Expression cassette containing overlapping open reading frames and application
12416019 ยท 2025-09-16
Assignee
Inventors
- He XIAO (Hubei, CN)
- Xiaobin HE (Hubei, CN)
- Gang HUANG (Hubei, CN)
- Xing PAN (Hubei, CN)
- Yicheng ZHOU (Hubei, CN)
- Liang DU (Hubei, CN)
- Mengdie WANG (Hubei, CN)
- Huanhuan ZUO (Hubei, CN)
- Hao SUN (Hubei, CN)
Cpc classification
C12N2710/14052
CHEMISTRY; METALLURGY
C12N2710/14043
CHEMISTRY; METALLURGY
C12N5/0601
CHEMISTRY; METALLURGY
C12N2710/14022
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
Abstract
An expression cassette containing overlapping open reading frames and an application thereof are provided. The overlapping open reading frames are overlapping open reading frames of a first ORF and a second ORF and include in sequence from a 5 end to a 3 end: a first promoter at least used to drive gene transcription of the first ORF; a 5 part of a gene of the first ORF; an intron; and a 3 part of a gene of the second ORF, the intron including a second promoter used only to drive gene transcription of the second ORF. By arranging two promoters in a single expression cassette in the disclosure, the two promoters are used to drive the expression of proteins of the overlapping reading frames and regulate the relative expression time and expression intensity of different proteins.
Claims
1. An expression cassette containing overlapping open reading frames, the overlapping open reading frames being overlapping open reading frames of a first ORF and a second ORF, comprising a second promoter used only to drive gene transcription of the second ORF and further comprising in sequence from a 5 end to a 3 end: a first promoter at least used to drive gene transcription of the first ORF; a 5 part of a gene of the first ORF; an intron; and a 3 part of a gene of the second ORF, wherein the second promoter precedes the 5 end of the first promoter or within the intron, wherein during post-transcriptional processing, the translation initiation codons ATG of the first ORF is formed through alternative splicing of the intron.
2. The expression cassette according to claim 1, wherein the intron is located between any two nucleotides of the translation initiation codons ATG of the first ORF.
3. The expression cassette according to claim 1, wherein the second promoter is within the intron.
4. The expression cassette according to claim 1, wherein the second promoter precedes the 5 end of the first promoter.
5. The expression cassette according to claim 1, wherein the first promoter is only used to drive gene transcription of the first ORF.
6. The expression cassette according to claim 1, wherein the first promoter is used to drive gene transcription of the first ORF and the second ORF.
7. The expression cassette according to claim 1, wherein the gene of the first ORF is used to express a Rep78 and/or Rep68 protein, and the gene of the second ORF is used to express a Rep52 and/or Rep 40 protein.
8. The expression cassette according to claim 1, wherein the gene of the first ORF is used to express a VP1 protein, and the gene of the second ORF is used to express a VP2 and/or VP3 protein(s).
9. The expression cassette according to claim 1, wherein the first promoter is active before the second promoter.
10. The expression cassette according to claim 9, wherein the first promoter is an immediate early promoter, an early promoter, or a late promoter, and the second promoter is a very late promoter.
11. The expression cassette according to claim 1, wherein the first promoter is deltalE1, IE1, 39K, or p6.9, and the second promoter is polH or p10.
12. The expression cassette according to claim 1, wherein the first promoter is p10, and the second promoter is po1H.
13. A nucleic acid molecule, comprising a Cap gene expression cassette and a Rep gene expression cassette, and the Cap gene expression cassette and/or the Rep gene expression cassette is the expression cassette according to claim 1.
14. The nucleic acid molecule according to claim 13, further comprising an exogenous gene.
15. The nucleic acid molecule according to claim 14, wherein AAV inverted terminal repeats are provided at both ends of the exogenous gene.
16. The nucleic acid molecule according to claim 14, wherein the exogenous gene is a reporter gene, and the reporter gene is at least one of a chloramphenicol acetyltransferase encoding gene, a -galactosidase encoding gene, a -glucuronidase encoding gene, a Renilla luciferase encoding gene, an alkaline phosphatase encoding gene, a firefly luciferase encoding gene, a green fluorescent protein encoding gene, and a red fluorescent protein encoding gene.
17. The nucleic acid molecule according to claim 14, wherein the exogenous gene is a gene encoding a drug polypeptide, and the drug polypeptide is at least one of lipoprotein esterase, apolipoprotein, cytokine, interleukin, and interferon.
18. A recombinant baculovirus vector, comprising the expression cassette according to claim 1.
19. The recombinant baculovirus vector according to claim 18, wherein the recombinant baculovirus vector is an insect cell compatible vector.
20. An isolated insect cell, comprising the recombinant baculovirus vector according to claim 18.
21. The insect cell according to claim 20, wherein the insect cell is a Spodoptera frugiperda cell, a Trichopodia cell, a Drosophila cell, or a mosquito cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(14) In order to make the objectives, technical solutions, and advantages of the disclosure clearer and more comprehensible, the disclosure is further described in detail with reference to the drawings and embodiments. It should be understood that the specific embodiments described herein serve to explain the invention merely and are not used to limit the invention. In addition, the technical features involved in the various embodiments of the invention described below can be combined with each other as long as the technical features do not conflict with each other.
