Methods and compositions for improving soybean yield
12458029 ยท 2025-11-04
Assignee
Inventors
Cpc classification
A01N63/20
HUMAN NECESSITIES
A01H3/00
HUMAN NECESSITIES
C12R2001/01
CHEMISTRY; METALLURGY
International classification
A01N63/20
HUMAN NECESSITIES
A01H3/00
HUMAN NECESSITIES
A01H6/54
HUMAN NECESSITIES
Abstract
The present disclosure provides yield enhancing compositions comprising Methylobacterium, methods for improving soy bean yield, and methods of making the compositions. Also provided are isolated soybean yield enhancing Methylobacterium.
Claims
1. A method for improving soybean plant yield that comprises: (a) applying a composition to a soybean plant or part thereof wherein the composition comprises one or more Methylobacterium selected from the group consisting of: NLS0934 (NRRL B-67341), NLS0497 (NRRL B-67925), NLS0693 (NRRL B-67926), NLS1179 (NRRL B-67929), NLS1181 (NRRL B-67927), and NLS0610 (NRRL B-67892); or the composition comprises Methylobacterium NLS0109 (NRRL B-67340) and NLS0610 (NRRL B-67892); wherein said composition further comprises at least one additional component selected from the group consisting of an additional active ingredient, an agriculturally acceptable adjuvant, and an agriculturally acceptable excipient; and, (b) growing the soybean plant to maturity, thereby improving yield of the soybean plant.
2. The method of claim 1, wherein the composition is applied to a soybean seed.
3. The method of claim 1 wherein the applied composition coats or partially coats the soybean plant or part thereof.
4. The method of claim 1 wherein the composition is applied to foliage of the soybean plant.
5. The method of claim 1 wherein said composition is applied by spraying, coating, partially coating, immersing, and/or imbibing the soybean plant or plant part with the composition.
6. The method of claim 5, wherein the applied composition coats or partially coats the soybean plant or a part thereof, wherein partial coating includes coating at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or about 99.5% of the surface area of the soybean plant or a part thereof.
7. The method of claim 1 wherein the composition further comprises Methylobacterium isolate NLS0017 (B-50931).
8. The method of claim 1, wherein said composition further comprises an additional active ingredient.
9. The method of claim 8, wherein the additional active ingredient is selected from the group consisting of a fungicide, insecticide, nematicide, and an additional biological.
10. The method of claim 9, wherein the additional biological is a biocontrol agent.
11. The method of claim 9, wherein the additional active ingredient: (a) is selected from the group consisting of clothianidin, Bacillus firmus, abamectin, thiamethoxam, imidacloprid, azoxystrobin, fluopyram, fluoxastrobin, ipconazole, mefenoxam, metalaxyl, penflufen, prothioconazole, pyraclostrobin, and sedaxane; (b) is selected from the group consisting of ISO01 (NRRL B-50929), ISO02 (NRRL B-50930), ISO03 (NRRL B-50931), ISO04 (NRRL B-50932), ISO05 (NRRL B-50933), ISO06 (NRRL B-50934), ISO07 (NRRL B-50935), ISO08 (NRRL B-50936), ISO09 (NRRL B-50937), ISO10 (NRRL B-50938), ISO11 (NRRL B-50939), ISO12 (NRRL B-50940), ISO13 (NRRL B-50941), ISO14 (NRRL B-50942), ISO16 (NRRL B-67340), and variants thereof; and/or (c) is a bacterium of the genus Actinomycetes, Agrobacterium, Arthrobacter, Alcaligenes, Aureobacterium, Azobacter, Bacillus, Beijerinckia, Brevibacillus, Burkholderia, Chromobacterium, Clostridium, Clavibacter, Comomonas, Corynebacterium, Curtobacterium, Enterobacter, Flavobacterium, Gluconobacter, Hydrogenophage, Klebsiella, Paenibacillus, Pasteuria, Phingobacterium, Photorhabdus, Phyllobacterium, Pseudomonas, Rhizobium, Bradyrhizobium, Serratia, Stenotrophomonas, Variovorax, or Xenorhadbus.
12. The method of claim 1 wherein said composition is an essentially dry fermentation product having about 5% or less water content.
13. The method of claim 12 wherein said additional component is an agriculturally acceptable excipient selected from the group consisting of woodflours, clays, activated carbon, diatomaceous earth, fine-grain inorganic solids and calcium carbonate.
14. The method of claim 12 wherein said additional component is an agriculturally acceptable adjuvant selected from the group consisting of polyvinyl acetates, polyvinyl acetate copolymers, hydrolyzed polyvinyl acetates, polyvinylpyrrolidone-vinyl acetate copolymer, polyvinyl alcohols, polyvinyl alcohol copolymers, polyvinyl methyl ether, polyvinyl methyl ether-maleic anhydride copolymer, waxes, latex polymers, celluloses, methylcelluloses, hydroxy methylcelluloses, hydroxypropylcellulose, hydroxymethylpropylcelluloses, polyvinyl pyrrolidones, alginates, dextrins, malto-dextrins, polysaccharides, fats, oils, proteins, karaya gum, jaguar gum, tragacanth gum, polysaccharide gums, mucilage, gum arabics, shellacs, vinylidene chloride polymers and copolymers, soybean-based protein polymers and copolymers, lignosulfonates, acrylic copolymers, starches, polyvinylacrylates, zeins, gelatin, carboxymethylcellulose, chitosan, polyethylene oxide, acrylamide polymers and copolymers, polyhydroxyethyl acrylate, methylacrylamide monomers, alginate, ethylcellulose, polychloroprene and syrups or mixtures thereof.
15. The method of claim 13, wherein said agriculturally acceptable excipient is a clay or inorganic solid selected from the group consisting of calcium bentonite, kaolin, china clay, talc, perlite, mica, vermiculite, silicas, quartz powder, montmorillonite and mixtures thereof.
Description
DESCRIPTION
(1) Definitions
(2) The term and/or where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term and/or as used in a phrase such as A and/or B herein is intended to include A and B, A or B, A (alone), and B (alone). Likewise, the term and/or as used in a phrase such as A, B, and/or C is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
(3) Where a term is provided in the singular, embodiments comprising the plural of that term are also provided.
(4) As used herein, the terms include, includes, and including are to be construed as at least having the features or encompassing the items to which they refer while not excluding any additional unspecified features or unspecified items.
(5) As used herein, the phrases adhered thereto and adherent refer to Methylobacterium that are associated with a solid substance by growing, or having been grown, on a solid substance.
(6) As used herein, the phrase active ingredient refers to a biological or pesticide in a composition for treatment of plants and/or plant parts.
(7) As used herein, the term biological refers to a component of a composition for treatment of plants or plant parts comprised of or derived from a microorganism. Biologicals include biocontrol agents, other beneficial microorganisms, microbial extracts, natural products, plant growth activators or plant defense agents. Non-limiting examples of biocontrol agents include bacteria, fungi, beneficial nematodes, and viruses. In certain compositions, a biological can comprise a mono-culture or co-culture of Methylobacterium, or a combination of Methylobacterium strains or isolates that have been separately cultured.
(8) As used herein, the phrase agriculturally acceptable adjuvant refers to a substance that enhances the performance of a biological or pesticide in a composition for treatment of plants and/or plant parts. In certain compositions, a biological can comprise a mono-culture or co-culture of Methylobacterium.
(9) As used herein, the phrase agriculturally acceptable excipient refers to an essentially inert substance that can be used as a diluent and/or carrier for a biological or pesticide in a composition for treatment of plants and/or plant parts. In certain compositions, a biological can comprise a mono-culture or co-culture of Methylobacterium.
(10) As used herein, the term strain shall include all isolates of such strain.
(11) As used herein, the phrase control plant refers to a plant that had not received treatment with a yield enhancing Methylobacterium or composition comprising the same at either the seed or any subsequent stage of the control plant's development. In certain embodiments, a control plant can be a plant that was treated with an additional active ingredient or a yield neutral Methylobacterium.
(12) As used herein, the phrase co-culture of Methylobacterium refers to a Methylobacterium culture comprising at least two strains of Methylobacterium or at least two species of Methylobacterium.
(13) As used herein, the phrase contaminating microorganism refers to microorganisms in a culture, fermentation broth, fermentation broth product, or composition that were not identified prior to introduction into the culture, fermentation broth, fermentation broth product, or composition.
(14) As used herein, variant when used in the context of a Methylobacterium isolate, refers to any isolate that has chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of a deposited Methylobacterium isolate provided herein. A variant of an isolate can be obtained from various sources including soil, plants or plant material and water, particularly water associated with plants and/or agriculture. Variants include derivatives obtained from deposited isolates. Methylobacterium isolates or strains can be sequenced (for example as taught by Sanger et al. (1977), Bentley et al. (2008) or Caporaso et al. (2012)) and genome-scale comparison of the sequences conducted (Konstantinidis et al. (2005)) using sequence analysis tools, such as BLAST, as taught by Altschul et al. (1990) or clustalw (www.ebi.ac.uk/Tools/msa/clustalw2/).
(15) As used herein, derivative when used in the context of a Methylobacterium isolate, refers to any Methylobacterium that is obtained from a deposited Methylobacterium isolate provided herein. Derivatives of a Methylobacterium isolate include, but are not limited to, derivatives obtained by selection, derivatives obtained by mutagenesis and selection, and genetically transformed Methylobacterium obtained from the Methylobacterium isolate. A derivative can be identified, for example based on genetic identity to the strain or isolate from which it was obtained and will generally exhibit chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of the strain or isolate from which it was derived.
(16) As used herein, sequence identity when used to evaluate whether a particular Methylobacterium strain is a variant or derivative of a Methylobacterium strain provided herein refers to a measure of nucleotide-level genomic similarity between the coding regions of two genomes. Sequence identity between the coding regions of bacterial genomes can be calculated, for example, by determining the Average Nucleotide Identity (ANI) score using FastANI (Jain et al. High throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries, Nat Communications 9, 5114 (2018)) and Han et al. (ANI tools web: a web tool for fast genome comparison within multiple bacterial strains; Database, 2016, 1-5).
(17) As used herein, the term emulsion refers to a colloidal mixture of two immiscible liquids wherein one liquid is the continuous phase and the other liquid is the dispersed phase. In certain embodiments, the continuous phase is an aqueous liquid and the dispersed phase is liquid that is not miscible, or partially miscible, in the aqueous liquid.
(18) As used herein, the phrase essentially free of contaminating microorganisms refers to a culture, fermentation broth, fermentation product, or composition where at least about 95% of the microorganisms present by amount or type in the culture, fermentation broth, fermentation product, or composition are the desired Methylobacterium or other desired microorganisms of pre-determined identity.
(19) As used herein, the phrase inanimate solid substance refers to a substance which is insoluble or partially soluble in water or aqueous solutions and which is either non-living or which is not a part of a still-living organism from which it was derived.
(20) As used herein, the phrase mono-culture of Methylobacterium refers to a Methylobacterium culture consisting of a single strain of Methylobacterium.
(21) As used herein, a pesticide refers to an insecticide, fungicide, nematocide, bacteriocide, or any combination thereof.
(22) As used herein, the phrase bacteriostatic agent refers to agents that inhibit growth of bacteria but do not kill the bacteria.
