Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species
12440555 ยท 2025-10-14
Assignee
Inventors
- Ayumi Fujisawa (Kanagawa, JP)
- MAYUMI KUBOMURA (KANAGAWA, JP)
- Sakiko Saeki (Tokyo, JP)
- SHUJI SAITO (KANAGAWA, JP)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2710/16334
CHEMISTRY; METALLURGY
C12N2760/18134
CHEMISTRY; METALLURGY
C12N2710/16343
CHEMISTRY; METALLURGY
C12N2720/10034
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61K39/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a recombinant avian herpes virus, which comprises at least two recombinant nucleotide sequences, each recombinant nucleotide sequence encoding a distinct antigenic peptide, wherein the at least two recombinant nucleotide sequences are inserted into distinct non-coding regions of the viral genome chosen among the region located between UL44 and UL45, the region located between UL45 and UL46, the region located between US10 and SORF3, and the region located between SORF3 and US2.
Claims
1. A recombinant avian herpes virus of turkeys (HVT), which comprises (i) a first recombinant nucleotide sequence encoding a glycoprotein B (gB) protein of infectious laryngotracheitis virus (ILTV) or an immunogenic fragment thereof, inserted into a non-coding region of the viral genome located between UL45 and UL46, and (ii) a second recombinant nucleotide sequence encoding an antigenic peptide, distinct from an antigenic peptide of infectious laryngotracheitis virus (ILTV), wherein said second recombinant nucleotide sequence is inserted into a non-coding region of the viral genome chosen among the region located between UL44 and UL45, the region located between US10 and SORF3, and the region located between SORF3 and US2.
2. The recombinant HVT of claim 1, wherein the first recombinant nucleotide sequence is under the control of the Pec promoter.
3. The recombinant HVT according to claim 2, wherein the Pec promoter comprises SEQ ID NO: 2.
4. The recombinant HVT of claim 1, wherein the second recombinant nucleotide sequence encodes an antigenic peptide selected from an antigenic peptide of avian paramyxovirus type 1, an antigenic peptide of Gumboro disease virus, an antigenic peptide of Mycoplasma galisepticum, and an antigenic peptide of avian influenza virus.
5. The recombinant HVT of claim 1, wherein the second recombinant nucleotide sequence encodes the VP2 protein of Infectious bursal disease virus (IBDV) or an antigenic fragment thereof.
6. The recombinant HVT of claim 1, wherein the second recombinant nucleotide sequence is under the control of a promoter selected from the chicken beta-actin (Bac) promoter, the Pec promoter, the Murine Cytomegalovirus (Mcmv) immediate-early (ie) 1 promoter, the Human Cytomegalovirus promoter (Hcmv ie), the Simian virus (SV) 40 early promoter, and the Raus Sarcoma virus (RSV) long terminal repeat promoter, or any fragments thereof which retain a promoter activity.
7. The recombinant HVT of claim 1, wherein the second recombinant nucleotide sequence is under the control of the Mcmv ie1 promoter.
8. The recombinant HVT according to claim 7, wherein the Mcmv ie1 promoter comprises SEQ ID NO: 19.
9. The recombinant HVT of claim 1, which comprises (i) inserted between UL45 and UL46 a recombinant nucleotide sequence encoding the ILTV gB protein or an antigenic fragment thereof under the control of the Pec promoter, and (ii) inserted between UL44 and UL45 a recombinant nucleotide sequence encoding the VP2 protein of Infectious bursal disease virus (IBDV) or an antigenic fragment thereof, under the control of Mcmv ie1 promoter.
10. The recombinant HVT of claim 9, wherein, upon infection of Chicken Embryo Fibroblasts (CEF) with said recombinant HVT, the recombinant nucleotide sequence encoding the ILTV gB protein and the recombinant nucleotide sequence encoding the VP2 protein of IBDV are co-expressed in said CEF cells after 10 passages.
11. The recombinant HVT of claim 1, which comprises (i) inserted between UL45 and UL46 a recombinant nucleotide sequence encoding the ILTV gB protein or an antigenic fragment thereof under the control of the Pec promoter, and (ii) inserted between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of the Infectious bursal disease virus (IBDV) or an antigenic fragment thereof, under the control of Mcmv ie1 promoter.
12. The recombinant HVT of claim 11, wherein, upon infection of Chicken Embryo Fibroblasts (CEF) with said recombinant HVT, the recombinant nucleotide sequence encoding the ILTV gB protein and the recombinant nucleotide sequence encoding a VP2 protein of IBDV are co-expressed in said CEF cells after 10 passages.
13. A multivalent vaccine, which comprises an effective immunizing amount of the recombinant HVT of claim 2.
14. A method for vaccinating an avian simultaneously against at least two pathogens, comprising administering to said avian the multivalent vaccine of claim 13.
15. Antiserum obtained by 1) immunizing an avian species with an effective amount of recombinant HVT according to claim 1; and 2) recovering said antiserum from the blood of said avian.
16. A vaccination kit for immunizing avian species which comprises the following components: a) an effective amount of the vaccine of claim 13, and b) a means for administering said vaccine to said avian species.
17. The recombinant HVT of claim 4, wherein the second recombinant nucleotide sequence encodes an antigenic peptide selected from the F protein of Newcastle disease virus (NDV) or an antigenic fragment thereof, the VP2 protein of Infectious bursal disease virus (IBDV) or an antigenic fragment thereof, the Mycoplasma galisepticum 40K protein or an antigenic fragment thereof, and an influenza virus surface protein hemagglutinin (HA) or an antigenic fragment thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4) ). There was no band in the lane of rHVT/44-45BacVP2 (FW123). As shown in
) On the contrary, there was no band in the lane of rHVT/45-46 PecF (FW029). The 38-kd is the mature VP2 protein (A. A. Azad et al., 1987, Virol. 161:145-152; K. J., Fahey et al., 1985, J. Gen. Virol. 66:1479-1488). Double rHVTs of the invention expressed both NDV-F and IBDV-VP2.
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION OF THE INVENTION
(9) The present invention generally relates to multivalent recombinant herpes viruses and their use for immunizing avian species against at least two diseases in the same time. According to the invention, foreign DNA sequences are inserted in particular insertion sites within the rHV genome, providing stable and efficient constructs suitable for use in vaccine compositions or methods.
(10) The present disclosure will be best understood by reference to the following definitions:
Definitions
(11) In the context of the invention, the term reconstructed or recombinant, in relation to a sequence, designates a sequence, nucleic acid or unit which does not exist naturally and/or which has been engineered using recombinant DNA technology (also called gene cloning or molecular cloning).
(12) The term recombinant in relation to a herpes virus refers to a herpes virus whose genome has been modified by insertion of at least one heterologous nucleic acid, i.e., a nucleic acid (e.g., DNA) which is not found naturally in the genome of the herpes virus, or which is found naturally in said genome but in a different form or at a different position. It will be understood that the recombinant herpes virus can be manufactured by a variety of methods, and, once made, can be reproduced without use of further recombinant DNA technology. The structure of the recombinant herpes virus is therefore described in terms of DNA insertion.