(15) For ease of understanding, the terms appearing in this specific embodiment are defined as follows:
(16) The term polynucleotide: refers to a biological macromolecule composed of single nucleotides. The polynucleotide molecule mentioned in the disclosure may be a deoxyribonucleic acid (DNA) molecule or a ribonucleic acid (RNA) molecule. A person having ordinary skill in the art knows that the RNA sequence is basically similar to the DNA sequence or has a certain degree of sequence identity. Thymine (T) in the DNA sequence can be considered equivalent to uracil (U) in the RNA sequence.
(17) The term operably linked: refers to the connection of polynucleotide (or polypeptide) sequences in a functional relationship. Two nucleotide sequences are operably linked when the two nucleotide sequences are placed in a functional relationship. For instance, a transcriptional control sequence (e.g., a promoter) is operably linked to a gene's coding sequence if it affects the transcription of the gene's coding sequence.
(18) The term expression cassette: refers to a nucleic acid construct including coding and regulatory sequences operably linked when introduced into a host cell, resulting in the transcription and/or translation of RNA or polypeptide, respectively. An expression cassette is understood to include a promoter allowing the initiation of transcription, the open reading frame of the gene of interest, and a transcription terminator. Generally, the promoter sequence is placed upstream of the gene of interest at a distance compatible with expression control. The expression cassette may be a multi-piece nucleic acid construct or a one-piece nucleic acid construct.
(19) The term open reading frame (ORF): refers to the normal nucleotide sequence of a structural gene with the potential to encode a protein or polypeptide and begins with a start codon and ends with a stop codon with no stop codon in between to interrupt translation. On an mRNA chain, a ribosome starts translation from the start codon, synthesizes a polypeptide chain along the mRNA sequence, and continues to extend. When a stop codon is encountered, the extension reaction of the polypeptide chain is terminated.
(20) The term vector: refers to a nucleic acid molecule designed to transport, transfer, and/or store genetic material, as well as to express genetic material and/or integrate genetic material into the chromosomal DNA of a host cell, such as a plasmid vector, a cosmid vector, an artificial chromosome, a phage vector, and other viral vectors. A vector usually consists of at least three basic units, namely a replication source, a selectable marker, and a multiple cloning site.
(21) The term intron: also known as spacer sequence, refers to a non-coding segment in a gene or mRNA molecule and is an intervening sequence in the DNA of eukaryotic cells. The intronic sequence is transcribed in the mRNA precursor, is removed by splicing, and is ultimately no longer present in the mature mRNA molecule. Depending on whether the splicing process is spontaneous or processed by the spliceosome, introns are divided into self-splicing introns and spliceosomal introns. A self-splicing intron is a special type of intron, a ribozyme that can be cut out by its own action to leave the mRNA. The intron involved in the disclosure is a spliceosomal intron, and the splicing of such an intron requires the help of the spliceosome. There are a splicing donor sequence and a splicing acceptor sequence at both ends of the intron sequence, which are the sequences on both sides of the cutoff and rejoining sites. The spliceosome is a ribonucleoprotein complex dynamically composed of small nuclear RNAs (snRNAs) and protein factors. The spliceosome recognizes the splicing site of the mRNA precursor, catalyzes the splicing reaction, completely cuts out the intron, and then rejoins the upstream and downstream RNA sequences.
(22) The intron mentioned in the disclosure can be a natural intron, or an intron that has been artificially modified and has splicing activity in insect cells, and the source thereof is not limited to insect cells.
(23) The term AAV serotype: since the discovery of adeno-associated viruses (AAVs), more than 100 AAV serotypes or mutants have been isolated from adenovirus, humans, or primates, and some mammals, among which AAV1-9 is mainly used. The main difference between rAAV vectors of different serotypes is the capsid protein. Different AAV serotypes have certain differences in infection efficiency and tissue specificity.
(24) The genome structures of all known adeno-associated virus serotypes are very similar. AAV is a single-stranded DNA virus with a simple genome structure and a full length of approximately 4.7 kb, as shown in
(25) As a defective virus, AAV cannot replicate independently in the absence of helper viruses. Therefore, AAV can only be integrated into the host cell chromosome at a specific site and remain in a latent state. In the presence of helper virus, the increased expression amount of the rep gene can rescue the AAV genome integrated in the host cell chromosome and replicate AAV DNA in large quantities. The single-stranded rAAV genome is packaged into infectious virus particles under the action of VP capsid protein.
(26) The term Cap gene: consists of overlapping amino acid sequences encoding the structural VP capsid protein and contains three overlapping open reading frames, encoding three types of subunits: VP1, VP2, and VP3. VP1, VP2, and VP3 contain different start codons and share a stop codon, and VP1 and VP2 share the VP3 sequence. The N-terminus of VP1 has a conserved phospholipase A2 sequence, and this sequence is involved in the escape of the virus from the body and is critical to its infectivity. The VP2 protein is not essential for assembly or infection. The core of the VP3 protein consists of a conserved -barrel motif, which determines the differences in receptors between different serotypes of AAV and host cells. The correct ratio of the three proteins in wild-type AAV is 6:6:54, which is approximately 1:1:10.
(27) The term Rep gene: is used to encode four overlapping multifunctional proteins, Rep78, Rep68, Rep52, and Rep40. Rep78 and Rep68 proteins are involved in the replication and integration of AAV and can bind to specific sequences in the ITR. Rep52 and Rep40 proteins have helicase and ATPase activities and participate in single-stranded genome replication and virus assembly. Whether in mammalian cells or insect cells, unspliced mRNA encoding Rep78 and Rep52 proteins is sufficient to prepare rAAV.