(23) As used herein, the phrase pesticide does not substantially inhibit growth of said Methylobacterium refers to any pesticide that when provided in a composition comprising a fermentation product comprising a solid substance wherein a mono-culture or co-culture of Methylobacterium is adhered thereto, results in no more than a 50% inhibition of Methylobacterium growth when the composition is applied to a plant or plant part in comparison to a composition lacking the pesticide. In certain embodiments, the pesticide results in no more than a 40%, 20%, 10%, 5%, or 1% inhibition of Methylobacterium growth when the composition is applied to a plant or plant part in comparison to a composition lacking the pesticide.
(24) As used herein, the term Methylobacterium refers to genera and species in the methylobacteriaceae family, including bacterial species in the Methylobacterium genus and proposed Methylorubrum genus (Green and Ardley (2018)). Methylobacterium includes pink-pigmented facultative methylotrophic bacteria (PPFM) and also encompasses the non-pink-pigmented Methylobacterium nodulans, as well as colorless mutants of Methylobacterium isolates. For example, and not by way of limitation, Methylobacterium refers to bacteria of the species listed below as well as any new Methylobacterium species that have not yet been reported or described that can be characterized as Methylobacterium or Methylorubrum based on phylogenetic analysis: Methylobacterium adhaesivum; Methylobacterium oryzae; Methylobacterium aerolatum; Methylobacterium oxalidis; Methylobacterium aquaticum; Methylobacterium persicinum; Methylobacterium brachiatum; Methylobacterium phyllosphaerae; Methylobacterium brachythecii; Methylobacterium phyllostachyos; Methylobacterium bullatum; Methylobacterium platani; Methylobacterium cerastii; Methylobacterium pseudosasicola; Methylobacterium currus; Methylobacterium radiotolerans; Methylobacterium dankookense; Methylobacterium soli; Methylobacterium frigidaeris; Methylobacterium specialis; Methylobacterium fujisawaense; Methylobacterium tardum; Methylobacterium gnaphalii; Methylobacterium tarhaniae; Methylobacterium goesingense; Methylobacterium thuringiense; Methylobacterium gossipiicola; Methylobacterium trifolii; Methylobacterium gregans; Methylobacterium variabile; Methylobacterium haplocladii; Methylobacterium aminovorans (Methylorubrum aminovorans); Methylobacterium hispanicum; Methylobacterium extorquens (Methylorubrum extorquens); Methylobacterium indicum; Methylobacterium podarium (Methylorubrum podarium); Methylobacterium iners; Methylobacterium populi (Methylorubrum populi); Methylobacterium isbiliense; Methylobacterium pseudosasae (Methylorubrum pseudosasae); Methylobacterium jeotgali; Methylobacterium rhodesianum (Methylorubrum rhodesianum); Methylobacterium komagatae; Methylobacterium rhodinum (Methylorubrum rhodinum); Methylobacterium longum; Methylobacterium salsuginis (Methylorubrum salsuginis); Methylobacterium marchantiae; Methylobacterium suomiense (Methylorubrum suomiense; Methylobacterium mesophilicum; Methylobacterium thiocyanatum (Methylorubrum thiocyanatum); Methylobacterium nodulans; Methylobacterium zatmanii (Methylorubrum zatmanii); Methylobacterium organophilum.
(25) As used herein, the phrase solid substance refers to a substance which is insoluble or partially soluble in water or aqueous solutions.
(26) As used herein, the phrase solid phase that can be suspended therein refers to a solid substance that can be distributed throughout a liquid by agitation.
(27) As used herein, the term non-regenerable refers to either a plant part or processed plant product that cannot be regenerated into a whole plant.
(28) As used herein, the phrase substantially all of the solid phase is suspended in the liquid phase refers to media wherein at least 95%, 98%, or 99% of solid substance(s) comprising the solid phase are distributed throughout the liquid by agitation.
(29) As used herein, the phrase substantially all of the solid phase is not suspended in the liquid phase refers to media where less than 5%, 2%, or 1% of the solid is in a particulate form that is distributed throughout the media by agitation.
(30) To the extent to which any of the preceding definitions is inconsistent with definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the preceding definition will be used herein.
(31) Yield Enhancing Methylobacterium, Compositions Comprising Yield Enhancing Methylobacterium, Methods of their Use, and Methods of Making
(32) Various yield enhancing Methylobacterium isolates, compositions comprising these Methylobacterium, methods of using the compositions to improve soybean plant yield, and methods of making the compositions are provided herein. In certain embodiments, yield enhancing Methylobacterium isolates are selected from NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof, and a combination of Methylobacterium isolate NLS0109 (NRRL B-67340) or a variant thereof, and Methylobacterium isolate NLS0017 (B-50931) or NLS0610 (ISO26) or variants thereof. Amounts of the compositions that comprise yield enhancing Methylobacterium sufficient to provide for improved soybean plant yield can be determined by measuring any or all of changes in yield relative to untreated plants or plant parts. In certain embodiments, yield can be assessed by measuring output of seed on a per unit area basis (i.e. bushels per acre, kilograms per hectare, and the like), where the yield enhancing Methylobacterium treated plants or plants grown from Methylobacterium treated seed are grown at about the same density as the control plants. In certain embodiments, yield can be assessed by measuring output on a per plant or per plant part basis (grams of seed per plant, grams of seed per pod, pods per plant, seeds per pod and the like) of the yield enhancing Methylobacterium treated plants in comparison to untreated control plants.
(33) Isolated yield enhancing Methylobacterium are provided herein. In certain embodiments, the Methylobacterium is selected from the group consisting of M. gregans, M. dankookense, M. radiotolerans, M. komagatae, and M. bullatum. In certain embodiments, the yield enhancing Methylobacterium isolate is selected from the group consisting of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof, and combinations thereof. In certain embodiments, the yield enhancing Methylobacterium isolate is selected from the group consisting of NLS0934 (NRRL B-67341), NLS1181 (ISO25), and variants thereof. In certain embodiments, the yield enhancing Methylobacterium is a combination of Methylobacterium isolates NLS0109, and NLS0017 (NRRL B-50931) or NLS0610 (ISO26). In certain embodiments, the yield enhancing Methylobacterium isolate can enhance yield when applied to a soybean seed, when applied in vegetative stages of soybean development, or when applied during reproductive stages of soybean development. In certain embodiments, the yield enhancing Methylobacterium has a chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), or NLS0610 (ISO26)); or the yield enhancing Methylobacterium is a combination of Methylobacterium variants of NLS0109 having chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of NLS0109 (NRRL B-67340), and variants of NLS0017 (NRRL B-50931) or NLS0610 (ISO26) variants having chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of NLS0017 (NRRL B-50931) or NLS0610 (ISO26). In certain embodiments, the yield enhancing Methylobacterium provides for at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, or at least about 15% increases in yield of a treated plant or a plant arising from a treated seed in comparison to untreated control plants or plants grown from untreated seeds. In certain embodiments, the yield enhancing Methylobacterium provides for at least about 2% or at least about 5% to at least about a 10% or at least about a 20% increase in yield of a treated plant or a plant grown from a treated seed in comparison to untreated control plants or plants arising from untreated seeds.
(34) In certain embodiments, the yield enhancing Methylobacterium provides for increased yield when applied to a seed. In certain embodiments, the yield enhancing Methylobacterium provides for increases in yield when applied during soybean vegetative stages of development. In certain embodiments, the yield enhancing Methylobacterium provides for increased yield when applied just prior to or during soybean reproductive stages of development. In some embodiments, a Methylobacterium is applied more than once, wherein such applications can be to a soybean seed and a soybean plant at one or more stages of development, or can be more than one application to a soybean plant at two or more developmental stages. In certain embodiments of any of the aforementioned compositions, the composition comprises a solid substance wherein a mono-culture or co-culture of Methylobacterium is adhered thereto. In certain embodiments where the Methylobacterium is adhered to a solid substance, the composition comprises a colloid formed by the solid substance wherein a mono-culture or co-culture of Methylobacterium is adhered thereto and a liquid. In certain embodiments, the colloid is a gel. In certain embodiments of certain aforementioned compositions, composition is an emulsion that does not contain a solid substance. In certain embodiments of any of the aforementioned compositions, the yield enhancing Methylobacterium is selected from the group consisting of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof. In certain embodiments of any of the aforementioned compositions, the yield enhancing Methylobacterium is a combination of Methylobacterium NLS0109, and NLS0017 or NLS0610. In certain embodiments, the yield enhancing Methylobacterium has a chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), or NLS0610 (ISO26); or the yield enhancing Methylobacterium is a combination of Methylobacterium variants of NLS0109, and NLS0017 or NLS0610 having chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of NLS0109 (NRRL B-67340), NLS0017 (NRRL B-50931) or NLS0610.
(35) In certain embodiments, isolated yield enhancing Methylobacterium can be identified by treating a plant, a seed, soil in which the plant or a plant arising from the seed are grown, or other plant growth media in which the plant or a plant arising from the seed are grown and assaying for increased yield.
(36) In certain embodiments, soybean seed or soybeans in the vegetative stages of development are treated with the yield enhancing Methylobacterium. The vegetative stages of soybean are as follows: VE (emergence), VC (cotyledon stage), V1 (first trifoliolate leaf), V2 (second trifoliolate leaf), V3 (third trifoliolate leaf), V4 (fourth trifoliate leaf), up to V(n) (nth trifoliolate leaf, where the final number of trifoliate leaves depend on the soybean variety and environmental conditions). A description of the soybean vegetative stages can be found on the world wide web (internet) at extension.agron.iastate.edu/soybean/production_growthstages.html and in Soybean Growth and Development, Pedersen, P., Iowa State University Extension and Outreach publication PM 1945 December 2009). In certain embodiments, the yield enhancing Methylobacterium are applied at about the VE to about the V4, V5, V6, or Vn stage of development, where n is the number of trifoliate leaves present immediately prior to entering the reproductive stages of development. In certain embodiments, the yield enhancing Methylobacterium are applied at about the VC, V1, V2, or V3 to about the V4, V5, V6, or Vn stage of development, where n is the number of trifoliate leaves present immediately prior to entering the reproductive stages of development. In certain embodiments, the yield enhancing Methylobacterium that is applied to the seed or during the vegetative stage is selected from the group consisting of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof.
(37) In certain embodiments, the yield enhancing Methylobacterium are applied to a transgenic soybean plant that is herbicide, insect or disease tolerant. In certain embodiments, the yield enhancing Methylobacterium are applied before, during, or after the application of glyphosate to a transgenic soybean plant that is glyphosate tolerant. Commercially available glyphosate formulations that can be used include, but are not limited to, Roundup Original MAX, Roundup PowerMAX, Roundup UltraMax, or RoundUp WeatherMAX (Monsanto Co., St. Louis, MO., USA); Touchdown IQ or Touchdown Total (Syngenta, Wilmington, Delaware, USA); Glyphomax, Glyphomax Plus, or Glyphomax XRT (Dow Agrosciences LLC, Indianapolis, IN, USA). Soybean plants are typically sprayed with glyphosate at about the V3-V4 vegetative development stage. In certain embodiments, the yield enhancing Methylobacterium that is applied before, during, or after the application of glyphosate is a derivative of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), or NLS0610 (ISO26)), that is selected for glyphosate resistance. Selections for glyphosate resistant bacteria that have been described (Comai et al., Science 221 (4608): 370-371) can be adapted for selection of yield enhancing Methylobacterium that are glyphosate resistant. The selection and use of glyphosate resistant yield enhancing Methylobacterium from mutagenized or other populations of Methylobacterium such as NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), or NLS0610 (ISO26), and variants thereof, is provided herein.
