may be diagnosed based on calling one or more sequence variants in accordance with a method disclosed herein include, without limitation, Acanthoma, Acinic cell carcinoma, Acoustic neuroma, Acral lentiginous melanoma, Acrospiroma, Acute eosinophilic leukemia, Acute lymphoblastic leukemia, Acute megakaryoblastic leukemia, Acute monocytic leukemia, Acute myeloblastic leukemia with maturation, Acute myeloid dendritic cell leukemia, Acute myeloid leukemia, Acute promyelocytic leukemia, Adamantinoma, Adenocarcinoma, Adenoid cystic carcinoma, Adenoma, Adenomatoid odontogenic tumor, Adrenocortical carcinoma, Adult T-cell leukemia, Aggressive NK-cell leukemia, AIDS-Related Cancers, AIDS-related lymphoma, Alveolar soft part sarcoma, Ameloblastic fibroma, Anal cancer, Anaplastic large cell lymphoma, Anaplastic thyroid cancer, Angioimmunoblastic T-cell lymphoma, Angiomyolipoma, Angiosarcoma, Appendix cancer, Astrocytoma, Atypical teratoid rhabdoid tumor, Basal cell carcinoma, Basal-like carcinoma, B-cell leukemia, B-cell lymphoma, Bellini duct carcinoma, Biliary tract cancer, Bladder cancer, Blastoma, Bone Cancer, Bone tumor, Brain Stem Glioma, Brain Tumor, Breast Cancer, Brenner tumor, Bronchial Tumor, Bronchioloalveolar carcinoma, Brown tumor, Burkitt's lymphoma, Cancer of Unknown Primary Site, Carcinoid Tumor, Carcinoma, Carcinoma in situ, Carcinoma of the penis, Carcinoma of Unknown Primary Site, Carcinosarcoma, Castleman's Disease, Central Nervous System Embryonal Tumor, Cerebellar Astrocytoma, Cerebral Astrocytoma, Cervical Cancer, Cholangiocarcinoma, Chondroma, Chondrosarcoma, Chordoma, Choriocarcinoma, Choroid plexus papilloma, Chronic Lymphocytic Leukemia, Chronic monocytic leukemia, Chronic myelogenous leukemia, Chronic Myeloproliferative Disorder, Chronic neutrophilic leukemia, Clear-cell tumor, Colon Cancer, Colorectal cancer, Craniopharyngioma, Cutaneous T-cell lymphoma, Degos disease, Dermatofibrosarcoma protuberans, Dermoid cyst, Desmoplastic small round cell tumor, Diffuse large B cell lymphoma, Dysembryoplastic neuroepithelial tumor, Embryonal carcinoma, Endodermal sinus tumor, Endometrial cancer, Endometrial Uterine Cancer, Endometrioid tumor, Enteropathy-associated T-cell lymphoma, Ependymoblastoma, Ependymoma, Epithelioid sarcoma, Erythroleukemia,Esophageal cancer, Esthesioneuroblastoma, Ewing Family of Tumor, Ewing Family Sarcoma, Ewing's sarcoma, Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor, Extrahepatic Bile Duct Cancer, Extramammary Paget's disease, Fallopian tube cancer, Fetus in fetu, Fibroma, Fibrosarcoma, Follicular lymphoma, Follicular thyroid cancer, Gallbladder Cancer, Gallbladder cancer, Ganglioglioma, Ganglioneuroma, Gastric Cancer, Gastric lymphoma, Gastrointestinal cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal Stromal Tumor, Gastrointestinal stromal tumor, Germ cell tumor, Germinoma, Gestational choriocarcinoma, Gestational Trophoblastic Tumor, Giant cell tumor of bone, Glioblastoma multiforme, Glioma, Gliomatosis cerebri, Glomus tumor, Glucagonoma, Gonadoblastoma, Granulosa cell tumor, Hairy Cell Leukemia, Hairy cell leukemia, Head and Neck Cancer, Head and neck cancer, Heart cancer, Hemangioblastoma, Hemangiopericytoma, Hemangiosarcoma, Hematological malignancy, Hepatocellular carcinoma, Hepatosplenic T-cell lymphoma, Hereditary breast-ovarian cancer syndrome, Hodgkin Lymphoma, Hodgkin's lymphoma, Hypopharyngeal Cancer, Hypothalamic Glioma, Inflammatory breast cancer, Intraocular Melanoma, Islet cell carcinoma, Islet Cell Tumor, Juvenile myelomonocytic leukemia, Kaposi Sarcoma, Kaposi's sarcoma, Kidney Cancer, Klatskin tumor, Krukenberg tumor, Laryngeal Cancer, Laryngeal cancer, Lentigo maligna melanoma, Leukemia, Leukemia, Lip and Oral Cavity Cancer, Liposarcoma, Lung cancer, Luteoma, Lymphangioma, Lymphangiosarcoma, Lymphoepithelioma, Lymphoid leukemia, Lymphoma, Macroglobulinemia, Malignant Fibrous Histiocytoma, Malignant fibrous histiocytoma, Malignant Fibrous Histiocytoma of Bone, Malignant Glioma, Malignant Mesothelioma, Malignant peripheral nerve sheath tumor, Malignant rhabdoid tumor, Malignant triton tumor, MALT lymphoma, Mantle cell lymphoma, Mast cell leukemia, Mediastinal germ cell tumor, Mediastinal tumor, Medullary thyroid cancer, Medulloblastoma, Medulloblastoma, Medulloepithelioma, Melanoma, Melanoma, Meningioma, Merkel Cell Carcinoma, Mesothelioma, Mesothelioma, Metastatic Squamous Neck Cancer with Occult Primary, Metastatic urothelial carcinoma, Mixed Mullerian tumor, Monocytic leukemia, Mouth Cancer, Mucinous tumor, Multiple Endocrine Neoplasia Syndrome, Multiple Myeloma, Multiple myeloma, Mycosis Fungoides, Mycosis fungoides, Myelodysplastic Disease, Myelodysplastic Syndromes, Myeloid leukemia, Myeloid sarcoma, Myeloproliferative Disease, Myxoma, Nasal Cavity Cancer, Nasopharyngeal Cancer, Nasopharyngeal carcinoma, Neoplasm, Neurinoma, Neuroblastoma, Neuroblastoma, Neurofibroma, Neuroma, Nodular melanoma, Non-Hodgkin Lymphoma, Non-Hodgkin lymphoma, Nonmelanoma Skin Cancer, Non-Small Cell Lung Cancer, Ocular oncology, Oligoastrocytoma, Oligodendroglioma, Oncocytoma, Optic nerve sheath meningioma, Oral Cancer, Oral cancer, Oropharyngeal Cancer, Osteosarcoma, Osteosarcoma, Ovarian Cancer, Ovarian cancer, Ovarian Epithelial Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant Potential Tumor, Paget's disease of the breast, Pancoast tumor, Pancreatic Cancer, Pancreatic cancer, Papillary thyroid cancer, Papillomatosis, Paraganglioma, Paranasal Sinus Cancer, Parathyroid Cancer, Penile Cancer, Perivascular epithelioid cell tumor, Pharyngeal Cancer, Pheochromocytoma, Pineal Parenchymal Tumor of Intermediate Differentiation, Pineoblastoma, Pituicytoma, Pituitary adenoma, Pituitary tumor, Plasma Cell Neoplasm, Pleuropulmonary blastoma, Polyembryoma, Precursor T-lymphoblastic lymphoma, Primary central nervous system lymphoma, Primary effusion lymphoma, Primary Hepatocellular Cancer, Primary Liver Cancer, Primary peritoneal cancer, Primitive neuroectodermal tumor, Prostate cancer, Pseudomyxoma peritonei, Rectal Cancer, Renal cell carcinoma, Respiratory Tract Carcinoma Involving the NUT Gene on Chromosome 15, Retinoblastoma, Rhabdomyoma, Rhabdomyosarcoma, Richter's transformation, Sacrococcygeal teratoma, Salivary Gland Cancer, Sarcoma, Schwannomatosis, Sebaceous gland carcinoma, Secondary neoplasm, Seminoma, Serous tumor, Sertoli-Leydig cell tumor, Sex cord-stromal tumor, Sezary Syndrome, Signet ring cell carcinoma, Skin Cancer, Small blue round cell tumor, Small cell carcinoma, Small Cell Lung Cancer, Small cell lymphoma, Small intestine cancer, Soft tissue sarcoma, Somatostatinoma, Soot wart, Spinal Cord Tumor, Spinal tumor, Splenic marginal zone lymphoma, Squamous cell carcinoma, Stomach cancer, Superficial spreading melanoma, Supratentorial Primitive Neuroectodermal Tumor, Surface epithelial-stromal tumor, Synovial sarcoma, T-cell acute lymphoblastic leukemia, T-cell large granular lymphocyte leukemia, T-cell leukemia, T-cell lymphoma, T-cell prolymphocytic leukemia, Teratoma, Terminal lymphatic cancer, Testicular cancer, Thecoma, Throat Cancer, Thymic Carcinoma, Thymoma, Thyroid cancer, Transitional Cell Cancer of Renal Pelvis and Ureter, Transitional cell carcinoma, Urachal cancer, Urethral cancer, Urogenital neoplasm, Uterine sarcoma, Uveal melanoma, Vaginal Cancer, Verner Morrison syndrome, Verrucous carcinoma, Visual Pathway Glioma, Vulvar Cancer, Waldenstrom's macroglobulinemia, Warthin's tumor, Wilms' tumor, and combinations thereof. Non-limiting examples of specific sequence variants associated with cancer are provided in Table 6.