(28) The term relative expression content: is the relative proportion of the expression amounts of different proteins. For instance, an increase in the relative expression content of Rep78/Rep52 protein may mean an increase in Rep78 protein expression amount, or it may mean a decrease in Rep52 protein expression amount.
(29) The term promoter: is the DNA sequence located upstream of the 5 end of a structural gene and is able to activate RNA polymerase, so that it can accurately bind to the template DNA and have the specificity for transcription initiation.
(30) The term solid rate: taking the AAV vector as an example, the solid AAV is the AAV vector carrying the target gene. The empty shell AAV vector is an AAV vector that does not carry the target gene, consists of a serotype-specific AAV protein coat, and is usually produced by incomplete viral packaging during the production process. It must be minimized during purification of gene therapy products because these viral capsids do not contain DNA. When they are infused into patients, they compete for the limited number of receptors on the cell surface on the one hand, and they are not beneficial to gene therapy and may cause side effects on the other hand. Further, the increase in empty shell AAV content will lead to an increase in the dosage. The higher the dosage, the higher the risk of serious side effects. The same is true for AAVs that contain incomplete copies of therapeutic genes.
(31) The solid rate refers to the proportion of solid AAV in the prepared AAV vector. The higher the solid rate, the greater the proportion of solid AAV, which proves that the quality of the prepared AAV vector is higher.
(32) The disclosure provides an expression cassette used to express a gene including overlapping open reading frames in a cell, especially in an insect cell, and the expression cassette includes: operably linked from a 5 end to a 3 end: an artificially constructed sequence; and an overlapping open reading frame lacking a first translation initiation codon, where the artificially constructed sequence includes a first promoter and a second promoter independent of each other, and a complete sequence of the first translation initiation codon is not included between the first promoter and the second promoter.
(33) In some embodiments, the artificially constructed sequence also includes an intron, and the intron is located between translation initiation codons ATG, for example, between AT and G or between A and TG. The intron is used to form the first translation initiation codon in the artificially constructed sequence through alternative splicing during post-transcriptional processing, so that the overlapping open reading frame can be expressed smoothly.
(34) In some embodiments, the second promoter precedes the first promoter (i.e., precedes the 5 end of the first promoter), and the first promoter precedes the intron. In some other embodiments, the first promoter precedes the intron, and the second promoter is contained within the intron.
(35) In some embodiments, the first promoter is used to express all proteins encoded by the overlapping open reading frame, while the second promoter is used to adjust the relative expression time and relative expression content/expression intensity of these proteins. In some other embodiments, the gene encoded by the expression cassette is a parvovirus Rep gene. The two promoters of the disclosure may be used to adjust the relative expression time and relative expression content/expression intensity of different Rep proteins. Further, a Rep40 protein has a similar function to a Rep52 protein, and a Rep68 protein also has a similar function to a Rep78 protein. Therefore, the first promoter may be used to drive the expression of the Rep68 and/or Rep78 protein(s) and may also be used to drive the expression of the Rep40 protein and/or the Rep52 protein, and the second promoter is used to additionally drive the expression of the Rep40 protein and/or the Rep52 protein.
(36) In some embodiments, the gene encoded by the expression cassette is a parvovirus Cap gene. The two promoters of the disclosure may be used to adjust the relative expression time and relative expression content/expression intensity of different Cap proteins. Further, the first promoter is used to drive the expression of a VP1 protein and may also be used to drive the expression of a VP2/3 protein, and the second promoter is used to additionally drive the expression of the VP2/3 protein.
(37) In some embodiments, the first promoter is active before the second promoter. For instance, the first promoter may be an early and late promoter such as deltaIE1, IE1, 39K, or p6.9, and the second promoter may be a very late promoter such as p10 or polH.
(38) In some other embodiments, the first promoter and the second promoter may produce activity almost simultaneously, for example, the first promoter is p10 and the second promoter is polH.
(39) Since variations in some non-critical sites of the promoters have no impact on their functions, the sequences of the first promoter and the second promoter may also be partially different from the original sequences of the above promoters.
(40) The disclosure further provides an optimized expression cassette for a gene including overlapping open reading frames for use in a cell, especially in an insect cell. The overlapping open reading frames are overlapping open reading frames of a first ORF and a second ORF and include in sequence from a 5 end to a 3 end: a first promoter used to drive gene transcription of the first ORF; a 5 part of a gene of the first ORF; an intron; and a 3 part of a gene of the second ORF, where the intron includes a second promoter used to drive gene transcription of the second ORF, the first promoter is an immediate early promoter, an early promoter, or a late promoter, the second promoter is a very late promoter, and for example, in some embodiments, the first promoter is deltaIE1, IE1, 39K, or p6.9, and the second promoter is polH or p10.
(41) In some embodiments, the intron is located between any two nucleotides of translation initiation codons ATG of the first ORF. The intron is used to form the first translation initiation codon in the artificially constructed sequence through alternative splicing during post-transcriptional processing.
(42) In some other embodiments, the intron is located between the translation initiation codons ATG of the first ORF and an exon of the first ORF.
(43) In some embodiments, the gene encoded by the expression cassette is a parvovirus Rep gene, the first ORF is used to encode the Rep78 protein, and the second ORF is used to encode the Rep52 protein. The two promoters of the disclosure may be used to adjust the relative expression time and relative expression content/expression intensity of different Rep proteins. Further, the Rep40 protein has a similar function to the Rep52 protein, and the Rep68 protein also has a similar function to the Rep78 protein. Therefore, the first promoter may be used to drive the expression of the Rep68 and/or Rep78 protein(s), and the second promoter is used to drive the expression of the Rep40 protein and/or the Rep52 protein.
