PIV5-BASED COVID-19 VACCINE

20250319176 ยท 2025-10-16

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides constructs of the parainfluenza virus type-5 (PIV5) virus expressing the SARS-CoV-2 envelope spike (S) protein for use as safe, stable, efficacious, and cost-effective vaccines against COVID-19.

    Claims

    1. A viral expression vector comprising a parainfluenza virus 5 (PIV5) genome comprising a heterologous nucleotide sequence expressing a heterologous polypeptide, wherein the heterologous polypeptide comprises a coronavirus spike (S) protein.

    2. The viral expression vector of claim 1, wherein the coronavirus S protein comprises the coronavirus S protein of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

    3. The viral expression vector of claim 1, wherein the cytoplasmic tail of the coronavirus S protein has been replaced with the cytoplasmic tail of the fusion (F) protein of PIV5.

    4. The viral expression vector of claim 1, wherein the coronavirus S protein comprises the coronavirus S protein of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and wherein the cytoplasmic tail of the coronavirus S protein has been replaced with the cytoplasmic tail of the fusion (F) protein of PIV5.

    5. The viral expression vector of claim 1, wherein the heterologous polypeptide comprises a coronavirus spike (S) protein that contains mutations at amino acid residue W886 and/or F888.

    6. The viral expression vector of claim 5, wherein the amino acid substitution at amino acid residue W886 comprises a substitution of tryptophan (W) to arginine (R) and/or the amino acid substitution at amino acid residue W888 comprises a substitution of phenylalanine (F) to arginine (R).

    7. The viral expression vector of claim 1, wherein the heterologous nucleotide sequence is inserted between the small hydrophobic protein (SH) gene and the hemagglutinin-neuraminidase (HN) gene of the PIV5 genome.

    8. The viral expression vector of claim 1, wherein the heterologous nucleotide sequence replaces the SH gene nucleotide sequence.

    9. The viral expression vector of claim 1, wherein the heterologous nucleotide sequence is inserted between the hemagglutinin-neuraminidase (HN) gene and the large RNA polymerase protein (L) gene of the PIV5 genome.

    10. The viral expression vector of claim 1, wherein the heterologous nucleotide sequence is inserted closer to the leader than between the hemagglutinin-neuraminidase (HN) gene and the large RNA polymerase protein (L) gene of the PIV5 genome; is inserted upstream of the nucleocapsid protein (NP) gene of the PIV5 genome; is inserted immediately downstream of the leader sequence of the PIV5 genome; is inserted between the fusion (F) protein gene and the SH gene of the PIV5 genome; is inserted between the VP gene and the matrix protein (M) gene of the PIV5 genome; is inserted between the M gene and the F gene of the PIV5 genome; is inserted between the nucleocapsid protein (NP) gene and the V/P gene of the PIV5 genome; is inserted between the leader sequence and the nucleocapsid protein (NP) gene of the PIV5 genome; is inserted wherein a portion of the F or HN gene of PIV5 has been replaced with the heterologous nucleotide sequence; is inserted within the SH gene nucleotide sequence, is inserted within the NP gene nucleotide sequence, is inserted within the V/P gene nucleotide sequence, is inserted within the M gene nucleotide sequence, is inserted within the F gene nucleotide sequence, is inserted within the HN gene nucleotide sequence, and/or is inserted within the L gene nucleotide sequence.

    11. The viral expression vector of claim 1, wherein the PIV5 genome further comprises one or more mutations.

    12. The viral expression vector of claim 11, wherein the one or more mutations comprise a mutation of the V/P gene, a mutation of the shared N-terminus of the V and P proteins, a mutation of residues 26, 32, 33, 50, 102, and/or 157 of the shared N-terminus of the V and P proteins, a mutation lacking the C-terminus of the V protein, a mutation lacking the small hydrophobic (SH) protein, a mutation of the fusion (F) protein, a mutation of the phosphoprotein (P), a mutation of the large RNA polymerase (L) protein, a mutation incorporating residues from canine parainfluenza virus, a mutation inducing apoptosis, or a combination thereof.

    13. The viral expression vector of claim 11, wherein the one or more mutations comprise PIV5 VAC, PIV5SH, PIV5-P-S308G, or a combination thereof.

    14. A viral particle comprising the viral expression vector of claim 1.

    15. A composition comprising the viral expression vector of claim 1.

    16. A method of expressing a heterologous coronavirus spike (S) glycoprotein in a cell, the method comprising contacting the cell with the viral expression vector of claim 1.

    17. A method of inducing an immune response in a subject to a coronavirus spike (S) glycoprotein, the method comprising administering the viral expression vector of claim 1 to the subject.

    18. The method of claim 17 wherein the immune response comprises a humoral immune response and/or a cellular immune response.

    19. A method of vaccinating a subject against coronavirus disease 2019 (COVID-19), the method comprising administering the viral expression vector of claim 1 to the subject.

    20. The method of claim 17, wherein the viral expression vector, viral particle, or composition is administered intranasally, intramuscularly, topically, or orally.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0020] FIG. 1 shows the plasmid cloning outline for pDA27.

    [0021] FIG. 2 shows the construct of CVX-UGA1 generated from pDA27.

    [0022] FIG. 3 shows the plasmid map showing sequencing fragments.

    [0023] FIG. 4 shows the process for constructing the CVX-UGA1 vaccine using the pAB76 plasmid.

    [0024] FIG. 5 shows an outline scheme for virus rescue and plaque purification.

    [0025] FIG. 6 shows the immunofluorescence assay images of MDBK cells infected with CVX-UGA1 and stained for SARS-CoV-2 S with SARS-CoV-2 Spike S1 monoclonal antibody.

    [0026] FIG. 7 shows the map of the pDA16 plasmid.

    [0027] FIG. 8 shows the map of the nCOV19-S-human-Genscript plasmid.

    [0028] FIG. 9 shows the map and sequence of the pDA27 (CVX-UGA1) plasmid (SEQ ID NO:1).

    [0029] FIG. 10 shows the map of the pCAGGS-NP plasmid.

    [0030] FIG. 11 shows the map of the pCAGGS-P plasmid.

    [0031] FIG. 12 shows the map of the pCAGGS-L plasmid.

    [0032] FIG. 13 shows the map of the pBH437-pCAGGS-T7 plasmid.

    [0033] FIG. 14 shows the map of the pBH276 plasmid.

    [0034] FIG. 15 shows the map of the pBH161 plasmid.

    [0035] FIG. 16 shows the map of the pCH10 plasmid.

    [0036] FIG. 17 shows the map of the pAB76 Plasmid.

    [0037] FIG. 18A-FIG. 18F show the generation of CVXGA1 and analysis of CVXGA1 in tissue culture cells and mice. FIG. 18A shows schematics of CVXGA1. PIV5 has seven genes and encodes 8 proteins, NP, V, P, M, F, SH, HN and L. Leader and trailer sequences are important for viral RNA synthesis. S of SARS-CoV-2 contains signal peptide (SP), receptor binding domain (RBD), fusion peptide (FP), transmembrane domain (TM) and cytoplasmic tail (CT). CVXGA1 contains S whose CT was replaced with that of F of PIV5 and which was inserted between SH and HN of PIV5. FIG. 18B shows detection of S expression. To detect SARS-CoV-2-S expression, immunofluorescence assays were performed. MDBK cells were mock infected or infected at 1 multiplicity of infection (MOI) with PIV5 or CVXGA1. Two days post-infection, the cells were fixed, permeabilized, and stained with antibodies specific for PIV5-V/P (anti-vector) and SARS-CoV-2 S. To detect expression using immunoblotting, Vero cells were infected with PIV5, CVXGA1 at 1 MOI and lysed at 24 hours post infection (hpi). The lysates were resolved on an SDS-PAGE gel and immunoblotted with anti-SARS-CoV-2 S and anti-PIV5-V/P. FIG. 18C shows syncytial formation by CVXGA1. Vero cells were infected with PIV5 or CVXGA1 at an MOI of 0.1. At 48 hpi, the cells were photographed. FIG. 18D show anti-S titers in BALB/c mice immunized with CVXGA1. BALB/c mice (n=5 per group) were immunized via intranasal (IN) route with CVXGA1 at a dose of 10.sup.4, 10.sup.5 and 10.sup.6 plaque forming unit (PFU). At 28 days after immunization (dpi), mice were bled and anti-S titers were measured using ELISA. FIG. 18E shows anti-receptor binding domain (RBD) titers in BALB/c mice immunized with CVXGA1. Titers of RBD of samples in FIG. 18D were determined using ELISA. FIG. 18F shows neutralization titers in BALB/c mice immunized with CVXGA1. Neutralization titers of samples in FIG. 18D were determined as described in Materials and Methods of Example 2.

    [0038] FIG. 19A-FIG. 19D show intranasal vaccination with CVXGA1 reduces clinical and pathological disease in Ad-hACE2 sensitized BALB/c mice following SARS-CoV-2 infection. FIG. 19A shows schematic of experimental protocol for CVXGA1 vaccine study in BALB/c mice. Treatment groups (Gp) include: Gp 1: DMEM immunization via intramuscular (IM) route; Gp 2: CVXGA1 immunization via intranasal (IN) route; Gp 3: UV inactivated SARS-CoV-2 administered via IM route with Alum adjuvant. All animals were then sensitized to SARS-CoV-2 infection with Ad-hACE2, and 5 days later were inoculated with 110.sup.5 PFU of SARS-CoV-2. Other measurements and the number of animals per group are indicated. Days post immunization denoted by dpi. FIG. 19B shows outcomes in mouse model of SARS-CoV-2 infection. Ad5-hACE2 transduced BALB/c mice were intranasally infected with 110.sup.5 PFU of SARS-CoV-2 in 50 l of DMEM. Weight changes in 6- to 8-week-old mice were monitored daily (DMEM: n=6, CVXGA1: n=14, UV-inactivated SARS-CoV-2: n=6 mice per group). Mice immunized with CVXGA1 showed significantly less weight loss. *P value <0.05; **P value <0.005; Mann-Whitney test. FIG. 19C shows CVXGA1 vaccine reduces lung disease severity. Results of histopathological scoring for lung disease. Mononuclear cell infiltrates were present in all groups, while granulocytic infiltration increased in mice immunized IM with UV inactivated SARS-CoV-2 followed by a second boost dose. n=4. FIG. 19D shows CVXGA1 vaccine reduces lung disease. Five days post SARS-CoV-2 infection, lungs were harvested, fixed in zinc formalin, and embedded in paraffin. Representative H&E staining of lungs are presented. Eosinophilic infiltrates were noted in the UV inactivated SARS-CoV-2 group at day 5 post SARS-CoV-2 infection (indicated by arrows in lower panel and inset). Eosinophilic infiltrates are enumerated in graph on right. Bar=255 and 51 m, top and bottom panels, respectively.

    [0039] FIG. 20A-FIG. 20F present immunogenicity and efficacy of CVXGA1 in ferrets. FIG. 20A shows a schematic of ferret immunization and viral challenge. Groups of six ferrets were immunized CVXGA1) or mock immunized (PBS) at a dose of 10.sup.6 PFU Intranasally. Nasal washes were performed for vaccine shedding and weekly blood collections obtained following immunization. Ferrets were challenge 39 days post challenge (dpc) with 410.sup.5 PFU SARS-CoV-2 intranasally. Nasal washes and rectal swabs were performed 1, 3, 5, and 7 dpc. One-half (n=6) ferrets were humanely euthanized four days post infection. The study ended at 7 dpc.

    [0040] FIG. 20B shows anti-RBD serum IgG in ferrets after IN immunization. Serum anti-RBD IgG titers were evaluated via ELISA. Titers of 28 dpi are shown. FIG. 20C shows neutralization titers after immunization. Anti-SARS-CoV-2 neutralization titers at 28 dpi were determined using a VSV-CoV-SARS2-S pseudo-particle. The +RHS (positive recovered human serum) was used as a positive control, and media alone was used as a negative control. FIG. 20D shows viral RNA in nasal washes after challenge. Amount of viral RNAs in nasal washes at 1, 3, 5 and 7 dpc were determined using qRT-PCR as described in Materials and Methods. FIG. 20E shows viral RNA in lung after challenge. Amount of viral RNAs in lungs at 4 dpc and 7 dpc were determined using qRT-PCR. FIG. 20F shows viral RNA in trachea after challenge. Amount of viral RNAs in trachea at 4 dpc and 7 dpc were determined using qRT-PCR.

    [0041] FIG. 21A-FIG. 21E present immunogenicity and efficacy of CVXGA1 in cats. FIG. 21A is a schematic of immunization and challenge. Cats in a group of 4 were immunized with PBS, CVXGA1 at a dose of 10.sup.6 PFU via IN or subcutaneous (subQ) route. For the subQ group, the cats were boosted with the same dose at 21 dpi. At 42 days after initial immunization, the cats were challenged with 410.sup.5 PFU of SARS-CoV-2 via IN route. Nasal washes and rectal swaps were collected every other day until termination of the experiment at 14 dpc. FIG. 21B shows anti-S titer in cats after immunization. Titers of anti-S serum IgG were determined by ELISA. Titers of sera at 28 dpi are shown. FIG. 21C shows anti-RBD titer in cats after immunization. Titers of anti-RBD in sera were determined using ELISA. Titers of sera at 28 dpi were shown. FIG. 21D shows anti-S IgA titer in nasal washes after immunization. Titers of anti-S IgA in nasal washes were determined using ELISA. Titers at 28 dpi were shown. FIG. 21E shows virus titers in nasal washes after challenge. SARS-CoV-2 infectious particles recovered in feline nasal washes quantified as focus forming units (FFU) and presented as to log.sub.10 FFU/mL after viral challenge.

    [0042] FIG. 22A-FIG. 22C present immunogenicity of CVCGA1 in C57B16 mice. FIG. 22A is a schematic of immunization. C57B16 mice (n=5 per group) were immunized intranasal (IN) route with PBS, PIV5 at a dose 10.sup.6 plaque forming unit (PFU) or of CVXGA1 at a dose of 610.sup.3 PFU. At 28 days after immunization, mice were sacrificed. Terminal bleed and splenocytes were collected. FIG. 22B shows anti-S titers in mice. Anti-S titers were measured using ELISA. FIG. 22C shows cellular immune response. Cellular immune response was determined using Elispot. Splenocytes were stimulated with SARS-CoV-2 S protein peptide library. Results were presented as the number of IFN-7 secreting cells per 106 splenocytes. Error bars are standard error of the mean. * (P<0.05) significance between PIV5 and vaccine group.

    [0043] FIG. 23A-FIG. 23C present protection of Ad-hACE2 sensitized mice by CVXGA1. FIG. 23A is a schematic of experimental protocol for PIV5-based SARS-CoV-2 vaccine study in BALB/c mice. Treatment groups included: Group (Gp) 1: DMEM immunization IN; Gp 2: CVXGA1 immunization 510.sup.3 PFU IN; Gp 3: CVXGA1 immunization 510.sup.4 PFU IN. All animals were then sensitized to SARS-CoV-2 infection with Ad-hACE2, and 5 days later were inoculated with 110.sup.5 PFU of SARS-CoV-2. Other measurements and the number of animals per group are indicated. Days post immunization denoted by dpi. FIG. 23B shows outcomes in mice immunized with CVXGA1, followed by SARS-CoV-2 infection. Ad5-hACE2 transduced BALB/c mice were infected intranasally with 110.sup.5 PFU of SARS-CoV-2 in 50 l of DMEM. Weight changes in 6 to 8 week old mice were monitored daily (n=5 mice per group). Mice immunized with 510.sup.4 PFU CVXGA1 showed less weight loss than those receiving 510.sup.3 PFU (*P value <0.05; **P value <0.005; Mann-Whitney test). FIG. 23C shows CVXGA1 intranasal immunization reduces lung tissue SARS-CoV-2 titers. To obtain virus kinetics, lungs were harvested and homogenized at 1 dpi, and virus titered by plaque assay. Titers are expressed as PFU per lung tissue (n=3 mice per group). Mice immunized with 510.sup.4 PFU CVXGA1 showed a greater reduction in lung tissue titers (*P value <0.05; **P value <0.005; Mann-Whitney test).

    [0044] FIG. 24A-FIG. 24B present immunogenicity of inactivated SARS-CoV-2 in mice. FIG. 24A shows anti-S levels in mice after prime-boost immunization with inactivated SARS-CoV-2. Anti-S levels in sera from mice immunized with inactivated SARS-CoV-2 as described in FIG. 19A were determined using ELISA. FIG. 24B shows anti-RBD levels in mice after prime-boost immunization with inactivated SARS-CoV-2. Anti-RBD levels in sera from mice immunized with inactivated SARS-CoV-2 as described in FIG. 19A were determined using ELISA. FIG. 25A-FIG. 25E presents immunogenicity and efficacy of CVXGA1 in ferrets. FIG. 25A shows anti-S IgG titer in sera after immunization. Anti-S levels in sera at 7, 28 dpi and 7 dpc were determined using ELISA and graphed. FIG. 25B shows anti-S IgA in nasal washes. IgA levels in nasal washes collected at 28 dpi were measured using ELISA. FIG. 25 shows detection of virus and viral RNA in nasal wash at 5 dpc. Titers of SARS-CoV-2 in nasal washes at 5 dpc were determined using immunofluorescence assay after plaque assay and graphed as FFU (fluorescence foci forming unit) per milliliter. qRT-PCR results for nasal washes at 5 dpc were the same as in FIG. 20D. FIG. 25D shows detection of SARS-CoV-2 antigen in lungs at 4 dpc. Sections of lungs from ferrets sampled at 4 days post challenge were fixed in formalin and processed for immunohistochemistry for SARS-CoV2 antigen N. FIG. 25E is a comparison of anti-S before and after challenge. Levels of anti-S in ferrets at 28 dpi (dashed line) and 7 dpc (solid line) were determined using ELISA.

    [0045] FIG. 26A-FIG. 26D present immunogenicity and efficacy of CVXGA1 in cats. FIG. 26A shows neutralizing antibody titers. Serum collected at 28 dpi was assayed using a VSVCoV-SARS2-S pseudo-particle. The +RHS (positive recovered human serum) was used as a positive control. FIG. 26B shows detection of viral RNA in nasal washes. Amount of viral RNAs in nasal washes at 1, 3, 5, 7, 9, 11, 13, and 14 dpc were determined using qRT-PCR. FIG. 26C is a comparison of anti-S before and after challenge. Levels of anti-S in ferrets at 41 dpi and 14 dpc were determined using ELISA. FIG. 26D is a comparison of anti-N before and after challenge. Levels of anti-N in ferrets at 41 dpi and 14 dpc were determined using ELISA.

    [0046] FIG. 27 shows the neutralization titers in BALB/c mice immunized with CVXGA1. Neutralization titers of samples were determined as described in Materials and Methods. Error bars represent the standard error of the mean, and P-values were calculated with one-way ANOVA. *P value<0.05, ***P value <0.001.