(38) In certain embodiments, soybean seed or soybeans in the late vegetative stages to reproductive stages of development are treated with the yield enhancing Methylobacterium. The late vegetative stages of soybean are the V5 or V6, to V(n) (nth trifoliolate leaf, where the final number of trifoliate leaves depend on the soybean variety and environmental conditions) stages. The reproductive stages of soybean development are: R1 (beginning floweringat least one flower on any node); R2 (full floweringan open flower at one of the two uppermost nodes); R3 (beginning podpods are 5 mm at one of the four uppermost nodes); R4 (full podpods at 2 cm at one of the four uppermost nodes); R5 (Beginning seedseed is 3 mm long in the pod at one of the four uppermost nodes on the main stem); R6 (full seedpod containing a green seed that fills the pod capacity at one of the four uppermost nodes on the main stem); R7 (beginning maturityone normal pod on the main stem has reached its mature pod color); and R8 (full maturity95% of the pods have reached their full mature color. In certain embodiments, the yield enhancing Methylobacterium that is applied to late vegetative or reproductive stage is selected from the group consisting of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof, and a combination of Methylobacterium NLS0109, and NILS0017 or NILS0610, and variants thereof.
(39) Various Methylobacterium isolates provided herein are disclosed in Table 1.
(40) TABLE-US-00001 TABLE 1 Methylobacterium isolates ISOLATE NLS USDA ARS Deposit Identifier No. No. NRRL No..sup.1 Methylobacterium sp. #1 ISO01 NLS0046 NRRL B-50929 Methylobacterium sp. #2 ISO02 NLS0020 NRRL B-50930 Methylobacterium sp. #3 ISO03 NLS0017 NRRL B-50931 Methylobacterium sp. #4 ISO04 NLS0042 NRRL B-50932 Methylobacterium sp. #5 ISO05 NLS0089 NRRL B-50933 Methylobacterium sp. #6 ISO06 NLS0068 NRRL B-50934 Methylobacterium sp. #7 ISO07 NLS0065 NRRL B-50935 Methylobacterium sp. #8 ISO08 NLS0069 NRRL B-50936 Methylobacterium sp. #9 ISO09 NLS0062 NRRL B-50937 Methylobacterium sp. #10 ISO10 NLS0064 NRRL B-50938 Methylobacterium sp. #11 ISO11 NLS0021 NRRL B-50939 Methylobacterium sp. #12 ISO12 NLS0066 NRRL B-50940 Methylobacterium sp. #13 ISO13 NLS0037 NRRL B-50941 Methylobacterium sp. #14 ISO14 NLS0038 NRRL B-50942 Methylobacterium #16 ISO16 NLS0109 NRRL B-67340 Methylobacterium #17 ISO17 NLS0934 NRRL B-67341 Methylobacterium sp #22 ISO22 NLS0497 NRRL B-67925 Methylobacterium sp #23 ISO23 NLS0693 NRRL B-67926 Methylobacterium sp #24 ISO24 NLS1179 NRRL B-67929 Methylobacterium sp #25 ISO25 NLS1181 NRRL B-67927 Methylobacterium sp #26 ISO26 NLS0610 NRRL B-67892 .sup.1Deposit number for strain deposited with the AGRICULTURAL RESEARCH SERVICE CULTURE COLLECTION (NRRL) of the National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 61604 U.S.A. under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. Subject to 37 CFR 1.808(b), all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of any patent from this patent application.
(41) Variants of a Methylobacterium isolate listed in Table 1 include derivatives obtained therefrom by genetic transformation, mutagenesis and/or insertion of a heterologous sequence. In some embodiments, such variants are identified by the presence of chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of the strain from which it was derived. In certain embodiments, derivatives and other variants are distinguished by the presence of one or more unique DNA sequences that include: (i) a unique sequence of SEQ ID NOs: 1-15 and SEQ ID NOs: 61-79. Specific assays and primer sequences that use such sequences for specific detection of Methylobacterium strains from isolated DNA or various samples from treated plants are described in the examples herein, and in WO2020010264.
(42) Co-assigned patents or patent applications that disclose additional specific uses of certain Methylobacterium strains of Table 1 such as: increasing corn yield (US20160295868); improving lettuce cultivation (U.S. Pat. No. 10,212,939); improving tomato growth (U.S. Pat. No. 10,368,547); improving soybean yield (US2016/0302423); improving fruit production (U.S. Pat. No. 10,111,438); controlling corn rootworm (US20170238553); controlling root lesion nematodes (U.S. Pat. No. 10,448,645); controlling root knot nematodes (U.S. Pat. No. 10,098,353); and controlling fungal disease (US20180295841 and US20190364905) are each incorporated herein by reference in their entireties.
(43) Also provided herein are methods for improving soybean yield that comprise applying any of the aforementioned compositions provided herein to a plant or a plant part in an amount that provides for increased soybean yield in the plant, plant part, or a plant obtained therefrom relative to infection of a control plant, plant part, or plant obtained therefrom that had not received an application of the composition. In certain embodiments, the plant part is selected from the group consisting of a leaf, a stem, a flower, a root, a pod, a coleoptile and a seed. In certain embodiments, the method further comprises the step of harvesting at least one plant part selected from the group consisting of a leaf, a stem, a flower, a root, a pod, or a seed from the plant or plant part. In certain embodiments of any of the aforementioned methods, the methods further comprise obtaining a processed food or feed composition from the plant or plant part. In certain embodiments, the processed food or feed composition is a meal or a paste. In certain embodiments of any of the aforementioned methods, the yield enhancing Methylobacterium is selected from the group consisting of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof. In certain embodiments of any of the aforementioned compositions, the yield enhancing Methylobacterium is a combination of Methylobacterium NLS0109, and NLS0017 or NLS0610, or variants thereof.
(44) Also provided are methods of making the compositions useful for improving soybean yield that comprise combining a yield enhancing Methylobacterium with an agriculturally acceptable excipient and/or with an agriculturally acceptable adjuvant. In certain embodiments of the methods, the Methylobacterium is adhered to a solid substance. In certain embodiments of the methods, the Methylobacterium is adhered to a solid substance, where the solid substance is combined with a liquid to form a composition that is a colloid. In certain embodiments of the methods, the colloid is a gel. In certain embodiments of the methods, Methylobacterium adhered to a solid substance is provided by culturing the Methylobacterium in the presence of the solid substance. In certain embodiments of the methods, the composition comprises an emulsion. In certain embodiments of the methods, the Methylobacterium is provided by culturing the Methylobacterium in an emulsion. In certain embodiments of any of the aforementioned methods, the yield enhancing Methylobacterium is selected from the group consisting of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof. In certain embodiments of any of the aforementioned compositions, the yield enhancing Methylobacterium is a combination of Methylobacterium NLS0109, and NLS0017 or NLS0610, or variants thereof.
(45) Methods where Methylobacterium are cultured in biphasic media comprising a liquid phase and a solid substance have been found to significantly increase the resultant yield of Methylobacterium relative to methods where the Methylobacterium are cultured in liquid media alone. In certain embodiments, the methods can comprise growing the Methylobacterium in liquid media with a particulate solid substance that can be suspended in the liquid by agitation under conditions that provide for Methylobacterium growth. In certain embodiments where particulate solid substances are used, at least substantially all of the solid phase can thus be suspended in the liquid phase upon agitation. Such particulate solid substances can comprise materials that are about 1 millimeter or less in length or diameter. In certain embodiments, the degree of agitation is sufficient to provide for uniform distribution of the particulate solid substance in the liquid phase and/or optimal levels of culture aeration. However, in other embodiments provided herein, at least substantially all of the solid phase is not suspended in the liquid phase, or portions of the solid phase are suspended in the liquid phase and portions of the solid phase are not suspended in the liquid phase. Non-particulate solid substances can be used in certain biphasic media where the solid phase is not suspended in the liquid phase. Such non-particulate solid substances include, but are not limited to, materials that are greater than about 1 millimeter in length or diameter. Such particulate and non-particulate solid substances also include, but are not limited to, materials that are porous, fibrous, or otherwise configured to provide for increased surface areas for adherent growth of the Methylobacterium. Biphasic media where portions of the solid phase are suspended in the liquid phase and portions of the solid phase are not suspended in the liquid phase can comprise a mixture of particulate and non-particulate solid substances. Such particulate and non-particulate solid substances used in any of the aforementioned biphasic media also include, but are not limited to, materials that are porous, fibrous, or otherwise configured to provide for increased surface areas for adherent growth of the Methylobacterium. In certain embodiments, the media comprises a colloid formed by a solid and a liquid phase. A colloid comprising a solid and a liquid can be pre-formed and added to liquid media or can be formed in media containing a solid and a liquid. Colloids comprising a solid and a liquid can be formed by subjecting certain solid substances to a chemical and/or thermal change. In certain embodiments, the colloid is a gel. In certain embodiments, the liquid phase of the media is an emulsion. In certain embodiments, the emulsion comprises an aqueous liquid and a liquid that is not miscible, or only partially miscible, in the aqueous liquid. Liquids that are not miscible, or only partially miscible, in water include, but are not limited to, any of the following: (1) liquids having a miscibility in water that is equal to or less than that of pentanol, hexanol, or heptanol at 25 degrees C.; (2) liquids comprising an alcohol, an aldehyde, a ketone, a fatty acid, a phospholipid, or any combination thereof; (3) alcohols selected from the group consisting of aliphatic alcohols containing at least 5 carbons and sterols; (4) an animal oil, microbial oil, synthetic oil, plant oil, or combination thereof; and/or, (5) a plant oil is selected from the group consisting of corn, soybean, cotton, peanut, sunflower, olive, flax, coconut, palm, rapeseed, sesame seed, safflower, and combinations thereof. In certain embodiments, the immiscible or partially immiscible liquid can comprise at least about 0.02% to about 20% of the liquid phase by mass. In certain embodiments, the methods can comprise obtaining a biphasic culture media comprising the liquid, the solid, and Methylobacterium and incubating the culture under conditions that provide for growth of the Methylobacterium. Biphasic culture medias comprising the liquid, the solid, and Methylobacterium can be obtained by a variety of methods that include, but are not limited to, any of: (a) inoculating a biphasic media comprising the liquid and the solid substance with Methylobacterium; (b) inoculating the solid substance with Methylobacterium and then introducing the solid substance comprising the Methylobacterium into the liquid media; (c) inoculating the solid substance with Methylobacterium, incubating the Methylobacterium on the solid substance, and then introducing the solid substance comprising the Methylobacterium into the liquid media; or (d) any combination of (a), (b), or (c). Methods and compositions for growing Methylobacterium in biphasic media comprising a liquid and a solid are disclosed in co-assigned U.S. Pat. Nos. 9,181,541 and 9,845,462, which are incorporated herein by reference in their entirety, and in co-assigned International Patent Publication WO2013181610, published Dec. 5, 2013, which is incorporated herein by reference in its entirety.