(44) In some embodiments, the second promoter contains translation initiation codon and stop codon sequences that are recognized by a ribosome, so that when the intron is not spliced during the post-transcriptional processing of a Rep gene expression cassette driven by the first promoter, the Rep40 protein and/or the Rep52 protein will not be translated and produced. In some embodiments, the gene encoded by the expression cassette is a parvovirus Cap gene. The two promoters of the disclosure may be used to adjust the relative expression time and relative expression content/expression intensity of different Cap proteins. Further, the first promoter is used to drive the expression of the VP1 protein, and the second promoter is used to additionally drive the expression of the VP2 and/or VP3 protein(s).
(45) Since variations in some non-critical sites of the promoters have no impact on their functions, the sequences of the first promoter and the second promoter may also be partially different from the original sequences of the above promoters.
(46) The expression cassette of the Rep gene may be integrated into different baculovirus vectors with the expression cassette of the Cap gene and a sequence of an exogenous gene containing AAV inverted terminal repeats at both ends, or they can be integrated into the same recombinant baculovirus vector. In some embodiments, both the expression cassette of the Rep gene and the expression cassette of the Cap gene can use the abovementioned expression cassette, or one of them can use the abovementioned expression cassette.
(47) In some embodiments, the exogenous gene is a reporter gene and is, for example, a chloramphenicol acetyltransferase encoding gene, a -galactosidase encoding gene, a -glucuronidase encoding gene, a Renilla luciferase encoding gene, an alkaline phosphatase encoding gene, a firefly luciferase encoding gene, a green fluorescent protein encoding gene, or a red fluorescent protein encoding gene.
(48) In some other embodiments, the exogenous gene is a gene encoding a drug polypeptide, and the drug polypeptide is lipoprotein esterase, apolipoprotein, cytokine, interleukin, or interferon and the like.
(49) In some embodiments, the insect cell is a Spodoptera frugiperda cell, a Trichopodia cell, a Drosophila cell, or a mosquito cell and the like.
Example 1
Step One: Construction of Rep Gene Expression Cassette I and Recombinant Baculovirus Vector Containing Rep Gene Expression Cassette I
(50) With reference to
(51) The construct is cloned into a pFastBac vector to prepare a transfer plasmid. The transfer plasmid is transformed into a DH10Bac strain, and a recombinant baculovirus vector AcRepA containing RepA is obtained through the gene transposition reaction mediated by Tn7 transposase.
Step Two: Construction of Cap Gene Expression Cassette
(52) Construction of a Cap8 expression cassette containing the AAV serotype 8 Cap gene: The Cap gene expression cassette is constructed with reference to the method described in Example 3 of Chinese patent (CN202111105263.5). With reference to
Step Three: Construction of Recombinant AAV Bacmid
(53) The method for constructing recombinant AAV bacmid for producing AAV virus in an insect cell is provided with reference to Example 1 in the previously applied patent CN112553257A in this example, and the following steps are included.
(54) (1) A homologous recombination vector containing the essential functional elements Cap and Rep gene expression cassettes of AAV is constructed. The essential functional elements in the homologous recombination vector are then inserted into the C-terminus of the essential gene Ac135 (116492 . . . 117391) in the baculovirus genome in E. coli through Red homologous recombination. A recombinant baculovirus vector containing Cap and Rep gene expression cassettes is obtained, numbered Bac-Cap-Rep.
(55) (2) A homologous recombination vector containing an ITR core element (ITR-GOI) is constructed. The ITR core element is numbered I-G-1, and its nucleotide sequence is shown in SEQ ID No. 5. The GOI in the ITR core element uses a red fluorescent protein mcherry gene expression cassette, that is, the miniEfla promoter controls mcherry expression to facilitate detection of rAAV activity in this example.
(56) (3) The shuttle vector constructed in the above step (2) is used to transform competent cells containing the Bac-Cap-Rep recombinant bacmid. The essential functional elements in the homologous recombination vector are then inserted into the C-terminus of the essential gene Ac98 (88502 . . . 88464) in the baculovirus genome in E. coli through Red homologous recombination. A recombinant bacmid containing the functional protein components necessary for rAAV production and the ITR core element of the recombinant baculovirus genome is finally obtained, numbered Bac-Cap-Rep-ITR-GOI.
Step Four: Preparation of AAV Recombinant Baculovirus
(57) The recombinant AAV bacmid prepared in step three is transfected into a host cell line and cultured to obtain the AAV recombinant baculovirus, and the specific steps are provided as follows.
(58) The above recombinant bacmid DNA was extracted and transfected into Sf9 insect cells to prepare recombinant baculovirus BEV and rAAV. The transfected Sf9 insect cells successfully produced BEV, and further infection with a large number of replicating and proliferating BEV caused obvious cytopathic effect (CPE) in Sf9 cells. The culture supernatant of Sf9 cells that had undergone CPE was collected, which contained a large amount of BEV, which was the 0.sup.th generation BEV (P0). At the same time, the Sf9 cells containing a large amount of rAAV were collected. The prepared BEV-P0 was infected into suspension-cultured Sf9 cells at a multiplicity of infection (MOI=1). After 72 hours of infection, the cell activity dropped to less than 50%. The cell culture medium was centrifuged at 1000 g for 5 minutes, and the culture supernatant and cell pellet were collected. The supernatant was labeled as the first generation BEV-P1, and the cells were labeled as rAAV packaged with BEV-P0.