(13) In the present description, the terms nucleic acid, nucleic sequence, and nucleotide sequence are used interchangeably and refer to a nucleic acid molecule having a determined sequence, which may be deoxyribonucleotides and/or ribonucleotides. The nucleotide sequence may be first prepared by, e.g., recombinant, enzymatic and/or chemical techniques, and subsequently replicated in a host cell or an in vitro system. A nucleotide sequence preferentially comprises an open reading frame encoding a peptide. The nucleotide sequence may contain additional sequences such as a transcription terminator, a signal peptide, an IRES, an intron, etc. Preferably, an open reading frame in a recombinant nucleic acid does not contain an intron.
(14) The term untranslated region as used herein refers to a region of nucleotides that has no ORF and does not define an amino acid sequence of protein to be expressed by translation, or a region of nucleotides in which the ORF is not involved in any of transcription, translation, or protein expression.
(15) The term avian species is intended to encompass all kinds of avians such as birds of the class of Ayes, i.e., vertebrate animals which are feathered, winged, bipedal, endothermic and egg-laying. In the context of the invention, avians or avian species refer more particularly to birds with economical and/or agronomical interests, such as poultry (such as chickens and turkeys), waterfowl poultry (such as ducks and geese) and ornamental birds (such as swans and psittacines).
(16) The term vaccine as used herein designates an agent which may be used to cause, stimulate or amplify an immune response in an organism.
(17) Viruses
(18) Viruses for use in the present invention are those that belong generally to the genus of avian herpes viruses.
(19) For example, avian herpes viruses for use in the present invention include, but are not limited to, a herpes virus of turkeys (HVT), a serotype 2 Marek's disease virus, preferably the SB1 strain of the serotype 2 Marek's disease virus, or a serotype 1 Marek's disease virus, preferably the CVI988/Rispens strain of the serotype 1 Marek's disease virus. Preferred herpes viruses of the invention are derived from serotypes or strains that are non-pathogenic to targeted avian species.
(20) Multivalent Recombinant Avian Herpes Viruses
(21) An object of the invention relates to recombinant avian herpes viruses suitable for immunizing avian species against at least two diseases, with improved stability through passages. Particular insertion sites have been identified by the inventors which, in combination, provide improved stability for foreign antigen genes.
(22) An object of the invention therefore relates to a recombinant avian herpes virus which comprises at least two recombinant nucleotide sequences, each recombinant nucleotide sequence encoding a distinct antigenic peptide, wherein said at least two recombinant nucleotide sequences are inserted into distinct non-coding regions of the viral genome chosen among the region located between UL44 and UL45, the region located between UL45 and UL46, the region located between US10 and SORF3, and the region located between SORF3 and US2.
(23) The location of the quoted non-coding regions is known in the art and can be found, e.g., in Kingham et al. (The genome of herpesvirus of turkeys: comparative analysis with Marek's disease virusesJournal of General Virology (2001) 82, 1123-1135).
(24) For example, by reference to an FC126 complete genome (GenBank: AF291866.1), the region located between UL44 and UL45 corresponds to nucleotides 94243-94683 of the HVT genome, the region located between UL45 and UL46 corresponds to nucleotides 95323-95443 of the HVT genome, the region located between US10 and SORF3 corresponds to nucleotides 138688-138825 of the HVT genome, and the region located between SORF3 and US2 corresponds to nucleotides 139867-140064 of the HVT genome.
(25) The nucleic acid of interest for insertion into the genome of the herpes virus may be homologous or heterologous with respect to the herpes virus. The nucleic acid typically encodes an antigen from a pathogen and may be derived or obtained from any pathogenic organism capable of causing an infection in avian species. Typically, the cloned nucleic acids are derived from pathogens which cause diseases that have an economic impact on the poultry industry. Examples of pathogens that cause infection in avians include viruses, bacteria, fungi, protozoa, etc.
(26) The homologous or heterologous nucleotide sequence for insertion into the viral genome may thus be any sequence coding for an antigenic peptide of a bird pathogenic agent. The nucleic acid sequence according to the present invention can be derived from any source, e.g., viral, prokaryotic, eukaryotic or synthetic. Typically, the nucleotide sequences encode an immunogenic peptide of a pathogen, and preferably represent surface proteins, secreted proteins or structural proteins of said pathogen, or fragments thereof.
(27) The nucleotide sequence may encode for example an antigenic peptide derived from avian influenza virus, avian paramyxovirus type 1, also called Newcastle disease virus (NDV), avian metapneumovirus, Marek's disease virus, Gumboro disease virus, also called infectious bursal disease virus (IBDV), infectious laryngotracheitis virus (ILVT), infectious bronchitis virus (IBV), Escherichia coli, Salmonella species, Pasteurella multocida, Riemerella anatipestifer, Ornithobacterium rhinotracheale, Mycoplasma gallisepticum, Mycoplasma synoviae, Mycoplasma microorganisms infecting avian species or coccidia.
(28) Preferentially, the nucleotide sequences inserted into the viral genome are chosen among the F protein of NDV, the VP2 protein of IBDV, the gB protein of ILTV, the 40K protein of Mycoplasma galisepticum, and the surface protein hemagglutinin (HA) of the avian influenza virus.
(29) Various combinations of antigenic peptides may present great interest, depending on several factors, such as avian species, rearing country, rearing conditions, etc.
(30) For example, in an embodiment, the multivalent recombinant avian herpes virus of the invention incorporates into its genome the nucleotide sequence coding for the F protein of NDV and the nucleotide sequence coding for the VP2 protein of IBDV.
(31) According to a particular embodiment, three or more nucleotide sequences may be inserted into the viral genome.
(32) The recombinant herpes virus of the invention can express two or more antigens from the same pathogen.
(33) The homologous or heterologous nucleotide sequences coding for the antigens of interest may be operably linked to a promoter and further inserted into the viral genome. The promoter used may be either a synthetic or natural, endogenous or heterologous promoter.
(34) The promoter is not limited as long as it can effectively function in cells of birds infected with rHVT. Hence the choice of a promoter extends to any eukaryotic, prokaryotic or viral promoter capable of directing gene transcription in avian cells infected by the rHVT.
(35) Preferentially, the promoters are chosen among the chicken beta-actin (Bac) promoter, the Pec promoter, the Murine Cytomegalovirus (mCMV) IE1 promoter, the Human Cytomegalovirus (Hcmv) promoter, the Simian virus (SV)40 promoter, and the Raus Sarcoma virus (RSV) promoter, or any fragments thereof which retain a promoter activity.
(36) The nucleic acid sequence of a chicken Bac promoter is shown in SEQ ID NO: 1, the sequence of a Pec promoter is shown in SEQ ID NO: 2, the sequence of an mCMV IE1 promoter is shown in SEQ ID NO: 3, the sequence of an Hcmv promoter is shown in SEQ ID NO: 4 (Hcmv immediate-early (ie) promoter), the sequence of an SV40 promoter is shown in SEQ ID NO: 5 (SV40 early promoter), and the sequence of an RSV promoter is shown in SEQ ID NO: 6 (RSV long terminal repeat promoter).
