Dioxygenase mutants and use thereof in synthesizing (2S,3R)-3-hydroxypipecolic acid
12415992 ยท 2025-09-16
Assignee
Inventors
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
Abstract
By mutating arginine at position 97 and asparagine at position 43 of a wild type L-proline-3-hydroxylase, a mutated L-proline-3-hydroxylase is obtained. The mutated L-proline-3-hydroxylase comprises a variant of the wild-type L-proline-3-hydroxylase having SEQ ID NO:1, which comprises a substitution of the arginine corresponding to position 97 (R97) of SEQ ID NO:1 and a substitution of the asparagine corresponding to position 43 (N43) of SEQ ID NO:1; wherein the amino acid substituted into the mutated L-proline-3-hydroxylase at position R97 is methionine, and wherein the amino acid substituted into the mutated L-proline-3-hydroxylase at position N43 is selected from the group consisting of threonine (T), alanine (A), valine (V), serine(S), aspartic acid (D), and lysine (K).
Claims
1. A mutated L-proline-3-hydroxylase comprising a variant of the wild-type L-proline-3-hydroxylase having SEQ ID NO:1, which comprises a substitution of the arginine corresponding to position 97 (R97) of SEQ ID NO:1 and a substitution of the asparagine corresponding to position 43 (N43) of SEQ ID NO: 1; wherein the amino acid substituted into the mutated L-proline-3-hydroxylase at position R97 is methionine, and wherein the amino acid substituted into the mutated L-proline-3-hydroxylase at position N43 is selected from the group consisting of threonine (T), alanine (A), valine (V), serine(S), aspartic acid (D), and lysine (K).
2. A microbial cell expressing the mutated L-proline-3-hydroxylase according to claim 1, or containing a gene encoding the mutated L-proline-3-hydroxylase, or containing a recombinant vector comprising a gene encoding the mutated L-proline-3-hydroxylase.
3. The microbial cell according to claim 2, wherein the microbial cell comprises a host cell and the host cell is bacteria or fungi.
4. The microbial cell according to claim 3, wherein the microbial cell comprises a host cell and the host cell is Escherichia coli, Bacillus subtilis, or yeast.
5. A method for preparing (2S,3R)-3-hydroxypipecolic acid, comprising: adding the mutated L-proline-3-hydroxylase according to claim 1 to a reaction system containing L-pipecolic acid, preparing and obtaining the (2S,3R)-3-hydroxypipecolic acid.
6. The method according to claim 5, wherein the reaction system comprises L-pipecolic acid, -ketoglutaric acid, L-ascorbic acid, and FeSO.sub.4.Math.7H.sub.2O.
7. The method according to claim 6, wherein the method comprises: adding 100 L of crude enzyme of the mutated L-proline-3-hydroxylase to 150 L of the reaction system and obtaining a final reaction system; wherein the final reaction system contains comprises 10 mM substrate L-pipecolic acid, 15 mM to 30 mM -ketoglutaric acid is, 10 mM to 20 mM L-ascorbic acid, up to 0.10 mM FeSO.sub.4.Math.7H.sub.2O; the final reaction system has a total volume of 250 L; and the reaction is carried out at 10 C. and pH of 6.5 for 12 hours.
8. The method according to claim 7, wherein the final reaction system comprises 10 mM substrate L-pipecolic acid, 30 mM -ketoglutaric acid, 15 mM L-ascorbic acid, and 0.05 mM FeSO.sub.4.Math.7H.sub.2O; the final reaction system has a total volume of 250 L; and the reaction is carried out at 10 C. and pH of 6.5 for 12 hours.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTIONS OF THE EMBODIMENTS
(7) Culture media and solutions involved in the following examples are as follows:
(8) LB liquid culture medium (mg.Math.mL.sup.1): yeast extract 5, tryptone 10, NaCl 10.
(9) LB solid culture medium (mg.Math.mL.sup.1): yeast extract 5, tryptone 10, NaCl 10, agar powder 15.
(10) Protein purification Solution A: 20 mM Tris-HCl, 150 mM NaCl, adjusting pH to 7.5 and 8.0 with hydrochloric acid.
(11) Protein purification Solution B: 20 mM Tris-HCl, 150 mM NaCl, IM imidazole, adjusting pH to 7.5 and 8.0 with hydrochloric acid.
(12) Low-salt buffer: 20 mM Tris-HCl, 100 mM NaCl, adjusting pH to 7.5 with hydrochloric acid.