Examples 2 to 4
(59) In Examples 2 to 4, deltaIE1 in Example 1 is replaced with 39K, p6.9, and p10 as the first promoter sequence, and other steps are the same as in Example 1. Constructs RepB, RepC, and RepD, recombinant baculovirus vectors AcRepB, AcRepC, and AcRepD, as well as subsequent recombinant AAV bacmid and AAV recombinant baculovirus are obtained. The nucleotide sequences of RepB-RepD are shown in SEQ ID No. 6-8.
Example 5
Step One: Construction of Rep Gene Expression Cassette II and Recombinant Baculovirus Vector Containing Rep Gene Expression Cassette II
(60) With reference to what is shown in
(61) The construct was cloned into a pFastBac vector to prepare a transfer plasmid. The transfer plasmid was transformed into a DH10Bac strain, and a recombinant baculovirus vector AcRepI containing RepI was obtained through the gene transposition reaction mediated by Tn7 transposase.
(62) Step two to step four are the same as in Example 1.
Examples 6 to 8
(63) In Examples 6 to 8, deltaIE1 in Example 5 is replaced with 39K, p6.9, and p10 as the first promoter sequence, and other steps are the same as in Example 5. Constructs RepII, RepIII, and RepIV (the nucleotide sequences of which are shown in SEQ ID No. 10-12), recombinant baculovirus vectors AcRepII, AcRepIII, and AcRepIV as well as subsequent recombinant AAV bacmid and AAV recombinant baculovirus are obtained.
Comparative Examples 1 to 4
(64) Step one: A Rep gene expression cassette III and a recombinant baculovirus vector containing the Rep gene expression cassette III are constructed, and the Rep gene expression cassette III is constructed with reference to the method described in Example 6 of Chinese patent (CN202111105263.5). With reference to
(65) The constructs were cloned into a pFastBac vector to prepare a transfer plasmid. The transfer plasmid was transformed into a DH10Bac strain, and recombinant baculovirus vectors AcRep1-4 respectively containing Rep1-4 were obtained through the gene transposition reaction mediated by Tn7 transposase.
(66) Step two to step four are the same as in Example 1.
Experimental Result Verification
(67) For the ease of explanation of the experimental results, the recombinant AAV bacmids (Bac-Cap-Rep-ITR-GOI) constructed according to Examples 1 to 6 and Comparative Example 4 of the disclosure are numbered according to Table 1 according to their corresponding Cap gene expression cassette, Rep gene expression cassette, and ITR core element. The 7 different recombinant AAV bacmids constructed in this example all contain the Cap gene expression cassette, the Rep gene expression cassette, and the ITR core element. Herein, the recombinant AAV bacmid CRI-0 is a control bacmid containing the Rep4 gene expression cassette, and the Rep78/52 protein in the Rep4 gene expression cassette is driven by a single very late strong promoter polH. The details are shown in Table 1.
(68) TABLE-US-00001 TABLE 1 List of components of 7 different recombinant AAV bacmids constructed in the Examples and Comparative Examples Functional protein components and ITR core elements necessary for rAAV production Recombinant AAV Cap gene Rep gene ITR core bacmid (Bac-Cap-Rep- expression expression component ITR-GOI) number cassette cassette (ITR-GOI) CRI-0 Cap8 Rep4 I-G-1 CRI-1 Cap8 RepA I-G-1 CRI-2 Cap8 RepB I-G-1 CRI-3 Cap8 RepC I-G-1 CRI-4 Cap8 RepD I-G-1 CRI-5 Cap8 RepI I-G-1 CRI-6 Cap8 RepII I-G-1
(69) Verification Example 1 detects the expression of the Rep proteins (Rep78 and Rep52), and the specific steps are as follows.
(70) The above recombinant baculovirus vector DNA was extracted and transfected into Sf9 insect cells to prepare the recombinant baculovirus BEV. The transfected Sf9 insect cells successfully produced BEV, and further infection with a large number of replicating and proliferating BEV caused obvious cytopathic effect (CPE) in Sf9 cells. The culture supernatant of Sf9 cells that had undergone CPE was collected, which contained a large amount of BEV, which was the 0th generation BEV (P0). At the same time, the Sf9 cells containing a large amount of rAAV were collected. The prepared BEV-P0 was infected into suspension-cultured Sf9 cells at a multiplicity of infection (MOI=1). After 72 hours of infection, the cell activity dropped to less than 50%. The cell culture medium was centrifuged at 1000 g for 5 minutes, and the culture supernatant and cell pellet were collected. The supernatant was labeled as the first generation BEV-P1. Continuing to expand the culture, the prepared BEV-P1 was infected into suspension-cultured Sf9 cells at a multiplicity of infection (MOI=1). After 72 hours of infection, the cell activity dropped to less than 50%. The cell culture medium was centrifuged at 1000 g for 5 minutes, and the cell pellet was collected for Western Blot to detect the expression of the Rep proteins (Rep78 and Rep52).