    TABLE-US-00003 TABLE 6 Mutation COSMIC Amino acid mutation % in Gene Nucleotide melanoma Clinical relevance BRAF V600E 50% (80-90% among Increase sensitivity to BRAF 1799T>A BRAF mutations) inhibitors Increase sensitivity to MEK inhibitors BRAF V600E 50% (80-90% among Increase sensitivity to BRAF 1799_1800delTGinsAA BRAF mutations) inhibitors Increase sensitivity to MEK inhibitors BRAF V600R 50% (<5% among Increase sensitivity to BRAF 1798_1799delGTinsAG BRAF mutations) inhibitors Respond to MEK inhibitors BRAF V600M 50% (<1% among Increase sensitivity to BRAF 1798G>A BRAF mutations) inhibitors Respond to MEK inhibitors BRAF V600K 50% (5% among BRAF Increase sensitivity to BRAF 1798_1799delGTinsAA mutations) inhibitors Increase sensitivity to MEK inhibitors BRAF V600G 50% (<1% among Increase sensitivity BRAF 1799T>G BRAF mutations) inhibitors Respond to MEK inhibitors BRAF V600D 50% (<5% among Increase sensitivity to BRAF 1799-800delTGinsAT BRAF mutations) inhibitors Respond to MEK inhibitors BRAF L597V 50% (1% among BRAF Respond to BRAF inhibitors 1789C>G mutations) Respond to MEK inhibitors BRAF L597S 50% (<1% among Respond to BRAF inhibitors 1789 1790delCTinsTC BRAF mutations) Respond to MEK inhibitors BRAF L597Q 50% (<1% among Respond to BRAF inhibitors 1790T>A BRAF mutations) Respond to MEK inhibitors BRAF L597R 50% (<1% among Respond to BRAF inhibitors 1790T>G BRAF mutations) Respond to MEK inhibitors BRAF D594N 50% (<1% among Not to BRAF inhibitors 1799_1780delTGinsGA BRAF mutations) May respond to MEK inhibitors BRAF D594H 50% (<1% among Not to BRAF inhibitors 1780C>G BRAF mutations) May respond to MEK inhibitors BRAF D594E 50% (<1% among Not to BRAF inhibitors 1782T>A BRAF mutations) May respond to MEK inhibitors BRAF D594E 50% (<1% among Not to BRAF inhibitors 1782T>G BRAF mutations) May respond to MEK inhibitors BRAF D594G 50% (<1% among Not to BRAF inhibitors 1781A>G BRAF mutations) May respond to MEK inhibitors BRAF D594V 50% (<1% among Not to BRAF inhibitors 1781A>T BRAF mutations) May respond to MEK inhibitors NRAS G12D 13-25% (4% among cytotoxic chemotherapy 35G>A NRAS mutations) NRAS G13R 13-25% (2% among cytotoxic chemotherapy 37G>C NRAS mutations) Not to BRAF inhibitors May respond to MEK inhibitors NRAS G13D 13-25% (2% among cytotoxic chemotherapy 38G>A NRAS mutations) Not to BRAF inhibitors May respond to MEK inhibitors NRAS G13V 13-25% (2% among cytotoxic chemotherapy 38G>T NRAS mutations) Not to BRAF inhibitors May respond to MEK inhibitors NRAS Q61K 13-25% (34% among Respond to MEK inhibitors 181C>A NRAS mutations) NRAS Q61L 13-25% (8% among Respond to MEK inhibitors 182A>T NRAS mutations) NRAS Q61R 13-25% (35% among Respond to MEK inhibitors 182A>G NRAS mutations) NRAS Q61H 13-25% (2% among Respond to MEK inhibitors 183A>C NRAS mutations) NRAS Q61H 13-25% (2% among Respond to MEK inhibitors 183A>T NRAS mutations) CTNNB1 S37F ~2-3% in primary uveal 110C>T melanoma (46% among CTNNB1 mutations) CNA11 Q209L 34% in primary uveal 626A>T melanoma (92% among CNA11 mutations) CNA11 Q209P 34% in primary uveal 626A>C melanoma (1% among CNA11 mutations) GNAQ Q209L ~50% in primary uveal Sensitive to MEK inhibitors 626A>T melanoma (~33% among CNAQ mutations) GNAQ Q209P ~50% in primary uveal Sensitive to MEK inhibitors 626A>C melanoma Sensitive to MEK inhibitors (~64% among CNAQ mutations) GNAQ Q209R ~50% in primary uveal 626A>G melanoma (~2% among CNAQ mutations) KIT K624E ~20% among KIT Increase sensitivity to KIT 1924A>G mutant malignant inhibitor melanomas KIT D816H ~5% among KIT mutant Increase sensitivity to KIT 2446G>C malignant melanomas inhibitor KIT L567P ~25% among KIT Increase sensitivity to KIT 1727T>C mutant malignant inhibitor melanomas KIT V559A ~20% among KIT Increase sensitivity to KIT 1676T>C mutant malignant inhibitor melanomas KIT V559D ~5% among KIT mutant Increase sensitivity to KIT 1676T>A malignant melanomas inhibitor KIT W557R ~10% among KIT Increase sensitivity to KIT 1669T>C mutant malignant inhibitor melanomas KIT W557R ~10% among KIT Increase sensitivity to KIT 1669T>A mutant malignant inhibitor melanomas

    [0169] In addition, the methods and compositions disclosed herein may be useful in discovering new, rare mutations that are associated with one or more cancer types, stages, or cancer characteristics. For example, populations of individuals sharing a characteristic under analysis (e.g. a particular disease, type of cancer, stage of cancer, etc.) may be subjected to a method of detection sequence variants according to the disclosure so as to identify sequence variants or types of sequence variants (e.g. mutations in particular genes or parts of genes). Sequence variants identified as occurring with a statistically significantly greater frequency among the group of individuals sharing the characteristic than in individuals without the characteristic may be assigned a degree of association with that characteristic. The sequence variants or types of sequence variants so identified may then be used in diagnosing or treating individuals discovered to harbor them.

    [0170] Other therapeutic applications include use in non-invasive fetal diagnostics. Fetal DNA can be found in the blood of a pregnant woman. Methods and compositions described herein can be used to identify sequence variants in circulating fetal DNA, and thus may be used to diagnose one or more genetic diseases in the fetus, such as those associated with one or more causal genetic variants. Non-limiting examples of causal genetic variants are described herein, and include trisomies, cystic fibrosis, sickle-cell anemia, and Tay-Saks disease. In this embodiment, the mother may provide a control sample and a blood sample to be used for comparison. The control sample may be any suitable tissue, and will typically be process to extract cellular DNA, which can then be sequenced to provide a reference sequence. Sequences of cfDNA corresponding to fetal genomic DNA can then be identified as sequence variants relative to the maternal reference. The father may also provide a reference sample to aid in identifying fetal sequences, and sequence variants.

    [0171] Still further therapeutic applications include detection of exogenous polynucleotides, such as from pathogens (e.g. bacteria, viruses, fungi, and microbes), which information may inform a diagnosis and treatment selection. For example, some HIV subtypes correlate with drug resistance (see e.g. hivdb.stanford.edu/pages/genotype-rx). Similarly, HCV typing, subtyping and isotype mutations can also be done using the methods and compositions of the present disclosure. Moreover, where an HPV subtype is correlated with a risk of cervical cancer, such diagnosis may further inform an assessment of cancer risk. Further non-limiting examples of viruses that may be detected include Hepadnavirus hepatitis B virus (HBV), woodchuck hepatitis virus, ground squirrel (Hepadnaviridae) hepatitis virus, duck hepatitis B virus, heron hepatitis B virus, Herpesvirus herpes simplex virus (HSV) types 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), human cytomegalovirus (HCMV), mouse cytomegalovirus (MCMV), guinea pig cytomegalovirus (GPCMV), Epstein-Barr virus (EBV), human herpes virus 6 (HHV variants A and B), human herpes virus 7 (1-HHV-7), human herpes virus 8 (1-HHV-8), Kaposi's sarcoma-associated herpes virus (KSHV), B virus Poxvirus vaccinia virus, variola virus, smallpox virus, monkeypox virus, cowpox virus, camelpox virus, ectromelia virus, mousepox virus, rabbitpox viruses, raccoonpox viruses, molluscum contagiosum virus, orf virus, milker's nodes virus, bovin papullar stomatitis virus, sheeppox virus, goatpox virus, lumpy skin disease virus, fowlpox virus, canarypox virus, pigeonpox virus, sparrowpox virus, myxoma virus, hare fibroma virus, rabbit fibroma virus, squirrel fibroma viruses, swinepox virus, tanapox virus, Yabapox virus, Flavivirus dengue virus, hepatitis C virus (HCV), GB hepatitis viruses (GBV-A, GBV-B and GBV-C), West Nile virus, yellow fever virus, St. Louis encephalitis virus, Japanese encephalitis virus, Powassan virus, tick-borne encephalitis virus, Kyasanur Forest disease virus, Togavirus, Venezuelan equine encephalitis (VEE) virus, chikungunya virus, Ross River virus, Mayaro virus, Sindbis virus, rubella virus, Retrovirus human immunodeficiency virus (HIV) types 1 and 2, human T cell leukemia virus (HTLV) types 1, 2, and 5, mouse mammary tumor virus (MMTV), Rous sarcoma virus (RSV), lentiviruses, Coronavirus, severe acute respiratory syndrome (SARS) virus, Filovirus Ebola virus, Marburg virus, Metapneumoviruses (MPV) such as human metapneumovirus (HMPV), Rhabdovirus rabies virus, vesicular stomatitis virus, Bunyavirus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, La Crosse virus, Hantaan virus, Orthomyxovirus, influenza virus (types A, B, and C), Paramyxovirus, parainfluenza virus (PIV types 1, 2 and 3), respiratory syncytial virus (types A and B), measles virus, mumps virus, Arenavirus, lymphocytic choriomeningitis virus, Junin virus, Machupo virus, Guanarito virus, Lassa virus, Ampari virus, Flexal virus, Ippy virus, Mobala virus, Mopeia virus, Latino virus, Parana virus, Pichinde virus, Punta toro virus (PTV), Tacaribe virus and Tamiami virus.