    [0047] FIG. 28A-FIG. 28C show the results of intranasal vaccination with CVXGA1 protects K18-hACE2 transgenic mice against SARS-CoV-2 infection. Mice received DMEM intranasally; CVXGA1 immunization via intranasal (106 PFU, IN) route; UV-inactivated SARS-CoV-2 (UV-SARS2) administered via IM route with Alum adjuvant followed by a boost dose at 21 dpi; Wildtype PIV5 (106 PFU) via IN route. Five weeks following immunization, K18-hACE2 mice were intranasally infected with 410.sup.4 PFU of SARS-CoV-2 in 50 l of DMEM. Error bars represent the standard error of the mean. FIG. 28A shows the weight loss and FIG. 26B shows the survival outcomes in K18-hACE2 transgenic mice. Weight changes in 6- to 8-week-old mice were monitored daily (DMEM: n=9, CVXGA1: n=8, UV inactivated SARS-CoV-2: n=10 mice per group, PIV5: n=10). CVXGA1 immunized mice lost no weight and survived. All DMEM and PIV5 treated mice succumbed. One UV inactivated SARS-CoV-2 treated mouse survived. Days post infection with SARS-CoV-2 denoted by days p.i. FIG. 28A and FIG. 28B show that the CVXGA1 vaccine reduces lung tissue titer and prevents viral spread to the brain. Five days post SARS-CoV-2 infection, lung (n=4) and brain (n=4) tissues were obtained from groups in A and B, and titrated. See Materials and Methods for details. Limit of detection (LOD): Error bars represent the standard error of the mean. **P value <0.01; One-way ANOVA with Dunnet's post test.

    [0048] FIG. 29A-FIG. 29D show the histopathologic analysis of SARS-CoV-2 infection in K18-hACE2 transgenic mice immunized with CVXGA1. FIG. 29A-FIG. 29C show the histology of fixed lung tissues, five days post SARS-CoV-2 infection. Representative images of SARS-CoV-2 infected mice that received DMEM, CVXGA1, UV-SARS2, or PIV5. FIG. 29A shows representative distribution of virus antigen (N protein, brown stain) in lung tissues from indicated groups (n=4 per group). Note the rare focal immunostaining in CVXGA1 group compared to diffuse immunostaining in other groups. Bar=220 m. FIG. 29B shows the hematoxylin and eosin-stained tissues (n=4 per group). Eosinophilic infiltrates were only noted in the UV-SARS2 group (arrows in inset, Bar=45 m). FIG. 29C shows the hematoxylin and eosin-stained tissues (n=4 per group). Interstitial lung disease was in reduced in the CVXGA1. Bar=90 m. FIG. 29D shows the histopathologic scoring of lung tissues (see Methods for details, n=4 per group). Tissues from all 4 groups were ordinally scored for eosinophilic infiltrates, perivascular infiltrates, and interstitial lung disease. Error bars represent the standard error of the mean. * P<0.05, ** P<0.01, One-way ANOVA with Dunnet's post test.

    [0049] FIG. 30A-FIG. 30C show the immunogenicity of CVXGA1 in ferrets. FIG. 30 A shows the schematic of ferret immunization and viral challenge. Groups of six ferrets were immunized CVXGA1) or mock immunized (PBS) at a dose of 10.sup.6 PFU intranasally. Ferrets were challenge 39 days post immunization (dpi) with 410.sup.5 PFU SARS-CoV-2 intranasally. Nasal washes and rectal swabs were performed at 1, 3, 5, and 7 day post challenge (dpc). One-half (n=6) ferrets were humanely euthanized four days after challenge. The study ended at 7 dpc. FIG. 30B shows the anti-RBD serum IgG in ferrets after immunization. Serum anti-RBD IgG titers were evaluated via ELISA. Titers of 28 dpi are shown. Error bars represent the standard error of the mean. FIG. 30C shows the neutralization titers after immunization. Anti-SARS-CoV-2 neutralization titers at 28 dpi were determined using a VSV-CoV-SARS2-S virus. The +RHS (positive recovered human serum) was used as a positive control, and media alone was used as a negative control. Error bars represent the standard error of the mean, and P-values were calculated with one-way ANOVA. ****P value <0.0001.

    [0050] FIG. 31A-FIG. 31C show the efficacy of CVXGA1 in ferrets. FIG. 31A shows the detection of viral RNA in 1, 3, 5, and 7 post-challenge nasal wash via qRT-PCR. Viral RNA was quantified as genome copies per ml and presented as log.sub.10 Genome/ml as described in the Materials and Methods. Each symbol represents a different animal (6 PBS and 6 CVXGA1). PBS animals are black symbols, and CVXGA1-vaccinated animals are red symbols. 1 pfu/PCR reaction (rxn) is marked to differentiate between infectious viral particles and un-infectious genomic remnants. The limit of detection (LOD) is indicated by the lowest dashed line. FIG. 31B shows the detection of viral RNA in lung tissues collected at 4, 7 dpc via qRT-PCR. Viral RNA was quantified and presented as genome copies per reaction (rxn). FIG. 31C shows the detection of viral RNA in trachea tissues collected at 4, 7 dpc via qRT-PCR. Viral RNA was quantified and presented as genome copies per reaction (rxn).

    [0051] FIG. 32A-32B show the efficacy of transmission block by CVXGA1 immunization in ferrets. FIG. 32A shows the schematic of ferret immunization, viral challenge, and transmission. Groups of six ferrets were immunized CVXGA1), empty viral vector or mock immunized (PBS) at a dose of 10.sup.6 PFU Intranasally. Ferrets were challenged at 42 dpi with 410.sup.5 PFU SARS-CoV-2 intranasally. Nasal washes were collected at 1, 3, 5, 7, 9, and 11 dpc. One-half ferrets were humanely euthanized four days after challenge. The study ended at 11 dpc. At 2 dpc, one challenged ferret was mixed with one nave ferret, nasal washes were collected from nave ferrets at 1, 3, 5, 7, and 9 days post mixing (3, 5, 7, 9, and 11 dpc respectively). FIG. 32B shows the detection of SARS-CoV 2 in 1, 3, 5, 7, 9 and 11 dpc in nasal washes. Live virus was detected using focus-forming unit assay (FFA, FFU/ml) as described in the Materials and Methods. Each symbol represents a different animal. The limit of detection (LOD) is indicated by the lowest dashed line.

    [0052] FIG. 33A-FIG. 33C show immunogenicity of CVXGA1 in C57BL/6 mice. FIG. 33A shows the schematic of immunization. C57BL/6 mice (n=5 per group) were immunized via intranasal (IN) route with PBS, PIV5 at a dose 10.sup.6 plaque forming unit (PFU), or CVXGA1 at a dose of 610.sup.3 PFU. At 28 days post immunization, mice were sacrificed. Terminal bleed and splenocytes were collected. FIG. 33B shows the anti-S antibody titers in mice. Anti-S titers were measured using ELISA. Error bars indicate standard error of the mean. FIG. 33C shows the cellular immune response. Cellular immune response was determined using Elispot assay. Splenocytes were stimulated with SARS-CoV-2 S protein peptide library. Results were presented as the number of IFN- secreting cells per 10.sup.6 splenocytes. Error bars indicate standard error of the mean. * (P<0.05) significance between PIV5 and vaccine group. Analysis of variance (ANOVA) followed by Dunnett's multiple comparison test.

    [0053] FIG. 34A-FIG. 34E show the intranasal vaccination with CVXGA1 protects K18-hACE2 transgenic mice against lethal SARS-CoV-2 infection. Mice received DMEM immunization via intramuscular (IM) route; CVXGA1 immunization via intranasal (IN) route; UV-inactivated SARS-CoV-2 (UV-SARS2) administered via IM route with Alum adjuvant followed by a second boost dose at 14 dpi. Four weeks following immunization, K18-hACE2 mice were intranasally infected with 10.sup.6 PFU of SARS-CoV-2 in 50 l of DMEM. FIG. 34A shows the weight loss and FIG. 34B shows the survival outcomes in K18-hACE2 transgenic mice. Weight changes in 6 to 8 week-old mice were monitored daily (DMEM: n=5, CVXGA1: n=6, UV inactivated SARS-CoV-2: n=5 mice per group). While all mice had weight loss only the CVXGA1 immunized mice survived. Days post infection with SARS-CoV-2 denoted by dpi. *P value <0.05; **P value <0.005; Two-way ANOVA. FIGS. 34C and 34D is an analysis that shows CVXGA1 vaccine reduces lung tissue titer and prevents viral spread to the brain. Five days post SARS-CoV-2 infection, lung (n=4) and brain (n=4) tissues were obtained and titrated. (N/D: not detectable) *P value <0.05; **P value <0.005; One-way ANOVA. FIG. 34E shows the histology and scoring of lung tissues at five days post SARS-CoV-2 challenge. Left panels: Representative histology of DMEM, CVXGA1, or UV-SARS2 groups. Eosinophilic infiltrates (arrows in inset) were noted in the UV-SARS2 group. Eosinophilic infiltrates are enumerated in graph on right. **** P<0.0001, UV-SARS2 vs. DMEM or CVXGA1, One-way ANOVA. Bar=387 and 78 m, (top and bottom rows, respectively).

    [0054] FIG. 35A-FIG. 35D show the immunogenicity and efficacy of CVXGA1 in ferrets. FIG. 35A shows the post-immunization replication of CVXGA1 in ferret upper respiratory tracts. Ferret nasal washes were collected at 3, 7, and 14 days post-immunization. Plaque assays were performed in Vero cells. Nasal wash CVXGA1 was quantified as plaque-forming units per mL (PFU/mL). FIG. 35B shows the anti-S IgG titer in sera after immunization. Anti-S levels in sera at 7, 14, 21, 28 dpi, and 7 dpc were determined using ELISA. Data points represent mean values +/SD of duplicate values for individual animals (n=6 dpi; n=3 dpc). **** P<0.0001, Two-way ANOVA with Sidak's multiple comparisons test. FIG. 35C shows the anti-S IgA in nasal washes. IgA levels in nasal washes collected at 28 dpi were measured using ELISA. Data points represent pooled samples (n=6) in triplicate+/SD. FIG. 35D shows the comparison of anti-S serum IgG responses before and after SARS-CoV-2 challenge. Levels of anti-S IgG in ferrets at 28 dpi (dashed line) and 7 dpc (solid line) were determined using ELISA. Data points represent mean values+/SD of duplicate values for individual animals (n=6 dpi; n=3 dpc). **** P <0.0001, Two-way ANOVA with Sidak's multiple comparisons test.

    [0055] FIG. 36A-FIG. 36C show the ABSL3 facility for ferret SARS-CoV 2 infection. FIG. 36A shows the room layout for experiment described in FIG. 31. Challenge studies were completed in BSL3-Ag facilities. Rooms are equipped with single HEPA supply air and double HEPA exhaust and maintain negative pressure relative to outside clean corridors. Individually ventilated cages (IVCs) complete with solid cage bottoms and a plastic cage (Tecniplast) were supplied with HEPA supply and exhaust. FIG. 36B shows a representative image of Allentown, Inc conventional ferret caging. Each conventional ferret rack has six individual cages complete with plastic cage inserts with perforated floors and removable stainless-steel doors, plastic excreta pans, J-feeders, and automatic water manifold with lixits. FIG. 36C shows group locations within the cage racks. Nave ferrets were housed in IVCs before mixing with challenged ferrets in conventional (open) cages. Individual cages are labeled with the vaccine treatment group and animal identification with C indicative of nave contact animals. Gp3 represents a vaccine candidate that did not work as well as CVXGA1 did: these ferrets had the challenge virus in nasal cavities at 3 dpc.

    [0056] FIG. 37A-FIG. 37 B show viral RNA levels of ferrets immunized with CVXGA1 and their direct contacts. FIG. 37A shows the RNA levels in nasal washes. Detection of viral RNA in nasal washes collected at 1, 3, 5, 7, and 9 dpc in via qRT-PCR. Viral RNA was quantified using qRT-PCR. Each point represents a different animal, 1 pfu/PCR reaction (rxn) is marked to differentiate between infectious viral particles and un-infectious genomic remnants. The limit of detection (LOD) is indicated by the lowest dashed line. FIG. 37B shows the RNA levels in lungs of challenged ferrets. Lung samples were collected at days 4 and 10 dpc. Viral RNA was quantified via qRT-PCR, and PFU/mL was calculated with a standard curve. Each point represents a different animal, and 1 PFU/mL is marked to differentiate between infectious viral particles and un-infectious genomic remnants. The limit of detection (LOD) is indicated by the lowest dashed line.

    [0057] FIG. 38 shows a schematic of the CVX-UGA2 vector construct.

    DETAILED DESCRIPTION

    [0058] With the present invention, constructs of the parainfluenza virus type-5 (PIV5) virus expressing the SARS-CoV-2 envelope spike (S) protein have been generated for use as vaccines against COVID. These constructs demonstrate effectiveness as vaccines, with single dose intranasal immunization inducing sterilizing immunity in ferrets and cats.

    [0059] Coronavirus disease 2019 (COVID-19) is a newly emerging infectious disease currently spreading across the world. It is caused by a novel coronavirus, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (Zhu et al. N Engl J Med 382, 727-733 (2020)). SARS-CoV-2 was first identified in Wuhan, China in December 2019, and has subsequently spread globally to cause the COVID-19 pandemic. The virus has infected more than 221 million persons world-wide, caused more than 4,574,000 deaths as of Sep. 8, 2021, and is poised to continue to spread in the absence of herd immunity (see the worldwide web at who.int/emergencies/diseases/novel-coronavirus-2019). Social distancing and widespread testing with contact tracing and quarantine procedures are currently the only measures available to limit spread of the virus. A vaccine to protect against SARS-CoV-2 is urgently needed to prevent further mortality and reduce transmission.

    [0060] SARS-CoV-2 is a single-stranded RNA-enveloped virus belonging to the 8 coronavirus family (Lu et al. Lancet 395, 565-574 (2020)). An RNA-based metagenomic next-generation sequencing approach has been applied to characterize its entire genome, which is 29,881 nucleotides (nt) in length (GenBank Sequence Accession MN908947) encoding 9860 amino acids (Chen et al. Emerg Microbes Infect 9, 313-319 (2020)). Full-genome sequenced genomes available at GenBank include isolate 2019-nCoV WHU01 (GenBank accession number MN988668) and NC_045512 for SARS-CoV-2, both isolates from Wuhan, China, and at least seven additional sequences (MN938384.1, MN975262.1, MN985325.1, MN988713.1, MN994467.1, MN994468.1, and MN997409.1), which are >99.9% identical.

    [0061] Parainfluenza virus 5 (PIV5), a negative-stranded RNA virus, is a member of the Rubulavirus genus of the family Paramyxoviridae which includes many important human and animal pathogens such as mumps virus, human parainfluenza virus type 2 and type 4, Newcastle disease virus, Sendai virus, HPIV3, measles virus, canine distemper virus, rinderpest virus and respiratory syncytial virus. PIV5 was previously known as Simian Virus-5 (SV5). Although PIV5 is a virus that infects many animals and humans, no known symptoms or diseases in humans have been associated with PIV5. Unlike most paramyxoviruses, PIV5 infects normal cells with little cytopathic effect. As a negative stranded RNA virus, the genome of PIV5 is very stable. As PIV5 does not have a DNA phase in its life cycle and it replicates solely in cytoplasm, PIV5 is unable to integrate into the host genome. Therefore, using PIV5 as a vector avoids possible unintended consequences from genetic modifications of host cell DNAs. PIV5 can grow to high titers in cells, including Vero cells which have been approved for vaccine production by WHO and FDA. Thus, PIV5 presents many advantages as a vaccine vector.

    [0062] A PIV5-based vaccine vector of the present invention may be based on any of a variety of wild type, mutant, or recombinant (rPIV5) strains. Wild type strains include, but are not limited to, the PIV5 strains W3A, WR (ATCC Number VR-288), canine parainfluenza virus strain 78-238 (ATCC number VR-1573) (Evermann et al. Arch Virol 68, 165-172 (1981); Evermann et al. J Am Vet Med Assoc 177, 1132-1134 (1980)), canine parainfluenza virus strain D008 (ATCC number VR-399) (Binn et al. Proc Soc Exp Biol Med 126, 140-145 (1967)), MIL, DEN, LN, MEL, cryptovirus, CPI+, CPI, H221, 78524, T1 and SER. See, for example, (Baumgartner et al. Intervirology 27, 218-223 (1987); Chatziandreou et al. J Gen Virol 85, 3007-3016 (2004); Choppin Virology 23, 224-233 (1964)). Additionally, PIV5 strains used in commercial kennel cough vaccines, such as, for example, BI, FD, Merck, and Merial vaccines, may be used.

    [0063] A PIV5 vaccine vector of the present invention may be constructed using any of a variety of methods, including, but not limited to, the reverse genetics system described in more detail in He et al. (Virology; 237(2):249-60, 1997). PIV5 encodes eight viral proteins. Nucleocapsid protein (NP), phosphoprotein (P) and large RNA polymerase (L) protein are important for transcription and replication of the viral RNA genome. The V protein plays important roles in viral pathogenesis as well as viral RNA synthesis. The fusion (F) protein, a glycoprotein, mediates both cell-to-cell and virus-to-cell fusion in a pH-independent manner that is essential for virus entry into cells. The structures of the F protein have been determined and critical amino acid residues for efficient fusion have been identified. The hemagglutinin-neuraminidase (HN) glycoprotein is also involved in virus entry and release from the host cells. The matrix (M) protein plays an important role in virus assembly and budding. The hydrophobic (SH) protein is a 44-residue hydrophobic integral membrane protein and is oriented in membranes with its N terminus in the cytoplasm. For reviews of the molecular biology of paramyxoviruses see, for example, (Lamb Fields Virology: Sixth Edition 1, 957-995 (2013); Whelan et al. Biology of 25 Negative Strand RNA Viruses: The Power of Reverse Genetics, 61-119 (2004)).

    [0064] With the PIV5-based vaccine vectors of the present invention, a heterologous nucleotide sequence encoding the spike (S) protein of a coronavirus, including, but not limited to, the S protein of SARS-CoV-2, is inserted in the PIV5 genome. Coronavirus entry into host cells is mediated by the transmembrane S glycoprotein (Tortorici et al. Adv Virus Res 105, 93-116 (2019)). As the coronavirus S glycoprotein is surface-exposed and mediates entry into host cells, it is the main target of neutralizing antibodies upon infection and the focus of therapeutic and vaccine design. The spike S protein of SARS-CoV-2 is composed of two subunits, S1 and S2. The S1 subunit contains a receptor-binding domain that recognizes and binds to the host receptor angiotensin-converting enzyme 2, while the S2 subunit mediates viral cell membrane fusion by forming a six-helical bundle via the two-heptad repeat domain (Huang et al. Acta Pharmacologica Sinica 41, 1141-1149 (2020)).