(13) Protein gel staining solution: for a total volume of 1000 mL of protein gel staining solution, weighing 1 g of Coomassie Brilliant Blue R250, adding 450 mL of ethanol, 100 ml of acetic acid, and 450 mL of deionized water, and mixing thoroughly.
(14) Protein gel destaining solution: for a total volume of 1000 mL of protein gel staining solution, adding 100 mL of ethanol, 100 mL of acetic acid, and 800 mL of deionized water, and mixing thoroughly.
(15) Detection methods involved in the following examples are as follows:
(16) Detection of content of (2S,3R)-3-hydroxypipecolic acid:
(17) A sample is pipetted and centrifuged, supernatant is then collected and diluted to 4-7 mM, 125 L of the sample is taken, 125 L of 200 mM boric acid buffer (pH 9.2) is added to the sample, 250 L of 10 mM Fmoc-Cl is then added, and shaken well and reacted for 15 minutes, 250 L of 40 mM 1-aminoadamantane is added to terminate the reaction, filtering is performed using a 0.22 m organic filter for detection and analysis. Detection conditions: a Diomansil C18 column (4.60 mm250 mm5 m) is used, with a ultraviolet detection wavelength of 263 nm, a temperature of 25 C., a flow rate of 1 mL.Math.min.sup.1, and a sample injection volume of 10 L. A gradient elution method is adopted, a mobile phase A is 50 mM sodium acetate-glacial acetic acid buffer, pH 4.2; a mobile phase B is acetonitrile; Gradient program: Buffer A: 0-19 min 70%; 19-19.50 min 20%; 19.50-23.50 min 0%; 23.50-28 min 70%. Since a molecular weight of (2S,5S)-5-hydroxypipecolic acid is consistent with that of (2S,3R)-3-hydroxypipecolic acid, and a standard solution for quantification is prepared from (2S,5S)-5-hydroxypipecolic acid.
(18) Calculation method for molar yield: when the reaction is performed with using 10 mM substrate L-Pip, a product (2S,3R)-3-hydroxypipecolic acid has a theoretical molar yield of 10 mM. An actual product generated is detected using the detection method for (2S,3R)-3-hydroxypipecolic acid content described above. Molar yield (%)=(Actual yield/Theoretical yield)100.
(19) A preparation methods for competent cells involved in the following examples is as follows:
(20) Preparation of competent cells: competent cells are prepared according to instructions in the Competent Cell Preparation Kit (purchased from TaKaRa Bio Inc.), a single colony of Escherichia coli on a non-Kanamycin resistant LB plate is picked up and transferred into an LB tube, and cultured overnight at 37 C. and 200 r.Math.min.sup.1 for 8-12 hours; the single colony is then transferred with an inoculation volume of 2% to a 250 mL triangular flask containing 50 mL LB culture medium, and cultured at 37 C. and 200 r.Math.min.sup.1 until OD.sub.600 reaches approximately 0.6-0.8, the triangular flask is placed on ice for 30 minutes; 50 mL of bacterial solution is aliquoted and transferred into two 50 mL sterilized centrifuge tubes (25 mL per tube) on a clean bench, the solution is centrifuged at 6000 r.Math.min.sup.1 for 5 minutes at 4 C., a supernatant is discarded; and 10% Solution A is added to gently to resuspend a bacterial pellet, the solution is centrifuged again at 6000 r.Math.min.sup.1 for 5 minutes at 4 C., a supernatant is discarded, 10% Solution B is added to gently to resuspend a bacterial pellet, 100 L of bacterial solution is aliquoted and transferred into 1.5 mL sterilized EP tubes, which are stored at 80 C. for up to one year. All operations should be performed under sterile conditions.
(21) A preparation method involved in the following examples is as follows:
(22) Chemical transformation: competent medium is thawed on ice, 10 L of recombinant plasmid is added on a clean bench and gently mixed and incubated on ice for 30 minutes around; heat shock is performed at 42 C. in a metal bath for 90 seconds to obtain a mixture, the mixture is placed on ice for 5 minutes, 800 L of LB culture medium is added and cultured at 37 C. and 200 r.Math.min.sup.1 for 1 hour, centrifugation is performed at 6000 r.Math.min.sup.1 for 5 minute, and a supernatant is discarded on a clean bench; the remaining culture medium is resuspended and spread on a kanamycin-resistant plate, and cultured overnight at 37 C. for 12 hours, and colonies are picked up for colony PCR verification and sent to a sequencing company for sequencing.
