Method for controlling speed of polypeptide passing through nanopore and use thereof
12416640 ยท 2025-09-16
Assignee
Inventors
Cpc classification
C12Q1/25
CHEMISTRY; METALLURGY
G01N27/00
PHYSICS
International classification
G01N27/00
PHYSICS
Abstract
The present invention provides a method for controlling a speed of a polypeptide passing through a nanopore and use thereof in determining an amino acid sequence of a polypeptide. Specifically, the method comprises: conjugating a polynucleotide to the polypeptide to give a polynucleotide-polypeptide conjugate, and applying a voltage across the nanopore in the presence of a polynucleotide binding enzyme to move the conjugate through the nanopore. The polynucleotide binding enzyme controls the movement of the polynucleotide and thereby controls the movement of the conjugated polypeptide in the nanopore, thus controlling the speed of the polypeptide passing through the nanopore.
Claims
1. A method for controlling a speed of a polypeptide passing through a nanopore, comprising: 1) conjugating the polypeptide to a polynucleotide to give a polynucleotide-polypeptide conjugate; and 2) applying a voltage across the nanopore in the presence of a polynucleotide binding enzyme to move the polynucleotide-polypeptide conjugate through the nanopore, wherein the polynucleotide binding enzyme controls the movement of the polynucleotide, thus controlling the speed of the conjugated polypeptide passing through the nanopore.
2. The method according to claim 1, wherein the polynucleotide binding enzyme is a helicase, a polymerase or a translocase.
3. The method according to claim 2, wherein the polymerase is phi29 polymerase.
4. The method according to claim 2, wherein the helicase is an Hel308 family helicase.
5. The method according to claim 4, wherein the helicase is Hel308 Tga, Hel308 Mbu, Hel308 Pfu, Hel308Mma, Hel308Mok, Hel308Fac, Hel308Csy, Hel308Mhu, or F8813 protein.
6. The method according to claim 1, wherein the polynucleotide is a DNA or RNA.
7. The method according to claim 1, wherein the polynucleotide is a single-stranded DNA.
8. The method according to claim 1, wherein the polynucleotide and the polypeptide are linked covalently or through a linker group to form the polynucleotide-polypeptide conjugate.
9. The method according to claim 8, wherein the covalent linkage of the polynucleotide and the polypeptide is in a manner selected from an oxime bond, an amide bond, a thioether bond, a disulfide bond, a phosphoryl bond, a hydrazone bond, and a ureide bond, and a cyclic linkage formed by click reaction.
10. The method according to claim 1, wherein the nanopore is a biological nanopore or a solid nanopore.
11. The method according to claim 10, wherein the biological nanopore is selected from Staphylococcus aureus -hemolysin nanopore, MspA nanopore, Csgg nanopore, phi29 nanopore and FraC nanopore.
12. The method according to claim 10, wherein the solid nanopore is selected from graphene nanopore, silicon nitride nanopore, titanium dioxide nanopore, and alumina nanopore.
13. A method for measuring an electrical signal of a polypeptide formed by the polypeptide passing through a nanopore sensor, comprising: 1) conjugating the polypeptide to a polynucleotide to give a polynucleotide-polypeptide conjugate; 2) applying a voltage across the nanopore in the presence of a polynucleotide binding enzyme to move the polynucleotide-polypeptide conjugate through the nanopore, wherein the polynucleotide binding enzyme controls the movement of the polynucleotide, thus controlling the speed of the conjugated polypeptide passing through the nanopore; and 3) reading a nanopore current signal to acquire the electrical signal of the polypeptide.
14. The method according to claim 13, comprising: 1) conjugating the polypeptide to a polynucleotide to give a polynucleotide-polypeptide conjugate; 2) applying a voltage across the nanopore in the presence of a polynucleotide binding enzyme to move the polynucleotide-polypeptide conjugate through the nanopore, wherein the polynucleotide binding enzyme controls the movement of the polynucleotide, thus controlling the speed of the conjugated polypeptide passing through the nanopore; and 3) reading a nanopore current signal to identify a current signal of the amino acid sequence of the polypeptide.