    [0065] The total length of SARS-CoV-2 S is 1273 amino acids (aa) and consists of a signal peptide (amino acids 1-13) located at the N-terminus, the S1 subunit (14-685 residues), and the S2 subunit (686-1273 residues); the last two regions are responsible for receptor binding and membrane fusion, respectively. In the S1 subunit, there is an N-terminal domain (14-305 residues) and a receptor-binding domain (RBD, 319-541 residues); the fusion peptide (FP) (788-806 residues), heptapeptide repeat sequence 1 (HR1) (912-984 residues), HR2 (1163-1213 residues), TM domain (1213-1237 residues), and cytoplasm domain (1237-1273 residues) comprise the S2 subunit (Xia et al. Cell Mol Immunol 17, 765-767 (2020)).

    [0066] In some PIV5-based vaccine vectors of the present invention, the heterologous nucleotide sequence encoding the spike (S) protein of a coronavirus, including, but not limited to, the S protein of SARS-CoV-2, has been modified so that the cytoplasmic tail of the coronavirus S protein has been replaced with the cytoplasmic tail of the fusion (F) protein of PIV5. An example of such a PIV5 construct includes the PIV5 construct CVX-GA1, also referred to herein as CVXGA1, CVX-UGA1, pDA27, or DA27. A plasmid map of CVX-GA1 is shown in FIGS. 2 and 9, with the sequence of the construct included in FIG. 9.

    [0067] In some PIV5-based vaccine vectors of the present invention, the heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to, the S protein of SARS-CoV-2, has been modified so that the S protein includes an amino acid substitution at amino acid residue W886 and/or F888. In some aspects, the amino acid substitution at amino acid residue W886 includes a substitution of tryptophan (W) to arginine (R) and/or the amino acid substitution at amino acid residue W888 includes a substitution of phenylalanine (F) to arginine (R).

    [0068] In some PIV5-based vaccine vectors of the present invention, the heterologous nucleotide sequence encoding the spike (S) protein of a coronavirus, including, but not limited to, the S protein of SARS-CoV-2, includes both a modification so that the cytoplasmic tail of the coronavirus S protein has been replaced with the cytoplasmic tail of the fusion (F) protein of PIV5 and includes an amino acid substitution at amino acid residue W886 and/or F888. In some aspects, the amino acid substitution at amino acid residue W886 includes a substitution of tryptophan (W) to arginine (R) and/or the amino acid substitution at amino acid residue W888 includes a substitution of phenylalanine (F) to arginine (R). An example of such a PIV5 construct includes the PIV5 construct CVX-GA2, also referred to herein as CVXGA2 or CVX-UGA2. A plasmid map of CVX-GA1 is shown in FIG. 38.

    [0069] The heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted in any of a variety of locations in the PIV5 genome.

    [0070] In some preferred embodiments, the heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted between the small hydrophobic protein (SH) gene and the hemagglutinin-neuraminidase (HN) gene of the PIV5 genome.

    [0071] The heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted between the hemagglutinin-neuraminidase (HN) and large RNA polymerase protein (L) gene of the PIV5 genome. In some embodiments, the heterologous nucleotide sequence is not inserted at a location between the hemagglutinin-neuraminidase (HN) and large RNA polymerase protein (L) gene of the PIV5 genome. In some embodiments, the heterologous nucleotide sequence is inserted at a location other than between the hemagglutinin-neuraminidase (HN) and large RNA polymerase protein (L) gene of the PIV5 genome.

    [0072] The heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted between the nucleocapsid protein (NP) gene and the V/P gene of the PIV5 genome.

    [0073] The heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted between the M gene and the F gene of the PIV5 genome.

    [0074] The heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted between the F gene and the SH gene of the PIV5 genome.

    [0075] The heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted between the VP gene and the matrix protein (M) gene of the PIV5 genome.

    [0076] The heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted between the leader sequence and the nucleocapsid protein (NP) gene of the PIV5 genome.

    [0077] The heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted immediately downstream of the leader sequence of the PIV5 genome.

    [0078] The heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted to replace all or part of a PIV5 gene within the PIV5 genome. For example, the heterologous nucleotide sequence may replace the F, HN, or SH gene of the PIV5 genome. A heterologous nucleotide sequence may be inserted within a PIV5 gene, resulting in the expression of a chimeric polypeptide. For example, the heterologous nucleotide sequence may be inserted within the SH gene nucleotide sequence, within the NP gene nucleotide sequence, within the V/P gene nucleotide sequence, within the M gene nucleotide sequence, within the F gene nucleotide sequence, within the HN gene nucleotide sequence, and/or within the L gene nucleotide sequence of a PIV5 genome.

    [0079] A PIV5 viral vaccine of the present invention may also have a mutation, alteration, or deletion in one or more of these eight proteins of the PIV5 genome. For example, a PIV5 viral expression vector may include one or more mutations, including, but not limited to any of those described herein. In some aspects, a combination of two or more (two, three, four, five, six, seven, or more) mutations may be advantageous and may demonstrated enhanced activity.

    [0080] A mutation includes, but is not limited to, a mutation of the V/P gene, a mutation of the shared N-terminus of the V and P proteins, a mutation of residues 26, 32, 33, 50, 102, and/or 157 of the shared N-terminus of the V and P proteins, a mutation lacking the C-terminus of the V protein, a mutation lacking the small hydrophobic (SH) protein, a mutation of the fusion (F) protein, a mutation of the phosphoprotein (P), a mutation of the large RNA polymerase (L) protein, a mutation incorporating residues from canine parainfluenza virus, and/or a mutation that enhances syncytial formation.

    [0081] A mutation may include, but is not limited to, rPIV5-V/P-CPI, rPIV5-CPI, rPIV5-CPI+, rPIV5V C, rPIV-Rev, rPIV5-RL, rPIV5-P-S157A, rPIV5-P-S308A, rPIV5-L-A1981D and rPIV5-F-S443P, rPIV5-MDA7, rPIV5 ASH-CPI, rPIV5 ASH-Rev, and combinations thereof.

    [0082] PIV5 can infect cells productively with little cytopathic effect (CPE) in many cell types. In some cell types, PIV5 infection causes formation of syncytia, i.e., fusion of many cells together, leading to cell death. A mutation may include one or more mutations that promote syncytia formation (see, for example (Paterson et al. Virology 270, 17-30 (2000))).

    [0083] The V protein of PIV5 plays a critical role in blocking apoptosis induced by virus. Recombinant PIV5 lacking the conserved cysteine-rich C-terminus (rPIV5V C) of the V protein induces apoptosis in a variety of cells through an intrinsic apoptotic pathway, likely initiated through endoplasmic reticulum (ER)-stress (Sun et al. Journal of virology 78, 5068-5078 (2004)). Mutant recombinant PIV5 with mutations in the N-terminus of the V/P gene products, such as rPIV5-CPI, also induce apoptosis (Wansley et al. J Virol 76, 10109-10121 (2002)). A mutation includes, but is not limited to, rPIV5 ASH, rPIV5-CPI, rPIV5 VAC, and combinations thereof.

    [0084] Also included in the present invention are virions and infectious viral particles that include a PIV5 genome including a heterologous nucleotide sequence encoding a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2.

    [0085] Also included in the present invention are compositions including one or more of the PIV5 viral constructs or virions, as described herein. Such a composition may include a pharmaceutically acceptable carrier. As used, a pharmaceutically acceptable carrier refers to one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal. Such a carrier may be pyrogen free. The present invention also includes methods of making and using the viral vectors and compositions described herein.

    [0086] The compositions of the present disclosure may be formulated in pharmaceutical preparations in a variety of forms adapted to the chosen route of administration. One of skill will understand that the composition will vary depending on mode of administration and dosage unit.

    [0087] The agents of this invention can be administered in a variety of ways, including, but not limited to, intravenous, topical, oral, intranasal, subcutaneous, intraperitoneal, intramuscular, and intratumor deliver. In some aspects, the agents of the present invention may be formulated for controlled or sustained release. One advantage of intranasal immunization is the potential to induce a mucosal immune response.

    [0088] Also included in the present invention are methods of making and using PIV5 viral expression vectors, including, but not limited to any of those described herein.

    [0089] For example, the present invention includes methods of expressing a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, in a cell by contacting or infection the cell with a PIV5 viral expression vector, viral particle, or composition as described herein.

    [0090] The present invention includes methods of inducing an immune response in a subject to a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, by administering a viral expression vector, viral particle, or composition as described herein to the subject. The immune response may include a humoral immune response and/or a cellular immune response. The immune response may enhance an innate and/or adaptive immune response.

    [0091] The present invention includes methods expressing a heterologous coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, in a subject by administering a viral expression vector, viral particle, or composition as described herein to the subject.

    [0092] The present invention includes methods of vaccinating a subject by administering a viral expression vector, viral particle, or composition as described herein to the subject.

    [0093] With the methods of the present invention, any of a variety of modes of administration may be used. For example, administration may be intravenous, topical, oral, intranasal, subcutaneous, intraperitoneal, intramuscular, intratumor, in ovo, maternally, and the like. In some aspects, administration is to a mucosal surface. A vaccine may be administered by mass administration techniques such as by placing the vaccine in drinking water or by spraying the animals' environment. When administered by injection, the immunogenic composition or vaccine may be administered parenterally. Parenteral administration includes, for example, administration by intravenous, subcutaneous, intramuscular, or intraperitoneal injection.

    [0094] An agent of the present disclosure may be administered at once, as a single dose, or may be administered as multiple doses administered at intervals of time. For example, agents of the invention may be administered repeatedly, e.g., at least 2, 3, 4, 5, 6, 7, 8, or more times. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that any concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions and methods.

    [0095] In some therapeutic embodiments, an effective amount of an agent is an amount that results in a reduction of at least one pathological parameter. Thus, for example, in some aspects of the present disclosure, an effective amount is an amount that is effective to achieve a reduction of at least about 10%, at least about 15%, at least about 20%, or at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, compared to the expected reduction in the parameter in an individual not treated with the agent.

    [0096] In some aspects, any of the PIV5-based constructs and methods described in WO 2013/112690 and WO 2013/112720 (which is hereby incorporated by reference herein in its entirety) may be used in the present invention.

    [0097] As used herein, the term subject represents an organism, including, for example, a mammal. A mammal includes, but is not limited to, a human, a non-human primate, and other non-human vertebrates. A subject may be an individual, patient, or host. Non-human vertebrates include livestock animals (such as, but not limited to, a cow, a horse, a goat, and a pig), a domestic pet or companion animal, such as, but not limited to, a dog or a cat, and laboratory animals. Non-human subjects also include non-human primates as well as rodents, such as, but not limited to, a rat or a mouse. Non-human subjects also include, without limitation, poultry, horses, cows, pigs, goats, dogs, cats, guinea pigs, hamsters, mink, and rabbits.

    [0098] As used herein in vitro is in cell culture and in vivo is within the body of a subject. As used herein, isolated refers to material that has been either removed from its natural environment (e.g., the natural environment if it is naturally occurring), produced using recombinant techniques, or chemically or enzymatically synthesized, and thus is altered by the hand of man from its natural state.

    [0099] Exemplary Embodiments of the present invention include, but are not limited to, the following.

    [0100] 1. A viral expression vector comprising a parainfluenza virus 5 (PIV5) genome comprising a heterologous nucleotide sequence expressing a heterologous polypeptide, wherein the heterologous polypeptide comprises a coronavirus spike (S) protein.

    [0101] 2. The viral expression vector of Embodiment 1, wherein the coronavirus S protein comprises the coronavirus S protein of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

    [0102] 3. The viral expression vector of Embodiment 1, wherein the cytoplasmic tail of the coronavirus S protein has been replaced with the cytoplasmic tail of the fusion (F) protein of PIV5.

    [0103] 4. The viral expression vector of Embodiment 1, wherein the coronavirus S protein comprises the coronavirus S protein of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and wherein the cytoplasmic tail of the coronavirus S protein has been replaced with the cytoplasmic tail of the fusion (F) protein of PIV5.

    [0104] 5. The viral expression vector of any one of Embodiments 1 to 4, wherein the heterologous polypeptide comprises a coronavirus spike (S) protein that contains mutations at amino acid residue W886 and/or F888.

    [0105] 6. The viral expression vector of Embodiment 5, wherein the amino acid substitution at amino acid residue W886 comprises a substitution of tryptophan (W) to arginine (R) and/or the amino acid substitution at amino acid residue W888 comprises a substitution of phenylalanine (F) to arginine (R).

    [0106] 7. The viral expression vector of any one of Embodiments 1 to 6, wherein the heterologous nucleotide sequence is inserted between the small hydrophobic protein (SH) gene and the hemagglutinin-neuraminidase (HN) gene of the PIV5 genome.

    [0107] 8. The viral expression vector of any one of Embodiments 1 to 6, wherein the heterologous nucleotide sequence replaces the SH gene nucleotide sequence.

    [0108] 9. The viral expression vector of any one of Embodiments 1 to 6, wherein the heterologous nucleotide sequence is inserted between the hemagglutinin-neuraminidase (HN) gene and the large RNA polymerase protein (L) gene of the PIV5 genome.

    [0109] 10. The viral expression vector of any one of Embodiments 1 to 6, wherein the heterologous nucleotide sequence is inserted closer to the leader than between the hemagglutinin-neuraminidase (HN) gene and the large RNA polymerase protein (L) gene of the PIV5 genome; is inserted upstream of the nucleocapsid protein (NP) gene of the PIV5 genome; is inserted immediately downstream of the leader sequence of the PIV5 genome; is inserted between the fusion (F) protein gene and the SH gene of the PIV5 genome; is inserted between the VP gene and the matrix protein (M) gene of the PIV5 genome; is inserted between the M gene and the F gene of the PIV5 genome; is inserted between the nucleocapsid protein (NP) gene and the V/P gene of the PIV5 genome; is inserted between the leader sequence and the nucleocapsid protein (NP) gene of the PIV5 genome; is inserted wherein a portion of the F or HN gene of PIV5 has been replaced with the heterologous nucleotide sequence; is inserted within the SH gene nucleotide sequence, is inserted within the NP gene nucleotide sequence, is inserted within the V/P gene nucleotide sequence, is inserted within the M gene nucleotide sequence, is inserted within the F gene nucleotide sequence, is inserted within the HN gene nucleotide sequence, and/or is inserted within the L gene nucleotide sequence.

    [0110] 11. The viral expression vector of any one of Embodiments 1 to 10, wherein the PIV5 genome further comprises one or more mutations.

    [0111] 12. The viral expression vector of Embodiment 11, wherein the one or more mutations comprise a mutation of the V/P gene, a mutation of the shared N-terminus of the V and P proteins, a mutation of residues 26, 32, 33, 50, 102, and/or 157 of the shared N-terminus of the V and P proteins, a mutation lacking the C-terminus of the V protein, a mutation lacking the small hydrophobic (SH) protein, a mutation of the fusion (F) protein, a mutation of the phosphoprotein (P), a mutation of the large RNA polymerase (L) protein, a mutation incorporating residues from canine parainfluenza virus, a mutation inducing apoptosis, or a combination thereof.

    [0112] 13. The viral expression vector of Embodiment 11 or 12, wherein the one or more mutations comprise PIV5 VAC, PIV5SH, PIV5-P-S308G, or a combination thereof.

    [0113] 14. A viral particle comprising the viral expression vector of any one of Embodiments 1 to 13.

    [0114] 15. A composition comprising the viral expression vector of any one of Embodiments 1 to 13 and/or a viral particle of claim 14.

    [0115] 16. A method of expressing a heterologous coronavirus spike (S) glycoprotein in a cell, the method comprising contacting the cell with the viral expression vector, viral particle, or composition of any one of Embodiments 1 to 15.

    [0116] 17. A method of inducing an immune response in a subject to a coronavirus spike (S) glycoprotein, the method comprising administering the viral expression vector, viral particle, or composition of any one of claims Embodiments 1 to 15 to the subject.

    [0117] 18. The method of Embodiment 17 wherein the immune response comprises a humoral immune response and/or a cellular immune response.

    [0118] 19. A method of vaccinating a subject against coronavirus disease 2019 (COVID-19), the method comprising administering the viral expression vector, viral particle, or composition of any one of Embodiments 1 to 15 to the subject.

    [0119] 20. The method of any one of Embodiments 17 to 19, wherein the viral expression vector, viral particle, or composition is administered intranasally, intramuscularly, topically, or orally.

    [0120] The term and/or means one or all of the listed elements or a combination of any two or more of the listed elements.

    [0121] The words preferred and preferably refer to embodiments of the invention that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful and is not intended to exclude other embodiments from the scope of the invention.

    [0122] The terms comprises and variations thereof do not have a limiting meaning where these terms appear in the description and claims.

    [0123] Unless otherwise specified, a, an, the, and at least one are used interchangeably and mean one or more than one.

    [0124] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term about. Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

    [0125] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

    [0126] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.

    [0127] The description exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.

    [0128] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

    [0129] The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

    EXAMPLES

    Example 1

    Construction of CVX-UGA1

    [0130] CVX-UGA1 was generated from plasmid pDA27 (pDA27). Plasmid pDA27 has the SARS-CoV-2-S gene from nCOV19-S-human-Genscript plasmid (high-copy plasmid from GenScript), with the cytoplasmic tail replaced with PIV5 F cytoplasmic tail which was inserted into plasmid pDA16 (low-copy plasmid) backbone between genes SH and HN. The S gene sequence was based on MN908947 and codon-optimized for expression in human. Plasmid pDA16 contains the whole PIV5 virus genome and a chloramphenicol resistance gene. The sequence of the low-copy pDA16 plasmid has been fully verified.

    [0131] Process for obtaining pDA27 is shown in FIG. 1. SARS-CoV-2-S gene with the cytoplasmic tail replaced with PIV5 F tail was obtained through PCR from nCOV19-S-human-Genscript plasmid. The DA193-F and DA194-R primers used for the PCR reaction have overlapping regions with pDA16 plasmid and DA194-R primers contains the PIV5 F tail sequence. pDA16 plasmid was used as the backbone. The plasmid was digested with NotI and MluI restriction enzymes to remove previous gene inserted between PIV5 SH and HN genes. pDA27 plasmid was constructed through Gibson assembly. The SARS-CoV-2-S-Ftail PCR product was combined with digested pDA16 and Gibson assembly master mix and incubated at 50 C. for 1 hour.

    [0132] FIG. 2 shows where the S of SARS-CoV-2 was inserted into the PIV5 genome in pDA27 (CVX-UGA1). The new pDA27 plasmid was then transformed into TOP10 competent cells obtained from Thermo Fisher Scientific and plated on LB agar plates containing chloramphenicol. A single colony was expanded in LB media containing chloramphenicol and plasmid was purified and sequenced by PCR amplification of 5 fragments shown in FIG. 3 using primers listed in Table 1 and Table 2.

    [0133] The plasmid was sent for deep-sequencing, where the whole plasmid sequence and not just the part with the PIV5(SH-HN)-CoV-2-S-Ftail genome was obtained and the sequence verified. After confirmation of the proper sequence, viral rescue took place. This process shown in FIG. 5.

    [0134] An alternative method for the construction of CVX-UGA1 vaccine is by construction of the pAB76 plasmid. This plasmid contains the exact PIV5(SH-HN)-SARS-CoV-2-S genome as pDA27 but with a high-copy backbone (pUC19) containing an ampicillin resistance gene. The process for pAB76 is shown in FIG. 4.