(46) Methods where Methylobacterium are cultured in media comprising an emulsion have also been found to significantly increase the resultant yield of Methylobacterium relative to methods where the Methylobacterium are cultured in liquid media alone. In certain embodiments, the methods for making the compositions provided herein can comprise growing the yield enhancing Methylobacterium in an emulsion under conditions that provide for Methylobacterium growth. Medias comprising the emulsion and yield enhancing Methylobacterium can be obtained by a variety of methods that include, but are not limited to, any of: (a) inoculating a media comprising the emulsion with Methylobacterium; (b) inoculating the aqueous liquid with the Methylobacterium, introducing the non-aqueous liquid, and mixing to form an emulsion; (c) inoculating the aqueous liquid with the Methylobacterium, introducing the non-aqueous liquid, and mixing to form an emulsion; or (d) any combination of (a), (b), or (c). In certain embodiments, the emulsion comprises an aqueous liquid and a liquid that is not miscible, or only partially miscible, in the aqueous liquid. Non-aqueous liquids that are not miscible, or only partially miscible, in water include, but are not limited to, any of the following: (1) liquids having a miscibility in water that is equal to or less than that of n-pentanol, n-hexanol, or n-heptanol at 25 degrees C.; (2) liquids comprising an alcohol, an aldehyde, a ketone, a fatty acid, a phospholipid, or any combination thereof; (3) alcohols is selected from the group consisting of aliphatic alcohols containing at least 5, 6, or 7 carbons and sterols; (4) an animal oil, microbial oil, synthetic oil, plant oil, or combination thereof; and/or, (5) a plant oil is selected from the group consisting of corn, soybean, cotton, peanut, sunflower, olive, flax, coconut, palm, rapeseed, sesame seed, safflower, and combinations thereof. In certain embodiments, the immiscible or partially immiscible non-aqueous liquid can comprise at least about 0.02% to about 20% of the emulsion by mass. In certain embodiments, the immiscible or partially immiscible non-aqueous liquid can comprise at least about any of about 0.05%, 0.1%, 0.5%, or 1% to about 3%, 5%, 10%, or 20% of the emulsion by mass. Methods and compositions for growing Methylobacterium in media comprising an emulsion are disclosed in co-assigned U.S. Pat. No. 10,287,544 and International Patent Publication WO2014194189, published Dec. 4, 2014, which are incorporated herein by reference in their entireties.
(47) In some embodiments, the composition or method disclosed herein may comprise one or more additional components. In some embodiments an additional component can be an additional active ingredient, for example, a pesticide or a second biological. The pesticide may be, for example, an insecticide, a fungicide, an herbicide, or a nematicide. The second biological can be a biocontrol agent.
(48) Non-limiting examples of insecticides and nematicides include carbamates, diamides, macrocyclic lactones, neonicotinoids, organophosphates, phenylpyrazoles, pyrethrins, spinosyns, synthetic pyrethroids, tetronic and tetramic acids. In particular embodiments insecticides and nematicides include abamectin, aldicarb, aldoxycarb, bifenthrin, carbofuran, chlorantraniliporle, chlothianidin, cyfluthrin, cyhalothrin, cypermethrin, deltamethrin, dinotefuran, emamectin, ethiprole, fenamiphos, fipronil, flubendiamide, fosthiazate, imidacloprid, ivermectin, lambda-cyhalothrin, milbemectin, nitenpyram, oxamyl, permethrin, tioxazafen, spinetoram, spinosad, spirodichlofen, spirotetramat, tefluthrin, thiacloprid, thiamethoxam, and thiodicarb.
(49) Non-limiting examples of useful fungicides include aromatic hydrocarbons, benzimidazoles, benzthiadiazole, carboxamides, carboxylic acid amides, morpholines, phenylamides, phosphonates, quinone outside inhibitors (e.g. strobilurins), thiazolidines, thiophanates, thiophene carboxamides, and triazoles. Particular examples of fungicides include acibenzolar-S-methyl, azoxystrobin, benalaxyl, bixafen, boscalid, carbendazim, cyproconazole, dimethomorph, epoxiconazole, fluopyram, fluoxastrobin, flutianil, flutolanil, fluxapyroxad, fosetyl-Al, ipconazole, isopyrazam, kresoxim-methyl, mefenoxam, metalaxyl, metconazole, myclobutanil, orysastrobin, penflufen, penthiopyrad, picoxystrobin, propiconazole, prothioconazole, pyraclostrobin, sedaxane, silthiofam, tebuconazole, thifluzamide, thiophanate, tolclofos-methyl, trifloxystrobin, and triticonazole.
(50) Non-limiting examples of herbicides include ACCase inhibitors, acetanilides, AHAS inhibitors, carotenoid biosynthesis inhibitors, EPSPS inhibitors, glutamine synthetase inhibitors, PPO inhibitors, PS II inhibitors, and synthetic auxins. Particular examples of herbicides include acetochlor, clethodim, dicamba, flumioxazin, fomesafen, glyphosate, glufosinate, mesotrione, quizalofop, saflufenacil, sulcotrione, and 2,4-D.
(51) In some embodiments, compositions or methods disclosed herein may comprise an additional active ingredient which may be an additional biological. The additional biological could be a biocontrol agent, other beneficial microorganisms, microbial extracts, natural products, plant growth activators or a plant defense agent. Non-limiting examples of biocontrol agents include bacteria, fungi, beneficial nematodes, and viruses.
(52) In certain embodiments, an additional biological can be Methylobacterium. In certain embodiments, the additional biological is a Methylobacterium listed in Table 1, or variants thereof. Thus, compositions or methods comprised herein can comprise two or more of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), or variants thereof. In certain embodiments, an additional biological is selected from the group consisting of ISO01 (NRRL B-50929), ISO02 (NRRL B-50930), ISO03 (NRRL B-50931), ISO04 (NRRL B-50932), ISO05 (NRRL B-50933), ISO06 (NRRL B-50934), ISO07 (NRRL B-50935), ISO08 (NRRL B-50936), ISO09 (NRRL B-50937), ISO10 (NRRL B-50938), ISO11 (NRRL B-50939), ISO12 (NRRL B-50940), ISO13 (NRRL B-50941), ISO14 (NRRL B-50942), ISO16 (NRRL B-67340), and variants thereof. In certain embodiments, the aforementioned variant thereof can be a Methylobacterium having chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of ISO01 (NRRL B-50929), ISO02 (NRRL B-50930), ISO03 (NRRL B-50931), ISO04 (NRRL B-50932), ISO05 (NRRL B-50933), ISO06 (NRRL B-50934), ISO07 (NRRL B-50935), ISO08 (NRRL B-50936), ISO09 (NRRL B-50937), ISO10 (NRRL B-50938), ISO11 (NRRL B-50939), ISO12 (NRRL B-50940), ISO13 (NRRL B-50941), ISO14 (NRRL B-50942) or ISO16 (NRRL B-67340). In certain embodiments, an additional biological can be a Methylobacterium selected from M. gregans, M. radiotolerans, M. extorquens, M. populi, M. salsuginis, M. brachiatum, and M. komagatae.
(53) In certain embodiments, the additional biological can be a bacterium of the genus Actinomycetes, Agrobacterium, Arthrobacter, Alcaligenes, Aureobacterium, Azobacter, Beijerinckia, Bacillus, Brevibacillus, Burkholderia, Chromobacterium, Clostridium, Clavibacter, Comomonas, Corynebacterium, Curtobacterium, Enterobacter, Flavobacterium, Gluconobacter, Hydrogenophage, Klebsiella, Methylobacterium, Paenibacillus, Pasteuria, Phingobacterium, Photorhabdus, Phyllobacterium, Pseudomonas, Rhizobium, Bradyrhizobium, Serratia, Stenotrophomonas, Variovorax, or Xenorhadbus. In particular embodiments the bacteria is selected from the group consisting of Bacillus amyloliquefaciens, Bacillus cereus, Bacillus firmus, Bacillus lichenformis, Bacillus pumilus, Bacillus sphaericus, Bacillus subtilis, Bacillus thuringiensis, Chromobacterium suttsuga, Pasteuria penetrans, Pasteuria usage, and Pseudomona fluorescens.
(54) In certain embodiments the additional biological can be a fungus of the genus Alternaria, Ampelomyces, Aspergillus, Aureobasidium, Beauveria, Colletotrichum, Coniothyrium, Gliocladium, Metarhisium, Muscodor, Paecilonyces, Trichoderma, Typhula, Ulocladium, or Verticilium. In particular embodiments the fungus is Beauveria bassiana, Coniothyrium minitans, Gliocladium vixens, Muscodor albus, Paecilomyces lilacinus, or Trichoderma polysporum.
(55) In further embodiments the additional biological can be a nodulation related factor, plant growth activator or plant defense agent including, but not limited to harpin, Reynoutria sachalinensis, jasmonate, lipochitooligosaccharides (LCO), and isoflavones. In certain embodiments, additional biological components can include a combination of a bacterium and a nodulation related factor, plant growth activator or plant defense agent. One such combination includes, but not limited to, Optimize, a combination of Bradyrhizobium japonicum and LCO.
(56) In further embodiments, the additional biological can include, but is not limited to, various Bacillus sp., Pseudomonas sp., Coniothyrium sp., Pantoea sp., Streptomyces sp., and Trichoderma sp. Microbial biopesticides can be a bacterium, fungus, virus, or protozoan. Particularly useful biopesticidal microorganisms include various Bacillus subtilis, Bacillus thuringiensis, Bacillus pumilis, Pseudomonas syringae, Trichoderma harzianum, Trichoderma virens, and Streptomyces lydicus strains. Other microorganisms that are added can be genetically engineered or wild-type isolates that are available as pure cultures. In certain embodiments, it is anticipated that the biological or biocontrol agent can be provided in the fermentation broth, fermentation broth product, or composition in the form of a spore.
(57) In certain embodiments, the fermentation broth, fermentation broth product, or compositions that comprise yield enhancing Methylobacterium can further comprise one or more introduced additional active ingredients or microorganisms of pre-determined identity other than Methylobacterium.
(58) In certain embodiments, the liquid culture medium is prepared from inexpensive and readily available components, including, but not limited to, inorganic salts such as potassium phosphate, magnesium sulfate and the like, carbon sources such as glycerol, methanol, glutamic acid, aspartic acid, succinic acid and the like, and amino acid blends such as peptone, tryptone, and the like. Exemplary liquid media that can be used include, but are not limited to, ammonium mineral salts (AMS) medium (Whittenbury et al., 1970), Vogel-Bonner (VB) minimal culture medium (Vogel and Bonner, 1956), and LB broth (Luria-Bertani Broth).