    [0172] Examples of bacterial pathogens that may be detected by methods of the disclosure include, without limitation, Specific examples of bacterial pathogens include without limitation any one or more of (or any combination of) Acinetobacter baumanii, Actinobacillus sp., Actinomycetes, Actinomyces sp. (such as Actinomyces israelii and Actinomyces naeslundii), Aeromonas sp. (such as Aeromonas hydrophila, Aeromonas veronii biovar sobria (Aeromonas sobria), and Aeromonas caviae), Anaplasma phagocytophilum, Alcaligenes xylosoxidans, Acinetobacter baumanii, Actinobacillus actinomycetemcomitans, Bacillus sp. (such as Bacillus anthracis, Bacillus cereus, Bacillus subtilis, Bacillus thuringiensis, and Bacillus stearothermophilus), Bacteroides sp. (such as Bacteroides fragilis), Bartonella sp. (such as Bartonella bacilliformis and Bartonella henselae, Bifidobacterium sp., Bordetella sp. (such as Bordetella pertussis, Bordetella parapertussis, and Bordetella bronchiseptica), Borrelia sp. (such as Borrelia recurrentis, and Borrelia burgdorferi), Brucella sp. (such as Brucella abortus, Brucella canis, Brucella melintensis and Brucella suis), Burkholderia sp. (such as Burkholderia pseudomallei and Burkholderia cepacia), Campylobacter sp. (such as Campylobacter jejuni, Campylobacter coli, Campylobacter lari and Campylobacter fetus), Capnocytophaga sp., Cardiobacterium hominis, Chlamydia trachomatis, Chlamydophila pneumoniae, Chlamydophila psittaci, Citrobacter sp. Coxiella burnetii, Corynebacterium sp. (such as, Corynebacterium diphtheriae, Corynebacterium jeikeum and Corynebacterium), Clostridium sp. (such as Clostridium perfringens, Clostridium difficile, Clostridium botulinum and Clostridium tetani), Eikenella corrodens, Enterobacter sp. (such as Enterobacter aerogenes, Enterobacter agglomerans, Enterobacter cloacae and Escherichia coli, including opportunistic Escherichia coli, such as enterotoxigenic E. coli, enteroinvasive E. coli, enteropathogenic E. coli, enterohemorrhagic E. coli, enteroaggregative E. coli and uropathogenic E. coli) Enterococcus sp. (such as Enterococcus faecalis and Enterococcus faecium) Ehrlichia sp. (such as Ehrlichia chafeensia and Ehrlichia canis), Erysipelothrix rhusiopathiae, Eubacterium sp., Francisella tularensis, Fusobacterium nucleatum, Gardnerella vaginalis, Gemella morbillorum, Haemophilus sp. (such as Haemophilus influenzae, Haemophilus ducreyi, Haemophilus aegyptius, Haemophilus parainfluenzae, Haemophilus haemolyticus and Haemophilus parahaemolyticus, Helicobacter sp. (such as Helicobacter pylori, Helicobacter cinaedi and Helicobacter fennelliae), Kingella kingii, Klebsiella sp. (such as Klebsiella pneumoniae, Klebsiella granulomatis and Klebsiella oxytoca), Lactobacillus sp., Listeria monocytogenes, Leptospira interrogans, Legionella pneumophila, Leptospira interrogans, Peptostreptococcus sp., Moraxella catarrhalis, Morganella sp., Mobiluncus sp., Micrococcus sp., Mycobacterium sp. (such as Mycobacterium leprae, Mycobacterium tuberculosis, Mycobacterium intracellulare, Mycobacterium avium, Mycobacterium bovis, and Mycobacterium marinum), Mycoplasm sp. (such as Mycoplasma pneumoniae, Mycoplasma hominis, and Mycoplasma genitalium), Nocardia sp. (such as Nocardia asteroides, Nocardia cyriacigeorgica and Nocardia brasiliensis), Neisseria sp. (such as Neisseria gonorrhoeae and Neisseria meningitidis), Pasteurella multocida, Plesiomonas shigelloides. Prevotella sp., Porphyromonas sp., Prevotella melaminogenica, Proteus sp. (such as Proteus vulgaris and Proteus mirabilis), Providencia sp. (such as Providencia alcalfaciens, Providencia rettgeri and Providencia stuartii), Pseudomonas aeruginosa, Propionibacterium acnes, Rhodococcus equi, Rickettsia sp. (such as Rickettsia rickettsii, Rickettsia akari and Rickettsia prowazekii, Orientia tsutsugamushi (formerly: Rickettsia tsutsugamushi) and Rickettsia typhi), Rhodococcus sp., Serratia marcescens, Stenotrophomonas maltophilia, Salmonella sp. (such as Salmonella enterica, Salmonella typhi, Salmonella paratyphi, Salmonella enteritidis, Salmonella cholerasuis and Salmonella typhimurium), Serratia sp. (such as Serratia marcesans and Serratia liquifaciens), Shigella sp. (such as Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei), Staphylococcus sp. (such as Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus hemolyticus, Staphylococcus saprophyticus), Streptococcus sp. (such as Streptococcus pneumoniae (for example chloramphenicol-resistant serotype 4 Streptococcus pneumoniae, spectinomycin-resistant serotype 6B Streptococcus pneumoniae, streptomycin-resistant serotype 9V Streptococcus pneumoniae, erythromycin-resistant serotype 14 Streptococcus pneumoniae, optochin-resistant serotype 14 Streptococcus pneumoniae, rifampicin-resistant serotype 18C Streptococcus pneumoniae, tetracycline-resistant serotype 19F Streptococcus pneumoniae, penicillin-resistant serotype 19F Streptococcus pneumoniae, and trimethoprim-resistant serotype 23F Streptococcus pneumoniae, chloramphenicol-resistant serotype 4 Streptococcus pneumoniae, spectinomycin-resistant serotype 6B Streptococcus pneumoniae, streptomycin-resistant serotype 9V Streptococcus pneumoniae, optochin-resistant serotype 14 Streptococcus pneumoniae, rifampicin-resistant serotype 18C Streptococcus pneumoniae, penicillin-resistant serotype 19F Streptococcus pneumoniae, or trimethoprim-resistant serotype 23F Streptococcus pneumoniae), Streptococcus agalactiae, Streptococcus mutans, Streptococcus pyogenes, Group A streptococci, Streptococcus pyogenes, Group B streptococci, Streptococcus agalactiae, Group C streptococci, Streptococcus anginosus, Streptococcus equismilis, Group D streptococci, Streptococcus bovis, Group F streptococci, and Streptococcus anginosus Group G streptococci), Spirillum minus, Streptobacillus moniliformi, Treponema sp. (such as Treponema carateum, Treponema petenue, Treponema pallidum and Treponema endemicum, Tropheryma whippelii, Ureaplasma urealyticum, Veillonella sp., Vibrio sp. (such as Vibrio cholerae, Vibrio parahemolyticus, Vibrio vulnificus, Vibrio parahaemolyticus, Vibrio vulnificus, Vibrio alginolyticus, Vibrio mimicus, Vibrio hollisae, Vibrio fluvialis, Vibrio metchnikovii, Vibrio damsela and Vibrio furnisii), Yersinia sp. (such as Yersinia enterocolitica, Yersinia pestis, and Yersinia pseudotuberculosis) and Xanthomonas maltophilia among others.

    [0173] In some embodiments, the methods and compositions of the disclosure are used in monitoring organ transplant recipients. Typically, polynucleotides from donor cells will be found in circulation in a background of polynucleotides from recipient cells. The level of donor circulating DNA will generally be stable if the organ is well accepted, and the rapid increase of donor DNA (e.g. as a frequency in a given sample) can be used as an early sign of transplant rejection. Treatment can be given at this stage to prevent transplant failure. Rejection of the donor organ has been shown to result in increased donor DNA in blood; see Snyder et al., PNAS 108(15):6629 (2011). The present disclosure provides significant sensitivity improvements over prior techniques in this area. In this embodiment, a recipient control sample (e.g. cheek swab, etc.) and a donor control sample can be used for comparison. The recipient sample can be used to provide that reference sequence, while sequences corresponding to the donor's genome can be identified as sequence variants relative to that reference. Monitoring may comprise obtaining samples (e.g. blood samples) from the recipient over a period of time. Early samples (e.g. within the first few weeks) can be used to establish a baseline for the fraction of donor cfDNA. Subsequent samples can be compared to the baseline. In some embodiments %, an increase in the fraction of donor cfDNA of about or at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, 250%, 500%, 1000%, or more may serve as an indication that a recipient is in the process of rejecting donor tissue.

    EXAMPLES

    [0174] The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.

    Example 1: Preparing Tandem Repetitive Sequencing Library for Mutation Detection

    [0175] Starting with >10ng of 150 bp DNA fragments in 12 L water or 10 mM Tris-HCl pH 8.0, 2 L 10 CircLigase buffer mix was added and mixture heated to 95 C. for 2 minutes and chilled on ice for 5 minutes. To this was added 4 L 5M Betaine, 1 L 50 mM MnCl.sub.2, and 1 L CircLigase II. The reaction was incubated at 60 C. for at least 12 hours. Next was added 2 L RCA primer mix (50 nM each, to a 5 nM final concentration), and mixed. The mixture was heated to 95 C. for 2 minutes and cooled down to 42 C. for 2 hours. The CirLigation product was purified with Zymo oligo nucleotide purification kit. According to the manufacturer's instructions, 28 L water was added into 22 L CircLigation product for a total volume of 50 L. This was mixed with 100 L Oligo binding buffer and 400 L ethanol. This was spun for 30 seconds at >10,000g, and the flow-through was discarded. 750 L DNA wash buffer was added, then spun for 30 seconds at >10,000g, flow-through discarded, and spun for another 1 minute at top speed. The column was moved to a new Eppendorf tube and eluted with 17 L water (final eluted volume was approximately 15 L).

    [0176] Rolling circle amplification was conducted in a volume of about 50 L. Into the 15 L elution sample, was added 5 L 10 RepliPHI buffer (Epicentre), 1 L 25 mM dNTPs, 2 L 100 mM DTT, 1 L 100U/L RepliPHI Phi29, and 26 L water. The reaction mix was incubated at 30 C. for 1 hour. RCA products were purified by adding 80 L of Ampure beads, following the manufacturer's instructions for the remaining wash steps. For elution, 22.5 L elution buffer was added, and the beads were incubated at 65 C. for 5 minutes. After spining briefly, the tube was returned to the magnets.

    [0177] About 20 L of eluted product from the RCA reaction was mixed with 25 L 2 Phusion Master mix, 2.5 L DMSO, and 0.5 L of 10 M of each B2B primer mix. Amplification used the following PCRprogram: 95 C. for 1 minute, 5 cycles of extension (95 C. for 15 seconds, 55 C. for 15 seconds, 72 C. for 1 minute), 13-18 cycles of replication (95 C. for 15 seconds, 68 C. for 15 seconds, 72 C. for 1 minute), and 72 C. for 7 minutes of final extension. PCR product size was checked by running an E-gel. If the range was from 100-500 bp, a 0.6 Ampure bead purification was performed to enrich 300-500 bp and take 1-2ng for another round of PCR with small RNA library adaptor primers. If the product size range was >1000 bp, products were purified with 1.6 Ampure beads, and 2-3ng taken for Nextera XT amplicon library prep to enrich sizes in the range of 400-1000 bp by 0.6 Ampure bead purification.

    [0178] For performing bioinformatics on sequencing data, FASTQ files were obtained from a MiSeq run. The sequences were aligned in FASTQ files to reference genomic sequences containing targeted sequences (e.g. KRAS and EGFR) using BWA. The regions and lengths of repeat units and its reference position were found for each sequence (both reads) using the alignment results. Variants in all loci were found using the alignment results and information of repeat units of each sequence. Results from two reads were combined. The normalized frequency of variants and the noise level were computed. Multiple additional criteria in variant calls from confirmed variants were applied, including qscore>30 and p-value<0.0001. The confirmed variants that passed these criteria were reported as true variants (mutations). The process can be automated by computer languages (e.g. python).

    Example 2: Making Tandem Repetitive Sequencing Library for Detection of Sequence Variants

    [0179] 10 ng of DNA fragments with 150 bp average length in a 12 L volume were used for tandem repetitive sequencing library construction. The DNA was previously processed with T4 Polynucleotide Kinase (New England Biolabs) to add phosphate group at the 5 terminus and leaving a hydroxyl group at the 3 terminus. For DNA fragments generated from DNase I or enzymatic fragmentation or extracted from serum or plasma, the terminus processing step was skipped. The DNA was mixed with 2 L 10 CircLigase buffer (Epicentre CL9021K). The mixture was heated to 95 C. for 2 minutes and chilled on ice for 5 minutes, then 4 L Betaine, 1 L 50 mM MnCl.sub.2, and 1 L CircLigase II (Epicentre CL9021K) were added. The ligation reaction was performed at 60 C. for at least 12 hours. 1 L of each RCA primer mix at 200 nM (to final of 10 nM final concentration) was added to the ligation products and mixed, heated to 96 C. for 1 minute, cooled to 42 C., and incubated at 42 C. for 2 hours.

    [0180] The CircLigation product with hybridized RCA primers were purified with Zymo oligo nucleotide purification kit (Zymo Research, D4060). To do this, the 21 L of product was diluted to 50 L with 28 L water and 1 L of carrier RNA (Sigma-Aldrich, R5636, diluted at 200 ng/L with 1 TE buffer). The diluted sample was mixed with 100 L Oligo binding buffer and 400 L of 100% ethanol. The mixture was loaded on the column and centrifuged for 30 seconds at >10,000g. The flow-through was discarded. The column was washed with 750 L DNA wash buffer by centrifuging for 30 seconds at >10,000g, discarding the flow-through and centrifuging for another 1 minute at top speed. The column was moved to a new 1.5 mL Eppendorf tube and the DNA was eluted with 17 L elution buffer (10 mM Tris-Cl pH 8.0, final eluted volume about 15 L).

    [0181] 5 L 10 RepliPHI buffer, 2 L 25 mM dNTPs, 2 L 100 mM DTT, 1 L 100 U/L RepliPHI Phi29, and 25 L water (Epicentre, RH040210) were added to the 15 L eluted sample from the column, for a total reaction volume of 50 L. The reaction mix was incubated at 30 C. for 2 hours. The RCA products were purified by adding 80 L of Ampure XP beads (Beckman Coulter, A63881). The manufacturer's instructions were followed for the washing steps. RCA products were eluted after 5 minutes of 65 C. incubation in 22.5 L elution buffer. The tube was briefly centrifuged before returned to magnets.