    [0135] The pCH10 plasmid was used to obtain the high-copy pUC19 backbone. The plasmid was digested with RsrII and AatII restriction enzymes.

    [0136] The pDA27 plasmid (low-copy) was used to obtain the PIV5(SH-HN)-SARS-CoV-2-S-Ftail. The plasmid was digested with pDA27 plasmid with RsrII and AatII restriction enzymes.

    [0137] Digested products (pUC19 high-copy backbone and PIV5(SH-HN)-SARS-CoV-2-S-Ftail) were ligated following Rapid Ligation protocol to obtain final plasmid.

    [0138] Either of the processes shown in FIG. 1 or FIG. 2 can be used to produce the final plasmid used for the production of seed CVX-UGA1. The PIV5(SH-HN)-SARS-CoV-2-S-Ftail genomes in pDA27 and pAB76 are identical. The only difference is that pDA27 is a low-copy plasmid (chloramphenicol resistant) and pAB76 is a high-copy plasmid (ampicillin resistant).

    [0139] For the rescue of the recombinant vector virus, the pDA27 plasmid was transfected into BHK-21 cells(obtained from ATCC) together with plasmids encoding the PIV5 NP, P, L proteins and T7 RNA Polymerase allowing for the rescue of recombinant virus from the supernatant. Rescue plasmids are CAGGS-NP, pCAGGS-P, CAGGS-L, and pBH437-T7. The full sequence of the rescue plasmids was confirmed prior to use in virus rescue. The media used for virus rescue was DMEM media (obtained from Gibco) with TPB (obtained from BD), FBS (obtained from HyClone), and PenStrep (obtained from Lonza).

    [0140] Following seven days of incubation, 5 mL of supernatant containing the vector virus was obtained and mixed with 10SPG and stored at 80 C. Aliquots of this frozen stock were serially diluted to perform a plaque assay on Vero cells (obtained from ATCC) in 6-well plates, with the objective of obtaining a 6-well with a single plaque. A 1000 uL pipette tip was used to poke the single plaque and re-suspend in DMEM media containing FBS and PenStrep. The re-suspended plaque was then used to infect nave Vero cells in a 6 cm dish. After 7 days, the supernatant (5 mL) from the 6 cm dish containing the single plaque purification was mixed with 10SPG and stored at 80 C. Part of the supernatant (140 uL) was used to do RNA extraction and RT-PCR to verify sequence. The RT-PCR was done with the same primers described in Table 1.

    TABLE-US-00001 TABLE 1 Primers Primers A PIV5-1-F, PIV5-4369-R B PIV5-3469-F, PIV5-6276-R C PIV5-5590-F, PIV5-7149-R D PIV5-6814-F, PIV5-11607-R E PIV5-10545-F, PIV5-15246-R

    TABLE-US-00002 TABLE2 ArtificialOligonucleotidePrimers Number SEQIDNO: Name Sequence Concentration 1 2 PIV5-1-F ACCAAGGGGAAAATG 100uM AAGTGGTGAC 2 3 PIV5-3469-F TCCAGGTCACTGTTAG 100uM GAAGACATC 3 4 PIV5-4369-R AGTGTGTTGTAGCCTA 100uM CGATCAGTG 4 5 PIV5-5590-F CAAGATGCACCTTCTCT 100uM CCAGTG 5 6 PIV5-6276-R GCTCGATTACCTAGATT 100uM GACCGAGAC 6 7 PIV5-6814-F TAACTCTGCAGTCGCTC 100uM TACCTC 7 8 PIV5-7149-R ACATGATCCTGGCATC 100uM CATTCAG 8 9 PIV5-10545-F TCAACCCACCAGCAGA 100uM TACCAG 9 10 PIV5-11607-R TCAATGATGATGTGAG 100uM CTACACGC 10 11 PIV5-15246-R ACCAAGGGGAAAACCA 100uM AGATTAATCC 11 12 DA193-F ATCCACAATCTACAGTC 100uM GACGCGGCCGCCATGT TCGTCTTCCTGGTCCT 12 13 DA194-R GTATGGCAGGAGGCTA 100uM GCACGCGTTCATTTAT GATAAACAAAATTCTC CATTCTATTTCGATTAG

    [0141] For the rescue of the CVX-UGA1 to produce master seed, the DA27 or AB76 plasmid is transfected into 293T serum-free cells (obtained from ATCC) together with plasmids encoding the PIV5 NP, P, L proteins and T7 RNA Polymerase allowing for the rescue of recombinant virus from the supernatant. The next day, 293T serum free-transfected cells are trypsinized and co-cultured with Vero-SF (serum free) cells in a 10 cm dish and then incubated for seven days. Following seven days of incubation, 5 mL of supernatant containing the vector virus is obtained and mixed with 10SPG and stored at 80 C. Aliquots of this frozen stock are serially diluted to perform a plaque assay on Vero-SF cells in 6-well plates, to obtain a 6-well with a single plaque. A 1000 uL pipette tip is used to poke the single plaque and re-suspend in VP-SFM media. The re-suspended plaque is then be used to infect nave Vero-SF cells in a 6 cm dish. After 7 days, the supernatant (5 mL) from the 6 cm dish containing the single plaque purification was mixed with 10SPG and stored at 80 C. Aliquots from the initial round of single plaque purification are used as the seed inoculum for manufacture of the pre-master seed vaccine to generate a master seed in a GMP facility using qualified GMP produced Vero-SF cell banks in serum free media (VP-SFM Media).

    [0142] The CVX-UGA1 virus rescue may be performed with either pDA27 or pAB76 as they have the exact PIV5(SH-HN)-SARS-CoV-2-S-Ftail genome. The only difference is that pDA27 is a low-copy plasmid and pAB76 is a high-copy plasmid.

    [0143] Plasmids used in future rescue to obtain CVX-UGA1 will be prepared using animal-free products. The goal is to produce CVX-UGA1 free of animal products except cells (293T-serum free and Vero-serum free, and animal-products free).

    [0144] The production of SARS-CoV-2-S-protein by the seed construct was confirmed by immunofluorescence assay. This is shown in FIG. 6. Primary antibody: SARS-CoV-2 Spike S1 rabbit monoclonal antibody from Sino Biological and Secondary Antibody: Cy3 labeled Goat anti-rabbit IgG (H+L) from KPL.

    [0145] Detection of SARS-CoV-2 S in CVX-UGA1-infected MDBK cells by immunofluorescence assay. SARS-CoV-2 S was detected using SARS-CoV-2 Spike S1 monoclonal antibody followed by Cy3 labeled Goat anti-rabbit IgG as a secondary. Infected cells were also labeled with anti-PIV5-P/V (PK) antibody as a control followed by Goat anti-mouse IgG H&L (FITC) secondary antibody. DAPI (4=,6-diamidino-2-phenylindole; blue) was used as a nuclear stain. For future experiments, Vero-SF cells will be used instead of MDBK cells.

    [0146] A map of the pDA16 plasmid is shown in FIG. 7. This plasmid contains the PIV5 genome plus the PCDV1 gene. It is a low-copy plasmid with a chloramphenicol resistance gene.

    [0147] A map of the nCOV19-S-human-Genscript plasmid is shown in FIG. 8. This is a high-copy plasmid and it contains and ampicillin resistance gene. It was obtained from GenScript.

    [0148] A map and sequence of the pDA27 (CVX-UGA1) plasmid is shown in FIG. 9. This plasmid is a low-copy plasmid and it contains a chloramphenicol resistance gene. A map of the pCAGGS-NP plasmid is shown in FIG. 10. This plasmid is a high-copy plasmid and it contain an ampicillin resistance gene. PIV5 NP DNA sequence from pBH276 plasmid was subcloned into pCAGGS expression plasmid. For more detail, see Schmitt et al., 2002, J Virol 76, 3952-3964, doi:10.1 128/jvi.76.8.3952-3964.2002.

    [0149] A map of the pCAGGS-P plasmid is shown in FIG. 11. This plasmid is a high-copy plasmid and it contain an ampicillin resistance gene. PIV5 P DNA sequence from pBH276 plasmid was subcloned into pCAGGS expression plasmid. For more detail, see Waning et al., 2002, J Virol; 76:9284-9297, doi:10.1 128/jvi.76.18.9284-9297.2002.

    [0150] A map of the pCAGGS-L plasmid is shown in FIG. 12. This plasmid is a high-copy plasmid and it contain an ampicillin resistance gene. PIV5 L DNA sequence from pBH276 plasmid was subcloned into pCAGGS expression plasmid. For more detail, see Waning et al., 2002, J Virol; 76:9284-9297, doi:10.1 128/jvi.76.18.9284-9297.2002.

    [0151] A map of the pBH437-pCAGGS-T7 plasmid is shown in FIG. 13. This plasmid is a high-copy plasmid and it contain an ampicillin resistance gene. T7 polymerase DNA sequence from pBH161 plasmid was subcloned into pCAGGS expression plasmid.

    [0152] A map of the pBH276 plasmid is shown in FIG. 14. This plasmid contains the PIV5 genome. It is a high-copy plasmid with an ampicillin resistance gene. For more detail, see He et al., 1997, Virology; 237:249-260, doi:10.1006/viro.1997.8801.

    [0153] A map of the pBH161 plasmid is shown in FIG. 15. This plasmid is a high-copy plasmid and contain an ampicillin resistance gene. For more detail, see He et al., 1997, Protein Expression and Purification; 9:142-151, doi:10.1006/prep.1996.0663.

    [0154] A map of the pCH10 plasmid is shown in FIG. 16. This plasmid contains the PIV5 genome. It is a high-copy plasmid with an ampicillin resistance gene.

    [0155] A map of the pAB76 plasmid is shown in FIG. 17. This plasmid is a high-copy plasmid and it contains an ampicillin resistance gene.

    Protocols

    Subculturing Procedure for Vero-SF

    [0156] Volumes used in this protocol are for a 75 cm.sup.2 flask.

    [0157] Remove and discard culture medium using pasteur pipet and vacuum pump.

    [0158] Briefly rinse the cell layer with 10 mL Ca++/Mg++ free Dulbecco's phosphate buffered saline (DPBS).

    [0159] Add 5 mL of TrypLE to flask. Incubate at 37 C. until cells have detached. Observe cell monolayer using an inverted microscope to ensure complete cell detachment from the surface of the flask.

    [0160] To avoid clumping do not agitate the cells by tapping or shaking the flask while waiting for the cells to detach. Cells that are difficult to detach may be placed at 37 C. to facilitate dispersal.

    [0161] Add 10 mL of pre-warmed VP-SFM medium to flask and aspirate cells by gently pipetting with 10 mL serological pipet. Tilt flask in all directions to thoroughly rinse flask.

    [0162] Transfer cell suspension to a 15 mL conical tube and spin at 125 g for 10 minutes.

    [0163] Discard supernatant and re-suspend cells in fresh VP-SFM. Add appropriate aliquots of cell suspension to new culture vessels.

    [0164] Incubate cultures at 37 C.

    [0165] Cells grow best after the first subculture.

    [0166] Subcultivation Ratio: 1:4 dilution.

    [0167] Medium Renewal: Two times weekly.

    Subculturing Procedure for 293T-SF

    [0168] Volumes used in this protocol are for a 75 cm.sup.2 flask.

    [0169] Remove and discard culture medium using pasteur pipet and vacuum pump.

    [0170] Briefly rinse the cell layer with 10 mL Ca++/Mg++ free Dulbecco's phosphate buffered saline (DPBS).

    [0171] Add 10 mL of pre-warmed BalanCD HEK293 medium to flask and re-suspend cells by gently pipetting with 10 mL serological pipet.

    [0172] Transfer cell suspension to a 15 mL conical tube and spin at 125 g for 10 minutes.

    [0173] Discard supernatant and re-suspend cells in fresh BalanCD HEK293 medium. Add appropriate aliquots of cell suspension to new culture vessels.

    [0174] Incubate cultures at 37 C.

    [0175] Cells grow best after the first subculture.

    [0176] Subcultivation Ratio: 1:4 dilution.

    [0177] Medium Renewal: Two times weekly.

    Subculturing Procedure for BHK-21 and Vero Cells

    [0178] Volumes used in this protocol are for a 75 cm.sup.2 flask.

    [0179] Remove and discard culture medium using pasteur pipet and vacuum pump (IV-18).

    [0180] Briefly rinse the cell layer with 10 mL Ca++/Mg++ free Dulbecco's phosphate buffered saline (DPBS).

    [0181] Add 5 mL of Trypsin/EDTA to flask. Tilt flask to cover surface and remove excess.

    [0182] Incubate at 37 C. until cells have detached. Observe cell monolayer using an inverted microscope to ensure complete cell detachment from the surface of the flask.

    [0183] To avoid clumping do not agitate the cells by tapping or shaking the flask while waiting for the cells to detach. Cells that are difficult to detach may be placed at 37 C. to facilitate dispersal

    [0184] Add 20 mL of pre-warmed respective culture medium to flask and re-suspend cells using 10 mL serological pipet. Tilt flask in all directions to thoroughly rinse flask. Add appropriate aliquots of cell suspension to new culture vessels.

    [0185] Incubate cultures at 37 C.

    [0186] Culture medium for BHK is DMEM+TPB+FBS+PenStrep and for Vero is DMEM+FBS+PenStrep.

    PIV5 Rescue (Transfection)

    1 Day Before:

    [0187] Plate BHK-21 cells in 60 mm tissue culture dish at a 1:8 dilution (75% confluency the next day)

    Day of:

    [0188] Mix plasmid DNA, pCAGGs-NP, pCAGGs-P, pCAGGs-L, and pBH437 (pCAGGS-T7) in 1.6 mL microcentrifuge tube in the biological safety cabinet.

    [0189] Mix by pipetting between additions.

    [0190] Add JetPRIME Buffer and JetPRIME Transfection Reagent.

    [0191] Incubate at room temperature for 15 minutes.

    [0192] Add transfection mixture to cells dropwise.

    [0193] Monitor cells for next 7 days for syncytia using EVOS.

    [0194] Once syncytia are present, start collecting 1 mL of media in a Cryo Tube and mix with 10SPG.

    [0195] Store at 80 C.

    Piv5 Rescue Co-Culture (Transfection)

    1 Day Before:

    [0196] Plate 293T-SF cells in 6-well tissue culture dish at a 1:6 (about 75% confluency) dilution.

    [0197] Plate Vero-SF cells in 10 cm dish at a 1:20 (about 50% confluency) dilution.

    Day of:

    [0198] Mix plasmid DNA, pCAGGs-NP, pCAGGs-P, pCAGGs-L, and pBH437 (pCAGGs-T7) in 1.6 mL microcentrifuge tube containing serum-free Opti-MEM in the biological safety cabinet.

    [0199] Mix by pipetting between additions.

    [0200] Add P3000 Reagent.

    [0201] In a different 1.6 mL microcentrifuge tube containing serum-free Opti-MEM add Lipofectamine3000 Transfection Reagent.

    [0202] Incubate at room temperature for 20 minutes.

    [0203] Add transfection mixture to cells dropwise.

    Next Day:

    [0204] Trypsinize 293T-SFs, re-suspend well in 1 mL VP-SFM, move to a separate 15 mL conical tube.

    [0205] Trypsinize 10 cm Vero-SFs, re-suspend in 3 mL VP-SFM, move to 15 mL conical tube.

    [0206] Add 6 mL VP-SFM to 15 mL conical tube.

    [0207] Mix well and add the full 10 mL from 15 mL conical tube to a new 10 cm dish.

    [0208] Monitor cells for next 7 days for syncytia using EVOS.

    [0209] Once syncytia are present, start collecting 1 mL of media in a Cryo Tube and mix with 10SPG.

    [0210] Store at 80 C.

    Virus Plaque Purification

    [0211] Take 1 mL frozen rescue aliquots and do plaque assay.

    [0212] After 7 days, poke an individual plaque using a 1000 uL pipette tip and add to 6 cm dish of Vero-SF cells plated at a 90% confluency the day before following protocol on Appendix IV-1. Use VP-SFM media.

    [0213] At day 7, collect 140 uL media sample and use for RNA extraction using QIAamp Viral RNA Mini Kit.

    [0214] Collect the rest of the media (4.8 mL) in a Cryo Tube and mix with 10SPG.

    [0215] Store at 80 C.

    PIV5 Plaque Assay

    [0216] All steps are done in the biological safety cabinet.

    1 Day Before:

    [0217] Plate Vero-SF cells in 6 well culture plate at a 1:3 dilution (95% confluency the next day).

    Day of:

    [0218] Thaw PIV5 virus at 37 C. in incubator and keep on ice after thawing.

    [0219] While virus is thawing prepare 10-fold dilutions in 96-well plate starting with undiluted sample and ending with 10-5 dilution using multichannel pipette and label 6 well plates with name of virus, passage number, date collected and dilution factor, as follows: [0220] Add 200 L of undiluted sample to first well [0221] Add 180 L of infection media to wells 2-6 [0222] Take 20 uL from first well, transfer to second well, and mix thoroughly using pipetting+mixing feature in multichannel pipette. Discard tips. [0223] Repeat previous step 5 more times.

    [0224] Aspirate media from cells using pasteur pipet and vacuum pump. Add 900 L of VP-SFM media to each well in the 6 well culture plate.

    [0225] Infect 6 well culture plate with 100 L of virus dilution per well. Use same tip going from least concentrated to most and incubate for 1 hour.

    [0226] Aspirate media after 1 hour of infection.

    [0227] Add 4 mL of overlay to each well. Overlay: For 1 6 well culture plate, mix 13 mL of 2% LMP agar and 13 mL of 2 VP-SFM media.

    [0228] Incubate at 37 C. for 7 days.

    Growing PIV5 Virus

    1 Day Before:

    [0229] Plate Vero-SF cells in 175 cm.sup.2 flask at a 1:3 dilution (95% confluency the next day).

    Day of:

    [0230] Prepare inoculum. Virus at MOI=0.01 in 20 mL of VP-SFM media.

    [0231] Aspirate maintenance media from cells using pasteur pipet and vacuum pump Infect Vero-SF cells for 2 hours at 37 C. Rock plate every 15 minutes.

    [0232] Aspirate inoculum and add 40 mL of VP-SFM media.

    [0233] Incubate at 37 C. for 7 days.

    Day 7:

    [0234] Collected media in 50 mL conical tube and centrifuge at 1500 rpm for 10 minutes at 4 C. to remove cell debris.

    [0235] Transfer 38 mL supernatant to new 50 mL conical tube.

    [0236] Add 3.8 mL of 10SPG and make 1 mL aliquots in Cryo tubes.

    [0237] Label tubes as follows: [0238] Virus name Plaque # [0239] Cell Passage [0240] Date Initials

    [0241] Store virus aliquots at 80 C.