Example 1: Construction of Recombinant Bacteria Containing L-Proline-3-Hydroxylase Mutants
(23) Specific steps were as follows:
(24) (1) Construction of an Expression Vector and Recombinant Bacteria Containing Wild-Type L-Proline-3-Hydroxylase (Cis-P3H)
(25) Sequence information of the L-proline-3-hydroxylase (SEQ ID NO. 1) was codon-optimized according to codon preference rules of Escherichia coli to obtain an optimized gene of L-proline-3-hydroxylase; the optimized gene of L-proline-3-hydroxylase was then inserted into an expression vector pET28a to construct an L-proline-3-hydroxylase (cis-P3H) expression vector pET28a (+)-cis-P3H, and wild-type recombinant bacteria Escherichia coli BL21 pET28a (+)-cis-P3H was obtained.
(26) A PCR system: 25 L PrimeSTARR MAX DNA Polymerase, 23 L ddH.sub.2O, 1 L pET28a (+)-cis-P3H, 0.50 L primer 1, 0.50 L primer 2.
(27) PCR reaction conditions: 98 C. for 30 second, 98 C. for 10 second, 55 C. for 5 second, 72 C. for 90 second, for a total of 30 cycles.
(28) (2) Construction of an Expression Vector and Recombinant Bacteria Containing L-Proline-3-Hydroxylase Mutants
(29) Long and short fragments of the PCR product were ligated via homologous recombinase and then transformed into competent cells of Escherichia coli BL21 (DE3), and specific operations were the same as the chemical transformation method above.
(30) Below was primer information (Table 1) of each mutant obtained by performing N43 saturation mutagenesis, taking R97M as a template (
(31) TABLE-US-00002 TABLE1 PrimerinformationofR97MandeachmutantforN43saturationmutagenesis usingR97Masatemplate Differentmutants Primersequence pET28a(+)-R97M F:tgaacgtctgcaaatggcgcgtaccatgaacctgaaaaacgctgttgttat(SEQIDNO.10) R:ataacaacagcgtttttcaggttcatggtacgcgccatttgcagacgttca(SEQIDNO.11) pET28a(+)-R97M/N43G F:tgagttcagcaacggtttctggaaaggcatcccgctgtacaacgcgagcgg(SEQIDNO.12) R:ccgctcgcgttgtacagcgggatgcctttccagaaaccgttgctgaactca(SEQIDNO.13) pET28a(+)-R97M/N43A F:tgagttcagcaacggtttctggaaagcgatcccgctgtacaacgcgagcgg(SEQIDNO.14) R:ccgctcgcgttgtacagcgggatcgctttccagaaaccgttgctgaactca(SEQIDNO.15) pET28a(+)-R97M/N43V F:tgagttcagcaacggtttctggaaagttatcccgctgtacaacgcgagcgg(SEQIDNO.16) R:ccgctcgcgttgtacagcgggataactttccagaaaccgttgctgaactca(SEQIDNO.17) pET28a(+)-R97M/N43L F:tgagttcagcaacggtttctggaaactgatcccgctgtacaacgcgagcgg(SEQIDNO.18) R:ccgctcgcgttgtacagcgggatcagtttccagaaaccgttgctgaactca(SEQIDNO.19) pET28a(+)-R97M/N43I F:gagttcagcaacggtttctggaaaatcatcccgctgtacaacgcgagcggt(SEQIDNO.20) R:accgctcgcgttgtacagcgggatgattttccagaaaccgttgctgaactc(SEQIDNO.21) pET28a(+)-R97M/N43M F:gagttcagcaacggtttctggaaaatgatcccgctgtacaacgcgagcggt(SEQIDNO.22) R:accgctcgcgttgtacagcgggatcattttccagaaaccgttgctgaactc(SEQIDNO.23) pET28a(+)-R97M/N43W