    [0182] About 20 L of eluted product from the RCA reaction were mixed with 25 L 2 Phusion Master mix (New England Biolabs M0531S), 2.5 L water, 2.5 L DMSO, and 0.5 L of B2B primer mix (10 M each). Amplification was performed with the following thermocycling program: 95 C. for 2 minutes, 5 cycles of extension (95 C. for 30 seconds, 55 C. for 15 seconds, 72 C. for 1 minute), 18 cycles of replication (95 C. for 15 seconds, 68 C. for 15 seconds, 72 C. for 1 minute), and 72 C. for 7 minutes of final extension. The PCR product size was checked by electrophoresis. Once the long PCR products were confirmed by electrophoresis, the PCR products were mixed with 30 L Ampure beads (0.6 volume) for purification to enrich>500 bp PCR products. The purified products were quantified with Qubit 2.0 Quantification Platform (Invitorgen). About 1 ng purified DNA was used for Nextera XT Amplicon library preparation (Illumina FC-131-1024). Library elements with an insert size of >500 bp were enriched by purification with 0.6 Ampure beads.

    [0183] The concentration and size distribution of the amplified libraries were analyzed using the Agilent DNA High Sensitivity Kit for the 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA). Sequencing was performed using Illumina MiSeq with 2-250 bp MiSeq sequencing kit. According to the MiSeq manual, 12 M denatured library was loaded on the sequencing run. In a variation on this procedure, Illumina adapters were used in library preparation in place of Nextera preparation. To do this, about 1 ng of similarly purified DNA was used for PCR amplification with a pair of primers containing the universal part of 2 primers and Illumina Adapter sequence (P5 and P7; 5CAAGCAGAAGACGGCATACGA3 (SEQ ID NO: 3) and 5ACACTCTTTCCCTACACGACGCTCTTCCGATCT3 (SEQ ID NO: 4)). Using Phusion Master Mix, 12 cycles of replication steps (95 C. for 30 seconds, 55 C. for 15 seconds, 72 C. for 60 seconds) were performed. The purpose of this amplification step was to add Illumina adapters for amplicon sequencing. Amplicons>500 bp in length were enriched with 0.6 Ampure beads. The concentration and size distribution of the amplicon library were analyzed using the Agilent DNA High Sensitivity Kit for the 2100 Bioanalyzer (Agilent technologies Inc., Santa Clara, CA). Sequencing was performed using Illumina MiSeq with 2250 bp MiSeq sequencing kit. The universal part of B12B3 primers also served as sequencing primer sequences and custom sequencing primer was added if the primer was not contained in the Illumina kit. 12 M denatured library was loaded on the sequencing run.

    [0184] The target region coverage in one example analysis is illustrated in FIG. 33. Table 3 below describes results for the analysis of the targeted regions.

    [0185] Table 1 provides examples of RCA primers useful in methods of the disclosure. Table 2 provides examples of B12B3 primers useful in methods of the disclosure.

    TABLE-US-00004 TABLE1 RCA RCA primerA RCAPrimerA SEQ primerB RCAPrimerB SEQ GeneName name Sequence IDNO: name Sequence IDNO: PIK3CA PIK3CA-E1a GCTTTGAGCTGTT 5 PIK3CA-E1b AAAGCAATTTC 47 CTTTGTCATT TACACGAGATC C PIK3CA PIK3CA-E2a TTTAATTGTGTGG 6 PIK3CA-E2b ATTAAACAGCA 48 AAGATCCAATC TGCATTGAACT G EGFR EGFR-E1a CTTTCTCACCTTC 7 EGFR-E1b AAATTCCCGTC 49 TGGGATCC GCTATCAAG EGFR EGFR-E2a CCATCACGTAGG 8 EGFR-E2b ATGGCCAGCGT 50 CTTCCTG GGACAAC EGFR EGFR-E3a GACATAGTCCAG 9 EGFR-E3b TGTCCGGGAAC 51 GAGGCAGC ACAAAGAC EGFR EGFR-E4a AAGCGACGGTCC 10 EGFR-E4b TGGCAGCCAGG 52 TCCAAG AACGTAC EGFR EGFR-E5a AGTACGTTCCTG 11 EGFR-E5b AACACCGCAGC 53 GCTGCC ATGTCAAG EGFR EGFR-E6a ATCCACTTGATA 12 EGFR-E6b AAGTGGATGGC 54 GGCACCTTG ATTGGAATC EGFR EGFR-E7a TCTCGCTGGCAG 13 EGFR-E7b CCTGGAGAAAG 55 GGATTC GAGAACGC EGFR EGFR-E9a AACTTTGGGCGA 14 EGFR-E9b AGTTCCGTGAG 56 CTATCTGC TTGATCATCG EGFR EGFR-E10a TTGGAGTCTGTA 15 EGFR-E10b ACTTCTACCGT 57 GGACTTGGC GCCCTGATG EGFR EGFR-E11a CTGCTGTGGGAT 16 EGFR-E11b CACAGCAGGGC 58 GAGGTACTC TTCTTCAG EGFR EGFR-E12a CATGGAATGCTT 17 EGFR-E12b CATGGGCAACT 59 GTACCACATC TCTCTGTTTC BRAF BRAF-E1a CAGTTTGAACAG 18 BRAF-E1b AAACTGATGGG 60 TTGTCTGGATC ACCCACTCC PTEN PTEN-E1a TGTTTCTGCTAAC 19 PTEN-E1b AGGAGATATCA 61 GATCTCTTTG AGAGGATGGAT TC PTEN PTEN-E2a CAGGAAATCCCA 20 PTEN-E2b TCCTGCAGAAA 62 TAGCAATAATG GACTTGAAGG PTEN PTEN-E3a GCTTTGAATCCA 21 PTEN-E3b GGATTCAAAGC 63 AAAACCTTAAAA ATAAAAACCAT C TAC PTEN PTEN-E4a TACAGTACATTC 22 PTEN-E4b TATGTTGTATA 64 ATACCTACCTCTG ACTTAAACCCG C ATAGAC PTEN PTEN-E5a AAAGGATATTGT 23 PTEN-E5b TTGAAGACCAT 65 GCAACTGTGG AACCCACCAC PTEN PTEN-E6a CCATAGAAATCT 24 PTEN-E6b AAGTAAGGACC 66 AGGGCCTCTTG AGAGACAAAA AGG PTEN PTEN-E7a CCAGATGATTCTT 25 PTEN-E7b GGATTATAGAC 67 TAACAGGTAGC CAGTGGCACTG PTEN PTEN-E9a GAACTTGTCTTCC 26 PTEN-E9b CATGTACTTTG 68 CGTCGTG AGTTCCCTCAG C PTEN PTEN-E12a TCTGGTCCTGGTA 27 PTEN-E12b CAGGACCAGA 69 TGAAGAATG GGAAACCTCAG PTEN PTEN-E13a GCTCTATACTGC 28 PTEN-E13b CGTGCAGATAA 70 AAATGCTATCG TGACAAGGAAT ATC PTEN PTEN-E14a TTGGAGAAAAGT 29 PTEN-E14b GGTCAGTTAAA 71 ATCGGTTGG TTAAACATTTT GTGG PTEN PTEN-E15a TGGTGTTACAGA 30 PTEN-E15b GATGTTAGTGA 72 AGTTGAACTGC CAATGAACCTG ATC KRAS KRAS-E1a AAGAGTGCCTTG 31 KRAS-E1b TCTTGCCTACG 73 ACGATACAGC CCACCAG TP53 TP53-E1a CCTGACTCAGAC 32 TP53-E1b CAGGCCCTTCT 74 TGACATTCTCC GTCTTGAAC TP53 TP53-E2a ATGTTCCGAGAG 33 TP53-E2b GAACATCTCGA 75 CTGAATGAG AGCGCTCAC TP53 TP53-E3a TTAAAGGACCAG 34 TP53-E3b TTATGGTATAA 76 ACCAGCTTTC GTTGGTGTTCT GAAG TP53 TP53-E4a CTTGGGACCTCTT 35 TP53-E4b AGAGGTCCCAA 77 ATCAAGTGG GACTTAGTACC TG TP53 TP53-E5a AAGCAAGCAGGA 36 TP53-E5b GCTTGCTTACC 78 CAAGAAGC TCGCTTAGTG TP53 TP53-E6a GGGACGGAACAG 37 TP53-E6b TTCCGTCCCAG 79 CTTTGAG TAGATTACCAC TP53 TP53-E7a CAACTACATGTG 38 TP53-E7b CATGTAGTTGT 80 TAACAGTTCCTG AGTGGATGGTG C G TP53 TP53-E8a GTGGAGTATTTG 39 TP53-E8b ATACTCCACAC 81 GATGACAGAAAC GCAAATTTCC TP53 TP53-E9a TGCTCAGATAGC 40 TP53-E9b CTATCTGAGCA 82 GATGGTGAG GCGCTCATG TP53 TP53-E10a CTGTGCAGCTGT 41 TP53-E10b GCAGGTCTTGG 83 GGGTTGA CCAGTTG TP53 TP53-E12a AAGTCTGTGACT 42 TP53-E12b TGTCCCAGAAT 84 TGCACGGTC GCAAGAAGC TP53 TP53-E13a CCTGTCATCTTCT 43 TP53-E13b GATGACAGGG 85 GTCCCTTC GCCAGGAG TP53 TP53-E14a AAGACCCAGGTC 44 TP53-E14b TGGGTCTTCAG 86 CAGATGAAG TGAACCATTG TP53 TP53-E15a CTGCTCTTGTCTT 45 TP53-E15b GAGCAGAAAG 87 TCAGACTTCC TCAGTCCCATG TP53 TP53-E16a CTCTGAGTCAGG 46 TP53-E16b GCTCGACGCTA 88 AAACATTTTCAG GGATCTGAC