    Example 2

    A Single Dose Intranasal Immunization with Parainfluenza Virus 5-Based COVID-19 Vaccine Generates Sterilizing Immunity in Nasal Cavities of Ferrets and Cats

    [0242] SARS-CoV-2 is a novel betacoronavirus and the cause of COVID-19 pandemic. A vaccine to protect against SARS-CoV-2 infection is urgently needed to reduce spread and limit further mortality. Numerous vaccine candidates are being evaluated to identify an effective means to combat the pandemic. The upper respiratory tract is an initial site of SARS-CoV-2 infection, and for many infected individuals remains the primary site of viral replication. High viral loads and shedding from this region can begin several days before symptom onset and can continue for days after illness onset. Controlling infection at these sites is critical to combat the pandemic. To date, no vaccine has provided sterilizing immunity in the upper respiratory tract, such as nasal cavity of large animal models. This example has optimized a vaccine candidate in mouse models and subsequently demonstrates that a single dose intranasal immunization with a parainfluenza virus 5 (PIV5) expressing the S protein of SARS-CoV-2 induced sterilizing immunity in ferrets and cats. This mucosal vaccine strategy inhibited SARS-CoV-2 replication in upper respiratory tract, thus preventing progression of infection into lower respiratory tract. Most importantly, a vaccine candidate that induces sterilizing immunity in upper respiratory tract will likely limit transmission, thus, reducing SARS-CoV-2 infections in populations.

    [0243] The sinonasal epithelium of the upper respiratory tract is an initial site of SARS-CoV-2 infection, and for many individuals remains the primary site of virus replication. High levels of viral replication occur in the upper respiratory tract (Wolfel et al. Nature 581, 465-469 (2020)), and nasopharyngeal shedding can continue for several days following initial presentation (Li et al. Journal of Medical Virology 92, 2286-2287 (2020)). Progressive lower respiratory tract manifestations of pneumonia, acute respiratory distress syndrome (ARDS), and respiratory failure contribute to much of the COVID-19 morbidity and mortality, and there is increasing evidence of involvement of other organ systems beyond the lungs. Because the upper and lower respiratory tracts are critical sites of COVID-19 pathogenesis, stopping viral replication in the upper respiratory tract prior to progression to the lung is an important goal for a protective vaccine. Leading vaccines to date generated robust antibody responses in immunized animals and in human clinical trials, and reduced SARS-CoV-2 replication in the lower respiratory tract in non-human primate models (Corbett et al. N Engl J Med 383, 1544-1555 (2020); Gao et al. Science 369, 77-81 (2020); Mercado et al. Nature, (2020); van Doremalen et al. bioRxiv, (2020); Wang et al. Cell 182, 713-721 e719 (2020)). However, complete protection in the upper respiratory tract, which is important to prevent SARS-CoV-2 transmission, has been difficult to achieve. There are currently no reports on whether these vaccine candidates can block transmission.

    [0244] Parainfluenza virus type-5 (PIV5) is a negative-stranded RNA virus in the family Paramyxoviridae that has been evaluated as a vaccine vector for influenza, respiratory syncytial virus (RSV), rabies, and a variety of other pathogens (Chen et al. J Virol 87, 2986-2993 (2013); Li et al. mBio 11, (2020); Mooney et al. J Virol 87, 363-371 (2013); Phan et al. Vaccine 32, 3050-3057 (2014); Phan et al. J Virol 91, (2017)). In animal models PIV5 is safe, and is not associated with any disease with the exception of kennel cough in dogs (Cornwell et al. Vet Rec 98, 301-302 (1976)). Intranasally administered kennel cough vaccines containing live PIV5 have been used for over four decades with an excellent safety record. Dogs immunized with kennel cough vaccines can shed PIV5 up to for 5 days and it has been safe to humans in close contact with immunized animals (Kontor et al. American journal of veterinary research 42, 1694-1698 (1981); Chen et al. PLoS One 7, e50144 (2012)). PIV5 is particularly well suited as a vaccine vector for respiratory diseases, as when administered intranasally it elicits locally protective IgA responses in the respiratory tract as well as systemic innate and adaptive immune responses (Wang et al. J Virol 91, (2017)). Recently, a single intranasal dose of a PIV5-based MERS vaccine induced neutralizing antibodies and cellular immune responses and was 100% protective against a lethal challenge with MERS-CoV in a murine model of MERS (Li et al. mBio 11, (2020)). This example provides a promising vaccine candidate for protection against SARS-CoV-2.

    [0245] Employing a strategy similar to that used in PIV5-based MERS-CoV vaccine development, a PIV5 expressing the SARS-CoV-2 Spike (S) protein (termed CVXGA1) was generated (FIG. 18A) and confirmed its S glycoprotein expression by immunofluorescence and western blot (FIG. 18B). Besides full-length S, a cleaved product, S1, was also detected in CVXGA1-infected cells, indicating S was processed (FIG. 18B). S promotes cell-to-cell fusion and virus-to cell fusion to facilitate viral entry and immunization with S generates protective immunity against SARS-CoV-2. It is thought that the native (pre-fusion) conformation of S induces desirable immunity for optimal protection. To examine whether S expressed by CVXGA1 is functional, Vero cells, which express the ACE2 receptor, were infected with CVXGA1. Syncytia formation (cell-to-cell fusion) was observed only in CVXGA1-infected cells, indicating the S protein expressed by CVXGA1 is functional (FIG. 18C). To investigate CVXGA1 immunogenicity, immunized mice were intranasally immunized with various doses of CVXGA1. A dose-dependent increase in anti-S antibodies was detected in BALB/c mice after a single intranasal administration (FIG. 18D). Similarly, antibodies recognizing the receptor binding domain (RBD) of S were detected in a dose-dependent manner in BALB/c mice immunized with CVXGA1 (FIG. 18E). Furthermore, neutralizing antibodies against SARS-CoV-2 were detected in BALB/c mice immunized in a dose-dependent manner (FIG. 18F). Significant antibody generation and cellular responses were observed in C57BL/6 mice after a single intranasal (IN) immunization with a dose as low as 610.sup.3 plaque forming units (PFU) (FIG. 22). These results indicate that a single intranasal dose immunization with CVXGA1 generated robust immune responses in mice.

    [0246] To determine efficacy of CVXGA1, three complementary animal models were used. BALB/c mice lack a functional ACE2 receptor for SARS-CoV-2, and thus are resistant to infection. Introducing human ACE2 by adenoviral vector transduction (Ad5-hACE2) sensitized mice to SARS-CoV-2 infection resulting in a transient pneumonic infection. This mouse model was used to evaluate the efficacy of CVXGA1. Intranasal vaccination with CVXGA1 protected mice from weight loss (FIG. 23) and also reduced lung tissue titers, and tissue histopathological changes. The lack of complete protection of mice may be due to lower doses (highest at 510.sup.4 PFU per mouse) used in these experiments. Alternatively, it is possible that Ad5-hACE2 transduction may be a contributing factor in the lack of sterilizing immunity in this model. While immunization with UV inactivated SARS-CoV-2 generated higher anti-S antibody titers, no neutralizing antibody was detected (FIG. 24) and inactivated SARS-CoV-2 immunization did not protect mice against SARS-CoV-2 challenge (FIG. 19B). While CVXGA1 generated lower anti-S titers than inactivated SARS-CoV-2, it protected mice better than inactivated SARS-CoV-2, suggesting that cellular immunity generated by CVXGA1 likely played a role this outcome. This is consistent with the lack of sterilizing immunity in lungs of CVXGA1 immunized mice sensitized with Ad5-ACE2 and challenged with SARS-CoV-2.

    [0247] Previously, a PIV5-based MERS vaccine to an inactivated MERS-CoV vaccine were compared in mice and it was found that immunization with inactivated MERS-CoV caused a hypersensitivity-type immune response, indicated by an influx of eosinophils into the lungs after virus challenge. Similar to this observation, immunization with UV inactivated SARS-CoV-2 was associated with eosinophilic infiltrates, while CVXGA1 immunized mice lacked such infiltrates after challenge, suggesting that CVXGA1 did not elicit a hypersensitivity-type response (FIG. 19C, D). In contrast, all treatment groups had similar degrees of mononuclear cell infiltrations (FIG. 19C).

    [0248] Ferrets are a widely used model of human respiratory infections, are susceptible to SARS-CoV-2 infection, and can transmit the virus to other animals via direct contact and aerosol (Kim et al. Cell Host Microbe, (2020); Shi et al. Science, (2020); Richard et al. Nat Commun 11, 3496 (2020)). To examine CVXGA1 efficacy in ferrets, animals were immunized intranasally with PBS or CVXGA1 (FIG. 20A). CVXGA1 immunization generated robust antibody responses as evident by high titers of anti-S IgG (FIG. 25A), anti-RBD IgG (FIG. 20B) and neutralizing antibodies in FIG. 20C. Low levels of anti-S IgA were detected in nasal washes (FIG. 25B). When challenged with SARS-CoV-2 intranasally, no viral RNA was detected in nasal washes from CVXGA1 immunized ferrets (FIG. 20D). In contrast, viral RNA was detected in all mock-immunized ferrets (FIG. 20D and Table 3). To compare viral RNA detection with an infectious focus forming assay, infectious virus in nasal washes from 5 day post challenge (dpc) was determined using infectious focus forming assay.

    TABLE-US-00003 TABLE 3 Viral genome numbers determined using qRT-PCR in nasal washes from ferrets. 1 dpc 3 dpc 5 dpc 7 dpc PBS-1 58 302 PBS-2 51 237 41 44 PBS-3 232 35705 PBS-4 22 3489 153 5819 PBS-5 121 3838 PBS-6 97 23 15744 8645

    [0249] The detection of viral RNA genomes with qRT-PCR was comparable to the infectious focus forming assay (FIG. 25C). SARS-CoV-2 N protein was detected in the airways and parenchyma of PBS-immunized, SARS-COV-2 challenged ferrets at 4 dpc (FIG. 25D). Viral RNA was also detected in the trachea and lungs of mock-immunized ferrets but not in trachea and lungs of CVXGA1 immunized ferrets (FIGS. 20E and 20F). To assess SARS-CoV-2 exposure in ferrets, anti-S antibody levels were quantified at the time of experiment termination (7 dpc). Anti-S levels in CVXGA1 immunized group increased after challenge (FIG. 25E), indicative of a memory response and exposure to the S antigen. These results indicate that CVXGA1 immunization induced sterilizing immunity after challenge with SARS-CoV 2, most importantly in the nasal cavity, a critical site for SARS-CoV 2 replication and transmission.

    [0250] Cats are naturally susceptible to SARS-CoV-2 infection and in the laboratory, setting can transmit the virus. To determine whether CVXGA1 immunization blocks upper respiratory tract infection, cats were immunized with CVXGA1 intranasally (IN) and subcutaneously (subQ) without an adjuvant (FIG. 21A). To enhance immune responses, the group immunized via the subQ route were boosted (FIG. 21A). Both subQ (prime-boost) and IN immunizations generated similar antibody responses (FIGS. 21B and 21C and FIG. 26A). Of note, IN immunization generated detectable anti-S IgA in nasal washes (FIG. 21D). Following challenge, cats in the mock immunization group (PBS) all had high SARS-CoV-2 titers in nasal washes (average over 6.2710.sup.4 FFU/ml) at 1 day post challenge. Excitingly, in the IN immunization group, two of four cats (50%) had no detectable virus, and two of four had a 230-fold reduction in SARS-CoV-2 titers (average 2.710.sup.2 FFU/ml). Interestingly, while subQ immunization generated serum antibody titers similar to IN immunization, it did not protect against infection of the nasal cavities at 1 dpc (6.1610.sup.4 FFU/ml). However, subQ immunized cats cleared infection faster than mock-immunized cats: by 5 dpc, 3 out of 4 cats had no virus detected, while all mock immunized animals remained infected (FIG. 21E). By 7 dpc, no virus was detected in nasal washes of all cats. These results were confirmed using qRT-PCR for viral RNA (FIG. 26B). It is noteworthy and consistent with previous reports that while no live virus was detected in nasal washes at 7 dpc, viral genomes were detected up to 11 dpc in the PBS group.

    [0251] To determine the animal's exposure to SARS-CoV-2 replication, anti-N antibodies levels were measured at the end of the experiment (14 dpc). Anti-N antibodies were detected in all cats at 14 dpc; PBS- and subQ immunized cats had higher anti-N levels than IN immunized animals (FIG. 26C). Consistent with exposure to SARS-CoV-2, IN immunized animals had an increase of anti-S titers after challenge (FIG. 26D). The finding that subQ immunization generated anti-S responses comparable to the IN immunization but did not prevent infection in nasal cavities is consistent with observations that high serum antibody responses do not prevent infection of the nasal cavities. In evaluating the immune responses of individual animals, no correlation between serum antibody titers and protection of nasal cavities was observed, further confirming that anti-S antibody titers are not a predictor of protection in the sinonasal tract (Table 4).

    TABLE-US-00004 TABLE 4 Summary of Cat Experiment Neutralizing Anti-S VSV-S IgA (28 dpi (28 dpi Vaccine Animal endpoint endpoint Group ID Anti-S Anti-RBD titer) dilution) 1 DPC 3 DPC 5 DPC 7 DPC PBS 1.1 0.21 0.34 0 2 85000 290 140 0 PBS 1.2 0.21 0.26 0 0 1880 530 760 0 PBS 1.3 0.27 0.14 0 0 85000 253 220 0 PBS 1.4 0.25 0.23 0 0 79000 540 20 0 CVXGA1 2.1 2.29 1.88 479.6 0 82000 0 0 0 (SubQ) CVXGA1 2.2 2.45 2.14 176.2 0 31000 770 10 0 (SubQ) CVXGA1 2.3 1.43 0.24 0 2 40300 235 0 0 (SubQ) CVXGA1 2.4 2.25 2.02 0 0 93000 10 0 0 (SubQ) CVXGA1 3.1 1.78 1.73 0 2 160 0 0 0 (IN) CVXGA1 3.2 2.27 1.57 0 8 0 0 0 0 (IN) CVXGA1 3.3 1.72 1.77 118.8 2 0 0 0 0 (IN) CVXGA1 3.4 2.46 1.99 135.6 8 380 0 0 0 (IN)

    [0252] This work demonstrates that a PIV5-based intranasal COVID-19 vaccine can generate sterilizing immunity in animals. Further development of this vaccine candidate may provide a COVID-19 vaccine that could block SARS-CoV-2 transmission. Kennel cough vaccines have been produced inexpensively for decades. A safe, efficacious, and inexpensive COVID-19 vaccine based on the PIV5 vector may contribute to the control of COVID-19 pandemic.

    Materials and Methods

    Virus and Cells

    [0253] The CVXGA1 plasmid, encoding the full-length genome of PIV5 with SARS-CoV-2-S whose cytoplasmic tail was replaced with that of F of PIV5 and which was inserted between SH and HN of PIV5. Virus rescue was performed as described previously (Li et al., 2013, J Virol; 87:354-362, doi:10.1128/JVI.02321-12). Briefly, the CVXGA1 plasmid, as well as four helper plasmids, pPIV5-NP, pPIV5-P, pPIV5-L, and pT7-polymerase, encoding NP, P, L proteins and T7 RNA polymerase, respectively, were co-transfected into BHK21 cells at 90% confluence in 6-cm plates with Lipofectamine 3000 (Invitrogen). Virus released into the media was amplified in Vero cells. Recovery of virus is indicated by syncytia formation in Vero cells. The virus was then plaque-purified as a single plaque from Vero cells. The full-length genomes of the plaque-purified single clone of CVXGA1 virus was sequenced as described (Li et al., 2013, J Virol; 87:354-362, doi:10.1128/JVI.02321-12). Viruses were grown in Vero cells for 5 to 7 days using DMEM containing 2% FBS. Media were collected and pelleted at 3000 rpm to remove cell debris by using a Sorvall tabletop centrifuge for 10 min. Virus supernatant was supplemented with 10% sucrose-phosphate-glutamate (SPG) buffer, snap-frozen in liquid nitrogen, and stored at 80 C. immediately after collection.

    [0254] SARS-CoV-2 virus or tissue homogenate supernatants were serially diluted in DMEM. 12 well plates of VeroE6 cells were inoculated at 37 C. in 5% CO.sub.2 for 1 hr and gently rocked every 15 min. After removal of the inocula, plates were overlaid with 1.2% agarose containing 4% FBS. Three days later, overlays were removed, and plaques visualized using 0.1% crystal violet staining. Viral titers were quantified as PFU/mL tissue. SARS-CoV-2 was inactivated by exposure to UV light for 1 hr using a wattage of 4,016 W/cm.sup.2.

    [0255] All cell lines were incubated at 37 C. in 5% C02. Vero cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 5% fetal bovine serum (FBS), 100 IU/ml penicillin, and 100 g/ml streptomycin. BHK21 cells were grown in DMEM containing 10% tryptose phosphate broth (TPB), 5% fetal bovine serum (FBS), 100 IU/ml penicillin, and 100 g/ml streptomycin.

    Immunofluorescence and Immunoblotting

    [0256] Immunofluorescence of SARS-CoV-2-S expression was carried out in MDBK cells in 24-well plates that were infected with CVXGA1 or PIV5 at an MOI of 1. At 2 days postinfection (dpi), the cells were washed with PBS and then were fixed in 2% formaldehyde. The cells were permeabilized in 0.1% PBS-Saponin solution and incubated for 1 hpi with anti-SARS-CoV-2-S(Sino Biological, catalog no.40150-R007) and anti-PIV5-V/P at 1:200 dilution, and then fluorescein isothiocyanate (FITC)-labeled goat anti-Rabbit (KPL, catalog no. 02-15-16) and Cy3-labeled goat anti-Mouse (KPL, catalog no. 072-01-18-06) secondary antibodies were added to the cells. The cells were incubated for 30 min and were examined and photographed using a fluorescence microscope (Advanced Microscopy Group).

    [0257] Immunoblotting was performed on Vero cells in 12-well plates that were infected with PIV5 or CVXGA1 at an MOI of 1. At 24 hpi, Laemmli sample buffer (Bio-Rad, catalog no. 1610737) with 5% P-mercaptoethanol was used to lyse cells. The lysates were run on an SDS-PAGE gel and immunoblotted with anti-SARS-CoV-2-S(Sigma, catalog no. ZHU1076) and anti-PIV5-V/P antibody.

    Purification of S and RBD of S

    [0258] The plasmid encoding the cDNA for pre-fusion stabilized SARS-CoV-2 spike ectodomain (Wrapp et al. 2020, Science; 367:1260-1263, doi:10.1126/science.abb2507) was synthesized (Twist Bioscience) and cloned into the pTwist CMV Hygro vector. The plasmid encoding the monomeric spike receptor binding domain was obtained from BEI Resources (NR-52309). The plasmids were expanded by transformation into Escherichia coli DH5 cells with 100 g/mL of ampicillin (Thermo Fisher Scientific) used for selection. Plasmids were purified using the EZNA plasmid maxi kit (Omega Biotek), according to the manufacturer's protocol. For each liter of transfection, 1 mg of plasmid DNA was mixed with 4 mg of 25,000-molecular-weight polyethylenimine (PEI; PolySciences Inc.) in 66 ml Opti-MEM cell culture medium (Gibco). After 30 min, the DNA-PEI mixture was added to HEK293F cells (1 million cells/ml) in Freestyle 293 medium (Gibco). After 5 to 7 days, the cultures were centrifuged to pellet the cells, and the supernatants were filtered through a 0.45-m sterile filter. Recombinant proteins were purified from the filtered culture supernatants using HisTrap Excel columns (GE Healthcare Life Sciences). Each column was stored in 20% ethanol and washed with 5 column volumes (CV) of wash buffer (20 mM Tris pH 7.5, 500 mM NaCl, and 20 mM imidazole) before loading samples onto the column. After sample application, columns were washed with 10 CV of wash buffer. Proteins were eluted from the column with 6 CV of elution buffer (20 mM Tris pH 7.5, 500 mM NaCl, and 250 mM imidazole). Proteins were concentrated and buffer exchanged into phosphate buffered saline (PBS) using Amicon Ultra-15 centrifugal filter units with a 30-kDa cutoff (Millipore Sigma).