(37) It should be noted that variants of such sequences encoding functional promoters are known and/or can be designed/tested by the skilled artisan, for use in the instant invention.
(38) In a preferred recombinant herpes virus of the invention, at least one of the nucleic acids comprises a Pec or Bac promoter to drive expression of the antigenic peptide.
(39) Multivalent Construction
(40) Gene cloning and plasmid construction are well known to a person of ordinary skill in the art and may be essentially performed by standard molecular biology techniques (Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, Woodbury, N.Y. 2001).
(41) In order to construct a multivalent recombinant herpes virus of the present invention, initially, the herpes virus is propagated in a suitable host cell and then the genomic DNA is obtained. The host and the conditions for propagating the virus are selected as appropriate. As host cells, cells derived from chicken are preferred, and CEF (chick embryo fibroblast), chicken kidney cells, and the like can be used. They may be cultured in a culture medium such as Eagle's MEM, Leibowitz-L-15/McCoy 5A (1:1 mixture) culture medium at about 37 C. for 3 to 4 days.
(42) DNA is extracted from the virus-infected cells cultured as above according to a conventional method. After protein is denatured in the lysis buffer and removed, DNA is extracted with phenol and ethanol.
(43) Typically, the recombinant viruses may be prepared by homologous recombination between the viral genome and a construct (e.g., a plasmid) comprising the nucleic acid to be inserted, flanked by nucleotides from the insertion site to allow recombination.
(44) Plasmid with Insertion Site Sequence
(45) One possibility to insert a foreign gene in one of the untranslated regions of the viral genome according to the invention may be to first clone a sequence containing the targeted untranslated region into a plasmid, or other suitable vector. According to the invention, such sequence is chosen among the sequence of the region located between UL44 and UL45, the sequence of the region located between UL45 and UL46, the sequence of the region located between US10 and SORF3, and the sequence of the region located between SORF3 and US2.
(46) Examples of plasmids comprise pBR322, pBR325, pBR327, pBR328, pUC18, pUC19, pUC7, pUC8, and pUC9, examples of phages comprise lambda phage and M13 phage, and an example of cosmids comprises pHC79.
(47) The untranslated region sequence is integrated into the plasmid according to a conventional cloning method. The insertion region sequences are preferably of sufficient length so that, upon insertion of the nucleic acid, the sequences which flank the nucleic acid are of appropriate length so as to allow in vivo homologous recombination with the viral genome. Preferably, the flanking sequences shall have at least approximately 50 nucleotides in length.
(48) In order to insert one or more foreign sequence(s) into the untranslated region, mutation may be carried out at a specific site of the untranslated region to make a new cleavage site for restriction enzymes. A method of carrying out mutation may be a conventional method, and a method commonly used by a person skilled in the art such as in vitro mutagenesis and PCR can be used. Thus, in the PCR method, a mutation such as the deletion, replacement, or addition of 1 to 2 nucleotides in the PCR primer is carried out, and the primer is then used to create a mutation.
(49) Plasmid Further Containing Targeted Foreign Nucleotide Sequence(s)
(50) The nucleotide and promoter sequences, for insertion into the virus, are further inserted into the insertion region of the viral genome in the plasmid.
(51) More precisely, the nucleotide and promoter sequences are introduced into a fragment of genomic herpes virus DNA containing insertion region sequences, subcloned in the plasmid.
(52) If desired, a plasmid can be prepared which contains two or more foreign nucleic acid sequences, e.g., derived from the same or different pathogens, said sequences being flanked by insertion region sequences as described herein.
(53) Viral Genome Comprising a Foreign Nucleotide Sequence in an Insertion Site
(54) Plasmids in which at least one nucleotide sequence has been inserted into the untranslated region obtained as above may be introduced into an HVT-infected cell or HVT genome-transfected cell using electroporation, calcium phosphate, a lipofectin-based method or the like. When the amount of the plasmid to be introduced is in the range of 0.1 to 1000 g, the efficiency of generation of recombinant viruses by recombination between the homologous regions of HVT-DNA and the plasmid becomes high in cells.
(55) Production of the Multivalent Recombinant Herpes Virus
(56) The multivalent of the invention may be obtained by co-transfecting in the same cell culture a plasmid containing, as described above, an insertion site sequence in which is integrated a foreign nucleotide sequence, and a recombinant herpes virus containing, as described above, the same insertion site free of the foreign nucleotide sequence and a second insertion site in which is integrated a distinct foreign nucleotide sequence. This co-transfection results in the recombination of the plasmid DNA into the viral genome.
(57) Otherwise, the multivalent of the invention may be obtained by co-transfecting in the same cell culture two plasmids each containing a distinct insertion site sequence in which is integrated a distinct foreign nucleotide sequence, and a herpes virus containing, as described above, the same insertion sites free of the foreign nucleotide sequence. The co-transfection results in the recombination of both plasmid DNAs into the viral genome.
(58) The resulting multivalent recombinant virus may be selected genotypically or phenotypically using known techniques of selection, e.g., by hybridization, detecting enzyme activity encoded by a gene co-integrated along with the recombinant nucleic acid sequences or detecting the antigenic peptide expressed by the recombinant herpes virus immunologically. The selected recombinant herpes virus can be cultured on a large scale in cell cultures after which recombinant herpes virus-containing peptides can be collected.
(59) Preferred Multivalent Constructions
(60) It is an object of the invention to propose multivalent recombinant herpes viruses which present at least two foreign nucleotide sequences each being inserted in a particular insertion site, in suitable manner for encoding and expressing the corresponding antigenic peptides in avian cells.
(61) Among the plurality of possible embodiments based on the combinations of the targeted insertion sites and the preferred recombinant nucleotide sequences, and optionally the preferred promoters, the Applicant has surprisingly found that particular combinations present a high level of stability, allowing their use for preparing improved multivalent vaccines.
(62) Based on this noticing, it is a purpose of the invention to propose specific multivalent recombinant avian herpes viruses with a high level of stability.
(63) Preferred multivalent recombinant avian herpes viruses of the invention comprise two recombinant nucleotide sequences, each recombinant nucleotide sequence encoding a distinct antigenic peptide and being inserted into a distinct non-coding region of the viral genome chosen among the region located between UL44 and UL45, the region located between UL45 and UL46, the region located between US10 and SORF3, and the region located between SORF3 and US2.
(64) Preferred antigenic peptides of the invention are chosen among the F protein of NDV, the VP2 protein of IBDV, the gB protein of ILTV, the 40K protein of Mycoplasma galisepticum, and the surface protein HA of the avian influenza virus.
(65) Advantageously, the promoters used with nucleotide sequences inserted in the insertion site between UL44 and UL45 are chosen among the Pec promoter, the mCMV IE1 promoter, the Hcmv promoter, the SV40 promoter, and the RSV promoter, or any fragments thereof which retain a promoter activity. Indeed, applicant has surprisingly found that the Bac promoter inserted between UL44 and UL45 does not allow stable expression of a foreign gene. However, the Bac promoter inserted in the region between UL45 and UL46 does allow stable expression.