15. A method for identifying a polypeptide or a part thereof, wherein the identification is performed by measuring an electrical signal generated by the polypeptide passing through a nanopore sensor, comprising: 1) ligating the polypeptide to a nucleic acid to give a nucleic acid-polypeptide ligation product; 2) applying a voltage across the nanopore in the presence of a nuclease to move the nucleic acid-polypeptide ligation product through the nanopore, wherein the nuclease controls the movement of the nucleic acid, thus controlling the speed of the ligated polypeptide passing through the nanopore; 3) reading a nanopore current signal to acquire the electrical signal of the polypeptide; and 4) identifying the polypeptide or the part thereof based on the electrical signal.
16. The method according to claim 15, wherein the identification is to detect, in the polypeptide or the part thereof, a post-translational modification selected from ubiquitination, phosphorylation, glycosylation, esterification, alkylation and acetylation, glutamation, lipoation, isoprenylation, glycination, sulfation, adenylation and ADP ribosylation.
17. The method according to claim 15, wherein the part is a continuous amino acid sequence of the polypeptide.
18. The method according to claim 15, wherein the part is one or several amino acid residues of the polypeptide.
19. The method according to claim 15, wherein the part is one or more mutation sites of the polypeptide.
20. The method according to claim 15, wherein in step 4), the polypeptide or the part thereof is identified by comparing an electrical signal of the polypeptide with signals from a library of known polypeptides.
Description
DESCRIPTION OF THE DRAWINGS
(1) Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
DETAILED DESCRIPTION
(13) Technical schemes in the examples of the present invention will be described clearly and completely in conjunction with the accompanying drawings. It is apparent that the examples described herein are only some examples of the present invention, but not all of them. Based on the examples of the present invention, all other examples obtained by those of ordinary skill in the art without creative work shall fall within the protection scope of the present invention.
Example 1. Materials
(14) Hel308 helicase, ATP (100 mM, Thermo Fisher)
(15) 1,2-Diphytanoyl-sn-glycero-3-phosphocholine (Avanti)
(16) Sequences:
(17) TABLE-US-00001 ssDNA(SEQIDNO.1): NH2-CAAGAATACCTTTTTTTTTCCTTTTTTTTCCTCTACCACTTTTCAG ATCTCACTATCGCATTCTCATGCAGGTCGTAGCTTTTTTCTTTTTTCATC ATC ssDNA-R(SEQIDNO.2): TTTTTTTTTTTTTTTGCTACGACCTGCATGAGAATTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT-cholesterol EGSLFL-60C(SEQIDNO.3): EEEEGEEEEGGEEEGGEEESSEEEEGGEEELFEEGGGGEEEESSSSEEEE LLEEEEEEEC EDSLFYD-60C(SEQIDNO.4): EDEDEEEDYDDDEEEDEEDEVEEEEEYGEVVGELGGGGSHHDHHSSSGSE EEYEEDDDDC E29C(SEQIDNO.5): EEEEEEEEEEEEEEEEEEEEEEEEEEEEEC
Example 2. Determination of ssDNA
(18) 1. Procedures:
(19) The ssDNA and ssDNA-R in Example 1 were annealed at a molar ratio of 1:1 to form a double-stranded part: the cross section of PEEK tubing was pre-coated with a mixture of phospholipid and hexadecane and immersed in an electrolyte solution before bubbles were blown on the cross section of the peek tubing and sucked away using a pipette to form a phospholipid bilayer. In a system of 400 mM KCl in HEPES buffer (pH 7), MspA protein was added at the cis terminal. At 180 mV, when a pore current of about 160 pA was read, a 2-L mixture of the above-mentioned annealed product and Hel308 protein was added to 50 L of the cis terminal solution before adding 2 L of ATP. A voltage of 180 mV was applied and the data were recorded.