    ELISA

    [0259] To quantify the anti-SARS-CoV-2-S humoral response post-prime and post-boost, mouse serum was analyzed via ELISA. IMMULON 2HB 96-well microtiter plates were coated with 100 uL purified SARS-CoV-2-S at 1 ug/mL. The serum was serial diluted two-fold and incubated on the plates for 2 hrs. Horseradish peroxidase-labelled goat anti-mouse IgG secondary antibody (Southern Biotech, Birmingham, Alabama) was diluted 1:2500 and incubated on the wells for 1 hr. The plates were developed with KPL SureBlue Reserve TMB Microwell Peroxidase Substrate (SeraCare Life Sciences, Inc., Milford, Massachusetts), and OD450 values were detected with a BioTek Epoch Microplate Spectrophotometer (BioTek, Winooski, Vermont). Antibody endpoints were calculated as log 10 of the highest serum dilution at which the OD450 was greater than two standard deviations above the mean OD450 of nave serum.

    [0260] To detect Ferret IgG, medium binding 96-well ELISA microplates (Greiner Bio-One 655001) were coated with 20 ug of either the full length SARS-Cov-2 full spike protein or SARS-Cov-2 receptor binding domain (RBD) (Amana et al. 2020, Nat Med; 26:1033-1036, doi:10.1038/s41591-020-0913-15) in sterile 1 Phosphate Buffered Saline (Corning, 21-040-CV) overnight at 4 C. Plates were washed 3 with 300 uL 0.05% PBS-T using an automated plate washer (BioTek 405 TS Washer). All washes were performed using the same technique. Wells were blocked with 200 uL Blocking Buffer (0.5% bovine serum albumin+3% non-fat dry milk in 0.05% PBS-T), incubated 2 hours at room temperature, then washed. Heat inactivated serum was diluted in blocking buffer, 100 ul added to the appropriate wells, and incubated 2 hours at room temperature followed by a wash step. Goat anti-ferret IgG HRP conjugated antibody (Bethyl Laboratories, A140-108P) diluted 1:5000-1:10000 in blocking buffer was added at 100 uL per well and incubated for 1 hour at room temperature. Plates were washed and tapped dry to remove residual solutions. SIGMAFAST OPD (o-Phenylenediamine dihydrochloride) tablets (Sigma-Aldrich, P9187) for the detection of peroxidase activity was prepared in 20 mL DIH20 and added at 100 uL per well. Following an 8-minute development period, 50 uL 1 N H.sub.2SO.sub.4 was added to stop the reaction. Immediately, plates were read at absorbance of 490 nm (BioTek, Cytation7 machine). Background signal was calculated from the average absorbance values obtained from capture protein coated wells that received goat-anti ferret IgG HRP antibody.

    [0261] To detect feline IgG, 96-well ELISA microplates were coated and blocked as for ferret IgG assays. Heat inactivated serum was diluted in blocking buffer, 100 ul added to the appropriate wells, and incubated 2 hours at room temperature. Plates were washed and goat anti-cat IgG HRP conjugated antibody (Bethyl Laboratories, A20-120P) diluted 1:10000 in blocking buffer was added at 100 uL per well and incubated for 1 hour at room temperature. Plates were washed and tapped dry to remove residual solutions. Plates were developed and read as for ferret IgG ELISAs. Background signal was calculated from the average absorbance values obtained from capture protein coated wells that received goat-anti cat IgG HRP antibody.

    [0262] To detect feline IgA, ELISA microplates were coated, blocked, and washed as for ferret IgG detection. Two-fold serial dilutions of each nasal wash sample (collected in PBS) was performed in blocking buffer and 100 ul added to the appropriate wells. Nasal wash dilutions were incubated 2 hours at room temperature, washed, and goat anti-cat IgA HRP Conjugated Antibody (Bethyl Laboratories, A20-101P) diluted 1:10000 in blocking buffer was added at 100 uL per well and incubated 1 hour at room temperature. Plates were washed and tapped dry to remove residual solutions. Plates were developed and read as for ferret IgG ELISAs. Background signal was calculated from the average of absorbance values obtained from spike coated goat-anti cat IgA HRP only controls wells.

    [0263] To detect ferret IgA, ELISA microplates were coated, blocked, and washed as for ferret IgG detection. Two-fold serial dilutions of pooled heat inactivated nasal wash sample (collected in PBS) was performed in blocking buffer and 100 ul added to the appropriate wells. Nasal wash dilutions were incubated 2 hours at room temperature, washed, and goat anti-ferret IgA AP Conjugated Antibody (Rockland, 618-105-006) diluted 1:2000 in blocking buffer was added at 100 uL per well and incubated 1 hour at room temperature. Plates were washed and tapped dry to remove residual solutions. SIGMAFAST p-Nitrophenyl phosphate tablets (Sigma-Aldrich, N1891) for the detection of alkaline phosphatase activity was prepared in 5 mL DI H.sub.20 and added at 200 uL per well. Plates were wrapped in foil to protect from light and incubated 30-45 minutes at room temperature. Following an 8-minute development period, 50 uL 1 N H.sub.2SO.sub.4 was added to stop the reaction. Immediately, plates were read at absorbance of 405 nm (BioTek, Cytation7 machine). Background signal was calculated from the average absorbance values obtained from capture protein coated wells that received goat-anti ferret IgA AP antibody.

    Interferon- (IFN-7) ELISPOT Assay

    [0264] BD ELISPOT Mouse IFN-7 Set (BD Biosciences, San Jose, CA) was used for analyzing cellular immune responses. BD ELISPOT plates were coated with purified anti-mouse IFN- antibody 24 hours prior to performing assay. Mouse spleens (n=5, per group) were collected at 28-days post-immunization and put into 15 mL conical tubes containing 5 mL of HBSS. Splenocytes were prepared by pressing spleens through a 70 M cell strainer, incubating them with ACK lysis buffer, washing them with HBSS, and re-suspending in complete tumor medium (CTM) to a concentration of 510.sup.6 cells/mL. The capture antibody solution was removed from the plates and then the plates were washed 5-6 times with PBS. The plates were then blocked with CTM for 90 minutes. The blocking solution was discarded, and 0.1 pg of SARS-CoV-2 S peptides covering the whole protein in 50 L of CTM were added to the wells. 50 L of splenocytes were added to plates (2.510.sup.5 cells/well) and incubated at 37 C., 5% C02, for 48 hours. The spots were immunostained according to the BD ELISPOT Set instruction manual and counted using an IMMUNOSPOT analyzer (Cellular Technology Limited, CTL). Results were presented as the number of IFN- secreting cells per 106 splenocytes.

    Immunization and Infection of Mice with SARS-CoV 2

    [0265] Immunization. Six- to eight-week-old female mice (Envigo) were used in this study. The mice were anesthetized by intraperitoneal injection of 250 uL 2,2,2-tribromoethanol in tert-amyl alcohol (Avertin) and intranasally inoculated with 50 L of PBS or 10.sup.4, 10.sup.5, 10.sup.6 PFU CVXGA1. 28 days post-immunization, the mice were euthanized, serum was collected via cardiothoracic bleeds, and spleens were harvested. The mice were housed and immunized in enhanced biosafety level 2 facilities in HEPA-filtered isolators. All experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee at the University of Georgia.

    [0266] 10.sup.6 PFU UV-inactivated SARS-CoV-2 were 1:1 (vol/vol) mixed with Alum Adjuvant (Thermo, catalog no. 77161) in a volume of 200 l and delivered to mice intramuscularly. Sensitization of mice with Ad5-ACE2. The Ad5-hACE2 vector was previous described (Jia et al., 2005, J Virol; 79:14614-14621, doi:10.1128/JVI.79.23.14614-14621.2005; and Sun et al. 2020, Cell, doi:10.1016/j.cell.2020.06.010). Viral vector construction is performed using the RAPAD System VVC (Anderson et al., 2000, Gene Ther; 7:1034-1038, doi:10.1038/sj.gt.3301197). Mice were anesthetized with ketamine/xylazine (87.5 mg/kg ketamine/12.5 mg/kg xylazine) and transduced intranasally with 2.510.sup.8 PFU of Ad5-hACE2 in 75 l DMEM.

    [0267] Infection of mice. Mice were lightly anesthetized with ketamine/xylazine and intranasally inoculated with the indicated amount of SARS-CoV-2 in a total volume of 50 l DMEM. Animal weight and health were monitored daily. All experiments with SARS-CoV-2 were performed in a Biosafety Level 3 (BSL3) Laboratory. Five days post transduction, mice were anesthetized with ketamine/xylazine (87.5 mg/kg ketamine/12.5 mg/kg xylazine) and infected intranasally with 105 PFU SARS-CoV-2 (isolate USA-WA1/2020 BEI #NR-52281) in 50 l DMEM. Mice were monitored and weighted daily.

    Immunization and Infection of Ferrets with SARS-CoV 2

    [0268] Twelve, eight to nine-month-old male and female (700-2000 g) fitch ferrets were received from Triple F Farms and acclimated in UGA animal facilities. Prior to arrival, ferrets underwent sterilization and scent gland removal. Following an acclimation period of at least seven days, ferrets were anesthetized for subcutaneous placement of thermal transponders between the shoulder blades. Implantable Programmable Temperature Transponders (Bio Medic Data Systems, USA) are anchored securely to the tissue at the implantation site and allow temperature readouts ranging from 90-110 degrees Fahrenheit. Simultaneously, whole blood was collected for baseline serology and fecal swab performed for analysis of viral shedding.

    [0269] All experimental procedures were performed at the University of Georgia Biosciences Animal Facility. Animals were housed in pairs, with ad libitum access to food and water. All experiments were approved by the IACUC of the University of Georgia College of Veterinary Medicine. All procedures including nasal wash and blood collections were performed under short term isoflurane gas anesthesia.

    [0270] For infectious Sars-CoV-2 challenge, animals were transferred to the University of Georgia Animal Health Research Center Animal Biosafety Level-3 (ABSL3) facility. All experiments were approved by the IACUC of the University of Georgia College of Veterinary Medicine.

    [0271] Groups of six ferrets were vaccinated intranasally (IN) with 510.sup.6 PFU CVXGA1 in 1.0 mL sterile Phosphate Buffered Saline (PBS) distributed as 500 uL per nostril. Following vaccination, animals were monitored daily for clinical signs including nasal discharge, sneezing, diarrhea, lethargy, increased respiratory rate and effort (congestion), cyanosis, neurological changes, and response to external stimuli. Body temperature was tracked using the implanted temperature probes. Nasal washes and fecal swabs were collected 3, 7, 14, 21, and 28-days post immunization (dpi) to assess vaccine shedding. Whole blood was obtained weekly following immunization. Peripheral blood mononuclear cells (PBMCs) were isolated and cryopreserved for future analysis. For infectious challenge with SARS-Cov-2, 410.sup.5 PFU was delivered via the IN route. Again, physical observations, weights and temperatures were carried out daily. A subset of six animals were humanely euthanized and necropsied on day 4 post-challenge and remaining animals (n=6) were humanely euthanized on day 7 post-challenge. All necropsies were performed under the guidance of a board-certified veterinary pathologist. Tissue samples (trachea and lung) were collected for pathology and viral load. Terminal blood collection was carried out for serum and PBMC isolation.

    Immunization and Infection of Cats with SARS-CoV 2

    [0272] Twelve, sub adult (seven to nine-months old), intact male domestic shorthair (DSH) cats were received from MBR Wavery LLC. Following a period of acclimation, male cats were surgically castrated by a board-certified veterinary surgeon. All sterilized males were solo housed pending complete surgical recovery as determined by a boarded-certified lab animal veterinarian. Prior to immunization, cats were anesthetized using injectable anesthetics for subcutaneous placement of Implantable Programmable Temperature Transponders, IPTT 300 (Bio Medic Data Systems, USA) between the shoulder blades. Simultaneously, whole blood and fecal samples were collected. Individual serum was screened for the presence of SARS-CoV-2 protein reactive IgG antibodies by ELISA. Fecal swabs were evaluated via qRT-PCR for the presence of feline enteric coronavirus.

    [0273] All cat procedures performed prior to infectious challenge were performed at the University of Georgia Lifesciences Animal Facility. Animals were housed in groups or in pairs based on sex and temperament. Cats were fed a diet of commercially available dry food and given ad-libitum access water.

    [0274] Groups of cats (n=4/group) were vaccinated either intranasally (IN) or Subcutaneously (SQ) with 110.sup.6 PFU CVXGA1 suspended in sterile Phosphate Buffered Saline (PBS). Intranasal vaccination was completed with a 0.5 mL volume distributed as 250 uL per nostril. Subcutaneous delivery was carried out using 1.0 mL total volume. Subcutaneously vaccinated animals were boosted twenty-one days after primary injection. Following vaccination, animals were monitored daily for clinical signs including nasal discharge, sneezing, diarrhea, lethargy, increased respiratory rate and effort (congestion), cyanosis, neurological change, and response to external stimuli. Body temperature was tracked using the implanted temperature probes. Nasal washes and fecal swabs were collected 1, 3, 7, 14, 21, and 28-days post-vaccination (dpv) to assess vaccine shedding. Whole blood was obtained weekly following immunization. Peripheral blood mononuclear cells (PBMCs) were isolated and cryopreserved for future analysis. For infectious challenge SARS-Cov-2 was delivered via the IN route at a dose of 410.sup.5 PFU in 1.0 mL volume. All animals (n=12) were humanely euthanized fourteen days post-challenge. Necropsies were performed under the guidance of a board-certified veterinary pathologist. In addition to tissues, terminal blood collection was carried out for serum and PBMC isolation.

    Histology and Immunohistochemistry.

    [0275] Animals were anesthetized and perfused transcardially with PBS. Lung tissues were harvested, fixed (10% neutral buffered formalin), dehydrated through a series of alcohol and xylene baths, paraffin-embedded, sectioned (4 m) and stained with hematoxylin and eosin (HE) stains. Tissues were examined by a boarded pathologist in masked manner and following principles for reproducible tissues scores (Meyerholz and Beck, 2018, Invest; 98:844-855, doi:10.1038/s41374-018-0057-0). Perivascular eosinophil infiltration was assessed as previously described (Fuentes et al., 2015, J Virol; 89:8193-8205, doi:10.1128/JVI.00133-15). Briefly, perivascular regions with cellular infiltration were randomly selected (n=20/lung) by a masked pathologist, and the number of eosinophils was enumerated and averaged for a final score for each lung. Lungs were scored for mononuclear infiltrates, with scores of 0 representing values within normal parameters, 1 representing small aggregates in peribronchial and perivascular areas, 2 representing perivascular and periairway aggregates filling perivascular space, and 3 representing a score of 2 plus expanding sheets of infiltrates into septa and consolidation lesions in regions of the lung, respectively. Lungs were scored for granulocytic infiltrates, with scores as follows: 0, within normal parameters; 1, scattered PMNs sequestered in septa; 2, a score of 1 plus solitary PMNs extravasated in airspaces; 3, a score of 2 plus small aggregates in vessels and airspaces, respectively.

    SARS-COV2-S Neutralization

    [0276] VSV pseudotyped with SARS-CoV 2 (VSV-S) described before (Nie et al., 2020, Emerg Microbes Infect; 9:680-686, oi:10.1080/22221751.2020.1743767) was used for neutralization assay. VSV-S particles were titered by TCID50 in a 96 well plate in Vero cells to determine the optimal number of particles for neutralization. They were diluted in 2% FBS, 1% P/S in DMEM media. Titer was determined using Firefly luciferase detected Bio-Glo Luciferase Assay System by Promega. A particle control was used on each plate that consisted of a 1:1 ratio of diluted particles and sterile PBS (no serum). A negative control was also used on each plate consisting of sterile PBS and 2% FBS, 1% P/S in DMEM media to account for background.

    [0277] Serum was heat inactivated at 56 C. for 45 minutes prior to neutralization assay. It was then serial diluted in sterile PBS using 1:2 dilutions starting at 1:50 (felines) or 1:100 (ferrets) in a 96 well untreated plate containing no cells. A recovered human serum sample (+RHS) was used as a positive control in each assay and was serial diluted 1:2 starting at 1:100. Samples and controls were done in quadruplicate.

    [0278] 50 ul of diluted VSV-S particles were added to the 96 well plate containing 50 ul of diluted serum and incubated for 1 hour at 5% CO.sub.2 in 37 C. After 1 hr, the media was aspirated from a white 96 well plate contained Vero cells at 90-100% confluency and the particle-serum mixture (100 ul) was added to the cells. The plate was incubated at 5% CO.sub.2 in 37 C. for 18-24 hrs. The next day, samples were equilibrated to room temperate for 10-20 minutes and 50 ul of the Bio-Glo reagent was added to each well. Plates were read immediately using the Bio-Glo Protocol on a GloMax Luminometer by Promega.

    [0279] For neutralization with SARS-CoV-2, serum samples were heat inactivated at 56 C. for 30 minutes prior to neutralization assay. They were then serially diluted in sterile DMEM and mixed with equal volume of DMEM containing 20 PFU SARS-CoV-2. After incubation at 37 C. for 1 hr, the aliquots were added into Vero E6 cells in 12-well plates and incubated at 37 C. in 5% CO.sub.2 for 1 hr. After removal of inocula, plates were overlaid with 1.2% agarose containing 4% FBS. After further incubation at 37 C. in 5% C02 for 2 days, overlays were removed, and plaques were visualized by staining with 0.1% crystal violet.

    Sars-CoV-2 Nasal Shedding qPCR

    [0280] Generation of a standard curve. To propagate the virus used for the standard curve, Vero E6 cells were infected at approximately MOI 0.001 with SARS-CoV-2 USA-WA01/2020 (BEI Resources, cat #NR52281) passage 1 and incubated at 37 C.+5% CO.sub.2. 48 hours post-infection, the virus was collected and titered via plaque assay on Vero E6 cells with an avicel overlay of 1.2% Avicel+0.5DMEM+1% FBS+0.5 antibiotic/antimycotic. Virus, at a concentration of 1.110.sup.6 PFU/mL or 1.4410.sup.7 PFU/mL for the ferret and feline sample respectively, was mixed 1:1 with TRIzol Reagent (ThermoFisher Scientific) in order to inactivate and preserve the genetic material. Using a Quick RNA Viral Kit (Zymo Research), RNA was extracted from 600 L and eluted in 50 uL TRIzol. The RNA was serially diluted 1:10. 10 L of each virus dilution was used in a 40 uL qPCR reaction with 10 uL TaqPath 1-Step RT-qPCR Master Mix (ThermoFisher Scientific) and 3 uL nCov N1 primer/probe from EUA CDC SARS-2 kit (Integrated DNA Technologies). All qPCR reactions were analyzed using an Agilent Mx3000P.