F:tgagttcagcaacggtttctggaaatggatcccgctgtacaacgcgagcgg(SEQIDNO.24) R:ccgctcgcgttgtacagcgggatccatttccagaaaccgttgctgaactca(SEQIDNO.25) pET28a(+)-R97M/N43F F:tgagttcagcaacggtttctggaaattcatcccgctgtacaacgcgagcgg(SEQIDNO.26) R:ccgctcgcgttgtacagcgggatgaatttccagaaaccgttgctgaactca(SEQIDNO.27) pET28a(+)-R97M/N43P F:tgagttcagcaacggtttctggaaaccgatcccgctgtacaacgcgagcgg(SEQIDNO.28) R:ccgctcgcgttgtacagcgggatcggtttccagaaaccgttgctgaactca(SEQIDNO.29) pET28a(+)-R97M/N43S F:gagttcagcaacggtttctggaaaagcatcccgctgtacaacgcgagcggt(SEQIDNO.30) R:accgctcgcgttgtacagcgggatgcttttccagaaaccgttgctgaactc(SEQIDNO.31) pET28a(+)-R97M/N43T F:gagttcagcaacggtttctggaaaaccatcccgctgtacaacgcgagcggt(SEQIDNO.32) R:accgctcgcgttgtacagcgggatggttttccagaaaccgttgctgaactc(SEQIDNO.33) pET28a(+)-R97M/N43C F:tgagttcagcaacggtttctggaaatgcatcccgctgtacaacgcgagcgg(SEQIDNO.34) R:ccgctcgcgttgtacagcgggatgcatttccagaaaccgttgctgaactca(SEQIDNO.35) pET28a(+)-R97M/N43Y F:tgagttcagcaacggtttctggaaatacatcccgctgtacaacgcgagcgg(SEQIDNO.36) R:ccgctcgcgttgtacagcgggatgtatttccagaaaccgttgctgaactca(SEQIDNO.37) pET28a(+)-R97M/N43Q F:tgagttcagcaacggtttctggaaacagatcccgctgtacaacgcgagcgg(SEQIDNO.38) R:ccgctcgcgttgtacagcgggatctgtttccagaaaccgttgctgaactca(SEQIDNO.39) pET28a(+)-R97M/N43D F:tgagttcagcaacggtttctggaaagacatcccgctgtacaacgcgagcgg(SEQIDNO.40) R:ccgctcgcgttgtacagcgggatgtctttccagaaaccgttgctgaactca(SEQIDNO.41) pET28a(+)-R97M/N43E F:tgagttcagcaacggtttctggaaagaaatcccgctgtacaacgcgagcgg(SEQIDNO.42) R:ccgctcgcgttgtacagcgggatttctttccagaaaccgttgctgaactca(SEQIDNO.43) pET28a(+)-R97M/N43K F:agttcagcaacggtttctggaaaaaaatcccgctgtacaacgcgagcggtg(SEQIDNO.44) R:caccgctcgcgttgtacagcgggatttttttccagaaaccgttgctgaact(SEQIDNO.45) pET28a(+)-R97M/N43R F:tgagttcagcaacggtttctggaaacgtatcccgctgtacaacgcgagcgg(SEQIDNO.46) R:ccgctcgcgttgtacagcgggatacgtttccagaaaccgttgctgaactca(SEQIDNO.47) pET28a(+)-R97M/N43H F:tgagttcagcaacggtttctggaaacacatcccgctgtacaacgcgagcgg(SEQIDNO.2) R:ccgctcgcgttgtacagcgggatgtgtttccagaaaccgttgctgaactca(SEQIDNO.3)
(32) Expression vectors and recombinant bacteria containing different mutants were prepared; and the recombinant bacteria were: E. coli BL21/pET28a (+)-R97M, E. coli BL21/pET28a (+)-R97M/N43G, E. coli BL21/pET28a (+)-R97M/N43A, E. coli BL21/pET28a (+)-R97M/N43V, E. coli BL21/pET28a (+)-R97M/N43L, E. coli BL21/pET28a (+)-R97M/N43I, E. coli BL21/pET28a (+)-R97M/N43M, E. coli BL21/pET28a (+)-R97M/N43W, E. coli BL21/pET28a (+)-R97M/N43F, E. coli BL21/pET28a (+)-R97M/N43P, E. coli BL21/pET28a (+)-R97M/N43S, E. coli BL21/pET28a (+)-R97M/N43T, E. coli BL21/pET28a (+)-R97M/N43C, E. coli BL21/pET28a (+)-R97M/N43Y, E. coli BL21/pET28a (+)-R97M/N43Q, E. coli BL21/pET28a (+)-R97M/N43D, E. coli BL21/pET28a (+)-R97M/N43E, E. coli BL21/pET28a (+)-R97M/N43K, E. coli BL21/pET28a (+)-R97M/N43R, E. coli BL21/pET28a (+)-R97M/N43H.