    TABLE-US-00005 TABLE2 Gene B2B SEQ SEQ Name primerA PrimerASequence IDNO: B2BprimerB PrimerBSequence IDNO: PIK3CA PIK3CA- GTTCAGAGTTCTA 89 PIK3CA- CCTTGGCACCCGA 131 BX1a CAGTCCGACGATC BX1b GAATTCCAAAAG GCTTTGAGCTGTTC CAATTTCTACACG TTTGTCATT AGATCC PIK3CA PIK3CA- GTTCAGAGTTCTA 90 PIK3CA- CCTTGGCACCCGA 132 BX2a CAGTCCGACGATC BX2b GAATTCCAATTAA TTTAATTGTGTGGA ACAGCATGCATT AGATCCAATC GAACTG EGFR EGFR- GTTCAGAGTTCTA 91 EGFR-BX1b CCTTGGCACCCGA 133 BX1a CAGTCCGACGATC GAATTCCAAAATT CTTTCTCACCTTCT CCCGTCGCTATCA GGGATCC AG EGFR EGFR- GTTCAGAGTTCTA 92 EGFR-BX2b CCTTGGCACCCGA 134 BX2a CAGTCCGACGATC GAATTCCAATGG CCATCACGTAGGC CCAGCGTGGACA TTCCTG AC EGFR EGFR- GTTCAGAGTTCTA 93 EGFR-BX3b CCTTGGCACCCGA 135 BX3a CAGTCCGACGATC GAATTCCATGTCC GACATAGTCCAGG GGGAACACAAAG AGGCAGC AC EGFR EGFR- GTTCAGAGTTCTA 94 EGFR-BX4b CCTTGGCACCCGA 136 BX4a CAGTCCGACGATC GAATTCCATGGC AAGCGACGGTCCT AGCCAGGAACGT CCAAG AC EGFR EGFR- GTTCAGAGTTCTA 95 EGFR-BX5b CCTTGGCACCCGA 137 BX5a CAGTCCGACGATC GAATTCCAAACA AGTACGTTCCTGG CCGCAGCATGTC CTGCC AAG EGFR EGFR- GTTCAGAGTTCTA 96 EGFR-BX6b CCTTGGCACCCGA 138 BX6a CAGTCCGACGATC GAATTCCAAAGT ATCCACTTGATAG GGATGGCATTGG GCACCTTG AATC EGFR EGFR- GTTCAGAGTTCTA 97 EGFR-BX7b CCTTGGCACCCGA 139 BX7a CAGTCCGACGATC GAATTCCACCTGG TCTCGCTGGCAGG AGAAAGGAGAAC GATTC GC EGFR EGFR- GTTCAGAGTTCTA 98 EGFR-BX9b CCTTGGCACCCGA 140 BX9a CAGTCCGACGATC GAATTCCAAGTTC AACTTTGGGCGAC CGTGAGTTGATCA TATCTGC TCG EGFR EGFR- GTTCAGAGTTCTA 99 EGFR-BX10b CCTTGGCACCCGA 141 BX10a CAGTCCGACGATC GAATTCCAACTTC TTGGAGTCTGTAG TACCGTGCCCTGA GACTTGGC TG EGFR EGFR- GTTCAGAGTTCTA 100 EGFR-BX11b CCTTGGCACCCGA 142 BX11a CAGTCCGACGATC GAATTCCACACA CTGCTGTGGGATG GCAGGGCTTCTTC AGGTACTC AG EGFR EGFR- GTTCAGAGTTCTA 101 EGFR-BX12b CCTTGGCACCCGA 143 BX12a CAGTCCGACGATC GAATTCCACATG CATGGAATGCTTG GGCAACTTCTCTG TACCACATC TTTC BRAF BRAF- GTTCAGAGTTCTA 102 BRAF-BX1b CCTTGGCACCCGA 144 BX1a CAGTCCGACGATC GAATTCCAAAAC CAGTTTGAACAGT TGATGGGACCCA TGTCTGGATC CTCC PTEN PTEN- GTTCAGAGTTCTA 103 PTEN-BX1b CCTTGGCACCCGA 145 BX1a CAGTCCGACGATC GAATTCCAAGGA TGTTTCTGCTAACG GATATCAAGAGG ATCTCTTTG ATGGATTC PTEN PTEN- GTTCAGAGTTCTA 104 PTEN-BX2b CCTTGGCACCCGA 146 BX2a CAGTCCGACGATC GAATTCCATCCTG CAGGAAATCCCAT CAGAAAGACTTG AGCAATAATG AAGG PTEN PTEN- GTTCAGAGTTCTA 105 PTEN-BX3b CCTTGGCACCCGA 147 BX3a CAGTCCGACGATC GAATTCCAGGATT GCTTTGAATCCAA CAAAGCATAAAA AAACCTTAAAAC ACCATTAC PTEN PTEN- GTTCAGAGTTCTA 106 PTEN-BX4b CCTTGGCACCCGA 148 BX4a CAGTCCGACGATC GAATTCCATATGT TACAGTACATTCA TGTATAACTTAAA TACCTACCTCTGC CCCGATAGAC PTEN PTEN- GTTCAGAGTTCTA 107 PTEN-BX5b CCTTGGCACCCGA 149 BX5a CAGTCCGACGATC GAATTCCATTGAA AAAGGATATTGTG GACCATAACCCA CAACTGTGG CCAC PTEN PTEN- GTTCAGAGTTCTA 108 PTEN-BX6b CCTTGGCACCCGA 150 BX6a CAGTCCGACGATC GAATTCCAAAGT CCATAGAAATCTA AAGGACCAGAGA GGGCCTCTTG CAAAAAGG PTEN PTEN- GTTCAGAGTTCTA 109 PTEN-BX7b CCTTGGCACCCGA 151 CAGTCCGACGATC GAATTCCAGGATT BX7a CCAGATGATTCTTT ATAGACCAGTGG AACAGGTAGC CACTG PTEN PTEN- GTTCAGAGTTCTA 110 PTEN-BX9b CCTTGGCACCCGA 152 BX9a CAGTCCGACGATC GAATTCCACATGT GAACTTGTCTTCCC ACTTTGAGTTCCC GTCGTG TCAGC PTEN PTEN- GTTCAGAGTTCTA 111 PTEN-BX12b CCTTGGCACCCGA BX12a CAGTCCGACGATC GAATTCCACAGG TCTGGTCCTGGTAT ACCAGAGGAAAC 153 GAAGAATG CTCAG PTEN PTEN- GTTCAGAGTTCTA 112 PTEN-BX13b CCTTGGCACCCGA 154 BX13a CAGTCCGACGATC GAATTCCACGTGC GCTCTATACTGCA AGATAATGACAA AATGCTATCG GGAATATC PTEN PTEN- GTTCAGAGTTCTA 113 PTEN-BX14b CCTTGGCACCCGA 155 CAGTCCGACGATC GAATTCCAGGTC BX14a TTGGAGAAAAGTA AGTTAAATTAAA TCGGTTGG CATTTTGTGG PTEN PTEN- GTTCAGAGTTCTA 114 PTEN-BX15b CCTTGGCACCCGA BX15a CAGTCCGACGATC GAATTCCAGATGT TGGTGTTACAGAA TAGTGACAATGA 156 GTTGAACTGC ACCTGATC KRAS KRAS- GTTCAGAGTTCTA 115 KRAS-BX1b CCTTGGCACCCGA 157 BX1a CAGTCCGACGATC GAATTCCATCTTG AAGAGTGCCTTGA CCTACGCCACCA CGATACAGC G TP53 TP53- GTTCAGAGTTCTA 116 TP53-BX1b CCTTGGCACCCGA 158 BX1a CAGTCCGACGATC GAATTCCACAGG CCTGACTCAGACT CCCTTCTGTCTTG GACATTCTCC AAC TP53 TP53- GTTCAGAGTTCTA 117 TP53-BX2b CCTTGGCACCCGA 159 BX2a CAGTCCGACGATC GAATTCCAGAAC ATGTTCCGAGAGC ATCTCGAAGCGCT TGAATGAG CAC TP53 TP53- GTTCAGAGTTCTA 118 TP53-BX3b CCTTGGCACCCGA 160 BX3a CAGTCCGACGATC GAATTCCATTATG TTAAAGGACCAGA GTATAAGTTGGTG CCAGCTTTC TTCTGAAG TP53 TP53- GTTCAGAGTTCTA 119 TP53-BX4b CCTTGGCACCCGA 161 BX4a CAGTCCGACGATC GAATTCCAAGAG CTTGGGACCTCTTA GTCCCAAGACTTA TCAAGTGG GTACCTG TP53 TP53- GTTCAGAGTTCTA 120 TP53-BX5b CCTTGGCACCCGA 162 BX5a CAGTCCGACGATC GAATTCCAGCTTG AAGCAAGCAGGAC CTTACCTCGCTTA AAGAAGC GTG TP53 TP53- GTTCAGAGTTCTA 121 TP53-BX6b CCTTGGCACCCGA 163 BX6a CAGTCCGACGATC GAATTCCATTCCG GGGACGGAACAGC TCCCAGTAGATTA TTTGAG CCAC TP53 TP53- GTTCAGAGTTCTA 122 TP53-BX7b CCTTGGCACCCGA 164 BX7a CAGTCCGACGATC GAATTCCACATGT CAACTACATGTGT AGTTGTAGTGGAT AACAGTTCCTGC GGTGG TP53 TP53- GTTCAGAGTTCTA 123 TP53-BX8b CCTTGGCACCCGA 165 BX8a CAGTCCGACGATC GAATTCCAATACT GTGGAGTATTTGG CCACACGCAAAT ATGACAGAAAC TTCC TP53 TP53- GTTCAGAGTTCTA 124 TP53-BX9b CCTTGGCACCCGA 166 BX9a CAGTCCGACGATC GAATTCCACTATC TGCTCAGATAGCG TGAGCAGCGCTC ATGGTGAG ATG TP53 TP53- GTTCAGAGTTCTA 125 TP53-BX10b CCTTGGCACCCGA 167 BX10a CAGTCCGACGATC GAATTCCAGCAG CTGTGCAGCTGTG GTCTTGGCCAGTT GGTTGA G TP53 TP53- GTTCAGAGTTCTA 126 TP53-BX12b CCTTGGCACCCGA 168 BX12a CAGTCCGACGATC GAATTCCATGTCC AAGTCTGTGACTT CAGAATGCAAGA GCACGGTC AGC TP53 TP53- GTTCAGAGTTCTA 127 TP53-BX13b CCTTGGCACCCGA 169 BX13a CAGTCCGACGATC GAATTCCAGATG CCTGTCATCTTCTG ACAGGGGCCAGG TCCCTTC AG TP53 TP53- GTTCAGAGTTCTA 128 TP53-BX14b CCTTGGCACCCGA 170 BX14a CAGTCCGACGATC GAATTCCATGGGT AAGACCCAGGTCC CTTCAGTGAACCA AGATGAAG TTG TP53 TP53- GTTCAGAGTTCTA 129 TP53-BX15b CCTTGGCACCCGA 171 BX15a CAGTCCGACGATC GAATTCCAGAGC CTGCTCTTGTCTTT AGAAAGTCAGTC CAGACTTCC CCATG TP53 TP53- GTTCAGAGTTCTA 130 TP53-BX16b CCTTGGCACCCGA 172 BX16a CAGTCCGACGATC GAATTCCAGCTCG CTCTGAGTCAGGA ACGCTAGGATCT AACATTTTCAG GAC

    TABLE-US-00006 TABLE 3 Results reads 1.5M % target base w/1x 97.8% % on target 63.4% % duplicates 18.2% mean coverage 74.5x s.d of coverage 0.21

    Example 3: Fragmentation of Genomic DNA for Sequencing Library Construction

    [0186] 1 L of genomic DNA was processed using a NEBNext dsDNA Fragmentase kit (New England Biolabs) by following the manufacturer's protocol. Incubation time was extended to 45 minutes at 37 C. The fragmentation reaction was stopped by adding 5 L of 0.5M EDTA pH 8.0, and was purified by adding 2 volumes of Ampure XP beads (Beckman Coulter, A63881) according to the manufacturer's protocol. Fragmented DNA was analyzed on a Bioanalyzer with a High Sensitivity DNA kit (Agilent). The size range of fragmented DNA was typically from about 100 bp to about 200 bp with a peak of about 150 bp.

    Example 4: Library Preparation Procedures

    [0187] In this example, a KAPA Library Prep Kit (KK8230) was used for illustration purposes.

    [0188] For steps involving bead purification, AMPure XP Beads (cat #A63881) were equilibrated to room temperature and thoroughly resuspended before mixing with the sample. After mixing thoroughly with the sample on a vortex mixer, it was incubated at room temparature for 15 minutes to allow DNA to bind to the beads. Beads were then put over a magnetic stand until the liquid was clear. The beads were then washed twice with 200 l 80% ethanol and dried at room temperature for 15 minutes.