    [0281] Ferret nasal wash qPCR. 500 uL retrieved nasal wash sample was mixed 1:1 with DNA/RNA Shield (Zymo Research). Using a Quick RNA Viral Kit (Zymo Research), RNA was extracted from 600 L and eluted in 15 uL DNA/RNA Shield. 2 ng of each nasal wash sample was used in a 40 uL qPCR reaction with 10 uL TaqPath 1-Step RT-qPCR Master Mix (ThermoFisher Scientific) and 3 uL nCov N1 primer/probe from EUA CDC SARS-2 kit (Integrated DNA Technologies). Genome copy per qPCR reaction was calculated using the standard curve. The ratio of RNA used in the qPCR reaction was calculated by dividing 2 ng by the total RNA ng per sample. To calculate the genome copy for each sample, genome copy per qPCR reaction was multiplied by the ratio of RNA used in the reaction, and genome copy per mL was back-calculated using the dilution and extraction volumes described. Samples with CT values over 37 were considered PCR-negative. For each qPCR experiment, the 1 FFU/reaction (rxn) CT value cutoff was established using the standard curve, and samples with a CT value under 37, but over the 1 FFU/rxn cutoff, were assigned a genome copy/mL value of 0.5 for graphing purpose. The 1 FFU/mL and PCR-positive cutoff lines were plotted at y=1 and y=0.1, respectively.

    Feline Nasal Wash qPCR.

    [0282] 500 uL retrieved nasal wash sample was mixed 1:1 with DNA/RNA Shield (Zymo Research). Using a Quick RNA Viral Kit (Zymo Research), RNA was extracted from 600 L and eluted in 15 uL DNA/RNA Shield. 1 L of each nasal wash sample was used in a 40 uL qPCR reaction with 10 uL TaqPath 1-Step RT-qPCR Master Mix (ThermoFisher Scientific) and 3 uL nCov N1 primer/probe from EUA CDC SARS-2 kit (Integrated DNA Technologies).

    [0283] Genome copy per qPCR reaction was calculated using the standard curve. Genome copy per mL was back-calculated using the dilution and extraction volumes described. Samples with CT values over 37 were considered PCR-negative. For each qPCR experiment, the 1 FFU/rxn CT value cutoff was established using the standard curve, and samples with a CT value under 37, but over the 1 FFU/rxn cutoff, were assigned a genome copy/mL value of 0.5 for the purpose of graphing. The 1 FFU/mL and PCR-positive cutoff lines were plotted at y=1 and y=0.1, respectively.

    Focus Forming Units Assay

    [0284] Quantification of infectious SARS-Cov-2 was carried completed by focus forming units (FFU) on Vero E6 cells. Briefly, 96-well cell culture plates were seeded at 3.210.sup.5 cells/well and incubated overnight. Confluent monolayers were incubated with 10-fold serial dilutions of inoculum in culture media of DMEM containing 2% FBS and 1 antibiotic/antimycotic media. Growth media from culture plates, 50 uL inoculum was incubated for 1 hour, 37 C., 5% CO.sub.2 with humidity. Overlay media, 0.8% methylcellulose in culture media, was applied at 150 uL/well and plates returned to 37 C., 5% CO.sub.2 with humidity for 20-24 hours. For colorimetric development of focus forming units (FFU), methylcellulose overlay was decanted, and plates washed three times with 1PBS. Fixative solution (80% methanol, 20% acetone), was added at 100 L and allowed to incubate for a minimum of 10 minutes at room temperature before submersion in fixative solution and removal from BSL3 facilities. Primary antibody (HRP-conjugated 1CO.sub.2, 1.4 g/ml) was diluted to a 1:1000 in blocking buffer (0.1% Tween 20, 5% NFDM, 5% BSA) at 75 uL/well and incubated at room temperature for 45 minutes. Next, primary solution was decanted, and plates washed twice with 0.1% PBS-T. An additional wash step was completed with dH.sub.20, 75 uL/well TMB development solution and incubated at room temperature for 1 hour. A final dH.sub.20 wash step was completed, plates air dried and images obtained with BioTek Cytation7 machine for manual FFU quantification.

    Example 3

    Protection of K18-hACE2 Mice and Ferrets Against SARS-CoV-2 Challenge by a Single Dose Mucosal Immunization with a Parainfluenza Virus 5-Based COVID-19 Vaccine

    [0285] In this example, a recombinant PIV5 containing the full-length spike of SARS-CoV-2 with its cytoplasmic tail replaced with that of PIV5 F protein (CVXGA1) was generated and tested its efficacy as a vaccine in mice and ferrets.

    [0286] Generation and analysis of PIV5 expressing the S protein of SARS-CoV 2 (CVXGA1) Employing a strategy similar to that used in PIV5-based MERS-CoV vaccine development, a PIV5 expressing the SARS-CoV-2 Spike (S) protein (termed CVXGA1) was generated (FIG. 18A). The viral genome sequence by RT-PCR sequencing and also confirmed expression of the S glycoprotein in CVXGA1-infected cells using immunofluorescence and western blot (FIG. 18B). Besides full-length S, a cleaved product, S1, was also detected in CVXGA1-infected cells, indicating S was processed (FIG. 18B). The S protein mediates cell-to-cell fusion and virus-to cell fusion to facilitate viral entry and immunization with S generates protective immunity against SARS-CoV-2 (Corbett et al. N Engl J Med, (2020)). It is thought that the native (containing pre-fusion) conformation of S induces desirable immunity for optimal protection (Corbett et al. N Engl J Med, (2020)). To examine whether the S protein expressed by the PIV5 vector is functional, Vero cells, which express the ACE2 receptor, were infected with CVXGA1. Syncytia formation (cell-to-cell fusion) was observed only in CVXGA1-infected cells, indicating functional expression of the S protein (FIG. 18C).

    CVXGA1 Generated Humoral and Cellular Immune Responses in Mice

    [0287] To investigate CVXGA1 antigenicity, mice were intranasally immunized with a range of CVXGA1 inocula. A dose-dependent increase in anti-S antibodies was detected in BALB/c mice after a single intranasal administration (FIG. 18D). Similarly, antibodies recognizing the receptor binding domain (RBD) of S were detected in a dose-dependent manner in BALB/c mice immunized with CVXGA1 (FIG. 18E). Furthermore, neutralizing antibodies against SARS-CoV-2 were detected in BALB/c mice immunized in a dose-dependent manner (FIG. 27). Significant antibody generation and cellular responses were observed in C57BL/6 mice after a single intranasal (IN) immunization with a dose as low as 610.sup.3 plaque forming units (PFU) of CVXGA1 (FIG. 33). These results indicate that a single intranasal dose immunization with CVXGA1 generated robust immune responses in mice.

    CVXGA1 Protected Mice with Human ACE2 Receptor Against SARS-CoV2 Lethal Challenge

    [0288] To determine CVXGA1 efficacy, two complementary animal models were used: a severe disease model using transgenic mice and an upper respiratory tract infection model using ferrets. Mice lack a functional ACE2 receptor for SARS-CoV-2, and thus are resistant to infection. To examine vaccine efficacy in a very stringent model human ACE2 (hACE2) transgenic mice were used. Mice expressing hACE2 under regulation of the cytokeratin 18 promoter (K18), originally developed to study SARS-CoV infection (McCray et al. J Virol 81, 813-821 (2007)), were recently demonstrated to develop severe lung disease in response to SARS-CoV-2 infection (Jiang et al. Cell 182, 50-58 e58 (2020); Zheng et al. Nature, (2020)). Inoculation K18-hACE2 mice with 10.sup.5 PFU of SARS-CoV-2 results in 100% mortality, lung disease with signs of diffuse alveolar damage, and variable spread to the CNS. The lethal dose, 50% (LD50) is estimated to be 10.sup.4 PFU (Jiang et al. Cell 182, 50-58 e58 (2020); Zheng et al. Nature, (2020)). K18-hACE2 mice were immunized intranasally with a single dose of CVXGA1 (10.sup.6 PFU), and 4 weeks later challenged with 410.sup.4 PFU of SARS-CoV-2. Another group of K18-ACE2 mice were immunized intramuscularly with UV-inactivated SARS-CoV-2, then boosted 2 weeks later. Non-vaccinated mice received intramuscular DMEM. A second control group was immunized intranasally with a single dose of PIV5 vector intranasally (10.sup.6 PFU). In response to the SARS-CoV-2 challenge, the DMEM control group lost weight and succumbed to infection by 7 days post challenge (dpc) (FIG. 28A, 28B). Mice immunized with UV-inactivated SARS-CoV-2 or PIV5 lost as much weight as the DMEM group. All PIV5 immunized mice succumbed by 7 dpc, and 4 of 6 UV-inactivated SARS-CoV-2 immunized mice died (FIG. 28A, 28B). CVXGA1-immunized mice lost no weight and all survived (FIG. 28A, 28B).

    [0289] At 5 dpc, virus titers in the lung tissue of mice immunized with DMEM, UV inactivated SARS-CoV-2, or PIV5 were similar (FIG. 28C) and all three groups demonstrated evidence of brain infection (FIG. 28D). In contrast, CVXGA1 immunized mice had no detectable SARS-CoV-2 in lung tissue, demonstrating an 5 log reduction in virus titer (FIG. 28C). Notably, 4 out of 4 CVXGA1 immunized mice had no virus detected in brain tissue (FIG. 28D) after SARS-CoV-2 challenge.

    [0290] Five days post SARS-CoV-2 challenge, virus antigen (N protein) in lung tissues was localized. Control DMEM treated animals had diffuse antigen staining throughout the airway and lung parenchymal epithelial cells (FIG. 29A). In contrast, CVXGA1 immunized mice exhibited only uncommon small foci of N protein positive cells, presumptively indicative of initial infection sites that did not progress (FIG. 29A). Lung tissues from UV-inactivated SARS-CoV-2 and PIV5 treatment groups both showed diffuse antigen positive cells (FIG. 29A)

    [0291] Lung tissue sections from animals infected with SARS-CoV-2 were examined and scored for the presence of perivascular eosinophilic infiltrates. At 5 days post infection an influx of eosinophils was clearly evident in the mice immunized with UV-inactivated SARS-CoV-2 and absent from the other groups (FIG. 29B, inset arrows). Lung tissues were also scored for the presence of perivascular inflammatory cell infiltrates. Perivascular pulmonary infiltrates, when comprised mostly of lymphoid cells, can be a favorable sign of previous antigenic exposure and effective vaccination. As shown in FIG. 29B, compared to the DMEM control group, CVXGA1 immunized mice had a significant increase in perivascular lymphoid cell infiltrates.

    [0292] The presence of interstitial disease is often a hallmark of severe viral pneumonia. Lung tissues were examined and scored for the presence of interstitial disease (H-score), defined by the presence of alveolar septal infiltration, extension into the airspaces, and associated atelectasis and edema. Compared to the other treatment groups, CVXGA1 immunized mice had the least evidence of interstitial disease at 5 days post SARS-CoV-2 challenge (FIG. 29C). Histopathologic scores for eosinophilic infiltrates, perivascular infiltrates, and severity of interstitial lung disease are presented in FIG. 29D. Furthermore, efficacy of CVXGA1 immunization against a high challenge dose (10.sup.6 PFU SARS-CoV-2 per mouse) and found CVXGA1 immunization protected 100% mice from this lethal challenge was examined (FIG. 34).

    CVXGA1 Protected Ferrets from SARS-CoV 2 Infection

    [0293] Ferrets are a widely used model of human respiratory infections, are susceptible to SARS-CoV-2 infection, and can transmit the virus to other animals via direct contact and aerosol (Kim et al. Cell Host Microbe, (2020); Shi et al. Science, (2020); Richard et al. Nat Commun 11, 3496 (2020)). To test CVXGA1 efficacy in ferrets, animals were immunized intranasally with PBS or CVXGA1 (FIG. 30A). CVXGA1 replicated in the nasal cavities of ferrets at day 3 and 7 post immunization with a peak titer greater than 10.sup.4 PFU/ml in nasal washes, and CVXGA1 was cleared by 14 days after immunization (FIG. 35A). CVXGA1 immunization generated robust antibody responses as evident by high titers of anti-S IgG (FIG. 35B), anti-RBD IgG (FIG. 30B), and neutralizing antibodies in FIG. 30C. Low levels of anti-S IgA were detected in nasal washes (FIG. 35C). When challenged with SARS-CoV-2 intranasally, no viral genome RNA was detected in nasal washes from CVXGA1 immunized ferrets (FIG. 31A). In contrast, viral RNA was detected in all mock-immunized ferrets over time (FIG. 31A). Viral RNA was also detected in the trachea and lungs of mock-immunized ferrets but not in trachea and lungs of CVXGA1 immunized ferrets (FIG. 31B, C). To assess SARS-CoV-2 exposure in ferrets, anti-S antibody levels were quantified at the time of experiment termination (7 dpc). Anti-S IgG levels in CVXGA1 immunized group increased after challenge (FIG. 35D), indicative of a memory response and exposure to the S antigen. These results indicate that CVXGA1 immunization markedly reduced SARS-CoV-2 replication in the upper respiratory tract, a site critical for SARS-CoV-2 onset.

    [0294] To determine if CVXGA1 immunization can block transmission, ferrets were immunized with a single dose of CVXGA1 as before. Control animals were immunized with PBS or empty PIV5 virus vector (FIG. 32A). 42 days after IN immunization, ferrets were challenged with SARS-CoV-2 and nasal washes collected at 1, 3, 5, 7, 9, and 11 dpc (FIG. 32A). Nave ferrets were co-housed with the challenged ferrets at a ratio of 1 nave: 1 infected beginning at 2 dpc (2 ferrets per cage). Due to animal welfare regulations, all ferrets were housed in open cages in the BSL3 facility (FIG. 36). All ferrets in the PBS and empty PIV5 vector groups became infected as indicated by detection of live SARS-CoV-2 in nasal secretions, peaking at 3 dpc (FIG. 32B). All nave ferrets co-housed with the infected PBS and empty PIV5 vector groups contracted SARS-CoV-2, with peak titers detected around 5 days after co-housing. The titers in the exposed nave animals reached similar levels as directly infected animals, consistent with 100% transmission (FIG. 32B). As before (FIG. 32B), no virus was detected in nasal cavities of CVXGA1 immunized ferrets after challenge. No virus was detected in the nave ferrets co-housed with CVXGA1-immunized and SARS-CoV-2 challenged ferrets for first 5 days after co-housing (FIG. 32B), suggesting that direct contact with CVXGA1-immunized and challenged ferrets did not result in transmission of SARS-CoV-2 to nave ferrets. Beginning 7 days after mixing, ferrets mixed with CVXGA1 immunized animals acquired infection, likely from the environment which included infected ferrets in neighboring cages (FIG. 36).

    [0295] This work demonstrates that a PIV5-based mucosal COVID-19 vaccine can prevent lethal disease in a mouse model and markedly reduce upper respiratory tract virus replication and inhibit transmission in ferrets. While no animal model completely reproduces all features of severe SARS-CoV-2 infection in humans, K18-hACE2 mice support robust virus replication and develop dose-dependent severe disease, but to date transmission has not been studied in this model (Jiang et al. Cell 182, 50-58 e58 (2020); Zheng et al. Nature, (2020)). In K18-hACE2 mice, the lethal dose, 50% (LD50) is estimated to be 10.sup.4 PFU (Zheng et al. Nature, (2020); Winkler et al. Nat Immunol21, 1327-1335 (2020)). Prime-boost of K18-hACE2 mice with UV-inactivated SARS-CoV-2 failed to protect 100% of mice from a lethal challenge. Of note is that when an estimated 100 LD50 was used, challenge (10.sup.6 PFU), mice immunized with inactivated virus lost more weight than the PBS control group (FIG. 34). Similar to previous observations with a UV-inactivated MERS-CoV vaccine, immunization with UV-inactivated SARS-CoV-2 followed with a 10.sup.6 PFU SARS-CoV-2 challenge triggered an influx of eosinophils, consistent with a hypersensitivity-type response (FIG. 34E). K18-hACE2 mice that received sublethal SARS-CoV-2 inocula survived subsequent lethal dose challenge, but virus was detected in lung tissue of surviving mice at 5 dpc (Jiang et al. Cell 182, 50-58 e58 (2020)). All mice immunized with a single dose of CVXGA1 survived an estimated 100 LD50 challenge (10.sup.6 PFU) with no detectable virus in brain, and most importantly, 75% of the mice had no virus detected in lung tissue at 5 dpc, demonstrating the potent protective efficacy of CVXGA1.

    [0296] Generating a native configuration of the viral glycoprotein as an antigen is desirable to maximize protective immune responses and may be challenging. Virus inactivation often results in undesirable changes in antigen conformation. To obtain optimal structure of purified viral glycoproteins, mutations are often introduced (Wrapp et al. Science 367, 1260-1263 (2020)). Previously, it was demonstrated that PIV5 is an excellent vector to display the RSV F protein. Cells expressing F following after infection with recombinant PIV5 containing F retains the same conformation as the native F protein in RSV-infected cells (Wang et al. J Virol 91, (2017)), demonstrating that a PIV5 live virus vector can appropriately express native viral glycoproteins. Expression of full-length SARS-CoV-2 S protein in CVXGA1-infected cells caused syncytia formation (FIG. 18C), consistent with display of a native, fusion competent S protein. PIV5 enters host cells via F and HN-mediated membrane fusion: HN binds to sialic acid residues on cell surface proteins and F promotes membrane fusion. Since sialic acid residues are ubiquitous, PIV5 is known to infect practically all mammalian cells. Thus, expressing a functional S of SARS-CoV 2 does not expand cell tropism of CVXGA1 since CVXGA1 expresses S as well as F and HN (FIG. 18A). Furthermore, the accelerated syncytia formation promoted by CVXGA1 (PIV5 also causes syncytia in Vero E6 cells, albeit at a slower rate) is unlikely to cause damage as syncytia are more commonly observed in cells grown in monolayer culture and rarely occur in primary epithelial cells that are typically well-differentiated and polarized.