Example 2: Expression and Purification of L-Proline-3-Hydroxylase Mutants
(33) (1) Expression of L-Proline-3-Hydroxylase Mutants
(34) 1) The wild-type recombinant bacteria Escherichia coli BL21/pET28a (+)-cis-P3H and the recombinant bacteria containing mutants were inoculated into 5 mL LB medium containing kanamycin (50 g.Math.mL.sup.1) respectively and cultured at 37 C. and 200 r.Math.min.sup.1 for 8-12 hours to prepare seed solutions; 2) the seed solutions were then transferred to 50 mL LB medium containing 50 g.Math.mL.sup.1 kanamycin at an inoculation amount of 2% (volume fraction), and cultured at 37 C. and 200 r min-1 until the OD.sub.600 reached 0.6-0.8; and 0.10 mM IPTG was added to induce expression of the recombinant protein at 17 C. for 16 hours, and fermentation broths were then prepared respectively; 3) the fermentation broths were centrifuged at 8000 r.Math.min.sup.1 for 15 minutes at 4 C. to collect bacterial pellets, respectively, and the bacterial pellets were washed twice with saline for subsequent use; and 4) the recombinant bacterial pellets were resuspended in 20 mM Tris-HCl (pH 7.5) buffer, cells containing a target plasmid were sonicated using an ultrasonic cell disruptor at 400 W power, with 2-second operation and 3-second interval. Cell lysate was centrifuged in a refrigerated centrifuge for 15 minutes to remove cell debris, with a centrifugation temperature set at 4 C. and a rotation speed at 10,000 r.Math.min.sup.1 to prepare crude enzyme solutions containing different mutants, respectively.
(35) Results indicated that all recombinant proteins were heterologously expressed in a soluble form. SDS-PAGE analysis of the soluble components of the recombinant proteins indicated that bands were consistent with a predicted molecular weight (
(36) (2) Purification of L-Proline-3-Hydroxylase Mutants
(37) The recombinant bacterial pellets of the recombinant bacteria Escherichia coli BL21/pET28a (+)-cis-P3H containing the wild-type enzyme and the recombinant bacteria containing mutants obtained in the step 3) of Example 1 were resuspended in 20 mM Tris-HCl buffer (pH 7.5), and cells were sonicated using an ultrasonic cell disruptor at 400 W power, with 2-second operation and 3-second interval; cell lysate was frozen and centrifuged in a refrigerated centrifuge at 4 C. and 12,000 r.Math.min.sup.1 for 30 minutes, and a supernatant obtained after centrifugation was filtered through a 0.22 m water filter membrane; purification was performed using a purifier of an AKTAxpress system, a 5 mL HisTrap HP column was used as a purification column; a column was rinsed with 20 mL ethanol and 40 mL deionized water at 4 C., and then equilibrated with 20 mL protein purification Solution A (150 mM NaCl, 20 mM Tris-HCl, pH 7.5); the cell lysate supernatant was filtered through a 0.22 m filter membrane and then slowly loaded onto a chromatography column, the chromatography column was first washed with Elution Buffer 1 (80 mM imidazole, 20 mM Tris-HCl, 150 mM NaCl, pH 7.5, that is, 8% protein purification Solution B) to remove impurities, a target protein was then eluted with Elution Buffer 2 (250 mM imidazole, 20 mM Tris-HCl, 150 mM NaCl, pH 7.5, that is, 25% protein purification Solution B); and the eluted target protein was treated with a desalting column and a desalting buffer (10 mM Tris, 100 mM NaCl, pH 7.5) to obtain pure L-proline-3-hydroxylase.
(38) Purified enzyme solutions containing different positive mutants (
Example 3: Enzyme Activity Assay
(39) Specific steps were as follows:
(40) Crude enzyme or pure protein (100 L) was added to a reaction system (150 L), a final reaction mixture was up to a volume of 250 L, a final reaction system contained 10 mM substrate L-pipecolic acid, 10 mM -ketoglutaric acid, 10 mM L-ascorbic acid, 1 mM FeSO.sub.4.Math.7H.sub.2O, and 50 mM MES (pH 6.5); and the mixture was then incubated in a Thermomixer Comfort metal bath 17 C. and 1000 r.Math. min.sup.1.
(41) Specifically, the reaction under crude enzyme conditions was performed for 12 hours, the reaction under pure enzyme conditions was performed for 15 minutes, and a final protein concentration for the reaction under pure enzyme conditions was 0.5 mg.Math.mL.sup.1.