(20) 2. Results
(21) As shown in
Example 3. Conjugation of ssDNA and Polypeptide
(22) 1. Procedures:
(23) 1 mg of Sulfo-SMCC was dissolved in 40 L DMSO. After a complete dissolution, 80 L of 150 mM boric acid buffer (pH 8.5) was added and mixed well. The mixture was quickly added to 10-16 nmol of ssDNA in Example 1, vortexed and shaken to mix well, and incubated in a thermostat at 30 C. Unchanged SMCC was removed by dialysis, ethanol precipitation and desalting column. According to the ssDNA concentration measured by UV absorption, sulfhydryl-containing polypeptides EGSLFL-60C, EDSLFYD-60C and E29C at a 5-fold concentration were added, and shaken at room temperature for 1.5 h. The products were preserved at 20 C. for later use. The above conjugate was used for 15% Urea-PAGE gel electrophoresis.
(24) 2. Results
(25)
Example 4. Determination of ssDNA-E29C Conjugate
(26) 1. Procedures:
(27) The ssDNA-E29C conjugate from Example 3 and ssDNA-R were annealed at a molar ratio of 1:1 to form a double-stranded part: the cross section of PEEK tubing was pre-coated with a mixture of phospholipid and hexadecane and immersed in an electrolyte solution before bubbles were blown on the cross section of the peek tubing and sucked away using a pipette to form a phospholipid bilayer. In a system of 400 mM KCl in HEPES buffer (pH 7), MspA protein was added at the cis terminal. At 180 mV, when a pore current of about 160 pA was read, a 2-L mixture of the above-mentioned annealed product and Hel308 protein was added to 50 L of the cis terminal solution before adding 2 L of ATP. A voltage of 180 mV was applied and the data were recorded.
(28) 2. Results
(29) As shown in
Example 5. Determination of ssDNA-EGSLFL-60Cconjugate
(30) 1. Procedures:
(31) The ssDNA-EGSLFL-60C conjugate from Example 3 and ssDNA-R were annealed at a molar ratio of 1:1 to form a double-stranded part: the cross section of PEEK tubing was pre-coated with a mixture of phospholipid and hexadecane and immersed in an electrolyte solution before bubbles were blown on the cross section of the peek tubing and sucked away using a pipette to form a phospholipid bilayer. In a system of 400 mM KCl in HEPES buffer (pH 7), MspA protein was added at the cis terminal. At 180 mV, when a pore current of about 160 pA was read, a 2-L mixture of the above-mentioned annealed product and Hel308 protein was added to 50 L of the cis terminal solution before adding 2 L of ATP. A voltage of 180 mV was applied and the data were recorded.
(32) 2. Results
(33) As shown in
Example 6. Determination of ssDNA-EDSLFYD-60Cconjugate
(34) 1. Procedures:
(35) The ssDNA-EDSLFYD-60C conjugate from Example 3 and ssDNA-R were annealed at a molar ratio of 1:1 to form a double-stranded part: the cross section of PEEK tubing was pre-coated with a mixture of phospholipid and hexadecane and immersed in an electrolyte solution before bubbles were blown on the cross section of the peek tubing and sucked away using a pipette to form a phospholipid bilayer. In a system of 400 mM KCl in HEPES buffer (pH 7), MspA protein was added at the cis terminal. At 180 mV, when a pore current of about 160 pA was read, a 2-L mixture of the above-mentioned annealed product and Hel308 protein was added to 50 L of the cis terminal solution before adding 2 L of ATP. A voltage of 180 mV was applied and the data were recorded.
(36) 2. Results
(37) As shown in
(38) The preferred embodiments of the present invention are described in detail above, which, however, are not intended to limit the present invention. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, all of which will fall within the protection scope of the present invention.
(39) In addition, it should be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, such combinations will not be illustrated separately.
(40) Various embodiments of the present invention can also be combined arbitrarily, and should also be regarded as the disclosure of the present invention, as long as they do not violate the idea of the present invention.