    [0189] For performing the end-repair reaction, up to 50 L (2-10 ng) of cell-free DNA was mixed with 20 L of end repair master mix (8 L water, 7 L 1 KAPA end repair buffer, and 5 L KAPA end repair enzyme mix), and incubated for 30 minutes at 20 C. 120 L of AMPure XP Beads were then added to the 70 L end repair reaction. The sample was then purified as above.

    [0190] For performing A-tailing reactions, dried beads containing the end-repaired DNA fragment were mixed with A-tailing master mix (42 L water, 5 L 1 OX KAPA A tailing buffer, and KAPA A-tailing enzyme). The reaction was incubated at 30 C. for 30 minutes. After adding 90 L of PEG solution (20% PEG 8000, 2.5M NaCl), the mixture was washed according the bead purification protocol above. This A-tailing step was skipped for blunt-end ligation reactions.

    [0191] For linker ligation, two oligos having the following sequences (5 to 3) were used to form an adapter polynucleotide duplex: /5Phos/CCATTTCATTACCTCTTTCTCCGCACCCGACATAGAT*T (SEQ ID NO: 173) and /5Phos/ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG*T (SEQ ID NO: 174). The dried beads containing end-repaired (for blunt ligation) or a-tailed (for linker-based ligation) was mixed with 45 L of ligation master mix (30 L water, 10 L 5 KAPA ligation buffer, and 5 L KAPA T4 DNA ligase), and 5 L water (for blunt end ligation) or 5 L of an equal molar mix of linker oligonucleotides (for linker-based ligation). The beads were thoroughly resuspended, and incubated at 20 C. for 15 minutes. After adding 50 L of PEG solution (see above), the mixture was washed according to the above bead purification protocol.

    [0192] Multiple displacement amplication (MDA) was performed using Illustra Genomiphi V2 DNA Amplification Kits. The dried beads containing the ligated fragment chain were resuspended in 9 L of random hexamer-containing buffer and heated to 3 minutes at 95 C., followed by rapid cooling on ice. After adding 1 L of enzyme mix, the cooled sample was incubated at 30 C. for 90 minutes. The reaction was then stopped by heating at 65 C. for 10 minutes. After adding 30 L of PEG solution (see above), the mixture was washed according to the purification protocol described above, and resuspended in 200 L TE (with an incubation at 65 C. for 5 minutes). If desired, the purified product could be quantitated with quantitative PCR, digital droplet PCR (ddPCR), or put forward to next generation sequencing (NGS).

    [0193] After MDA, long ligated fragment chains (e.g.>2kb) were sonicated to 300 bp using a Covaris S220 in 130 L total volume. The manufacturer's protocol indicated 140 W peak power, 10% duty factor, 200 cycles per burst, and 80 seconds of treatment time. The fragment length of 300 bp was selected to increase the chance of keeping an intact original cell free DNA fragment. A standard library preparation protocol can be used to put adaptors on sonicated DNA fragments for sequencing if desired. A variety of read compositions were returned from pair-end sequencing runs on Illumina sequencers (either HiSeq or MiSeq). Those in which the junction (either self-junction, or adapter junction in the case where adapters were included in the ligation step) was internal to the read (flanked 5 and 3 by non-adapter sequence) were used to barcode sequences of interest.

    Example 5: Circularization and Amplification

    [0194] This provides an example illustration of a circularization and amplification procedure (also referred to as a Nebula procedure). The procedure used the following supplies: PCR Machine (e.g. MJ research PTC-200 Peltier thermal cycler); Circligase II, ssDNA ligase Epicentre cat #CL9025K; Exonuclease (e.g. Exol, NEB Biolabs cat #M0293S; Exolll, NEB biolabs cat #M0206S); T4 Polynucleotide Kinase (NEB Biolab cat #M020IS); Whole Genome Amplification kit (e.g. GE Healthcare, Illustra, Ready-To-Go, Genomiphi, V3 DNA amplification kit); GlycoBlue (e.g. Ambion cat #AM9515); Micro centrifuge (e.g. Eppendrof 5415D); DNA purification beads (e.g. Agencourt, AMpure XP, Beckman Coulter cat #A63881); Magnetic stand (e.g. The MagnaRack Invitrogen cat #CS15000); Qubit 2.0 Fluorometer (Invitrogen, cat #Q32866); molecular probes ds DNA HS assay kit (Life Technology cat #032854); and a Bioanalyzer (Agilent 2100), and high sensitivity DNA reagents (cat #5067-4626).

    [0195] For amplification of DNA fragments lacking a 5 terminal phosphate (e.g. cell-free DNA), the first step was end-repair and formation of single strands. DNA was denatured at 96 C. for 30 seconds (e.g. on a PCR machine). A polynucleotide kinase (PNK) reaction was prepared by combining 40 L of DNA and 5 L 10 PNK reaction buffer, followed by incubation at 37 C. for 30 minutes. 1 mM ATP and the PNK enzyme were added to the reaction, and incubated for 37 C. for 45 minutes. A buffer exchange was conducted by precipitating and resuspending the DNA. 50 L DNA from the PNK reaction, 5 L sodium acetate 0.5M pH 5.2, 1 L GlycoBlue, 1 L oligo (100ng/L), and 150 L 100% ethanol were combined. The mixture was incubated at 80 C. for 30 minutes, and centrifuged at 16k rpm for 5 minutes to pellet the DNA. The DNA pellet was washed with 500 L of 70% ethanol, air dried for 5 minutes at room temperature, and DNA was suspended in 12 L 10 mM Tris-Cl pH 8.0.

    [0196] Resuspended DNA was then circularized by ligation. The DNA was denatured at 96 C. for 30 seconds, the sample was chilled on ice for 2 minutes, and ligase mix (2 L 10 CircLigase buffer, 4 L 5M Betaine, 1 L 50 mM MnCl.sub.2, 1 L CircLigase II) was added. The ligation reaction was incubated at 60 C. for 16 hours on a PCR machine. Unligated polynucleotides were degraded by exonuclease digestion. For this, DNA was denatured at 80 C. for 45 seconds, and 1 L Exo nuclease mix (ExoI 20U/L: ExoIII 100U/L=1:2) was added to each tube. This was mixed by pipetting up and down 5 times, and spun briefly. The digestion mix was incubated at 37 C. for 45 minutes. The volume was brought to 50 L with 30 L of water, and a further buffer exchange was conducted by precipitation and resuspension as above.

    [0197] For conducting whole genome amplification (WGA), purified DNA was first denatured at 65 C. for 5 minutes. 10 L of denature buffer from GE WGA kit was added to 10 L of purified DNA. The DNA was cooled on a cool block or ice for 2 minutes. 20 L of DNA was added to the Ready-To-Go GenomiPhi V3 cake (WGA). The WGA reaction was incubated at 30 C. for 1.5 hours, followed by heat inactivation at 65 C. for 10 minutes.

    [0198] The sample was purified using AmpureXP magnetic beads (1.6). The beads were vortexted, and 80 L aliquoted in 1.5 mL tubes. 30 L water, 20 L amplified DNA, and the 80 L of beads were then combined, and incubated at room temperature for 3 minutes. The tubes were placed on a magnetic stand for 2 minutes, and the clear solution was pipetted out. The beads were washed twice with 80% ethanol. DNA was eluted by adding 200 L of 10 mM Tris-Cl pH 8.0. The DNA bead mixture was incubated at 65 C. for 5 minutes. The tubes were placed back on the magnetic stand for 2 minutes. 195 L of DNA was transfered to a new tube. 1 L was used for quantification by Qubit. Finally, 130 L WGA product was sonicated using Covaris S220 to reach a size of around 400 bp.

    Example 6: Circularization and Amplification with Additional Purification

    [0199] This provides an example illustration of a circularization and amplification procedure (also referred to as a Nebula procedure) with an phenol chlorophorm extraction step. Step 1 was the removal of the competitive RNA (from carrier RNA in extraction) and natural RNA (co-purified) for a circligase reaction. RNA was removed by adding 1 l of RNase A (10 mg/ml) (Qiagen 1007885) to 50 l of cfDNA(2-10 ng) and incubating at 37 C. for 30 minutes on PCR machine (MJ research PTC-200 Peltier thermal cycler).

    [0200] Step 2 was a buffer exchange with salt and ethanol precipitation. This step was useful to clean up and concentrate the input for ligation with near 100% recovery (whereas columns commonly recover only 30%). The Ethanol coprecipitant mix (50 L of DNA from RNase treatment, 5 L of sodium acetate 0.5M pH5.2, 1 L of GlycoBlue (Ambion AM9515), 1 L carrier oligo (100ng/l) 150 L of 100% Ethanol) was incubated at 80 C. for 30 minutes, and centrifuged at 16k rpm (Eppendorf 5415D) for 5 min to precipitate the DNA. The use of a 20-mer non-specific carrier oligo (we used a PCR primer), slightly increased the yield and stability of precipitation recovery. The DNA pellet was washed with 500 L of 70% Ethanol. The DNA pellet was air-dried for 5 min in room temperature, and resuspended with 13 L 10 mM Tris-Cl pH 8.0.

    [0201] Step 3 was circularization. 12 L of cfDNA was denatured at 96 C. for 30 seconds, and chilled on an ice block for 2 minutes. The addition of ligation mix(12 L cfDNA, 2 L of 10 Circligase buffer, 4 L 5M Betaine, 1 L of 50 mM MnCl.sub.2, 1 L of Circligase II (Epicentre #CL9025K) was set up on a cool block, and ligation was performed at 60 C. for 16 hours.

    [0202] Step 4 was exonuclease digestion. Ligation DNA mixture was incubated at 80 C. for 45 seconds on a PCR machine, followed by an Exonuclease treatment. 1 L Exo nuclease mix (Exol 20U/L: ExoIII 100U/L=1:2) was added to each tube, and reactions were incubated at 37 C. for 30 minutes. For quality control purposes, removal of linear template was not necessary.

    [0203] Step 5 was phenol chloroform extraction and buffer exchange with salt and ethanol precipitation. Phenol/ethanol was helpful to achieving more than 80% ligation efficiency (amount of ciruclarized product was approximately equal to amount of input polynucleotides). 180 L of 10 mM Tris was added to 20 L of DNA from the exonuclease treatment to make a volume of 200 L, and 200 L of phenol was used to extract DNA. The aqueous layer was collected, and the DNA was recovered by ethanol precipitation. The ethanol coprecipitant mix (200 L of DNA solution after phenol extraction, 20 L sodium acetate 0.5M pH 5.2, 1 L GlycoBlue, 1 L carrier oligo (100ng/L), 600 L of 100% ethanol) was incubated at 80 C. for 30 minutes, and centrifuged at 16k rpm for 5 minutes to precipitate the DNA. The DNA pellet was washed with 500 L of 70% ethanol. The DNA pellet was air dried for 5 minutes at room temperature, and resuspended with 11 L 10 mM Tris-Cl pH 8.0.

    [0204] Step 6 was whole genome amplification. 10 L of purified DNA was incubated at 65 C. for 5 minutes on a heating block, and 10 L of denature buffer from GE Healthcare, Ready-To-Go, Genomiphi, V3 DNA amplification kit were added. After DNA was cooled down for 5 minutes at room temperature, 20 L of DNA was subjected to the Ready-To-Go GenomiPhi V3 cake (WGA). The amplification reaction was incubated at 30 C. for 1.5 hours, and the reaction was terminated by heat inactivation at 65 C. for 10 minutes.