(59) In general, a solid substance that can be used in the methods and compositions to provide for the efficient growth of Methylobacterium can be any suitable solid substance which is insoluble or only partially soluble in water or aqueous solutions. Such suitable solid substances are also non-bacteriocidal or non-bacteriostatic with respect to yield enhancing Methylobacterium when the solid substances are provided in the liquid culture media. In certain embodiments, such suitable solid substances are also solid substances that are readily obtained in sterile form or rendered sterile. Solid substances can be sterilized by any method that provides for removal of contaminating microorganisms and thus include, but are not limited to, methods such as autoclaving, irradiation, chemical treatment, and any combination thereof. These solid substances include natural substances of animal, plant, microbial, fungal, or mineral origin, manmade substances, or combinations of natural and manmade substances. In certain embodiments, solid substances are inanimate solid substances. Inanimate solid substances of animal, plant, microbial, or fungal origin can be obtained from animals, plants, microbes, or fungi that are inviable (i.e. no longer living) or that have been rendered inviable. Diatom shells are thus inanimate solid substances when previously associated diatom algae have been removed or otherwise rendered inviable. Since diatom shells are inanimate solid substances, they are not considered to be photosynthetic organisms or photosynthetic microorganisms. In certain embodiments, solid substances include, but are not limited to, sand, silt, soil, clay, ash, charcoal, diatomaceous earth and other similar minerals, ground glass or glass beads, ground ceramic materials, ceramic beads, bentonite, kaolin, talc, perlite, mica, vermiculite, silicas, quartz powder, montmorillonite, and combinations thereof. In certain embodiments, a solid substance can be a polymer or polymeric beads. Polymers that can be used as a solid substance include, but are not limited to, various polysaccharides such as cellulosic polymers and chitinous polymers which are insoluble or only partially soluble in water or aqueous solutions, agar (i.e. galactans), and combinations thereof. In certain embodiments, a solid substance can be an insoluble or only partially soluble salt crystal. Salt crystals that can be used include, but are not limited to, insoluble or only partially soluble carbonates, chromates, sulfites, phosphates, hydroxides, oxides, and sulfides. In certain embodiments, a solid substance can be a microbial cell, fungal cell, microbial spore, or fungal spore. In certain embodiments, a solid substance can be a microbial cell or microbial spore wherein the microbial cell or microbial spore is not a photosynthetic microorganism. In certain embodiments, the microbial cell or microbial spore is not a photosynthetic microorganism, where the photosynthetic microorganism is selected from the group consisting of algae, cyanobacteria, diatoms, Botryococcus braunii, Chlorella, Dunaliella tertiolecta, Gracilaria, Pleurochrysis carterae, Sargassum, and Ulva. In still other embodiments, a solid substance can be an inactivated (i.e. inviable) microbial cell, fungal cell, microbial spore, or fungal spore. In still other embodiments, a solid substance can be a quiescent (i.e. viable but not actively dividing) microbial cell, fungal cell, microbial spore, or fungal spore. In still other embodiments, a solid substance can be cellular debris of microbial origin. In still other embodiments, a solid substance can be particulate matter from any part of a plant. Plant parts that can be used to obtain a solid substance include, but are not limited to, cobs, husks, hulls, leaves, roots, flowers, stems, barks, seeds, and combinations thereof. Products obtained from processed plant parts including, but not limited to, bagasse, wheat bran, soybean grits, crushed seed cake, stover, and the like can also be used. Such plant parts, processed plants, and/or processed plant parts can be milled to obtain a solid material in a particulate form that can be used. In certain embodiments, wood or a wood product including, but not limited to, wood pulp, sawdust, shavings, and the like can be used. In certain embodiments, a solid substance can be a particulate matter from an animal(s), including, but not limited to, bone meal, gelatin, ground or powdered shells, hair, macerated hide, and the like.
(60) In certain embodiments, a solid substance is provided in a particulate form that provides for distribution of the solid substance in the culture media. In certain embodiments, a solid substance is comprised of particle of about 2 microns to about 1000 microns in average length or average diameter. In certain embodiments, a solid substance is comprised of particle of about 1 micron to about 1000 microns in average length or average diameter. In certain embodiments, a solid substance is a particle of about 1, 2, 4, 10, 20, or 40 microns to any of about 100, 200, 500, 750, or 1000 microns in average length or average diameter. Desirable characteristics of particles used in the methods and compositions provided herein include suitable wettability such that the particles can be suspended throughout the media upon agitation.
(61) In certain embodiments, a solid substance is provided in the media as a colloid wherein the continuous phase is a liquid and the dispersed phase is the solid. Suitable solids that can be used to form colloids in liquid media used to grow yield enhancing Methylobacterium include, but are not limited to, various solids that are referred to as hydrocolloids. Such hydrocolloids used in the media, methods and compositions provided herein can be hydrophilic polymers, of plant, animal, microbial, or synthetic origin. Hydrocolloid polymers used in the methods can contain many hydroxyl groups and/or can be polyelectrolytes. Hydrocolloid polymers used in the compositions and methods provided herein include, but are not limited to, agar, alginate, arabinoxylan, carrageenan, carboxymethylcellulose, cellulose, curdlan, gelatin, gellan, -glucan, guar gum, gum arabic, locust bean gum, pectin, starch, xanthan gum, and mixtures thereof. In certain embodiments, a colloid used in the media, methods, and compositions provided herein can comprise a hydrocolloid polymer and one or more proteins.
(62) In certain embodiments, a solid substance can provide for adherent growth of the yield enhancing Methylobacterium on the solid substance. Yield enhancing Methylobacterium that are adhered to a solid substance are Methylobacterium that cannot be substantially removed by simply washing the solid substance with the adherent yield enhancing Methylobacterium with growth media whereas non-adherent Methylobacterium can be substantially removed by washing the solid substance with liquid growth media. In this context, substantially removed means that at least about 30%, 40%, 50%, 60%, 70%, or 80% the Methylobacterium present are removed when the solid substance is washed with three volumes of liquid growth media. Such washing can be effected by a variety of methods including, but not limited to, decanting liquid from a washed solid phase or passing liquid through a solid phase on a filter that permits flow through of bacteria in the liquid. In certain embodiments, the adherent yield enhancing Methylobacterium that are associated with the solid can include both Methylobacterium that are directly attached to a solid and/or Methylobacterium that are indirectly attached to a solid substance. Methylobacterium that are indirectly attached to a solid substance include, but are not limited to, Methylobacterium that are attached to another Methylobacterium or to another microorganism that is attached to the solid substance, Methylobacterium that are attached to a solid substance by being attached to another substance that is attached to the solid substance, and the like. In certain embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99.5% or 99.9% of the Methylobacterium in the fermentation broth, fermentation broth product, or compositions are Methylobacterium that are adhered to a solid substance. In certain embodiments, adherent yield enhancing Methylobacterium can be present on the surface of a solid substance in the fermentation broth, fermentation broth product, or composition at a density of at least about 1 Methylobacterium/20 square micrometers, of at least about 1 Methylobacterium/10 square micrometers, of at least about 1 Methylobacterium/10 square micrometers, of at least about 1 Methylobacterium/5 square micrometers, of at least about 1 Methylobacterium/2 square micrometers, or of at least about 1 Methylobacterium/square micrometer. In certain embodiments, adherent yield enhancing Methylobacterium can be present on the surface of a solid substance in the fermentation broth, fermentation broth product, or composition at a density of at least about 1 Methylobacterium/20 square micrometers to about 1 Methylobacterium/square micrometer, of at least about 1 Methylobacterium/10 square micrometers to about 1 Methylobacterium/square micrometer, of at least about 1 Methylobacterium/10 square micrometers to about 1 Methylobacterium/square micrometer, of at least about 1 Methylobacterium/5 square micrometers to about 1 Methylobacterium/square micrometer, or of at least about 1 Methylobacterium/2 square micrometers to about 1 Methylobacterium/square micrometer. In certain embodiments, adherent yield enhancing Methylobacterium can be present on the surface of a solid substance in the fermentation broth, fermentation broth product, or composition at a density of at least about 1 Methylobacterium/20 square micrometers to about 1 Methylobacterium/2 square micrometers, of at least about 1 Methylobacterium/10 square micrometers to about 1 Methylobacterium/2 square micrometers, of at least about 1 Methylobacterium/10 square micrometers to about 1 Methylobacterium/2 square micrometers, or of at least about 1 Methylobacterium/5 square micrometers to about 1 Methylobacterium/2 square micrometers. Biphasic fermentation broths provided herein can comprise a liquid phase that contains non-adherent Methylobacterium. In certain embodiments, titers of non-adherent Methylobacterium in the liquid phase can be less than about 100,000, 10,000, or 1,000 colony forming units (CFU) per ml. In certain embodiments of any of the aforementioned compositions, the yield enhancing Methylobacterium is selected from the group consisting of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof. In certain embodiments of any of the aforementioned compositions, the yield enhancing Methylobacterium is selected from the group consisting of NLS0934 (NRRL B-67341), NLS1181 (ISO25), and variants thereof. In certain embodiments of any of the aforementioned compositions, the yield enhancing Methylobacterium is a combination of Methylobacterium NLS0109 and NLS0017, or variants thereof.
(63) Fermentation broths and compositions with yield enhancing Methylobacterium at a titer of greater than about 510.sup.8 colony-forming units per milliliter, at a titer of greater than about 110.sup.9 colony-forming units per milliliter, at a titer of greater than about 110.sup.10 colony-forming units per milliliter, at a titer of at least about 310.sup.10 colony-forming units per milliliter are provided herein. In certain embodiments, fermentation broths and compositions provided herein can comprise yield enhancing Methylobacterium at a titer of at least about 510.sup.8 colony-forming units per milliliter to at least about 310.sup.10 colony-forming units per milliliter, at least about 510.sup.8 colony-forming units per milliliter to at least about 410.sup.10 colony-forming units per milliliter, or at least about 510.sup.8 colony-forming units per milliliter to at least about 610.sup.10 colony-forming units per milliliter. In certain embodiments, fermentation broths provided herein can comprise yield enhancing Methylobacterium at a titer of at least about 110.sup.9 colony-forming units per milliliter to at least about 310.sup.10 colony-forming units per milliliter, at least about 110.sup.9 colony-forming units per milliliter to at least about 410.sup.10 colony-forming units per milliliter, or at least about 110.sup.9 colony-forming units per milliliter to at least about 610.sup.10 colony-forming units per milliliter. In certain embodiments, fermentation broths provided herein will comprise yield enhancing Methylobacterium at a titer of at least about 110.sup.10 colony-forming units per milliliter to at least about 310.sup.10 colony-forming units per milliliter, at least about 110.sup.10 colony-forming units per milliliter to at least about 410.sup.10 colony-forming units per milliliter, or at least about 110.sup.10 colony-forming units per milliliter to at least about 610.sup.10 colony-forming units per milliliter. In certain embodiments, fermentation broths provided herein will comprise yield enhancing Methylobacterium at a titer of, at least about 310.sup.10 colony-forming units per milliliter to at least about 410.sup.10 colony-forming units per milliliter, or at least about 310.sup.10 colony-forming units per milliliter to at least about 610.sup.10 colony-forming units per milliliter. In certain embodiments of any of the aforementioned compositions, the yield enhancing Methylobacterium is selected from the group consisting of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof. In certain embodiments of any of the aforementioned compositions, the yield enhancing Methylobacterium is a combination of Methylobacterium NLS0109 and NLS0017, or variants thereof.
(64) Yield enhancing Methylobacterium can be obtained as fermentation products and used to make various compositions useful for treating plants or plant parts to improve soybean yield. The Methylobacterium compositions can be applied to plants or plant parts in various forms, including for example as liquid compositions or as dried compositions, for example dried powders. Dried powders can be obtained by various methods, including for example, by spray-drying, freeze-drying, vacuum-drying, air-drying and fluidized bed-drying. Plants or plant parts that have been at least partially coated or coated with the fermentation broth products or compositions comprising yield enhancing Methylobacterium are thus provided. In certain embodiments, the plant part is a seed. Partial coating of a plant, a plant part, such as a seed includes, but is not limited to coating at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or about 99.5% of the surface area of the plant, plant part, or plant seed. Also provided are processed plant products that contain the fermentation broth products or compositions with yield enhancing Methylobacterium or adherent yield enhancing Methylobacterium. In some embodiments, solid substances with adherent yield enhancing Methylobacterium can be used to make various compositions that are particularly useful for treating plant seeds. Seeds that have been at least partially coated with the fermentation broth products or compositions are thus provided. Partial coating of a seed includes, but is not limited to coating at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or about 99.5% of the surface area of the seed. Also provided are processed seed products, including, but not limited to, meal, flour, feed, and flakes that contain the fermentation broth products or compositions provided herein. In certain embodiments, the processed plant product will be non-regenerable (i.e. will be incapable of developing into a plant). In certain embodiments, the solid substance used in the fermentation product or composition that at least partially coats the plant or plant part or that is contained in the processed plant or plant part product comprises a solid substance and associated or adherent yield enhancing Methylobacterium that can be readily identified by comparing a treated and an untreated plant or plant part, or processed product thereof. In certain embodiments, the yield enhancing Methylobacterium is selected from the group consisting of NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof. In certain embodiments, the yield enhancing Methylobacterium is selected from the group consisting of NLS0934 (NRRL B-67341) and/or NLS1181 (ISO25). In certain embodiments of any of the aforementioned compositions, the yield enhancing Methylobacterium is a combination of Methylobacterium NLS0109, and NLS0017 or NLS0610, or variants thereof.