    [0297] Ferrets are very susceptible to SARS-CoV-2 infection, and readily transmit the virus by direct contact and aerosol (Kim et al. Cell Host Microbe, (2020); Shi et al. Science, (2020); Richard et al. Nat Commun 11, 3496 (2020)). Direct contact is a more efficient means of transmission than an indirect (aerosol) route. In published work, one infected ferret was co-housed with one or two nave animals to study direct contact transmission (Kim et al. Cell Host Microbe, (2020); Richard et al. Nat Commun 11, 3496 (2020)). To test the vaccine in a robust transmission model, one nave ferret was co-housed with one infected ferrets (FIG. 32A and FIG. 36). A single dose IN CVXGA1 immunization completely protected against SARS-CoV-2 infection: no viral RNA was detected in nasal cavities of immunized animals (FIG. 31A). Importantly, a single dose CVXGA1 immunization inhibited direct transmission of SARS-CoV-2 (FIG. 32). Because the ferrets were housed in open cages, animals co-housed with CVXGA1-immunized ferrets became infected at 7 and 9 days after mixing, likely through environmental transmission from other cages. It is also possible that the late infections of nave ferrets co-housed with CVXGA1-immunized ferrets were a result of transmission by CVXGA1-immunized and SARS-CoV-2-challenged ferrets, thus, CVXGA1 just delayed transmission of SARS-CoV-2.

    [0298] However, no virus was detected in nasal washes or lungs of CVXGA1-immunized ferrets (FIG. 37), suggesting that the likely source of virus for the co-housed ferrets was from infected ferrets housed in neighboring open cages. The lack of viral RNA in CVXGA1-immunized ferrets after challenge supports that the late infection of ferrets co-housed with CVXGA1-immunized ferrets came from other infected ferrets (FIG. 37). There were two possible routes by which nave ferrets co-housed with CVXGA1-immunized/SARS-CoV-2 challenged ferrets to become infected at later time points. One is that the ferrets acquired infection via aerosol transmission from infected ferrets in neighboring cages, as they were housed in open cages (FIG. 36). Another possibility was contamination from husbandry and equipment: the procedure mandated by our IACUC requires cage changes for the animals every 7 days. It is possible that the co-housed ferrets acquired infection through direct contact with contaminated equipment during these cage changes. A disconnect between the viral RNA level and live virus in the PBS group was observed (FIG. 32B and FIG. 37): live virus titers peaked at day 3 and were undetectable at day 7, while viral RNA first peaked at day 3 and had a high level at day 7. This delayed clearance of viral RNA may reflect methodologic differences, in which qRT-PCR can detect residual viral RNA. Intranasal CVXGA1 immunization generated robust serum antibody responses in mice and ferrets. Importantly, IN CVXGA1 immunization induced respiratory mucosal IgA in ferrets, consistent with previous report that PIV5 is a potent vector for vaccine development for respiratory infections, including influenza virus and respiratory syncytial virus (RSV) (Wang et al. J Virol 91, (2017); Mooney et al. J Virol 91, (2017)). Mucosal IgA was also detected in monkeys immunized intranasally with PIV5 expressing RSV F (Wang et al. J Virol 91, (2017)). As a live viral vector, it was hypothesized that CVXGA1 to generate robust cellular immune responses and, as observed in FIG. 33, cellular immune responses were detected in mice. Kennel cough vaccines have been produced inexpensively and safely used for many decades and the manufacturing capacity and vaccine delivery systems for PIV5 are well-established. Further development of a PIV5 vector-based vaccine may help block SARS-CoV-2 transmission and control the COVID-19 pandemic.

    Materials and Methods

    [0299] The virus and cells preparation, the immunoblotting method, the purification of S and RBD of S, the ELISA protocol and the focus forming units assay protocol are similar to those in Example 2.

    Immunofluorescence

    [0300] Immunofluorescent localization of SARS-CoV-2-S protein expression was performed in MDBK cells in 24-well plates that were infected with CVXGA1 or PIV5 at a MOI of 1. At 2 days after infection, the cells were washed with phosphate-buffered saline (PBS) and then fixed in 2% formaldehyde. The cells were permeabilized in 0.1% PBS-Saponin solution and incubated for 1 hr with anti-SARS-CoV-2 S (Sino Biological, catalog no.40150-R007) and anti-PIV5-V/P at 1:200 dilution, and then fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit (KPL, catalog no. 02-15-16) and Cy3-labeled goat anti-mouse (KPL, catalog no. 072-01-18-06) secondary antibodies were added to the cells with 2 drops/ml of 4%6-diamidino-2-phenylindole (DAPI) (NucBlue Live Cell Stain ReadyProbes reagent, Life technologies Corporation, Eugene, Oregon, USA). The cells were incubated for 30 min and were examined and photographed using a Nikon Eclipse Ti confocal fluorescence microscope.

    Immunization and Infection of Mice with SARS-CoV 2

    [0301] Six to eight-week-old female mice (Envigo) or K18-hACE2 mice (B6.Cg.Tg(K18-hACE2)2Prlmn/J, Jackson Laboratory) were used in these studies. The mice were anesthetized by intraperitoneal injection of 250 l 2,2,2-tribromoethanol in tert-amyl alcohol (Avertin) and intranasally inoculated with 50 l of PBS (or DMEM) or 10.sup.4, 105, 10.sup.6 PFU CVXGA1 or 10.sup.6 PFU PIV5 vector. Twenty-eight days post-immunization, the mice were euthanized, serum was collected via cardiothoracic bleeds, and spleens were harvested. The mice were housed and immunized in enhanced biosafety level-2 facilities in HEPA-filtered isolators. All experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committees at the University of Georgia and at the University of Iowa.

    [0302] 10.sup.6 PFU UV-inactivated SARS-CoV-2 were 1:1 (vol/vol) mixed with Alum Adjuvant (Thermo, catalog no. 77161) in a volume of 200 l and delivered to mice intramuscularly.

    [0303] Infection of mice. Mice were lightly anesthetized with ketamine/xylazine and intranasally inoculated with the indicated amount of SARS-CoV-2 in a total volume of 50 l DMEM. Animal weight and health were monitored daily. All experiments with SARS-CoV-2 were performed in a Biosafety Level-3 (BSL3) Laboratory.

    Immunization and Infection of Ferrets with SARS-CoV-2

    [0304] Twelve, eight to nine-month-old male and female (700-2000 g) fitch ferrets were received from Triple F Farms and acclimated in the UGA animal facilities. Prior to arrival, ferrets underwent sterilization and scent gland removal. Following an acclimation period of at least seven days, ferrets were anesthetized for subcutaneous placement of thermal transponders between the shoulder blades. Implantable Programmable Temperature Transponders (Bio Medic Data Systems, USA) were anchored securely to the tissue at the implantation site and allowed temperature readouts ranging from 90-110 F. Simultaneously, whole blood was collected for baseline serology and fecal swab performed for analysis of viral shedding.

    [0305] Pre-challenge procedures were performed at the University of Georgia Biosciences Animal Facility. Animals were housed in pairs, with ad libitum access to food and water. Following vaccination, procedures, including nasal wash and blood collections, were performed on anesthetized animals using ketamine/xylazine (15-20 mg/kg/1-2 mg/kg xylazine) delivered IM. Ferrets were monitored daily for clinical signs. Weights and temperatures were recorded, at minimum, during each procedure under sedation.

    Viral Challenge of Ferrets

    [0306] For SARS-CoV-2 challenge, animals were transferred to the University of Georgia Animal Health Research Center Animal Biosafety Level-3 (ABSL3) facility. Procedures performed after viral challenge were done under short-term isoflurane gas anesthesia.

    [0307] Groups of six ferrets were vaccinated intranasally (IN) with 110.sup.6 PFU CVXGA1 in 1.0 ml sterile PBS distributed as 500 l per nostril. Following vaccination, animals were monitored daily for clinical signs, including nasal discharge, sneezing, diarrhea, lethargy, increased respiratory rate and effort (congestion), cyanosis, neurological changes, and altered responses to external stimuli. Body temperature was tracked using the implanted temperature probes. Nasal washes and fecal swabs were collected 3, 7, 14, 21, and 28 days post immunization (dpi) to assess vaccine shedding. Whole blood was obtained weekly following immunization. Peripheral blood mononuclear cells (PBMCs) were isolated and cryopreserved for future analysis. For infectious challenge with SARS-CoV-2, 110.sup.6 PFU were delivered via the IN route. Again, physical observations, weights, and temperatures were measured daily. A subset of six animals were humanely euthanized and necropsied on day 4 post-challenge, and the remaining animals (n=6) were humanely euthanized on day 7 post-challenge. All necropsies were performed under the guidance of a board-certified veterinary pathologist. Tissue samples (trachea and lung) were collected for pathology and viral load. Terminal blood collection was carried out for serum and PBMC isolation. For transmission study, at 2 days post challenge (dpc), two challenged ferrets were mixed with one nave ferret.

    Co-Housing of Ferrets

    [0308] Two days post SARS-CoV-2 challenge a nave ferret was paired with one challenged ferret. The second challenged ferret was transferred to isolation caging until necropsy 4 days post challenge.

    [0309] All experiments were approved by the IACUC of the University of Georgia College of Veterinary Medicine.

    Histology and Immunohistochemistry

    [0310] Mice were anesthetized and perfused transcardially with PBS. Lung tissues were harvested, fixed in 10% neutral-buffered formalin, dehydrated through a series of alcohol and xylene baths, paraffin-embedded, sectioned at 4 m, and stained with hematoxylin and eosin (HE) stains. Tissues were examined by a boarded pathologist in a masked manner and following principles for reproducible tissues scores (Meyerholz et al. Lab Invest 98, 844-855 (2018)). Perivascular eosinophil infiltration was assessed as previously described (Li et al. mBio 11, (2020)). Briefly, perivascular regions with cellular infiltration were randomly selected (n=20/lung), and the number of eosinophils was enumerated and averaged for a final score for each lung. Perivascular lymphoid aggregates were ordinally scored: 0absent, 1few solitary cells, 2moderate small to medium aggregates, or 3robust aggregates forming circumferential perivascular cuffs with compression of adjacent parenchyma. Interstitial disease was ordinally scored using a modified HScore: 0absent, 1minor scattered cells in septa, 2moderate infiltrates septa and extending into lumen, or 3moderate to severe infiltrates in septa and lumen with associated consolidation/atelectasis and or edema. For each the tiers the % of lung affected was recorded. The final modified H-score for each lung was calculated by: % affected x each tier score, summed, and then divided by 100 to yield a score between 0 and 3.

    [0311] Immunohistochemistry was performed as previously described (Zheng et al. Nature 589, 603-607 (2021)). Briefly, primary anti-SARS-CoV-2 N protein antibody (1:20,000 dilution60 min, 40143-R019, SinoBiological) was followed by Rabbit Envision (Dako) and diaminobenzidine (DAB, Dako) as chromogen with hematoxylin as counterstain. Ordinal scoring of immunostaining was performed in a distribution-based manner: 0absent, 1-0 to 25%, 2-26-50%, 3-51-75% and 4>75% of lung fields in tissue section.

    SARS-CoV-2 S Neutralization

    [0312] VSV pseudotyped with SARS-CoV-2 (VSV-S) described previously was used for neutralization assay (Havranek et al. Viruses 12, (2020)). VSV-S particles were titered by TCID50 in a 96-well plate in Vero cells to determine the optimal number of particles for neutralization. They were diluted in 2% FBS, 1% P/S in DMEM media. Titer was determined using Firefly luciferase detected Bio-Glo Luciferase Assay System by Promega. A particle control was used on each plate that consisted of a 1:1 ratio of diluted particles and sterile PBS (no serum). A negative control was also used on each plate consisting of sterile PBS and 2% FBS, 1% P/S in DMEM media to account for background.

    [0313] Serum was heat inactivated at 56 C. for 45 minutes prior to neutralization assay. It was then serially diluted in sterile PBS using 1:2 dilutions starting at 1:100 (ferrets) in a 96-well untreated plate containing no cells. A recovered human serum sample (+RHS) was used as a positive control in each assay and was serially diluted 1:2 starting at 1:100. Samples and controls were done in quadruplicate.

    [0314] 50 l of diluted VSV-S particles were added to the 96-well plate containing 50 l of diluted serum and incubated for 1 hour at 5% CO.sub.2 in 37 C. After 1 hour, the media was aspirated from a white 96-well plate containing Vero cells at 90-100% confluency, and the particle-serum mixture (100 l) was added to the cells. The plate was incubated at 5% C02 in 37 C. for 18-24 hours. The next day, the media was aspirated and 50 ul of Nano-glo reagent was added to each well. Plates were agitated and then read immediately using the Renilla-Luciferase Protocol on a GloMax Luminometer by Promega.

    [0315] For neutralization with SARS-CoV-2, serum samples were heat inactivated at 56 C. for 30 minutes prior to neutralization assay. They were then serially diluted in sterile DMEM and mixed with an equal volume of DMEM containing 20 PFU of SARS-CoV-2. After incubation at 37 C. for 1 hour, the aliquots were added into Vero E6 cells in 12-well plates and incubated at 37 C. in 5% CO.sub.2 for 1 h. After removal of inocula, plates were overlaid with 1.2% agarose containing 4% FBS. After further incubation at 37 C. in 5% CO.sub.2 for 2 days, overlays were removed, and plaques were visualized by staining with 0.1% crystal violet.

    Sars-CoV-2 Nasal Shedding qPCR

    [0316] For the SARS-CoV-2 RNA genome standard curve, 1.110.sup.6 PFU/ml or 1.4410.sup.7 PFU/ml for ferret and feline standards, respectively, were inactivated by dilution 1:1 (vol/vol) with TRIzol Reagent (ThermoFisher Scientific) according to inactivation protocols. RNA was extracted from 600 l of the diluted virus using a Direct-zol RNA Miniprep Plus kit (Zymo Research) and eluted in 50 l DNA/RNA-free water according to protocol. RNA purity (A.sub.260/A.sub.280) and concentration were assessed using a DeNovix DS-11 FX+ Spectrophotometer/Fluorometer (DeNovix). RNA was stored at 80 C. For the standard curve, RNA was diluted 10-fold, and 10 l of each RNA dilution was used in a 40 l qPCR reaction with 10 L TaqPath 1-Step RT-qPCR Master Mix (ThermoFisher Scientific) and 3 l nCov N1 primer/probe from EUA CDC SARS-2 kit (Integrated DNA Technologies). For nasal wash samples, 500 l of recovered nasal wash or rectal swab sample was inactivated by dilution 1:1 with 2DNA/RNA Shield (Zymo Research) and stored at 20 C. until extraction. RNA was extracted from 600 l of the diluted sample using a Quick RNA Viral Kit (Zymo Research) and eluted in 15 l DNA/RNA-free water according to protocol. RNA purity (A260/A.sub.280) and concentration were assessed using a DeNovix DS-11 FX+ Spectrophotometer/Fluorometer. RNA was stored at 80 C. All qPCR reactions were analyzed using an Agilent Mx3000P.

    [0317] Ferret nasal wash qPCR. qPCR was performed using TaqPath 1-Step RT-qPCR Master Mix (ThermoFisher Scientific) on an Agilent Mx3000P qPCR System. Each nasal wash reaction consisted of 10 l of TaqPath, 3 l of primer/probe mix, 17 l of water, and 10 l of sample diluted to 2 ng for a final reaction volume of 40 l per well. The nCoV N gene specific primers were as follows: [0318] forward, 5-GACCCCAAAATCAGCGAAAT-3 (SEQ ID NO: 14); [0319] reverse, 5-TCTGGTTACTGCCAGTTGAATCTG-3 (SEQ ID NO: 15) and [0320] probe (5-(FAM)ACCCCGCATTACGTTTGGTGGACC(BHQ1)-3 (SEQ ID NO: 16) and were purchased from Integrated DNA Technologies as part of the RUO CDC SARS-2 kit. The thermal profile consisted of 1 cycle for 2 minutes at 25 C., 1 cycle for 15 minutes at 50 C., 1 cycle for 2 minutes at 95 C., and 50 cycles of 3 seconds at 95 C., then 30 seconds at 55 C. qPCR runs for each plate included RNA standards (10-fold dilutions, 10 l per reaction, in duplicate), no template control, no polymerase control, and a sample spiked with viral RNA for a positive control. PFU/ml concentration of each sample was determined using the original PFU/ml concentration of the viral stock used for the RNA standard curve. The ratio of RNA used in the qPCR reaction was calculated by dividing 2 ng by the total RNA concentration per sample. The PFU/ml output from the standard curve was multiplied by the ratio of RNA used in the reaction, and the total PFU/ml content of the sample was determined through back-calculation using the dilution and extraction volumes described. Samples with Ct values greater than 37 were considered PCR-negative. For each qPCR plate the 1 PFU/PCR reaction (rxn) Ct value was established from the standard curve and set as y=0, the limit of detection was set at the standard curve concentration at the Ct value of 37, and the challenge dose was included for reference. All samples between 1 PFU/rxn and the limit of detection are considered PCR-positive but having non-infectious genomic material.
    Ferret Tissue qPCR.

    [0321] Tissue samples were inactivated with 1 DNA/RNA Shield at a ratio of 1 ml of Shield per 100 mg tissue. The tissue was bead-homogenized (TissueLyser II, Qiagen) at a frequency of for 1.5 minutes and homogenate was stored at 20 C. until extraction. The extraction process was the same as for nasal washes. Ferret tissues were assayed using the above protocol with the following exceptions. Each reaction consisted of 6.66 l of TaqPath, 2 l of primer/probe mix, 20.34 l of water, and 1 l of sample for a final reaction volume of 30 l per well. HPRT was used as a housekeeping gene to ensure the presence of tissue RNA in the absence of viral RNA.

    [0322] The HPRT gene specific primers (forward, 5-CACTGGGAAAACAATGCAGA-3 (SEQ ID NO: 17); and reverse, 5-ACAAAGTCAGGTTTATAGCCAACA-3 (SEQ ID NO: 18)) were synthesized by Integrated DNA Technologies. The gene specific TaqMan MGB probe 5-NED-TGCTGGTGAAgAGGACCCCTCG-MGBNFQ-3 (SEQ ID NO:19) was synthesized by Applied Biosystems. HPRT fluorescence was read using the HEX absorption and emission spectra. PFU/ml concentration of each sample was determined using the original PFU/ml concentration of the viral stock used for the RNA standard curve. The total PFU/ml content of the sample was determined through back-calculation using the dilution and extraction volumes described to PFU/ml of homogenate. Samples with Ct values greater than 37 were considered PCR-negative. For each qPCR plate, the 1 PFU/ml Ct value was established from the standard curve and set as y=0, the limit of detection was set at the standard curve concentration at the Ct value of 37. All samples between 1 PFU/ml and the limit of detection are considered PCR-positive but having non-infectious genomic material. For graphing purpose CT values under 37, but over the 1 PFU/rxn cutoff, were assigned a genome copy/mL value of 0.5.

    Example 4

    Mutations at Amino Acid Residue W886 and/or F888

    [0323] Following procedures detailed in the previous examples, a construct in which the coronavirus S protein further contains mutations at amino acid residue W886 and/or F888 was produced. A schematic of this construct is shown in FIG. 38. For example, the amino acid substitution at amino acid residue W886 can be a substitution of tryptophan (W) to arginine (R) and/or the amino acid substitution at amino acid residue W888 can be a substitution of phenylalanine (F) to arginine(R).

    [0324] The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

    Sequence Listing Free Text

    [0325] SEQ ID NO: 1 Sequence of the pDA27 (CVX-UGA1) plasmid [0326] SEQ ID NOs: 2-19 Artificial Oligonucleotide Primers