    [0205] Step 7 was bead purification using AmpureXP magnetic beads (1.6). This was done as in the previous example.

    [0206] Step 8 was sonication as in the previous example. The DNA was then ready for quantitative PCR, ddPCR, or sequencing library construction.

    Example 7: Analysis of Ligation Efficiency and On-Target Rates

    [0207] cfDNA that was circularized and subjected to whole genome application as in the above examples was analyzed by quantitative PCR (qPCR). The qPCR amplification curve results for a sample target (using KRAS primers) are shown in FIG. 18. As shown in FIG. 18A, qPCR amplification of 1/10.sup.th of input cfDNA gave an average Ct (cycle threshold) of 31.75, and 1/10.sup.th of the same sample's ligation product gave an average Ct of 31.927, indicating a high ligation efficiency of about 88%. Ligation efficiency may range from about or more than about 70%, 80%, 90%, 95%, or more, such as about 100%. The linear DNA that was not circularized is removed in some examples, such that about all DNA can be amplified from circular forms. Each sample was run three times, in duplicate. As shown in FIG. 18B, the amplification curves of 10 ng of WGA product and reference genomic DNA (gDNA) (12878, 10 ng) virtually overlap with each other. The average Ct for the WGA sample was 26.655, while that of the gDNA sample was 26.605, indicating a high on-target rate of over 96%. The number of KRAS in a given amount of amplified DNA was comparable with the un-amplified gDNA, indicating an unbiased amplification process. Each sample was tested three times, in duplicate. As a point of contrast, the circularization protocol provided in Lou et al. (PNAS, 2013, 110 (49)) was also tested. Using the Lou method, which lacked the precipitation and purification steps of the examples described above, only 10-30% of linear input DNA was converted to circular DNA. Such low recovery presents a challenge to downstream sequencing and variant detection.

    Example 8: Analysis of Amplified Circularized DNA by ddPCR

    [0208] Droplet digital PCR (ddPCR) was used to assess allele frequency preservation and bias in whole genome amplification products generated from circularized polynucleotides. In general, ddPCR refers to a digital PCR assay that measures absolute quantities by counting nucleic acid molecules encapsulated in discrete, volumetrically defined, water-in-oil droplet partitions that support PCR amplification (Hinson et al, 2011, Anal. Chem. 83:8604-8610; Pinheiro et al, 2012, Anal. Chem. 84: 1003-1011). A single ddPCR reaction may be comprised of at least 20,000 partitioned droplets per well. Droplet digital PCR may be performed using any platform that performs a digital PCR assay that measures absolute quantities by counting nucleic acid molecules encapsulated in discrete, volumetrically defined, water-in-oil droplet partitions that support PCR amplification. A typical strategy for droplet digital PCR may be summarized as follows: a sample is diluted and partitioned into thousands to millions of separate reaction chambers (water-in-oil droplets) so that each contains one or no copies of the nucleic acid molecule of interest. The number of positive droplets detected, which contain the target amplicon (i.e., nucleic acid molecule of interest), versus the number of negative droplets, which do not contain the target amplicon (nucleic acid molecule of interest), may be used to determine the number of copies of the nucleic acid molecule of interest that were in the original sample. Examples of droplet digital PCR systems include the QX100 Droplet Digital PCR System by Bio-Rad, which partitions samples containing nucleic acid template into 20,000 nanoliter-sized droplets; and the RainDrop digital PCR system by RainDance, which partitions samples containing nucleic acid template into 1,000,000 to 10,000,000 pico liter-sized droplets. Additional examples of methods for ddPCR are provided in WO2013181276A1.

    [0209] In this example, BRAF V600E genomic DNA (gDNA) from a melanoma cell line was mixed in with reference genome DNA 12878 at specific proportions (0%, 0.67%, 2.0%, 6.67%, 20%, or 100%), and fragmented to generate fragments of a size resembling those found in cfDNA (in this case, about 150 bp). The mixed DNA samples (10 ng) were circularized and amplified according to Example 2. 40ng of amplified DNA was subjected to ddPCR for BRAF V600E and wild type. The observed mutation allele frequencies are illustrated graphically and tabulated in FIG. 19. As shown, the observed mutation allele frequency with amplification (middle row of FIG. 19 table) reflects the input mutant allele frequency (top row), as well as the ddPCR result from 100 ng of genomic DNA without amplification (bottom row). The allele frequency by ddPCR output is calculated as the number of BRAF mutation containing droplets over the sum of both mutant and wild type containing droplets. DNA with amplification is indicated as an open circle, and without amplification is indicated as a smalled filled circle. With the exception of a small deviation at 0.67%, the two data sets overlap completely. This demonstrates preservation of true representation of the mutant allele frequency, substantially without bias.

    Example 9: Detection of Sequence Variants Above Background

    [0210] 10 ng of sonicated gDNA (150 bp, Multi-Gene Multiplex reference DNA, Horizon) was circularized and amplified as described in Example 2, and followed by sonication. Fragmented DNA was then subjected to Rubicon sequencing library construction. After capture sequencing, variants within 50 bp from reference hotspots were plotted. Results for variant detection, where calling a variant required detection in two different polynucleotides distinguished by different junctions, are shown in FIG. 20. The seven expected reference hotspots (KIT D816V, EGFR G719S, EGFR T790M, EGFR L858R, KRAS G13D, KRAS G12D, NRAS Q61K) are plotted at position 0. Two other variants were also confirmed, illustrated as the open triangle and diamond in FIG. 20.

    [0211] For comparison, gDNA was sonicated as above, but 10 ng of the sonicated gDNA was directly subjected to Rubicon sequencing library construction according to common practice, without circularization and without requiring confirmation of a sequence variants on two different polynucleotides. After capture sequencing, variants within 50 bp from reference hotspots were again plotted, with results in FIG. 21. The seven expected reference hotspots (KIT D816V, EGFR G719S, EGFR T790M, EGFR L858R, KRAS G13D, KRAS G12D, NRAS Q61K) are plotted at position 0. The variants at other positions were not expected, and are most likely due to sequencing errors. By contrast with results of the method employed in generating FIG. 20, the results in FIG. 21 indicate that standard sequencing methods have a much higher random error rate that can mask true mutation signal when allele frequency is low (such as below 5%).

    [0212] Results of a separate analysis of sensitivity and background noise detected by sequencing methods with and without requiring detection in two different polynucleotides are illustrated in FIGS. 16-17. As these figures illustrate, the validation requirement greatly reduces background noise and increases sensitivity.

    Example 10: Analysis of GC Composition and Size Distribution

    [0213] 10 ng of sonicated gDNA (150 bp, Multi-Gene Multiplex reference DNA, Horizon) was amplified circularized and amplified as in Example 5, sequenced, and analyzed with the variant-calling two-polynucleotide verification filter (left). The number of sequences with a range of CG percentages were tabulated and plotted graphically, as shown in FIG. 22. As shown in the far left plot, sequences for samples prepared according to Example 5 largely resemble the theoretical distribution except the central peak (corresponds to the overall GC content of the underlying genome). By contrast, when the same amount of gDNA was used directly to construct a sequencing library without amplification using a Rubicon sequencing library construction kit, the difference between the sequencing result and theoretical distribution is very apparent (see the middle plot). The central peak of this direct Rubicon sequencing is higher than the theoretical distribution. Newman et al. (2014; Nature Medicine, (20):548-54) reported that the cfDNA sequencing GC content distribution was similar with theoretical distribution when 32ng of cfDNA was used. This is illustrated in the far right plot.

    [0214] DNA size distribution was assessed for cfDNA that had been circularized, amplified, and sequenced as in Example 5. As shown in FIG. 23, the peak of the distribution of fragment lengths indicated by the sequencing results is at about 150-180 bp, which resembles the typical distribution pattern of cfDNA.

    Example 11: Assessment of Amplification Uniformity

    [0215] The qPCR results of 10 products circularized and amplified according to Example 5 were compared to unamplified reference DNA (gDNA from 12878 cell line, Coriell Institute). 10 ng of genomic reference DNA or amplification product were used for each real-time qPCR reaction, and ratios were generated by relative quantification of amplification product over genomic reference. As shown in FIG. 24, the ratio of each PCR is within a 2-fold change, suggesting that the copy number of these targets in the amplified DNA pool are very similar to the un-amplified reference DNA. The 10 pairs of PCR primers from 6 genes (BRAF, cKIT, EGFR, KRAS, NRAS, PI3KCA) were designed and previously validated.

    Example 12: Quantification of amplification yield of DNA fragments

    [0216] cfDNA was isolated from four patients (patient 1-4) and one healthy control. Genomic DNA (gDNA, Multi-Gene Multiplex Horizon) was sonicated to approximately 150 bp fragments. DNA was circularized and amplified with random primers. Table 7 shows the amount of DNA input into the amplification reaction, and the amount of DNA produced by amplification. Significant amplification was obtained for even the smallest sample (0.4ng), and all samples were amplified at least 600-fold.

    TABLE-US-00007 TABLE 7 Sample Type Input (ng) Yield (ng) gDNA 10 6100 gDNA 4 6880 gDNA 2 5700 gDNA 1 5760 gDNA 0.5 3280 cfDNA healthy control 0.4 6240 cfDNA patient1 4 13800 cfDNA patient2 3 9480 cfDNA patient3 3 7840 cfDNA patient4 1 3180

    Example 13: Detecting Low-Frequency Mutations from cfDNA of Cancer Patients

    [0217] In step 1, cfDNA was circularized. The circle ligation mix was prepared in a PCR tube at room temperature. 4 ng-10 ng cfDNA were pipetted in a 12 l of volume to the PCR tube. DNA was denatured at 96 C. for 30 seconds, then PCR tubes were chilled on ice for 2 minutes. Ligation mix (2 l of 10 CircLigase buffer, 4 1 5 M betaine, 1 1d 50 mM MnCl2, 1 1d CircLigase II) was added to each tube, and the reaction proceeded at 60 C. for 16 hours on a PCR machine.

    [0218] In step 2, the ligation reactions were treated to remove unligated linear DNA. 1l Exonuclease mix (NEB M0206S, M0293S; ExoI 20u/l: ExoIII 100u/d=1:2) was added to each tube, mixed, and incubated at 37 C. for 30 minutes in PCR machine.

    [0219] In step 3, the ligation reaction was purified for buffer exchange. The ligation product was purified with Oligo Clean & Concentrator (Zymo Research). Binding mix (30 l of 10 mM Tris, 100 l of Oligo binding buffer, 400 l of 100% Ethanol) was added to the ligation reaction after Exonuclase treatment, mixed, and briefly spun down. Zymo-spin columns were loaded, and spun at greater than 10,000g for 30 seconds. Columns were washed with 750 l of DNA wash buffer, and centrifuged at 14,000g for 1 minute. DNA was eluted with 15 l of 10 mM Tris by centrifugation at greater than 10,000g for 30 seconds.

    [0220] In step 4, the DNA was amplified by random priming. Whole genome amplification (WGA) was performed with Ready-To-Go Genomiphi V3 DNA amplification Kit (GE Healthcare). 10 l of purified ligation was mixed with 10 l of 2 denaturation buffer, incubated at 95 C. for 3 minutes, then cooled to 4 C. on ice. 20 l of denatured DNA was added to WGA pre-mix, samples were incubated at 30 C. for 1.5 hours followed by inactivation at 65 C. for 10 minutes.