(65) Compositions useful for treating plants or plant parts that comprise yield enhancing Methylobacterium can also further comprise additional components, including an active ingredient, an agriculturally acceptable adjuvant or an agriculturally acceptable excipient. An agriculturally acceptable adjuvant or an agriculturally acceptable excipient is typically an ingredient that does not cause undue phytotoxicity or other adverse effects when exposed to a plant or plant part. In certain embodiments, a solid substance used in a fermentation broth can itself be an agriculturally acceptable adjuvant or an agriculturally acceptable excipient so long as it is not bacteriocidal or bacteriostatic to the Methylobacterium. In some embodiments agriculturally acceptable adjuvants and/or excipients are added to Methylobacterium to increase stability and/or shelf life. In other embodiments, the composition further comprises at least one of an agriculturally acceptable adjuvant or an agriculturally acceptable excipient.
(66) Any of the aforementioned compositions can also further comprise an additional active ingredient. In certain embodiments, the additional active ingredient is a pesticide used in the composition that does not substantially inhibit growth of the Methylobacterium. As Methylobacterium are gram negative bacteria, suitable bacteriocides used in the compositions can include, but are not limited to, bacteriocides that exhibit activity against gram positive bacteria but not gram negative bacteria. Compositions provided herein can also comprise a bacteriostatic agent that does not substantially inhibit growth of the Methylobacterium. Bacteriostatic agents suitable for use in compositions provided herein include, but are not limited to, those that exhibit activity against gram positive bacteria but not gram negative bacteria. Any of the aforementioned compositions can also be an essentially dry product (i.e. having about 5% or less water content), a mixture of the composition with an emulsion, or a suspension.
(67) Agriculturally acceptable adjuvants used in the compositions that comprise yield enhancing Methylobacterium include, but are not limited to, components that enhance product efficacy and/or products that enhance ease of product application. Adjuvants that enhance product efficacy can include various wetters/spreaders that promote adhesion to and spreading of the composition on plant parts, stickers that promote adhesion to the plant part, penetrants that can promote contact of the active agent with interior tissues, extenders that increase the half-life of the active agent by inhibiting environmental degradation, and humectants that increase the density or drying time of sprayed compositions. Wetters/spreaders used in the compositions can include, but are not limited to, non-ionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, organo-silicate surfactants, and/or acidified surfactants. Stickers used in the compositions can include, but are not limited to, latex-based substances, terpene/pinolene, and pyrrolidone-based substances. Penetrants can include mineral oil, vegetable oil, esterified vegetable oil, organo-silicate surfactants, and acidified surfactants. Extenders used in the compositions can include, but are not limited to, ammonium sulphate, or menthene-based substances. Humectants used in the compositions can include, but are not limited to, glycerol, propylene glycol, and diethyl glycol. Adjuvants that improve ease of product application include, but are not limited to, acidifying/buffering agents, anti-foaming/de-foaming agents, compatibility agents, drift-reducing agents, dyes, and water conditioners. Anti-foaming/de-foaming agents used in the compositions can include, but are not limited to, dimethopolysiloxane. Compatibility agents used in the compositions can include, but are not limited to, ammonium sulphate. Drift-reducing agents used in the compositions can include, but are not limited to, polyacrylamides, and polysaccharides. Water conditioners used in the compositions can include, but are not limited to, ammonium sulphate.
(68) Methods of treating plants and/or plant parts with the fermentation broths, fermentation broth products, and compositions comprising yield enhancing Methylobacterium are also provided herein. Treated plants, and treated plant parts obtained therefrom, include, but are not limited to, soybean. As used herein, the term soybean includes, but is not limited to all varieties, subspecies, and cultivars of Glycine max. Soybean subspecies include, but are not limited to, Glycine max L. ssp. max and Glycine max ssp. Formosana. Plant parts that are treated include, but are not limited to, leaves, stems, flowers, roots, seeds, pods, and the like. Seeds or other propagules of any of the aforementioned plants can be treated with the fermentation broths, fermentation broth products, fermentation products, and/or compositions provided herein.
(69) In certain embodiments, plants and/or plant parts are treated by applying the fermentation broths, fermentation broth products, fermentation products, and compositions that comprise yield enhancing Methylobacterium as a spray. Such spray applications include, but are not limited to, treatments of a single plant part or any combination of plant parts. Spraying can be achieved with any device that will distribute the fermentation broths, fermentation broth products, fermentation products, and compositions to the plant and/or plant part(s). Useful spray devices include a boom sprayer, a hand or backpack sprayer, crop dusters (i.e. aerial spraying), and the like. Spraying devices and or methods providing for application of the fermentation broths, fermentation broth products, fermentation products, and compositions to either one or both of the adaxial surface and/or abaxial surface can also be used. Plants and/or plant parts that are at least partially coated with any of a biphasic fermentation broth, a fermentation broth product, fermentation product, or compositions that comprise a solid substance with yield enhancing Methylobacterium adhered thereto are also provided herein. In certain embodiments, the plant part is a seed. Partial coating of a plant or a plant part includes, but is not limited to coating at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or about 99.5% of the surface area of the plant or plant part. In some embodiments, the plant part is a seed and partial coating includes, but is not limited to coating at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or about 99.5% of the surface area of the seed. Also provided herein are processed plant products that comprise a solid substance with yield enhancing Methylobacterium adhered thereto.
(70) In certain embodiments, seeds are treated by exposing the seeds to the fermentation broths, fermentation broth products, fermentation products, and compositions that comprise yield enhancing Methylobacterium. Seeds can be treated with the fermentation broths, fermentation broth products, and compositions provided herein by methods including, but not limited to, imbibition, coating, spraying, and the like. Seed treatments can be effected with both continuous and/or a batch seed treaters. In certain embodiments, the coated seeds can be prepared by slurrying seeds with a coating composition containing a fermentation broth or fermentation broth product comprising yield enhancing Methylobacterium and air drying the resulting product. Air drying can be accomplished at any temperature that is not deleterious to the seed or the Methylobacterium. In certain embodiments, air drying is accomplished at a temperature not greater than 30 degrees Centigrade. The proportion of coating that comprises yield enhancing Methylobacterium includes, but is not limited to, a range of 0.1 to 25% by weight of the seed, 0.5 to 5% by weight of the seed, and 0.5 to 2.5% by weight of seed. In certain embodiments, a solid substance used in the seed coating or treatment will have yield enhancing Methylobacterium adhered thereon. In certain embodiments, a solid substance used in the seed coating or treatment will be associated with yield enhancing Methylobacterium and will be present in a fermentation broth, fermentation broth product, or composition obtained by the methods provided herein. Various seed treatment compositions and methods for seed treatment disclosed in U.S. Pat. Nos. 5,106,648, 5,512,069, and 8,181,388 are incorporated herein by reference in their entireties and can be adapted for use with an active agent comprising the fermentation broths, fermentation broth products, or compositions provided herein. In certain embodiments, the composition used to treat the seed can contain agriculturally acceptable excipients that include, but are not limited to, woodflours, clays, activated carbon, diatomaceous earth, fine-grain inorganic solids, calcium carbonate and the like. Clays and inorganic solids that can be used with the fermentation broths, fermentation broth products, or compositions provided herein include, but are not limited to, calcium bentonite, kaolin, china clay, talc, perlite, mica, vermiculite, silicas, quartz powder, montmorillonite and mixtures thereof. Agriculturally acceptable adjuvants that promote sticking to the seed that can be used include, but are not limited to, polyvinyl acetates, polyvinyl acetate copolymers, hydrolyzed polyvinyl acetates, polyvinylpyrrolidone-vinyl acetate copolymer, polyvinyl alcohols, polyvinyl alcohol copolymers, polyvinyl methyl ether, polyvinyl methyl ether-maleic anhydride copolymer, waxes, latex polymers, celluloses including ethylcelluloses and methylcelluloses, hydroxy methylcelluloses, hydroxypropylcellulose, hydroxymethylpropylcelluloses, polyvinyl pyrrolidones, alginates, dextrins, malto-dextrins, polysaccharides, fats, oils, proteins, karaya gum, jaguar gum, tragacanth gum, polysaccharide gums, mucilage, gum arabics, shellacs, vinylidene chloride polymers and copolymers, soybean-based protein polymers and copolymers, lignosulfonates, acrylic copolymers, starches, polyvinylacrylates, zeins, gelatin, carboxymethylcellulose, chitosan, polyethylene oxide, acrylamide polymers and copolymers, polyhydroxyethyl acrylate, methylacrylamide monomers, alginate, ethylcellulose, polychloroprene and syrups or mixtures thereof. Other useful agriculturally acceptable adjuvants that can promote coating include, but are not limited to, polymers and copolymers of vinyl acetate, polyvinylpyrrolidone-vinyl acetate copolymer and water-soluble waxes. Various surfactants, dispersants, anticaking-agents, foam-control agents, and dyes disclosed herein and in U.S. Pat. No. 8,181,388 can be adapted for use with an active agent comprising the fermentation broths, fermentation broth products, or compositions provided herein.
(71) Provided herein are compositions that comprise yield enhancing Methylobacterium that provide for increased yield of soybean plants relative to untreated plants, plant parts, and plants obtained therefrom that have not been exposed to the compositions. In certain embodiments, plant parts, including, but not limited to, a seed, a leaf, a flower, a stem, a root, a pod, or a coleoptile can be treated with the compositions provided herein to increase soybean plant yield. Treatments or applications can include, but are not limited to, spraying, coating, partially coating, immersing, and/or imbibing the plant or plant parts with the compositions provided herein. Partial coating of a soybean plant or a soybean plant part includes, but is not limited to coating at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or about 99.5% of the surface area of the soybean plant or soybean plant part. In some embodiments, the soybean plant part that is partially coated is a soybean plant seed. In certain embodiments, a seed, a leaf, a flower, a stem, a root, a pod, or a coleoptile can be immersed and/or imbibed with a liquid, semi-liquid, emulsion, or slurry of a composition provided herein. Such seed immersion or imbibition can be sufficient to provide for increased yield in a treated soybean plant or soybean plant grown from a treated seed in comparison to an untreated soybean plant or soybean plant grown from an untreated seed. In certain embodiments, plant seeds can be immersed and/or imbibed for at least 1, 2, 3, 4, 5, or 6 hours. Such immersion and/or imbibition can, in certain embodiments, be conducted at temperatures that are not deleterious to the plant seed or the Methylobacterium. In certain embodiments, the seeds can be treated at about 15 to about 30 degrees Centigrade or at about 20 to about 25 degrees Centigrade. In certain embodiments, seed imbibition and/or immersion can be performed with gentle agitation. In certain embodiments, the soybean seed or VE stage soybean plant is exposed to the composition by providing the composition in furrow. Providing the composition in furrow represents one of several methods provided herein for applying a composition to a soybean seed or to a soybean plant at about the VE stage of soybean plant development.
(72) Compositions provided herein comprising yield enhancing Methylobacterium and related methods are therefore expected to be useful in improving yield in a wide variety of soybean plants, including, but not limited to, all varieties, subspecies, and cultivars of Glycine max.