(66) According to a first embodiment, the recombinant avian herpes virus comprises, inserted between UL45 and UL46, a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter, and, inserted between UL44 and UL45, a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of SV40 promoter (FW130).
(67) According to a second embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between UL44 and UL45 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the RSV promoter (FW129).
(68) According to a third embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter and in the insertion site between UL44 and UL45 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter (FW141).
(69) According to a fourth embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter (FW144).
(70) According to a fifth embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW146).
(71) According to a sixth embodiment, the recombinant avian herpes virus comprises in the insertion site between UL44 and UL45 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter (FW143).
(72) According to a seventh embodiment, the recombinant avian herpes virus comprises in the insertion site between UL44 and UL45 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter, and in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW142).
(73) According to an eighth embodiment, the recombinant avian herpes virus comprises in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW147).
(74) According to a ninth embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter (FW145).
(75) According to a tenth embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the SV40 promoter (FW149).
(76) According to an eleventh embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the SV40 promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW148).
(77) According to a twelfth embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between US10 and SORF3 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter (FW153).
(78) According to a thirteenth embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between US10 and SORF3 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW154).
(79) According to a fourteenth embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter, and in the insertion site between US10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter (FW155).
(80) According to a fifteenth embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter, and in the insertion site between US10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter (FW156).
(81) According to a sixteenth embodiment, the recombinant avian herpes virus comprises in the insertion site between US10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter (FW157).
(82) According to a seventeenth embodiment, the recombinant avian herpes virus comprises in the insertion site between US10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW158).
(83) According to an eighteenth embodiment, the recombinant avian herpes virus comprises in the insertion site between US10 and SORF3 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter (FW159).
(84) According to a nineteenth embodiment, the recombinant avian herpes virus comprises in the insertion site between US10 and SORF3 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter (FW160).
(85) According to a twentieth embodiment, the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the mCMV IE1 promoter, and in the insertion site between US10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter (FW161).
(86) Cell Cultures
(87) The resulting recombinant viruses of the present invention may be propagated in cell cultures in which said recombinant virus can propagate and grow. After required growth of the viruses is achieved the cells may be detached from the wells using a scraper or with trypsin and the infected cells may be separated from the supernatant by centrifugation.
(88) In preferred embodiments of the invention, CEF, embryonated egg, chicken kidney cells, and the like may be used as the host cells for the propagation of recombinant herpes viruses. Multivalent recombinant viruses of the present invention may be cultured in a culture medium such as Eagle's MEM, Leibowitz-L-15/McCoy 5A (1:1 mixture) culture medium at about 37 C. for 3 to 4 days. The infected cells thus obtained are suspended in a culture medium containing 10% dimethyl sulfoxide (DMSO) and stored frozen under liquid nitrogen.
(89) Advantageously, the recombinant multivalent herpes viruses of the invention present a high level of stability through passages, which corresponds to a coexpression of the recombinant nucleotide sequences in cells of avian species even after 10 or more passages. In the context of the invention a passage or cell passaging means a culture of cells in suitable conditions for allowing their growth and keeping them alive until they are 90% to 100% confluent. The passaging step consists of transferring a small number of cells of the previous confluent culture into a new culture medium. An aliquot of the previous confluent culture, containing a few cells, may be diluted in a large volume of fresh medium. In case of adherent cultures, cells may first be detached, for example by using a mixture of trypsin and EDTA, or any suitable enzyme, before using a few number of detached cells for seeding a new culture medium.
(90) According to preferred embodiments of the invention, CEF cells transfected with recombinant avian herpes viruses of the invention still coexpress the corresponding antigenic peptides after at least 10 passages. In other words, CEF cells resulting from 10 or more passages of CEF cells transfected with recombinant avian herpes viruses of the invention, and more particularly resulting from 15 passages, still contain the foreign nucleotide sequences of the recombinant avian herpes virus used for the initial cell transfection and express the at least two corresponding antigenic peptides. In the context of the invention, one considers that cells of a said passage still express the antigenic peptides if the level of production is greater than 80% of the level of production of the first passage, and preferentially greater than 85%.
(91) Multivalent Vaccine Compositions
(92) The invention also relates to a multivalent vaccine for immunizing avian species, such as poultry, which comprises an effective immunizing amount of a multivalent recombinant avian herpes virus of the invention.
(93) Preferentially, vaccines of the invention are able to cause or stimulate or amplify immunity against at least two pathogens chosen among avian paramyxovirus type 1, Gumboro disease virus, the infectious laryngotracheitis virus, Mycoplasma galisepticum, and the avian influenza virus.
(94) Vaccines of the invention comprise an immunologically effective amount of a multivalent recombinant herpes virus as described above, in a pharmaceutically acceptable vehicle.
(95) A multivalent recombinant herpes virus according to the invention may preferably be used as a live vaccine although other alternatives like inactivated vaccines or attenuated vaccines are well within the skill of a person skilled in the art.
(96) The vaccine according to the present invention may further comprise a suitable solvent, such as an aqueous buffer or a phosphate buffer. Preferably, the vaccine also comprises additives. Additives of the present invention may be obtained from any of a number of sources including various proteins and peptides derived from animals (e.g., hormones, cytokines, co-stimulatory factors), novel nucleic acids derived from viruses and other sources (e.g., double-stranded RNA, CpG), and the like, which are administered with the vaccine in an amount sufficient to enhance the immune response. In addition, any number of combinations of the aforementioned substances may provide an immunopotentiation effect, and therefore can form an immunopotentiator of the present invention.
(97) The vaccines of the present invention may further be formulated with one or more further additives to maintain isotonicity, physiological pH and stability, for example, a buffer such as physiological saline (0.85%), phosphate-buffered saline (PBS), a citrate buffer, Tris(hydroxymethyl aminomethane (TRIS), Tris-buffered saline and the like, or an antibiotic, for example, neomycin or streptomycin, etc.
(98) The route of administration can be any route including oral, ocular (e.g., by eyedrop), oculo-nasal administration using aerosol, intranasal, cloacal in feed, in water, or by spray, in ovo, topically, or by injection (e.g., intravenous, subcutaneous, intramuscular, intraorbital, intraocular, intradermal, and/or intraperitoneal) vaccination. The skilled person will easily adapt the formulation of the vaccine composition for each type of route of administration.
(99) Each vaccine may contain a suitable dose sufficient to elicit a protective immune response in avian species. Optimization of such dose is well known in the art. The amount of antigen per dose may be determined by known methods using antigen/antibody reactions, for example by the ELISA method.
(100) The vaccines of the invention can be administered as single doses or in repeated doses, depending on the vaccination protocol.
(101) The vaccines of the present invention are further advantageous in that they confer to bird species up to 80% protection against the targeted avian pathogens after 3 weeks of vaccination.
(102) The present invention further relates to the use of the vaccine as described above for immunizing avian species, such as poultry, and to a method of immunizing avian species by administering an immunologically effective amount of the vaccine according to the invention. The vaccine may be advantageously administered intradermally, subcutaneously, intramuscularly, orally, in ovo, by mucosal administration or via oculo-nasal administration.