(42) The reaction was terminated by boiling, and the sample after the termination of reaction was analyzed by high-performance liquid chromatography (HPLC). One unit of enzyme activity was defined as an amount of enzyme required to produce 1 mol of product per minute in a standard enzyme assay system.
(43) The relative enzyme activity of the control R97M and the crude enzyme solutions containing different mutants at N43 site were tested, respectively, and results were shown in Table 2:
(44) TABLE-US-00003 TABLE 2 Relative enzyme activity of crude enzyme solutions based on saturation mutants of N43 based on R97M Relative enzyme Relative enzyme Enzyme activity (%) Enzyme activity (%) R97M 100.00 R97M/N43S 236.05 R97M/N43G 14.76 R97M/N43T 286.65 R97M/N43A 212.40 R97M/N43C 74.11 R97M/N43V 108.34 R97M/N43Y 13.11 R97M/N43L 14.38 R97M/N43Q 29.14 R97M/N43I 11.24 R97M/N43D 121.08 R97M/N43M 27.09 R97M/N43E 28.53 R97M/N43W 0.00 R97M/N43K 142.34 R97M/N43F 6.14 R97M/N43R 23.73 R97M/N43P 33.17 R97M/N43H 47.01
(45) Relative enzyme activity of each mutant was calculated by setting the activity of R97M as 100%. As shown in Table 2, six positive mutants were obtained through saturation mutagenesis of N43 based on a R97M template: R97M/N43A, R97M/N43V, R97M/N43S, R97M/N43T, R97M/N43D and R97M/N43K, with relative enzyme activities being 212.40%, 108.34%, 236.05%, 286.65%, 121.08%, and 142.34%, respectively, corresponding to 2.12, 1.08, 2.36, 2.86, 1.21, and 1.42 times that of R97M. The specific enzyme activity of these six positive mutants at a pure enzyme level was detailed in Example 5.
Example 4: Comparison of Catalytic Performance Between Mutant R97M and Wild-Type (WT)
(46) (1) Molar Yield (%)
(47) Crude enzyme solutions (100 L) of R97M and WT obtained in Example 2 were added to a reaction system (150 L), and a final reaction system contained 10 mM substrate L-pipecolic acid, 10 mM -ketoglutaric acid, 10 mM L-ascorbic acid, 1 mM FeSO.sub.4.Math.7H.sub.2O, and 50 mM MES (pH 6.5); and reaction was carried out at 17 C. for 12 hours. The reaction was terminated by boiling, and the sample after the termination of reaction was analyzed by high-performance liquid chromatography (HPLC). An amount of product (2S,3R)-3-hydroxy-pipecolic acid was measured, and a corresponding molar yield was calculated.
(48) As shown by a blue column in
(49) (2) Specific Activity (mol.Math.min.sup.1.Math.mg.sup.1)
(50) Purified enzymes (100 L) of R97M and WT obtained in Example 2 were added to a reaction system (150 L), and a final reaction system contained 10 mM substrate L-pipecolic acid, 10 mM -ketoglutaric acid, 10 mM L-ascorbic acid, 1 mM FeSO.sub.4.Math.7H.sub.2O, and 50 mM MES (pH 6.5); reaction was carried out at 17 C. for 15 minutes, and a final protein concentration of pure enzymes was maintained at 0.50 mg ml-1. The reaction was terminated by boiling, and the sample after the termination of reaction was analyzed by high-performance liquid chromatography (HPLC). An amount of product was measured using the above detection method of (2S,3R)-3-hydroxy-pipecolic acid, and a corresponding specific activity was calculated.
(51) As shown by a red column in
(52) (3) Kinetic Parameters
(53) Kinetic parameters (K.sub.m and V.sub.max) were determined using a reaction mixture with a final volume of 250 L. For the substrate L-pipecolic acid, a concentration of L-pipecolic acid under the standard enzyme activity conditions ranged from 0.30 to 25 mM. Similarly, a concentration of 2-OG ranged from 0.30 to 40 mM. The assay was performed three times, and a Michaelis-Menten model was fitted using GraphPad Prism. Results were shown in Table 3.