(73) In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield can be a composition with yield enhancing Methylobacterium at a titer of at least about 110.sup.6 colony-forming units per milliliter, at least about 510.sup.6 colony-forming units per milliliter, at least about 110.sup.7 colony-forming units per milliliter, at least about 510.sup.8 colony-forming units per milliliter, at least about 110.sup.9 colony-forming units per milliliter, at least about 110.sup.10 colony-forming units per milliliter, or at least about 310.sup.10 colony-forming units per milliliter. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield to a plant or plant part can be a composition with yield enhancing Methylobacterium at a titer of about least about 110.sup.6 colony-forming units per milliliter, at least about 510.sup.6 colony-forming units per milliliter, at least about 110.sup.7 colony-forming units per milliliter, or at least about 510.sup.8 colony-forming units per milliliter to at least about 610.sup.10 colony-forming units per milliliter of a liquid or an emulsion. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield can be a fermentation broth product with a yield enhancing Methylobacterium titer of a solid phase of that product is at least about 110.sup.6 colony-forming units per milliliter, at least about 510.sup.6 colony-forming units per milliliter, at least about 110.sup.7 colony-forming units per milliliter, or at least about 510.sup.8 colony-forming units per gram to at least about 610.sup.10 colony-forming units of Methylobacterium per gram of the solid phase. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield can be a composition with a Methylobacterium titer of at least about 110.sup.6 colony-forming units per gram, at least about 510.sup.6 colony-forming units per gram, at least about 110.sup.7 colony-forming units per gram, or at least about 510.sup.8 colony-forming units per gram to at least about 610.sup.10 colony-forming units of Methylobacterium per gram of particles in the composition containing the particles that comprise a solid substance wherein a mono-culture or co-culture of yield enhancing Methylobacterium is adhered thereto. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield to a plant or plant part can be a composition with a Methylobacterium titer of at least about 110.sup.6 colony-forming units per mL, at least about 510.sup.6 colony-forming units per mL, at least about 110.sup.7 colony-forming units per mL, or at least about 510.sup.8 colony-forming units per mL to at least about 610.sup.10 colony-forming units of Methylobacterium per mL in a composition comprising an emulsion wherein a mono-culture or co-culture of a yield enhancing Methylobacterium adhered to a solid substance is provided therein or grown therein. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield to a plant or plant part can be a composition with a Methylobacterium titer of at least about 110.sup.6 colony-forming units per mL, at least about 510.sup.6 colony-forming units per mL, at least about 110.sup.7 colony-forming units per mL, or at least about 510.sup.8 colony-forming units per mL to at least about 610.sup.10 colony-forming units of Methylobacterium per mL of in a composition comprising an emulsion wherein a mono-culture or co-culture of a yield enhancing Methylobacterium is provided therein or grown therein. In certain embodiments of any of the aforementioned compositions, the Methylobacterium is selected from the group consisting of (i) NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof; and (ii) a combination of Methylobacterium isolate NLS0109 (NRRL B-67340) or a variant thereof, and Methylobacterium isolate NLS0017 (B-50931) or NLS0610, or variants thereof. In certain embodiments of any of the aforementioned compositions, the composition is a lyophilized composition.
(74) In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield can be a composition with a Methylobacterium at a titer of at least about 110.sup.4 colony-forming units per milliliter, at least about 110.sup.5 colony-forming units per milliliter, at least about 110.sup.6 colony-forming units per milliliter, at least about 510.sup.6 colony-forming units per milliliter, at least about 110.sup.7 colony-forming units per milliliter, at least about 510.sup.8 colony-forming units per milliliter, at least about 110.sup.9 colony-forming units per milliliter, at least about 110.sup.10 colony-forming units per milliliter, or at least about 310.sup.10 colony-forming units per milliliter. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield can be a composition with Methylobacterium at a titer of at least about 110.sup.4 colony-forming units per milliliter, at least about 110.sup.5 colony-forming units per milliliter, about least about 110.sup.6 colony-forming units per milliliter, at least about 510.sup.6 colony-forming units per milliliter, at least about 110.sup.7 colony-forming units per milliliter, or at least about 510.sup.8 colony-forming units per milliliter to at least about 610.sup.10 colony-forming units per milliliter of a liquid or an emulsion. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield can be a fermentation broth product with a Methylobacterium titer of a solid phase of that product is at least about 110.sup.4 colony-forming units per gram, at least about 110.sup.5 colony-forming units per gram, at least about 110.sup.6 colony-forming units per gram, at least about 510.sup.6 colony-forming units per gram, at least about 110.sup.7 colony-forming units per gram, or at least about 510.sup.8 colony-forming units per gram to at least about 610.sup.10 colony-forming units of Methylobacterium per gram, at least about 110.sup.11 colony-forming units of Methylobacterium per gram, at least about 110.sup.12 colony-forming units of Methylobacterium per gram, at least about 110.sup.13 colony-forming units of Methylobacterium per gram, or at least about 510.sup.13 colony-forming units of Methylobacterium per gram of the solid phase. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield can be a composition with a Methylobacterium titer of at least about 110.sup.6 colony-forming units per gram, at least about 510.sup.6 colony-forming units per gram, at least about 110.sup.7 colony-forming units per gram, or at least about 510.sup.8 colony-forming units per gram to at least about 610.sup.10 colony-forming units of Methylobacterium per gram, at least about 110.sup.11 colony-forming units of Methylobacterium per gram, at least about 110.sup.12 colony-forming units of Methylobacterium per gram, at least about 110.sup.13 colony-forming units of Methylobacterium per gram, or at least about 510.sup.13 colony-forming units of Methylobacterium per gram of particles in the composition containing the particles that comprise a solid substance wherein a mono-culture or co-culture of Methylobacterium is adhered thereto. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield can be a composition with a Methylobacterium titer of at least about 110.sup.6 colony-forming units per mL, at least about 510.sup.6 colony-forming units per mL, at least about 110.sup.7 colony-forming units per mL, or at least about 510.sup.8 colony-forming units per mL to at least about 610.sup.10 colony-forming units of Methylobacterium per mL in a composition comprising an emulsion wherein a mono-culture or co-culture of a Methylobacterium adhered to a solid substance is provided therein or grown therein. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for increased soybean yield can be a composition with a Methylobacterium titer of at least about 110.sup.6 colony-forming units per mL, at least about 510.sup.6 colony-forming units per mL, at least about 110.sup.7 colony-forming units per mL, or at least about 510.sup.8 colony-forming units per mL to at least about 610.sup.10 colony-forming units of Methylobacterium per mL of in a composition comprising an emulsion wherein a mono-culture or co-culture of a Methylobacterium is provided therein or grown therein. In certain embodiments of any of the aforementioned compositions, the Methylobacterium is selected from the group consisting of (i) NLS0934 (NRRL B-67341), NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof; and (ii) a combination of Methylobacterium isolate NLS0109 (NRRL B-67340) or a variant thereof, and Methylobacterium isolate NLS0017 (B-50931) or NLS0610 (ISO26), or variants thereof.
EXAMPLES
(75) The following examples are included to demonstrate illustrative, non-limiting embodiments of the disclosure. It will be appreciated by those of skill in the art that the techniques disclosed in the following examples represent techniques discovered by the Applicants to function well in the practice of the invention. However, those of skill in the art should, in light of the instant disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed, while still obtaining like or similar results, without departing from the scope of the disclosure.
Example 1
(76) Preparation of Methylobacterium
(77) In preparation for the field trials, Methylobacterium cultures were grown in ammonium mineral salts (AMS)+peptone media containing a carbon source (AMS+carbon (15 g/liter)+peptone (10 g/liter)) at 30 C. for 4 days. To prepare one liter of liquid AMS medium+carbon+peptone (AMS media solution), the following components were added to a total volume of one (1) liter of distilled water: 700 milligrams of dibasic potassium phosphate anhydrous, 540 milligrams of monobasic potassium phosphate anhydrous, one gram of magnesium sulfate heptahydrate, 500 milligrams of ammonium chloride anhydrous, 200 milligrams of calcium chloride dihydrate, 15 g of a carbon source, and 10 g of peptone.
(78) The AMS media solution was sterilized by autoclaving. After growing for 4 days at 30 C., cultures were harvested by centrifugation at 5000 rpm for 10 minutes and then re-suspended in AMS media solution with 20% (v/v) glycerol as a cryoprotectant. The cultures were aliquoted and frozen at 80 C. until thawed for use. The liquid Methylobacterium preparations were applied to commercial soybean seeds that had been treated with conventional fungicides and insecticides. The liquid Methylobacterium preparations were applied to the seeds at a rate of about 110.sup.5 CFU/seed to about 110.sup.6 CFU/seed.
Example 2
(79) Increased Soybean Yield by Application of Methylobacterium Compositions in 2017 Yield Trials
(80) Soybean microplot field trials were established at four locations throughout the Midwest soybean growing region for the purpose of evaluating 67 Methylobacterium isolates applied as a seed treatment to commercial soybean seeds. Six controls that were not treated with a Methylobacterium isolate were included in the trials.
(81) The microplot trials were conducted as randomized complete block design. There were six replications of each of the Methylobacterium isolates and controls at each location. The trials were established within existing farmer field sites and managed with local agronomic practices. All soybean varieties used were glyphosate-tolerant varieties. The trials were harvested for yield at physiological maturity with a commercial harvest combine.
(82) Results
(83) The analysis of yield results was conducted with JMP14 (SAS Institute), and the assumptions of normality and equal variance were tested prior to executing the Analysis of variance (ANOVA). ANOVA was conducted with the Analyze-Fit Model routine. Comparisons of Methylobacterium isolates to the average of the six untreated controls were performed with two-tailed t-tests applied to the pairwise differences between least-squares means estimated from the ANOVA model, under the null hypothesis that the difference in means was zero.
(84) Across-locations analyses for the four locations were conducted according to the following model: [2] Y.sub.hijk=M+I.sub.i+S.sub.j+IS.sub.ij+L.sub.h+R(L).sub.k(h)+LI.sub.hi+IR(L).sub.ik(h)+LS.sub.hj+LIS.sub.hij+e.sub.hijk, where Y.sub.hijk is the yield at location h of isolate i at stage j in replicate k, M represents the overall mean, I.sub.i is the fixed effect of isolate i, S.sub.j is the fixed effect of stage j, IS.sub.ij is the fixed effect of the interaction of isolate i and stage j, L.sub.h is the random effect of location h, R(L).sub.k(h) is the random effect of replicate k nested within location h, LI.sub.hi is the random effect of the interaction of location h and isolate i, IR(L).sub.ik(h) is the random effect of the interaction of isolate i and replicate k nested within location h, LS.sub.hj is the random effect of the interaction of location h and stage j, LIS.sub.hij is the random effect of the three-way interaction of location h with isolate i and stage j, and e.sub.hijk is the random error.
(85) Yield results for isolates selected for further analysis are shown in Table 2 below.
(86) TABLE-US-00002 TABLE 2 Yield results from 2017 soybean yield trials Yield Yield Win differ- differ- Con- rate ence ence trast (# Mean from from p-value locations yield UTC UTC v. above Treatment (Bu/A) (Bu/A) (%) UTC UTC) NLS0934 92.9 +6.0 +6.9% 0.0086 4/4 (100%) NLS1181 92.0 +5.1 +5.9% 0.025 4/4 (100%) NLS1179 91.6 +4.7 +5.4% 0.039 4/4 (100%) Methylobacterium S4 91.2 +4.3 +4.9% 0.055 4/4 (100%) Methylobacterium S3 91.1 +4.2 +4.8% 0.062 4/4 (100%) NLS0693 91.0 +4.1 +4.7% 0.075 3/4 (75%) NLS0610 90.0 +3.1 +3.6% 0.17 4/4 (100%) UTC 86.9 Methylobacterium S5 85.7 1.2 1.4% 0.59 2/4 (50%) NLS0497 85.7 1.2 1.4% 0.59 1/4 (25%) Methylobacterium S2 85.7 1.2 1.4% 0.59 2/4 (50%) Methylobacterium S1 82.4 4.5 4.5% 0.041 1/4 (25%) *P-values taken from a two-tailed t-test comparing each treatment to the Untreated Check (UTC).