(103) The present invention further relates to vaccination kits for immunizing avian species which comprise an effective amount of the multivalent vaccine as described above and a means for administering said components to said species. For example, such a kit comprises an injection device filled with the multivalent vaccine according to the invention and instructions for intradermic, subcutaneous, intramuscular, or in ovo injection. Alternatively, the kit comprises a spray/aerosol or eyedrop device filled with the multivalent vaccine according to the invention and instructions for oculo-nasal, oral or mucosal administration.
(104) The present invention will now be explained in more detail with reference to the following experiments and examples, but it must not be construed that the present invention is limited by these experiments and examples.
EXPERIMENTS
(105) In the experiments, several recombinant herpes viruses (monovalent or multivalent according to the invention) have been used, designated as follows (HVT/first insertion site-first foreign gene/second insertion site-second foreign gene): FW122: HVT/45-46 Hcmv VP2 Bac F FW123: HVT/44-45 Bac VP2 FW125: HVT/45-46 Bac F/44-45 Hcmv VP2 FW129: HVT/45-46 PecF/44-45 Rsv VP2 FW130: HVT/45-46 PecF/44-45 SV40 VP2 FW135: HVT/45-46 sv40 F/44-45 Bac VP2 FW137: HVT/45-46 Pec F sv40 VP2 FW141: HVT/45-46 PecF/44-45 mCMV IE1 VP2 FW142: HVT/45-46 Bac VP2/44-45 mCMV IE1 F FW144: HVT/45-46 Pec F/87-88 mCMV IE1 VP2 FW145: HVT/45-46 Bac VP2/87-88 mCMV IE1 F FW023: HVT/45-46 Bac VP2 FW029: HVT/45-46 Pec F
Experiment 1: Construction of Homology Vectors
(106) The plasmid construction was essentially performed by the standard molecular biology techniques (Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 2001). DNA restriction fragments were electrophoresed on agarose gels and purified with the Plasmid Plus Midi Kit (QIAGEN, Cat #12945).
(107) Construction of p44/45d46Sfi
(108) Based on the information of the gC homologue (gCh) gene of MDV serotype 1 (Coussens et al., J. Virol. 62:2373-2379, 1988) and its adjacent BamHI-B fragment (Japanese Unexamined Patent Publication No. H6-292583), a DNA fragment having an SfiI site between two ORFs, UL44h and UL45h, was prepared by PCR and cloned into pUC18. First, HVT DNA was prepared from CEF cells infected with the HVT FC126 strain according to the method of Lee et al. (J. Gen. Virol., 51:245-253, 1980). Using the obtained HVT DNA as a template, PCR was performed with two pairs of primers.
(109) The first pair was SEQ ID NO: 7 (5-CCCCGAATTCATGGAAGAAATTTCC-3) and SEQ ID NO: 8 (5-CGCGGGCCAATAAGGCCAACATCGGGACGTACATC-3).
(110) The second pair was SEQ ID NO: 9 (5-GCGCGGCCTTATTGGCCTTAAATAC CGCGTTTGGAG-3) and SEQ ID NO: 10 (5-CCCCAAGCTTTCAAGTGATACTGCG TGA-3).
(111) Using the mixture of the two obtained PCR products as a template, another PCR was conducted with SEQ ID NO: 7 and SEQ ID NO: 10 to generate a fragment having an SfiI site between two ORFs, UL44h and UL45h.
(112) The resulting fragment was then digested with EcoRI and HindIII and ligated to pUC18, which had been digested with EcoRI and HindIII. The obtained plasmid was designated p44/45Sfi.
(113) For construction of double recombinant HVT in which two genes were inserted at UL44/45 and UL45/46 respectively, the UL46 gene was deleted from p44/45Sfi. p45/46Sfi (U.S. Pat. No. 7,569,365) digested with EcoRI and SfiI was ligated with dSfil-EcoRI linker, resulting in plasmid p44/45d46. p44/45Sfi cleaved with SphI and PstI was ligated with p44/45d46 cleaved with the same enzymes, resulting in the plasmid p44/45d46Sfi.
(114) Construction of pHVT 87-88
(115) HVT DNA was prepared from CEF cells infected with the HVT FC126 strain according to the method of Lee et al. (J. Gen. Virol., 51:245-253, 1980). Using the obtained HVT DNA as a template, PCR was performed with two pairs of primers. Each primer was designed on the information of Genbank X68653.1. A DNA fragment having an SfiI site between two ORFs, US2 (HVT088) and SORF3 (HVT087), was prepared by PCR and cloned into pUC18.
(116) The first pair was SEQ ID NO: 11 (5-GGGAATTCGAAGAGCCCCCGCGGACG CATG-3) and SEQ ID NO: 12 (5-CCGCTAGCGGCCGCAAGTTCCTTCACCATGA CCAG-3).
(117) The second pair was SEQ ID NO: 13 (5-GCGGCCGCTAGCGGCCTTATTGG CCGTAGCATAAAGACGCAGG-3) and SEQ ID NO: 14 (5-CCAAGCTTCTAGTACA TATATATACATGAC-3).
(118) The first resulting fragment was digested with EcoRI and NheI. The second resulting fragment was digested with NheI and HindIII. These cleaved fragments were integrated into pUC18 cleaved with EcoRI and HindIII, resulting in the plasmid pHVT 87-88.
(119) Construction of pHVT 86-87
(120) HVT DNA was prepared from CEF cells infected with the HVT FC126 strain according to the method of Lee et al. (J. Gen. Virol., 51:245-253, 1980). Using the obtained HVT DNA as a template, PCR was performed with two pairs of primers. Each primer was designed on the information of Genbank X68653.1. A DNA fragment having an SfiI site between two ORFs, US10 (HVT086) and SORF3 (HVT087), was prepared by PCR and cloned into pUC18.
(121) The first pair was SEQ ID NO: 15 (5-GGGGGAATTCATTATCCCATCTAACAGTTATATACG-3) and SEQ ID NO: 16 (5-GCCGCTAGCGGCCGCCTTTATTAACAACCTTAC-3).
(122) The second pair was SEQ ID NO: 17 (5-GCGGCCGCTAGCGGCCTTATTGGCC GTTTATTCTATGTAAGAC-3) and SEQ ID NO: 18 (5-CCCAAGCTTAAGTTCCTTC ACCATG-3).
(123) The first resulting fragment was digested with EcoRI and NheI. The second resulting fragment was digested with NheI and HindIII. These cleaved fragments were integrated into pUC18 cleaved with EcoRI and HindIII, resulting in the plasmid pHVT 86-87.
(124) Construction of the Homology Vector
(125) Chemical Synthesized mCMV IE1 Promoter
(126) mCMV IE1 promoter (SEQ ID NO: 19) was synthesized on the information of 4191-4731 bp in Gene Bank L06816.1 reported by Koszinowski, U. H. Synthesized mCMV IE1 promoter was designed such that BgII-PstI sites were added in front of it and XbaI-NotI sites were added at the end.