(71)
(72)
(73)
(74)
Verification Example 2 Growth Kinetics Analysis
(75) The immediate early promoter deltaIE1 is active early in baculovirus infection, and early and abundant expression of the Rep78 protein in insect cells may have a negative impact on the yield of recombinant baculovirus (Urabe et al., 2006, Journal of Virology 80.4:1874-1885). In order to compare the growth kinetics of the recombinant baculoviruses containing different Rep gene expression cassettes in the above Examples and Comparative Examples, the above recombinant baculovirus is used to infect Sf9 cells at a multiplicity of infection (MOI=0.5). The supernatant of the infected cell culture is collected at 24, 48, 72, and 96 hours after infection, and the titer of the second generation BEV-P2 is determined using fluorescence quantitative PCR (qPCR), where the titer unit is expressed in VG/ml (VG, virus genomes). A pair of primers (Q-GP64-F: AACTTGGACATTACCCCGCC (SEQ ID NO: 24) and Q-GP64-R: CCGTTGTACGCATACGCCTG (SEQ ID NO: 25)) corresponding to the gp64 gene is used to determine the BEV titer, and titer unit is expressed in VG/ml (VG, virus genomes). The experimental results are shown in
Verification Example 3: Purification of Recombinant AAV Virus Particles and Detection of rAAV Virus Titer and Virus Particle Solid Rate
(76) This verification example uses Q-PCR to detect the titer of the harvested rAAV virus, and the titer unit is expressed in VG/ml (VG, virus genomes). rAAV titers are measured using a pair of primers (Q-ITR-F: GGAACCCCTAGTGATGGAGTT (SEQ ID NO: 26) and Q-ITR-R: CGGCCTCAGTGAGCGA (SEQ ID NO: 27)) targeting the ITR sequence. The specific operation is as follows. The culture was continuously expanded according to step four of Example 1 until the Sf9 cells cultured in the suspension were infected with BEV-P2 seed virus according to the multiplicity of infection (MOI=1) for rAAV packaging. The packaging volume is 300 mL to 400 mL. After 3 days of infection, cell activity was monitored. After the activity was lower than 50%, the cell culture was harvested, 500 l of the harvested mixed solution (mixed solution of cells and supernatant) was put into a 1.5 ml EP tube, frozen and thawed four times in liquid nitrogen, and treated in a 37 C. water bath. 0.1 l of Benzonase was added to the 500 l mixed solution, and the mixed solution was mixed in a 37 C. water bath for 1 hour and then in a 95 C. water bath for 10 minutes. Centrifugation was performed at 2500 g for 10 minutes, and the supernatant was collected in a new 1.5 ml EP tube. 200 l of the supernatant was added to 10 l of 10% SDS solution to a final concentration of 0.5% SDS. 1.2 l Proteinase K (working concentration 112 g/ml) was then added, the final volume was approximately 210 l, and a 55 C. water bath was performed for 1 hour. After a short centrifugation, a 95 C. water bath was performed for 10 minutes. After mixing, 5 l of sample was taken out and 145 l of ddH.sub.2O was added to make the final volume 150 l. After mixing, 10 l of the sample was taken out and 90 l of ddH.sub.2O was added to make the final volume 100 l. 2 l was used as a Q-PCR template to measure the titer of the virus sample. The experimental results are shown in Table 2.
(77) This example uses analytical ultracentrifugation technology (abbreviated as AUC) to detect the solid rate (complete capsid: total capsid) of the recombinant adeno-associated virus (rAAV).
(78) With the use of the sedimentation rate analysis method in the analytical ultracentrifugation technology, the sample is rotated at high speed in the centrifuge, and each component in the sample moves to the bottom of the sample pool. Different components have different movement rates (i.e., sedimentation coefficients) and have different times to fall to the bottom during centrifugation. During this process, the sample distribution state is scanned, and the sedimentation properties of different components are obtained by analyzing its change process over time. The sedimentation coefficient of each component of the sample depends on the molecular weight, molecular shape, and conformation. AUC is generally used to characterize the solid rate of rAAV.
(79) The collected cell culture was purified using an affinity chromatography column (AVIPure AAV8 Resin). 400 l of the purified rAAV sample was diluted to a dilution factor of OD.sub.230=0.90, and loaded onto the sample. The sedimentation coefficient and peak area percentage of each peak were recorded. Herein, the sedimentation coefficient of empty shell virus was 55S to 65S, the sedimentation coefficient of solid virus was 80S to 110S, 65S to 80S was the partial part, and greater than 110S was the aggregate. The peaks with sedimentation coefficients between 20S and 150S were normalized to obtain the peak area percentage of each peak, and the empty and solid rate of the virus sample was reported based on the results. The experimental results are shown in Table 2.
(80) TABLE-US-00002 TABLE 2 Titer and solid rate detection results of rAAV virions produced using 7 different recombinant AAV bacmids Recombinant rAAV rAAV solid rate AAV bacmid virus titer intact capsids: number (VG/ml) total capsids) CRI-0 1.12E+12 24% CRI-1 1.23E+12 37% CRI-2 1.37E+12 45% CRI-3 7.37E+11 28% CRI-4 6.41E+11 27% CRI-5 1.20E+12 32% CRI-6 1.27E+12 43%
(81) As can be seen from Table 2, the titers of rAAV virus particles produced using recombinant AAV bacmids CRI-1, CRI-2, CRI-5, and CRI-6 are higher than those of the control bacmid CRI-0, and the solid rate is significantly higher than that of the control bacmid CRI-0. Compared to the control bacmid CRI-0, the early expression of the Rep78 protein and the higher Rep52/Rep78 ratio in bacmids CRI-1, CRI-2, CRI-5, and CRI-6 may be the key factors for their high titers and the high solid rate. The titers of rAAV virus particles produced using the recombinant AAV bacmids CRI-3 and CRI-4 are lower than that of the control bacmid CRI-0, but their solid rates are higher than that of the control bacmid CRI-0. Bacmids CRI-0, CRI-3, and CRI-4 use polH, p6.9, and p10 late promoters respectively to drive the expression of the Rep78 protein, where the polH promoter is the most active. Compared to the control bacmid CRI-0, the lower Rep78 protein expression and higher Rep52/Rep78 ratio in bacmids CRI-3 and CRI-4 may be responsible for their relatively low titers and high solid rates. Increasing the solid rates of viral particles is beneficial to the rAAV product, so fewer particles can be used to obtain a similar amount of genome copies per kilogram, and it is also beneficial to establish a stable downstream purification process.