(54) TABLE-US-00004 TABLE 3 Kinetic parameters of wild-type L-proline-3-hydroxylase and its mutant R97M Sub- V.sub.m k.sub.cat/K.sub.m Enzyme strate K.sub.m (mM) (M .Math. min.sup.1) k.sub.cat (min.sup.1) (min.sup.1mM.sup.1) cis-P3H L-Pip 10.27 0.40 201.30 2.00 12.23 0.12 1.14 0.03 (WT) 2-OG 0.76 0.02 101.10 1.50 6.14 0.15 8.01 0.38 R97M L-Pip 6.83 0.32 212.30 3.50 13.82 0.22 2.09 0.06 2-OG 1.46 0.01 139.10 1.23 9.05 0.17 6.23 0.32
(55) The results showed that a Km value that R97M catalyzed the hydroxylation of L-pipecolic acid (6.83 mM) was lower than that of the WT enzyme (10.27 mM), indicating that R97M had an increased affinity for the substrate L-Pip. In addition, the catalytic efficiency kcat/Km of R97M (2.09 min.sup.1 mM.sup.1) was 1.83 times that of WT (1.14 min.sup.1 mM.sup.1).
Example 5: Comparison of Catalytic Performance Between R97M and Positive Mutants in an N43 Mutation Library
(56) The six positive mutants, that is, R97M/N43A, R97M/N43V, R97M/N43S, R97M/N43T, R97M/N43D and R97M/N43K, obtained in Example 3 were further studied, purification was performed according to the purification operation described in Example 2, and specific activities (mol.Math.min.sup.1.Math.mg.sup.1) of these mutants were measured. Specific steps were as follows:
(57) WT pure enzyme, R97M/N43A pure enzyme, R97M/N43V pure enzyme, R97M/N43S pure enzyme, R97M/N43T pure enzyme, R97M/N43D pure enzyme, and R97M/N43K pure enzyme (100 L) were respectively added to a reaction mixture (150 L), and a final reaction system contained 10 mM substrate L-pipecolic acid, 10 mM -ketoglutaric acid, 10 mM L-ascorbic acid, 1 mM FeSO.sub.4.Math.7H.sub.2O, and 50 mM MES (pH 6.5); and reaction was carried out at 17 C. for 15 minutes; the reaction was terminated by boiling, and the sample after the termination of reaction was analyzed by high-performance liquid chromatography (HPLC). An amount of product (2S,3R)-3-hydroxy-pipecolic acid was measured using the above detection method of (2S,3R)-3-hydroxy-pipecolic acid, and a corresponding specific activity was calculated. Specific results were shown in Table 4. Final protein concentration=Initial protein concentrationmolar extinction coefficient dilution factor.
(58) TABLE-US-00005 TABLE 4 Specific activity of pure enzyme solutions based on positive mutants of N43 based on R97M Final protein concentration Specific activity Enzyme (mg .Math. mL.sup.1) (mol .Math. min.sup.1 .Math. mg.sup.1) cis-P3H(WT) 0.56 0.12 R97M 0.55 0.19 R97M/N43A 0.50 0.45 R97M/N43V 0.48 0.24 R97M/N43S 0.43 0.34 R97M/N43T 0.37 0.46 R97M/N43D 0.43 0.32 R97M/N43K 0.69 0.21
(59) Results showed that the specific activities of R97M/N43A, R97M/N43V, R97M/N43S, R97M/N43T, R97M/N43D and R97M/N43K were 2.37, 1.26, 1.79, 2.42, 1.68, and 1.11 times that of R97M, respectively, and 3.75, 0.20, 2.83, 3.83, 2.67, and 1.75 times that of the wild-type. It can be seen that R97M/N43T and R97M/N43A were both dominant mutants, with specific activities of 0.46 mol.Math.min.sup.1.Math.mg.sup.1 and 0.45 mol.Math.min.sup.1.Math.mg.sup.1, respectively. The following experiments were performed by only taking R97M/N43T as an example.
Example 6: Condition Optimization for Mutant R97M/N43T
(60) (1) Effect of Reaction Conditions on Yield of (2S,3R)-3-Hydroxypipecolic Acid
(61) 1) Temperature Optimization
(62) The R97M/N43T crude enzyme (100 L) prepared in Example 2 was added to a reaction system (150 L) for reaction, with specific operation as follows: the R97M/N43T crude enzyme solution (100 L) was added to a reaction system (150 L), a final reaction system contained 10 mM substrate L-pipecolic acid, 10 mM -ketoglutaric acid, 10 mM L-ascorbic acid, 1 mM FeSO.sub.4.Math.7H.sub.2O, and 50 mM MES (pH 6.5), a reaction mixture finally obtained had a total volume of 250 L, and reaction was carried out for 12 hours at temperatures of 10 C., 17 C., 25 C., 30 C., 37 C., 45 C., and 55 C. Results were shown in
(63) The results indicated that R97M/N43T achieved a highest yield of (2S,3R)-3-hydroxypipecolic acid at 10 C., and yields of (2S,3R)-3-hydroxypipecolic acid at temperatures between 10-37 C. were significantly higher than those between 45-55 C.