(127) TABLE-US-00001 SEQIDNO:19:GGCCAATAAGGCTGCAGTACTGAGTCATTA GGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAAT AGGGGTGAATCAACAGGAAAGTCCCATTGGAGCCAAGTAC ACTGAGTCAATAGGGACTTTCCATTGGGTTTTGCCCAGTA CAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCCAT TATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGG GTTTTTCCAGCCAATTTAATTAAAACGCCATGTACTTTCC CACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGT GACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGGAA AGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAA AGGGCAGCCAAAACGTAACACCGCCCCGGTTTTCCCCTGG AAATTCCATATTGGCACGCATTCTATTGGCTGAGCTGCGT TCTACGTGGGTATAAGAGGCGCGACCAGCGTCGGTACCGT CGCAGTCTTCGGTCTGACCACCGTAGAACGCAGAGCTCCT CGCTGCAGGCGGCCGCTCTAGA.
Construction of p44/45 mCMV IE1 VP2 SPA
(128) SfiI-cleaved p44-45d46Sfi was dephosphorylated by using Alkaline Phosphatase Shewanella sp. S1B1 Recombinant (PAP) (Funakoshi #DE110). The fragment was ligated with BgII-cleaved p45/46BacVP2, resulting in the plasmid p44/45d46 BacVP2. The synthesized mCMV IE1 promoter (BgII/XbaI) was ligated with p44/45d46 BacVP2 cleaved with EcoRV and XbaI, and p44/45d46 Bac VP2 cleaved with EcoRV and BgII, resulting in p44/45d46 mCMV IE1 VP2. The synthetized short polyA signal (SPA: SEQ ID NO: 20 CTGCAGGCGGCCGCTCTAGAGTCGACAATAAAAGATCTTTATTTTCATTAGATC TGTGTGTTGGTTTTTTGTGTGGCCAATAAGGCC) was integrated into p44/45d46 mCMV IE1 VP2 cleaved with SalI and SfiI, resulting in the homology plasmid p44/45d46 mCMV IE1 VP2 SPA.
Experiment 2: Purifying Recombinant HVT in CEF Transfected With Each Transfer Vector
(129) Viral DNA of the HVT wild type, FC126 strain (wt-HVT) was prepared as described by Morgan et al. (Avian Diseases, 34:345-351, 1990). Viral DNAs of FW029 (rHVT/45-46PecF) and FW023 (rHVT/45-46BacVP2) were prepared in the similar method. The first double rHVT pattern was that the CEF cells were transfected with the prepared wt-HVT DNA and p45/46sv40VP2 PecF (ex. FW137). The second pattern was that the CEF cells were transfected with the prepared FW029 DNA and p44/45 mCMV IE1 VP2 (ex. FW141). The third pattern was that the CEF cells were transfected with the prepared FW023 DNA and p44/45 mCMV IE1 F (ex. FW142). The fourth pattern was that the CEF cells were transfected with the prepared FW029 DNA and pHVT87-88Bac VP (ex. FW144). The fifth pattern was that the CEF cells were transfected with the prepared FW023 and pHVT87-88Pec F (ex. FW145). These resulting recombinant viruses were plaque purified by staining plaques with the anti-NDV-F antibody and anti-IBDV-VP2 antibody.
(130) Briefly, 10.sup.7 primary CEF cells were suspended in 100 l of MEF-1 (LonzaLNJVD-1004) and co-transfected with 1 g of the homology vector, for example, p44/45 mCMV IE1 F and pHVT Bac VP2, and 2 g of HVT DNA, for example, FC126, FW029 and FW023, by electroporation. Electroporation was performed on Nucleofector II. Transfected cells were diluted in 20 ml of Leibovitz's L-15 (Gibco BRL, Cat. #41300-39), McCoy's 5A Medium (Gibco BRL, Cat. #21500-061) (1:1) and 4% calf serum (solution LM (+) medium), spread at 100 ul per well in a 96-well plate.
(131) Incubate at 37 C. in 5% CO.sub.2 until the plaques became visible, the cells were detached from plates by trypsinization, diluted in freshly prepared secondary CEF cells, transferred equally to two 96-well plates and incubated for 3 days to visualize the plaques. One of two plates was then stained with anti-VP2 monoclonal antibody R63 (ATCC #: HB-9490) as the primary antibody. After detecting the well containing the stained recombinant plaques, cells from the corresponding well of the other plate were recovered, diluted in fresh secondary CEF cells and transferred equally to two 96-well plates to complete the first round of purification. The purification procedure was repeated until every obtained plaque was stained positively by monoclonal antibody R63. After that, the double rHVT candidate was stained by the anti-NDV-F antibody 3-1G/5 (Morrison, T. G., Proc. Natl. Acad. Sci. U.S.A. 84:1020-1024, 1987) or anti-F rabbit serum. Finally, expression of proteins of every plaque of the candidate rHVT was confirmed by dual IFA staining. CEF cells infected by each rHVT were fixed with cold acetone-methanol (2:1), washed with PBS, reacted with antibody mixture (1:1000 diluted anti-F rabbit serum #35 and anti-VP2 mouse Mab R63) at 37 C. for 60 minutes. After washing 3 times with PBS, the cells reacted with fluorescent antibody mixture (1:1000 diluted Alexa Fluor 488 anti-rabbit and Alexa Fluor 546 anti-mouse provided by Invitrogen) at 37 C. for 60 minutes. After washing 3 times with PBS, they were observed by fluorescence microscope at magnification by 400 times.
(132) Protein VP2 expression was detected by anti-VP2 Mab (R63) and Alexa Fluor 546. Protein F expression was detected by anti-F #35 rabbit serum and Alexa Fluor 488. When all plaques expressed both F and VP2, we concluded purification was completed.
(133) The purified recombinant HVT was designated rHVT/ND/IBD.
(134) Table 1 below shows the expression of the VP2 and protein F obtained from the different rHVT/ND/IBD. Strain FW023 (HVT/45-46 Bac VP2) corresponds to a monovalent recombinant herpes virus used as control for VP2 expression, and FW029 (HVT/45-46 PecF) corresponds to a monovalent recombinant herpes virus used as control for protein F expression.
(135) TABLE-US-00002 TABLE 1 Expression of the inserted NDV-F and IBDV-VP2 genes by rHVT/ND/IBD (Detection of fluorescence) Primary antibody anti-F anti-VP2 monoclonal Virus antiserum antibody (R63) rabbit PBS FW137 +w +w FW129 + + FW130 + + FW141 + + FW142 + + FW144 + + FW145 + + FW029 + FW023 + FC126 None +: detected, +w; weakly detected, : not detected
Experiment 3: Co-expression of Two Proteins in CEF Infected with Double Recombinant HVTs
(136) 2 ml containing 210.sup.5 CEF cells was infected with recombinant HVTs, and incubated at 37 C. in 5% CO.sub.2 for 3 days.
(137) Then the culture was centrifuged at 300 g for 3 minutes, and the precipitated cells were resuspended in 100 ul. Laemmli buffer (100 ul) was added to the cell suspension. The resultant mixture was then boiled for 5 min and 5 ul of them was subjected to 10% SDS-polyacrylamide gel electrophoresis. The electrophoresed proteins were transferred from SDS-GEL to a PVDF membrane (Immobilon-P, Millipore), which was blocked in 1% w/v non-fat milk powder in PBS at room temperature for one hour.