Example 9
Step One: Construction of Rep Gene Expression Cassette IV and Recombinant Baculovirus Vector Containing Rep Gene Expression Cassette IV
(82) With reference to
(83) The construct was cloned into a pFastBac vector to prepare a transfer plasmid. The transfer plasmid was transformed into a DH10Bac strain, and a recombinant baculovirus vector AcRepE containing RepE was obtained through the gene transposition reaction mediated by Tn7 transposase. Step two: Construction of Cap gene expression cassette This step is the same as step two of Example 1. Step three: Construction of recombinant AAV bacmid This step is the same as step three of Example 1. Step four: Preparation of AAV recombinant baculovirus This step is the same as step four of Example 1.
Examples 10 to 12
(84) In Examples 10 to 12, deltaIE1 in Example 9 is replaced with 39K (SEQ ID No. 20), p6.9 (SEQ ID No. 21), and p10 (SEQ ID No. 22) as the first promoter sequence, and other steps are the same as in Example 9. Constructs RepF, RepG, and RepH, as shown in
Comparative Example 5
(85) Step one: A Rep gene expression cassette V and a recombinant baculovirus vector containing the Rep gene expression cassette V are constructed, and the Rep gene expression cassette V is constructed with reference to the method described in Example 6 of Chinese patent (CN202111105263.5). With reference to
(86) The construct was cloned into a pFastBac vector to prepare a transfer plasmid. The transfer plasmid was transformed into a DH10Bac strain, and a recombinant baculovirus vector AcRep5 containing Rep5 was obtained through the gene transposition reaction mediated by Tn7 transposase.
(87) Step two to step four are the same as in Example 9.
Experimental Result Verification
(88) For the ease of explanation of the experimental results, the recombinant AAV bacmids (Bac-Cap-Rep-ITR-GOI) constructed according to Examples 9 to 12 and Comparative Example 5 of the disclosure are numbered according to Table 3 according to their corresponding Cap gene expression cassette, Rep gene expression cassette, and ITR core element. The 5 different recombinant AAV bacmids constructed in this example all contain the Cap gene expression cassette, the Rep gene expression cassette, and the ITR core element. Herein, the recombinant AAV bacmid CRI-7 is a control bacmid containing the Rep5 gene expression cassette, and the Rep78/52 protein in the Rep5 gene expression cassette is driven by a single very late strong promoter polH. The details are shown in Table 3.
(89) TABLE-US-00003 TABLE 3 List of components of 7 different recombinant AAV bacmids constructed in the Examples and Comparative Example 5 Functional protein components Recombinant and ITR core elements necessary Corresponding AAV bacmid for rAAV production Example or (Bac-Cap-Rep- Cap gene Rep gene ITR core Comparative ITR-GOI) expression expression component Example number cassette cassette (ITR-GOI) Comparative CRI-7 Cap8 Rep5 I-G-1 Example 5 Example 9 CRI-8 Cap8 RepE I-G-1 Example 10 CRI-9 Cap8 RepF I-G-1 Example 11 CRI-10 Cap8 RepG I-G-1 Example 12 CRI-11 Cap8 RepH I-G-1
Verification Example 4
(90) The specific steps of the detection of expression of the Rep proteins (Rep78 and Rep52) are as follows.
(91) The above recombinant baculovirus vector DNA was extracted and transfected into Sf9 insect cells to prepare the recombinant baculovirus BEV. The transfected Sf9 insect cells successfully produced BEV, and further infection with a large number of replicating and proliferating BEV caused obvious cytopathic effect (CPE) in Sf9 cells. The culture supernatant of Sf9 cells that had undergone CPE was collected, which contained a large amount of BEV, which was the 0th generation BEV (P0). At the same time, the Sf9 cells containing a large amount of rAAV were collected. The prepared BEV-P0 was infected into suspension-cultured Sf9 cells at a multiplicity of infection (MOI=1). After 72 hours of infection, the cell activity dropped to less than 50%. The cell culture medium was centrifuged at 1000 g for 5 minutes, and the culture supernatant and cell pellet were collected. The supernatant was labeled as the first generation BEV-P1. Continuing to expand the culture, the prepared BEV-PI was infected into suspension-cultured Sf9 cells at a multiplicity of infection (MOI=1). After 72 hours of infection, the cell activity dropped to less than 50%. The cell culture medium was centrifuged at 1000 g for 5 minutes, and the cell pellet was collected for Western Blot to detect the expression of the Rep proteins (Rep78 and Rep52).