(64) 2) pH Optimization
(65) The R97M/N43T crude enzyme (100 L) prepared in Example 2 was added to a reaction system (150 L) for reaction, with specific operation as follows: the R97M/N43T crude enzyme solution (100 L) was added to a reaction system (150 L), a final reaction system contained 10 mM substrate L-pipecolic acid, 10 mM -ketoglutaric acid, 10 mM L-ascorbic acid, 1 mM FeSO.sub.4.Math.7H.sub.2O, pH values of MES buffer in the reaction system were set to 5.5, 6, 6.5 and 7, respectively, pH values of Tris-HCl buffer in the reaction system were set to 7, 7.5, 8, 8.5 and 9, respectively, a reaction mixture finally obtained had a total volume of 250 L, and reaction was carried out for 12 hours at 17 C. Results were shown in
(66) The results indicated that (2S,3R)-3-hydroxypipecolic acid achieved a highest yield when pH was 7.5, and yields of (2S,3R)-3-hydroxypipecolic acid at pH between 7.0-9.0 were comparable, but relatively higher than those at pH between 5.5-6.5.
(67) (2) Effect of Reaction Components on Yield of (2S,3R)-3-Hydroxypipecolic Acid
(68) A specific method was the same as in step (1), the R97M/N43T crude enzyme (100 L) prepared in Example 2 was added to the reaction mixture (150 L), and reaction was carried out at 17 C. for 12 hours, except that: 1) a concentration of Fe.sup.2+ in the final reaction system was adjusted to 0 mM, 0.05 mM, 0.10 mM, 0.25 mM, 0.50 mM, 1 mM, 2 mM, 3 mM and 4 mM; 2) a concentration of -ketoglutaric acid (2-OG) in the final reaction system was adjusted to 0 mM, 5 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM and 40 mM; and 3) a concentration of L-ascorbic acid (Vc) in the final reaction system was adjusted to 0 mM, 2 mM, 5 mM, 10 mM, 15 mM, 20 mM, 25 mM and 30 mM; and other conditions were the same as those described in Example 3.
(69) Results were shown in
(70) (3) Molar Yield of (2S,3R)-3-Hydroxypipecolic Acid Catalyzed by R97M/N43T Under Optimal Conditions
(71) According to the results of the optimization of conditions in (1) and (2) above, the optimized conditions were as follows:
(72) The R97M/N43T crude enzyme (100 L) prepared in Example 2 was added to a reaction system (150 L) for reaction, with specific operation as follows:
(73) the R97M/N43T crude enzyme (100 L) was added to a reaction system (150 L), a final reaction system contained 10 mM substrate L-pipecolic acid, 30 mM -ketoglutaric acid, 15 mM L-ascorbic acid, 0.05 mM FeSO.sub.4.Math.7H.sub.2O, a reaction mixture finally obtained had a total volume of 250 L, and reaction was carried out for 12 hours at a temperature of 10 C. and pH of 6.5.
(74) The wild-type enzyme was taken as a control.
(75) Evaluation was performed according to yields of (2S,3R)-3-hydroxypipecolic acid. The results showed that R97M/N43T achieved a molar yield of 8.82 mM at a substrate concentration of 10 mM under crude enzyme conditions, with a molar yield rate of 88%, and almost no substrate peak was detected, which was 4.11 times that of the wild-type enzyme (it had a molar yield rate of 21.40% and a yield of (2S,3R)-3-hydroxypipecolic acid up to 310 mg.Math.L.sup.1 under the initial reaction conditions as described in Item (1) of Example 4), in which case, the yield of (2S,3R)-3-hydroxypipecolic acid produced by R97M/N43T catalyzing L-pipecolic acid was 1278 mg.Math.L.sup.1.
(76) Although the present disclosure has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present disclosure. Those skilled in the art can make various modifications and variations without departing from the spirit and scope of the present disclosure. Therefore, the scope of protection of the present disclosure should be defined by the claims.