(138) For F detection (
(139) For VP2 detection (
(140) After washing three times with PBS, the membrane was incubated for one hour with an avidin-alkaline phosphatase complex, washed three times with PBS and one time with TBS (Tris-buffered saline), and reacted with BCIP-NBT (a substrate of alkaline phosphatase). As shown in ). There was no band in the lane of rHVT/44-45BacVP2 (FW123).
(141) ). On the contrary, there was no band in the lane of rHVT/PecF (FW029) (
(142) Double recombinant HVTs according to the invention expressed both NDV-F and IBDV VP2.
Experiment 4: Verification of the Genomic Structure
(143) Southern Blotting Analysis
(144) The purified rHVT/ND/IBD was propagated on CEF cells of one 25-cm.sup.2 flask to obtain the confluent plaques. Cells were recovered from dishes by scraping, transferred to Falcon tubes and subjected to centrifugation at 300 xg for 5 min. Harvested cells were washed with PBS, resuspended in 0.6 ml of PBS and 0.4 ml of lysis buffer (1.25% TritonX-100, 250 mM 2-ME, and 50 mM EDTA in PBS), and lysed by vortexing for 3 min. The lysates were then centrifuged at 600 xg for 5 min at room temperature and the supernatants were transferred to 15 ml Falcon tubes. The viruses were collected by centrifugation at 20,400 xg for 20 min. The resultant pellets were then suspended in 0.33 ml of a nuclease solution (12.5 mM Tris-Cl (pH7.5), 1 g/ml DNase I and 1 g/ml RNase A), incubated at 37 C. for 30 min, and disrupted by incubating at 55 C. for 30 min with 83 l of SDS-protease solution (50 mM EDTA, 5% SDS, 0.5 mg/ml protease K, and 28.5 mM 2-mercaptoethanol). The obtained mixture was treated twice with phenol-chloroform, and NaCl was added to the aqueous phase to the final concentration of 0.2 M. The viral DNA was precipitated by adding 2.5 volumes of ice-cold ethanol, washed with 70% ethanol and subjected to centrifugation at 20,400g for 20 min at 4 C. After air-drying, the pellets were dissolved in TE buffer (10 mM Tris-Cl (pH8.0), 1 mM EDTA).
(145) The viral DNA in TE buffer was digested with XhoI, SphI and SmaI, and subjected to 0.8% agarose gel electrophoresis. The electrophoresed DNA fragments on the single gel were transferred simultaneously to two nylon membranes (Molecular Cloning: A Laboratory Manual, third edition, 6.35, Sambrook, J., and Russell, D. W., Cold Spring Harbor Laboratory). After fixing DNA by baking, the immobilized DNA was hybridized with a DIG-labeled probe, VP2 probe or IS44/45 probe, which was prepared with the PCR DIG Probe Synthesis Kit (Roche Diagnostics, Cat. #1636090). In addition, the viral DNA in TE buffer was digested with XhoI and SphI, and hybridized with a DIG-labeled probe, F probe or IS45/46 probe, by the same procedure mentioned above. The VP2 probe was prepared with VP2 STC-F (SEQ ID NO: 21) and VP2 STC-R (SEQ ID NO: 22) as primers and p45/46bacVP2-STC as a template. The F probe was prepared with F-F (SEQ ID NO: 23) and F-R (SEQ ID NO: 24) as primers and p45/46PecF as a template. The IS45/46 probe was prepared with 45/46-F (SEQ ID NO: 25) and 45/46-R (SEQ ID NO: 26) as primers and pNZ45/46Sfi as a template. The IS44/45 probe was prepared with 44/45-F (SEQ ID NO: 27) and 44/45-R (SEQ ID NO: 28) as primers and pNZ44/45d46Sfi as a template.
(146) TABLE-US-00003 VP2STC-F (SEQIDNO:21) 5'-CACCGTCCTCAGCTTACCCACATC-3' VP2STC-R (SEQIDNO:22) 5'-ACGACGGATCCTGTTGCCACTCT-3' NDV-F-F (SEQIDNO:23) 5'-CTAGCAGTGGCAGTTGGGAAGAT-3' NDV-F-R (SEQIDNO:24) 5'-GTTAAGGCAGGGGAAGTGATTTGT-3' 45/46-F (SEQIDNO:25) 5'-GGGGAAGTCTTCCGGTTAAGGGAC-3' 45/46-R (SEQIDNO:26) 5'-GGTGCAATTCGTAAGACCGATGGG-3' 44/45-F (SEQIDNO:27) 5'-GTACTATAGAATGTGTTCC-3' 44/45-R (SEQIDNO:28) 5'-GTATCCAACGCCTCAAGATC-3'
(147) The results of Southern blotting showed (
(148) In addition a 2744-bp fragment was hybridized to the F probe in the DNA from each double recombinant HVT. No band was detected in the p45/46 SfiI.
(149) 2077-bp and 1228-bp fragments to IS44/45 probe in the DNA from FW129. 1350-bp fragment to IS44/45 probe in p45/46 PecF, which was inserted no gene at the IS44/45 site.
(150) 2744-bp and 770-bp fragments to IS45/46 probe in the DNA from each double recombinant HVT.
Experiment 5: Stability of the Recombinant HVTs in Passage
(151) Western Blotting Analysis
(152) Double recombinant HVTs were passaged serially (up to 15 times) on chicken embryo fibroblasts (CEF). Then cell lysates were applied to Western blot analysis. In a first panel (
(153) After 15 passages, F and VP2 were expressed stably in CEF infected with double recombinant HVT. However, FW137 expressed no signal of F and VP2 antigens after 15 passages, indicating that recombinant HVT which has two genes at a single site is unstable.
(154) Southern Blotting Analysis
(155) M: Molecular marker ramda HindIII digest TP-24: transfer plasmid p44-45d46SV40VP2 TP-25: transfer plasmid p44-45d46RsvVP2
(156) Each rHVT/ND/IBD was passaged fifteen times in CEF cells and subjected to Southern blot analysis as described in Experiment 4. The results were the same as those obtained in Experiment 4, indicating that the recombinant virus was stable even after 15 passages.
(157) The results of Southern blotting show in
(158)
(159)
(160)
(161) Southern blotting with the 44/45 probe and 45/46 probe showed the VP2 gene or F gene stably maintained at the insertion site 44/45 or 45/46 respectively in FW129 and FW130.
Experiment 6: Anti-NDV and IBDV ELISA Titer in Chickens Inoculated With Double Recombinant HVTs
(162) 3,000 PFU/200 l/bird of each rHVT/ND/IBD were inoculated subcutaneously into the backs of ten one-day-old SPF chickens (Line M, Japan Biological Laboratories) using a 20-gauge syringe. From three weeks post-vaccination onward, the serum was collected from the vaccinated birds. The anti-NDV antibody titer was measured by a commercial ELISA kit (IDEXX, ELISA kit to diagnose Newcastle Disease). The anti-IBDV antibody was titrated by a commercial ELISA kit, Flock Check Infectious Bursal Disease Antibody Test Kit (IDEXX Laboratory, Inc.). Chickens of the negative control group (non-immunized) were not administered with any vaccine.