(92)
(93)
(94)
Verification Example 5
Purification of Recombinant AAV Virus Particles and Detection of Raav Virus Titer and Virus Particle Solid Rate
(95) This verification example uses Q-PCR to detect the titer of the harvested rAAV virus, and the titer unit is expressed in VG/ml (VG, virus genomes). rAAV titers are measured using a pair of primers (Q-ITR-F: GGAACCCCTAGTGATGGAGTT (SEQ ID NO: 26) and Q-ITR-R: CGGCCTCAGTGAGCGA (SEQ ID NO: 27)) targeting the ITR sequence. The specific operation is as follows. The culture was continuously expanded according to step four of Example 9 until the Sf9 cells cultured in the suspension were infected with BEV-P2 seed virus according to the multiplicity of infection (MOI=1) for rAAV packaging. The packaging volume is 300 mL to 400 mL. After 3 days of infection, cell activity was monitored. After the activity was lower than 50%, the cell culture was harvested, 500 l of the harvested mixed solution (mixed solution of cells and supernatant) was put into a 1.5 ml EP tube, frozen and thawed four times in liquid nitrogen, and treated in a 37 C. water bath. 0.1 l of Benzonase was added to the 500 l mixed solution, and the mixed solution was mixed in a 37 C. water bath for 1 hour and then in a 95 C. water bath for 10 minutes. Centrifugation was performed at 2500 g for 10 minutes, and the supernatant was collected in a new 1.5 ml EP tube. 200 l of the supernatant was added to 10 l of 10% SDS solution to a final concentration of 0.5% SDS. 1.2 l Proteinase K (working concentration 112 g/ml) was then added, the final volume was approximately 210 l, and a 55 C. water bath was performed for 1 hour. After a short centrifugation, a 95 C. water bath was performed for 10 minutes. After mixing, 5 l of sample was taken out and 145 l of ddH.sub.2O was added to make the final volume 150 l. After mixing, 10 l of the sample was taken out and 90 l of ddH.sub.2O was added to make the final volume 100 l. 2 l was used as a Q-PCR template to measure the titer of the virus sample. The experimental results are shown in Table 4.
(96) This example uses a technique of analytical ultracentrifugation (abbreviated as AUC) to detect the solid rate (complete capsid: total capsid) of the recombinant adeno-associated virus (rAAV).
(97) Using the sedimentation rate analysis method in the analytical ultracentrifugation technology, the sample is rotated at high speed in the centrifuge, and each component in the sample moves to the bottom of the sample pool. Different components have different movement rates (i.e., sedimentation coefficients) and have different times to fall to the bottom during centrifugation. During this process, the sample distribution state is scanned, and the sedimentation properties of different components are obtained by analyzing its change process over time. The sedimentation coefficient of each component of the sample depends on the molecular weight, molecular shape, and conformation. AUC is generally used to characterize the solid rate of rAAV.
(98) The collected cell culture was purified using an affinity chromatography column (AVIPure AAV8 Resin). 400 l of the purified rAAV sample was diluted to a dilution factor of OD.sub.230=0.90, and loaded onto the sample. The sedimentation coefficient and peak area percentage of each peak were recorded. Herein, the sedimentation coefficient of empty shell virus was 55S to 65S, the sedimentation coefficient of solid virus was 80S to 110S, 65S to 80S was the partial part, and greater than 110S was the aggregate. The peaks with sedimentation coefficients between 20S and 150S were normalized to obtain the peak area percentage of each peak, and the empty and solid rate of the virus sample was reported based on the results. The experimental results are shown in Table 4.
(99) TABLE-US-00004 TABLE 4 Titer and solid rate detection results of rAAV virions produced using 5 different recombinant AAV bacmids Corresponding rAAV Example Recombinant rAAV solid rate or Comparative bacmid AAV virus titer (intact capsids: Example number (VG/ml) total capsids) Comparative CRI-7 1.12E+12 23% Example 5 Example 9 CRI-8 1.23E+12 35% Example 10 CRI-9 1.37E+12 39% Example 11 CRI-10 7.37E+11 28% Example 12 CRI-11 1.08E+12 20%
(100) As can be seen from Table 4, the titers of rAAV virus particles produced using recombinant AAV bacmids CRI-8 and CRI-9 are higher than those of the control bacmid CRI-7, and the solid rate is significantly higher than that of the control bacmid CRI-7. Compared to the control bacmid CRI-7, the early expression of the Rep78 protein and the higher Rep52/Rep78 ratio in bacmids CRI-8 and CRI-9 may be the key factors for their high titers and the high solid rate. The titer of rAAV virus particles produced using the recombinant AAV bacmid CRI-10 is lower than that of the control bacmid CRI-0, but its solid rate is higher than that of the control bacmid CRI-0. Bacmids CRI-7 and CRI-10 use polH and p6.9 late promoters respectively to drive the expression of the Rep78 protein, where the polH promoter is the most active. Compared to the control bacmid CRI-7, the lower Rep78 protein expression and higher Rep52/Rep78 ratio in the bacmid CRI-10 may be responsible for its relatively low titer and high solid rate. The titer of rAAV virus particles produced using the recombinant AAV bacmid CRI-11 is comparable to that of the control bacmid CRI-0, but its solid rate is slightly lower than that of the control bacmid CRI-7, possibly due to its use of a relatively weak very late promoter to drive Rep78 expression. Increasing the solid rates of viral particles is beneficial to the rAAV product, so fewer particles can be used to obtain a similar amount of genome copies per kilogram, and it is also beneficial to establish a stable downstream purification process.
(101) A person having ordinary skill in the art should be able to easily understand that the above description is only preferred embodiments of the disclosure and is not intended to limit the disclosure. Any modifications, equivalent replacements, and modifications made without departing from the spirit and principles of the disclosure should fall within the protection scope of the disclosure.