    [0221] In step 5, the amplification products were cleaned up using Agencourt AMPure XP Purification (1.6) (Beckman Coulter). 30 l of 10 mM Tris and 80 l of AMpure beads were added to 20 l of WGA reaction. The mixture was incubated at room temperature for 2 minutes. The tubes were placed on a magnet stand, and incubated for 2 minutes. The supernatants were removed and discarded. Samples were washed with 200 l of ethanol (80%) twice, air dried for 5 minutes, and DNA eluted with 200 l of 10 mM Tris pH 8.0.

    [0222] In step 6, WGA DNA was fragmented. 130 l WGA product was sonicated using a Covaris S220 sonicator to obtain a fragment size of approximately 400 bp. Covaris S220 settings were as follows: peak incident power=140 W, duty factor=10%, cycles per burst=200, treatment time=55 seconds.

    [0223] In step 7, samples were quantified by qPCR. 1/10 of the ligation input and ligation product were used for qPCR reactions with three replications to measure ligation efficiency. 10 ng of the fragmented WGA product along with 10 ng of reference gDNA (12878 cell line) were used for qPCR to measure on target rate. Reactions comprised 5 1d of 2 master mix (TaqMan Fast Universal PCR master mix (2), Applied Biosystems; Evagreen dye, Biotium), 0.5 l of primer (5 M), 1.2 1d of H.sub.2O, 10 l of DNA. Amplification proceeded according to the following program: 95 C. 2 minutes; and 40 cycles of [95 C. 10 seconds; 60 C., 20 seconds].

    [0224] In step 8, sequencing libraries were constructed. Sequencing libraries were prepared from 500-1000ng of sonicated amplified DNA using KAPA Hyper Prep Kit (KK8500) or KAPA Library Preparation Kit with Standard PCR Library (KK8200). Adaptor ligations (with 1 M adaptor final concentration) were prepared according to manufacturer's protocol. Adaptor ligated wash of the ligated product, 30 1d (0.3) of 20% PEG 8000/2.5M NaCl solution was added to 100 l of the resuspended ligated product. Beads were mixed thoroughly with the ligated product and incubated at room temperature for 15 minutes. Beads were then captured on a magnet until the liquid was clear. 130 l of supernatant was then subjected to size selection using Ampure XP beads. Samples were transferred to a new plate followed by an addition of 20 l of Ampure XP beads (0.5). Ligated product was now captured in the beads and washed two times with 200 l 80% ethanol. Ligated product was then resuspended and eluted in 20 l EB buffer. After size selection and purification, 20 l ligated product was added to 25 1 2 KAPA HiFi Hotstart ready mix and 5 1d 10 M P5+P7 primers (5CAAGCAGAAGACGGCATACGA3 (SEQ ID NO: 3), 5ACACTCTTTCCCTACACGACGCTCTTCCGATCT3 (SEQ ID NO: 4)) to amplify the library using the following cycling program: 98 C., 45 seconds; 5 cycles of (98 C., 15 seconds; 60 C., 30 seconds; 72 C., 30 seconds); 72 C., 60 seconds. Amplified library was diluted 20 before loading on a fragment analyzer or bioanalyzer (high sensitivity chip) for quantitation. Further size selection was done via gel size selector (Blue Pippin prep from Sage Science).

    [0225] In step 9, the sequencing library was enriched by probe capture enrichment using probes from xGEN Pan-Cancer Panel v1.5, 127908597 (IDT). In step 10, the library was sequenced in a HiSeq 2500, with an average depth of 1000.

    [0226] In step 11, sequencing data was analyzed to make variant calls. Variant calling included a step requiring that a sequence difference occur on two different polynucleotides (e.g. identified by different Junctions) to be counted as a variant. Several somatic mutations were detected and they were also reported in a public databases (COSMIC (Catalog of Somatic Mutations in Cancer)). Among the mutations identified was BRAF V600M with a 0.050 allele frequency, which demonstrate the high sensitivity of this system even when the input is low. Results for the detection of various mutations, including their frequency in the sample, are shown in Table 8.

    TABLE-US-00008 TABLE 8 Frequency in Cancer type Mutated gene Mutation sample Melanoma FGFR2 V191I 0.20% Melanoma NRAS Q61K 0.20% Melanoma CTNNB1 S37F 0.10% Melanoma BRAF V600E 0.10% Melanoma BRAF V600M 0.05% Breast cancer PIK3CA H1407L 53% Breast cancer LIFR S679L 0.60% Breast cancer KRAS G12D 0.60% Breast cancer ATM R2993* 0.30% Breast cancer ATRX S618F 0.10% Prostate AR T346A 6.40% Prostate SPOP F133L 3.30% Prostate BRAF V600M 1.10% Prostate NSD1 R1557C 1.00% Prostate SF3B1 K700E 1.60% Pancreatic KRAS G12V 1.70% Pancreatic TP53 7578176C>T (splice 0.5% donor variant)

    Example 14: Accurate Mutation Detection from Multiplex Reference DNA from FFPE Sample

    [0227] DNA was extracted from sample Horizon FFPE-multiplex (HD200) by following the manufacturer's protocol (Covaris truXTRAC FFPE DNA Kit). 130 l FFPE gDNA was sonicated using a Covaris S220 sonicator to obtain a fragment size of approximately 150 bp (Covaris S220 settings: peak incident power=175 W, duty factor=10%, cycles per burst=200, treatment time=430 seconds). 50 ng DNA in 11 l volume was denatured at 95 C. for 30 seconds. 10.5 l H.sub.2O, 2.5 l ligase buffer (NEB B0202S), and 1 l T4 Polynucleotide Kinase (NEB M0201S) were added. Reactions were incubated at 37 C. for 30 minutes for phosphorylate.

    [0228] Samples were ligated, then purified with Oligo Clean & Concentrator (Zymo Research). Binding mix (30 l of 10 mM Tris, 100 l of Oligo binding buffer, 400 l of 100% Ethanol) was added to the ligation reaction after Exonuclase treatment, mixed by vortex, and spun briefly. Samples were load on a Zymo-spin column, and spun at greater than 10,000g for 30 seconds. Columns were washed with 750 l of DNA wash buffer, and centrifuged at 14,000g for 1 minure. DNA was eluted with 15 l of 10 mM Tris by centrifugation at greater than 10,000g for 30 seconds.

    [0229] Samples were further processed and analyzed according to steps 5-11 in Example 13. Results are summarized in Table 9. The representation of nine mutations in Horizon's multiple mutation standard DNA were roughly retained by this process, while the quantity of DNA increased at least 600-fold.

    TABLE-US-00009 TABLE 9 Gene Mutations Allele Frequency Measured Allele Frequency BRAF p.V600E 10.5% 8% KIT p.D816V 10% 9.4% EGFR p.L858R 3% 4% EGFR p.T790M 1% 1% EGFR p.G719S 24.5% 14% KRAS p.G13D 15% 9.1% KRAS p.G12D 6% 5.4% NRAS p.Q61K 12.5% 8.3% PIK3CA p.H1047R 17.5% 14%

    Example 15: Detecting Low-Frequency Mutation from Cancer Mutation Cell Line gDNA Mutlimers

    [0230] In this example, sonicated genomic DNA was ligated to form multimers, which were then subjected to amplification, fragmentation, and analysis. FIGS. 25A and 25B illustrates an example of this process.

    [0231] gDNA from a melanoma cell line SK-mel-28 (ATCC) containing BRAF V600E mutation was mixed with reference gDNA (12878 Coriell Institute) to achieve 1% BRAF V600E. DNA was sonicated as in Example 14 to obtain a fragment size of approximately 150 bp. 100 ng of DNA in 11 l volume was denature at 95 C. for 30 sec. 10.5 1d H.sub.2O, 2.5 1d ligase buffer (NEB B0202S), and 1 1d T4 Polynucleotide Kinase (NEB M020IS) were added, followed by incubation at 37 C. for 30 minutes to phosphorylate the DNA.

    [0232] Samples were purified with Oligo Clean & Concentrator (Zymo Research). This included adding binding mix (25 1d of 10 mM Tris, 100 l of Oligo binding buffer, 400 l of 100% Ethanol) to the ligation reaction after Exonuclase treatment. This was mixed by vortex and spun briefly. A Zymo-spin column was loaded, and spun at greater than 10,000g for 30 seconds, washed with 750 l of DNA wash buffer, and centrifuged at 14,000g for 1 minute. DNA was eluted with 15 1d of 10 mM Tris by centrifugation at greater than 10,000g for 30 seconds.

    [0233] To ligate, 6ng DNA in 4 l volume, was mixed with 0.45 l 10 end repair buffer (Enyzymatics), 0.05 1d dNTP 25 mM, 0.5 1d ATP 10 mM, End repair enzyme mix (Enyzymatics), and T4 ligase 2000 unit/l. The reaction was incubated at 25 C. for 30 minutes, and followed by 75 C. for 20 minutes.

    [0234] Whole genome amplification was performed with Ready-To-Go Genomiphi V3 DNA amplification Kit (GE Healthcare). 8 l of H.sub.2O and 10 l of purified ligation were mixed with 10 l of 2 denaturation buffer. DNA was denatured at 95 C. for 3 minutes, and then cooled to 4 C. on ice. 20 l of denatured DNA was added to WGA pre-mix, and incubated at 30 C. for 1.5 hours followed by inactivation at 65 C. for 10 minutes.

    [0235] The amplification reaction was then cleaned up using Agencourt AMPure XP Purification (1.6) (Beckman Coulter). 30 l of 10 mM Tris and 80 l of AMpure beads were added to 20 l of WGA reaction. This was incubated at room temperature for 2 minutes. The tube was placed on a magnet stand, and incubated for 2 minutes. Supernatant was removed and discarded. Beads were washed with 200 l of ethanol (80%) twice, then air dried for 5 minutes. DNA was eluted with 200 1d of 10 mM Tris pH 8.0. 130 1d WGA product was then fragmented using the Covaris S220 sonicator to obtain a fragment size of approximately 400 bp (Covaris S220 settings: peak incident power=140 W, duty factor=10%, cycles per burst=200, treatment time=55 seconds).

    [0236] Mutations were detected by ddPCR using BioRad Prime PCR ddPCR mutation detection assays. Mutation-detection ddPCR reaction was assembled in a PCR tube at room temperature (80ng of amplified DNA, 10 l of 2 ddPCR supermix for probes, 1 1d of 20 target (BRAF V600E, BioRad) primers (9 M)/probe (FAM; 5 M), 1 l of 20 wild-type primers (9 M)/probe (HEX; 5 M), 8 1d of DNA sample (50 ng). The reaction was mixed by pipetting up and down 5 times, and then transferred to droplet generator cartridge. Droplets were generated using the QX200 droplet generator, transferred into a 96-well PCR plate, and amplified using the following PCR program: 95 C., 10 minutes; 40 cycles of [94 C., 30 seconds, 55 C. 1 minute]; 98 C., 10 minutes. PCR reaction plate was transferred into a QX200 droplet reader to quantify the result. Based on the input DNA, the expected frequency of the BRAF V600E mutation was 1%. By this ligation and amplification procedure, this frequency was roughly maintained (1.41% according to the ddPCR analysis) while the quantity of DNA increased about 200-fold.

    [0237] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.