(163)
(164) Double recombinant HVT using two sites stably induced both anti-NDV and anti-IBDV titers.
Experiment 7: Efficacy of rHVT/ND/IBD in SPF Chickens Against NDV
(165) The efficacy of rHVT/ND/IBD (FW130, FW135, FW137, and FW129) as a Newcastle disease vaccine was evaluated using the efficacy test.
(166) 3,000 PFU/200 l/bird of rHVT/ND were inoculated subcutaneously into the backs of ten one-day-old SPF chickens (Line M, Japan Biological Laboratories) using 20 Gauge syringe. From three weeks post-vaccination onward, the serum was collected from the vaccinated birds and the anti-NDV antibody titer was measured by a commercial ELISA kit (IDEXX, ELISA kit to diagnose Newcastle Disease).
(167) Chickens of the positive control group were vaccinated at 14 days of age with a commercial NDV live vaccine according to the vendor's recommendation. Chickens of the negative control group were not administered with any vaccine.
(168) At 43 days of age (42 days post-vaccination), chickens of all seven groups were challenged with 10.sup.3 EID.sub.50 of NDV-TexasGB, the standard challenge strain in the United States, intramuscularly to the femoral region. The challenged chickens were observed daily to check mortality and to detect any symptoms of Newcastle disease.
(169) TABLE-US-00004 TABLE 2 Challenge experiments of rHVT/ND/IBD-vaccinated SPF chickens with virulent NDV Dose No. of HI ELISA (PFU/ No. of symptom/ (ELISA) tite at Vaccination chicken) chickens total (%) titer at hatch challenge FW130 3000 10 0/10 (0) 0 0.649 FW135 3600 10 2/10(20) 0.085 FW137 3600 10 3/10(30) 0.050 FW129 3000 10 0/10(0) 0.233 FW029 4000 10 0/10(0) 0.544 Commercial On label 10 0/10 (0) 1.089 NDV Live vaccine Challenge N/A 10 11/12 (92) 0.089 Controls Non-challenge N/A 10 0/5 (0) N/A Controls
(170) As shown in Table 2, chickens vaccinated with rHVT/ND/IBD of the invention did not show any clinical signs and the ELISA titer at the day of challenge was significantly elevated. As expected, both chickens vaccinated with FW137 (wherein two recombinant nucleotide sequences are inserted into the same insertion site) or FW135 (wherein the Bac promoter is inserted between UL44 and UL45) show clinical signs, and the ELISA titer was weak.
Experiment 8: Efficacy of rHVT/ND/IBD in SPF Chickens Against IBDV
(171) The efficacy of FW129 and FW141 (HVT/45-46 PecF/44-45 mCMV IE1 VP2) as an IBD vaccine was evaluated by challenge IBDV STC.
(172) First, 2,000 pfu of rHVT/ND/IBD were inoculated into SPF embryonating chicken eggs at day 18 or subcutaneously into the backs of one-day-old SPF chickens. At three weeks old, vaccinated chickens were challenged orally with 10.sup.3.5 EID.sub.50/bird of IBDV STC. One week later, all chickens were weighed and necropsied to recover the bursae of Fabricius, which were observed for any lesions caused by Infectious Bursal Disease.
(173) The protection was evaluated by two criteria which are as follows. (1) The weight ratio of the bursa to the body (B/B index) was not statistically different from that of non-vaccinated, non-challenged chickens. (2) No malformation of the bursa of Fabricius such as edematization, hemorrhage, yellowish exudate, discoloration, atrophy, or gelatinous exudate was detected. The results were summarized in Table 3.
(174) TABLE-US-00005 TABLE 3 Challenge experiments of rHVT/ND/IBD-vaccinated SPF chickens with virulent IBDV Vaccination # Protected/total Vaccine Route (%) FW129 SQ 7/8 (88%) FW141 SQ 8/8 (100%) FW023 SQ 8/8 (100%) FW129 In ovo 8/10 (80%) FW141 In ovo 9/10 (90%) FW023 In ovo 9/10 (90%) None N/A 0/4 (0%) None N/A 5/5 (100%)
(175) More than 80% of all vaccinated chickens were protected against the challenge with IBDV STC strain, indicating that rHVT/ND/IBD can induce protective immunity in chickens against virulent IBDV.
Experiment 9: IBDV Challenge Trial at 8 Weeks in MDA+ Chickens
(176) Groups:
(177) G1: NINC (not vaccinated, not challenged) G2: NICC (not vaccinated, challenged) G3: FW141 G4: FW144 G5: FW023 (positive control)
Chicks MDA+ birds (layers), 16 to 17 birds in each group.
(178) Three thousand pfu of vaccines were inoculated subcutaneously into the backs of 16 to 17 one-day-old MDA+ chickens. At 8 weeks old, vaccinated chickens were challenged orally with 10.sup.3 TCID.sub.50/bird of IBDV STC. One week later, all chickens were weighed and necropsied to recover the bursae of Fabricius, which were observed for any lesions caused by Infectious Bursal disease.
(179) The protection was evaluated by the two following criteria: (1) The weight ratio of the bursa to the body (B/B index); (2) No malformation of the bursa of Fabricius such as edematization, hemorrhage, yellowish exudate, discoloration, atrophy, or gelatinous exudate was detected. The results are summarized in the following table.
(180) TABLE-US-00006 % n B/B Index dead lesion protection NINC 10 1.00 0 0/16 NICC 16 0.44 1 16/16 0 FW141 16 0.94 0 2/16 88 FW144 10 0.93 1 5/16 69 FW023 17 0.98 0 3/17 82
(181) These results show that the multivalent vaccine of the invention causes effective protection in vivo against IBDV.
Experiment 10: NDV Challenge Trial at 8 Weeks in MDA+ Chickens
(182) Group
(183) G1: challenge control G2: FW141 G3: FW144 G4: FW145 G5: FW 029 (positive control)
Chicks MDA+ birds (layers), 17 birds in each group.
(184) Three thousand PFU of vaccines were inoculated subcutaneously into the backs of 17 one-day-old MDA+ chickens. At 8 weeks old, vaccinated chickens were challenged with 10.sup.3 EID.sub.50 of NDV-TexasGB, the standard challenge strain in the United States, intra-muscularly to the femoral region. The challenged chickens were observed daily to check mortality and to detect any symptoms of Newcastle disease. The results are presented below.
(185) TABLE-US-00007 Immunized Challenged Dead Symptom* % protection Challenge 17 13 13 0 0.0 control FW141 17 15 1 0 93.3 FW144 17 15 3 1 73.3 FW145 17 13 0 0 100.0 FW029 17 16 3 0 81.3 *some NDV symptoms without death
(186) These results show that the multivalent vaccine of the invention causes effective protection in vivo against NDV and IBDV. The protection is strong and stable.