Example 3
(87) Increased Soybean Yield by Application of Methylobacterium Compositions in 2018 Yield Trials
(88) Strains for use in 2018 field trials were selected based on results from the 2017 field trials described above and cultures were prepared for inoculation as described in Example 1. Isolates demonstrating positive yield results in 2017 and several isolates that demonstrated a negative effect on yield were selected. Soybean field trials were established at four locations throughout the Midwest soybean growing region for the purpose of evaluating the Methylobacterium isolates applied as a seed treatment to commercial soybean seeds. Controls that were not treated with a Methylobacterium isolate were included in the trials.
(89) The trials were conducted as randomized complete block design consisting of four 30-inch rows that were 40 feet long. There were four replications of each of the Methylobacterium isolates and controls at each location. The trials were established within existing farmer field sites and managed with local agronomic practices. Harvest was done per standard grower practices and plot yields were determined using conventional metered combine harvesters. Plot test weights were used to calculate bu/acre yield estimates for each plot.
(90) Results
(91) The analysis of yield results was conducted as described above. Data for isolates showing an increase in soybean yield are provided in Table 3 below.
(92) TABLE-US-00003 TABLE 3 Yield results from 2018 soybean yield trials. Yield Yield Win differ- differ- rate ence ence Con- (# Mean from from trast locations yield UTC UTC p-value above Treatment (Bu/A) (Bu/A) (%) v. UTC UTC) NLS0934 73.8 +3.0 +4.2% 0.0050 4/4 (100%) NLS1181 73.5 +2.7 +3.8% 0.0098 4/4 (100%) NLS0497 73.2 +2.4 +3.4% 0.025 3/4 (75%) NLS0693 72.6 +1.8 +2.5% 0.097 3/4 (75%) NLS1179 72.5 +1.7 +2.4% 0.10 2/4 (50%) NLS0610 70.9 +0.1 +0.1% 0.94 2/4 (50%) UTC 70.8 Methylobacterium S1 70.8 0 0 1.00 2/4 (50%) Methylobacterium S2 70.7 0.1 0.1% 0.92 2/4 (50%) Methylobacterium S3 70.7 0.1 0.1% 0.86 2/4 (50%) Methylobacterium S4 70.1 0.7 1.0% 0.47 2/4 (50%) Methylobacterium S5 70.0 0.8 1.1% 0.39 2/4 (50%) *P-values taken from a two-tailed t-test comparing each treatment to the Untreated Check (UTC).
Example 4
(93) Increased Soybean Yield by Application of Dry Methylobacterium Compositions
(94) In preparation for the field trials, Methylobacterium cultures were grown in ammonium mineral salts (AMS)+peptone media containing a carbon source (AMS+carbon (15 g/liter)+peptone (10 g/liter)) at 30 C. for 4 days. To prepare one liter of liquid AMS medium+carbon+peptone (AMS media solution), the following components were added to a total volume of one (1) liter of distilled water: 700 milligrams of dibasic potassium phosphate anhydrous, 540 milligrams of monobasic potassium phosphate anhydrous, one gram of magnesium sulfate heptahydrate, 500 milligrams of ammonium chloride anhydrous, 200 milligrams of calcium chloride dihydrate, 15 g of a carbon source, and 10 g of peptone.
(95) The AMS media solution was sterilized by autoclaving. After growing for 4 days at 30 C., cultures were harvested by centrifugation at 5000 rpm for 10 minutes and cell pellets from centrifugation were re-suspended in AMS media solution at one tenth the original volume (concentrated slurry).
(96) The concentrated slurry and commercial formulation additives were mixed and the resulting mixture was frozen at 80 C. Frozen mixture was freeze-dried using standard industrial freeze-drying conditions and then ground into a powder. The powder was applied to commercial soybean seeds that had been treated with conventional fungicides and insecticides at a rate of about 110.sup.5 CFU/seed to about 110.sup.6 CFU/seed.
(97) Soybean field trials were established at multiple locations throughout the Midwest soybean growing region (9 locations in 2017 and 11 locations in 2018). The trials were conducted as randomized complete block design consisting of four 30-inch rows that were 40 feet long. There were four replications of each of the Methylobacterium isolates and controls at each location. Methylobacterium S6 positive control contained a Methylobacterium isolate that was previously shown to increase soybean yield (US20160302423). The trials were established within existing farmer field sites and managed with local agronomic practices. Harvest was done per standard grower practices and plot yields were determined using conventional metered combine harvesters. Plot test weights were used to calculate bu/acre yield estimates for each plot. Results are reported in Table 4 below.
(98) TABLE-US-00004 TABLE 4 2018 2017 2017/18 2 yr average Yield Yield average increase vs Treatment bu/ac bu/ac yield UTC (bu) Methylobacterium S6 62.56 58.10 60.33 4.47 Control NLS0610/N130109 61.77 58.51 60.14 4.28 NLS0017/N130109 61.24 60.02 60.63 4.77 NLS0610 62.09 58.52 60.31 4.45 Optimize 60.08 UTC 57.47 54.24 55.86
Example 5 Detection and Identification of Methylobacterium Strains, Variants and Derivatives
(99) Assays are disclosed for detection or identification of specific Methylobacterium strains and closely related derivatives. Genomic DNA fragments unique to a Methylobacterium strain are identified and qPCR Locked Nucleic Acid (LNA) based assays are developed.
(100) Genomic DNA sequences of Methylobacterium strains are compared by BLAST analysis of approximately 300 bp fragments using a sliding window of from 1-25 nucleotides to whole genome sequences of over 1000 public and proprietary Methylobacterium isolates. Genomic DNA fragments are identified that have weak BLAST alignments, indicative of approximately 60-95% identity over the entire fragment, to corresponding fragments of a Methylobacterium of interest. Fragments from the target Methylobacterium strain genome corresponding to the identified weak alignment regions were selected for assay development.
(101) Target fragment sequences that distinguish NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), and NLS0610 (ISO26), from related Methylobacterium isolates are provided in Table 5 below.
(102) TABLE-US-00005 TABLE5 UniqueFragmentSequencesofMethylobacteriumStrains SEQ Strain Fragment IDNO Sequence NLS0497 ref1_46464 1 CTCAACGTTGCCGCCTTAACCGAAGACTAACTA ACATAAATTTCAGTTAGCCGCGAAACAGAATAT GATACTTGGTCTTATACGACGCATAGAGGCGCA TTCCGTCAAGTCGCGCATTGCAGAGTCCCCCCGA AAATTCGTTTTCTGGGAGCGAGCAGAAACGTGT GCACGTGTTCTGTCACTCTATTTTCTGGTTTAGA GCAATCATCTCGCGGCTCAGATCCCGTCGTTCCA TAGAGTGGTTTCCGGTTCAGTATGAATTGTGAGC AGCCCCTGCGGCTATATCTACTTCGACGTATA NLS0497 ref1_85227 2 ACCAACAGGCAGAAGAGGCTTACAAAAATGCTC TAGATATCTATAATCGCGCCGGTCTGGATAATA GGCGGGAAAAGTCAAATATTCTTATCGGACTTG GCGATGCAGCTAGCGCACTGAGCAAATTTATAG ACGCGAAAAATTTCTACAGTGAAGGTTTAGCAG TCCGAGCGCGGTCATGACGGTGCTTGCGGACTA GTGTCTGCTCGCAATTCAGAGCAGCCGCTTCGGC TGGTTCAGTTTGGGTATGCCCTTTCTGTACCAGC CTGTGACTGGTCTGGTATGTAGCCCTTGACCAAT NLS0497 ref1_98103 3 ATGAAGCTCCGTCGTGTTTATGTAAAGAACGTTC GCAGTTTCTACGATGCTGAAGAACTCATTCTGGA CGGAGATATTTCTATTATTATAGGCCCAAATGGT GGAGGAAAAACAAATCTACTTGATGCGACGATA CACTTGTTGAGAAGACATTTATTGCAATCGTGGG CTGTCGTTCGCCATACATACACGCCAATAAACTA TTCCGATCACTTCCAACCAAATGATCAAATCACA AACTATGCGCTGGAGAAGTACAGCGGTCGCGAA AGCGAAGACCAAGTCGTTGAGTTCGATATC NLS0693 ref1_622066 4 CGGGGGCGGTCTCCTCATATATGGAGGGAATTA ATCTGAAGGGTCGGAGCCCCCGCTACGGCACAC ACACGGCGGCGGGCGGTGGGCTCCTTCCTCATA TACGCTTCCTGATAATTTCGACCGTAATCGCCCG CCGGCCGAGCGGCCAGACCTTATTAGTCCAGCA TCACACGGTGCATCGTATCGTGGAGGGCGAACA ACCGCCTAAGGTTCGCCACGTAGCCATCCACAT CCGCCCTTGCCGCTCGCGCAAGGGAAGCAGAAT GCTTGATAGCGACTTCGCGGGCGTCTTTGGTAGC C NLS0693 ref1_2496 5 TGTGGGCGCTCATGGAAACGGGGGACGTGCTTT TTTGATCTCTAGCCATTGTCATCATCCATCGGTC CGGGTGACAGGCCTTTACGCACATAACAACGGT TATTTCGATCAGCCCCCTCCTGATCGCACAAGTC AGCTATACAGATGCTTCTGAAAGCCAACAAAGG CGTTACGTATCTGCGTGACCCCACCGAGCTGCGC TGCGGCATCGCTGACAGCTCTGTATTTTAATTCG AGGAGGTGGGGCAATTTAGCCTGGTCAAGCTCG CCAACGTCTTCCTTCACATATTGAGACAGGAC NLS0693 ref1_2640477 6 AGAGTGTATTTCCCCAAGACTTTATCTCTTTGCT CATCACAAAACAGCCCGCTCAAGATGATATGCG CTGGGATTTGTGCCGCGACCCGTTGTAATTGTAT TTACCTCTCGGCTCATGTTCCCTGTCGCCGGAGC GATTGGAGGTAAAGTAATCTCAACTTTGCGGCC CATGGCTGATGCTAGCTCAGCTACGCGACCTAA GGTAATATCTTTGTGTCCGCGGAGTTCGCGATGA ATGACCGAGCGATTGACGCCGATGGTGCGGGCA ATATCGGCTTGAGTTAGACCGTTCTTGGCTTC NLS1179 ref1_687571 7 ACCTGTCTCGACATCGGGGGCAGCCACGAGGCG TCGGCCGTGGTAGATCTCGGCGAAGCGGTAGTA GTGGGCGAGGTCCCCATCGGGATCGATGGGGGA GTCCGGCGTACCTTCTCCCTCTTCTGCGATTAGC GACAGGGCTCGCATGGCGCTGGGTGCGTCAGTG ATGGCGAACAACCTACTATCGGGGAACCACCGC CTGTCGACGAGCTGGCGGTCCGGGTTTCCTTTGA AGACAGCGTCACCCAGCGCTTCGATCTTCTCAAT CAAGGCTGCGTAGAACTGCCCGATGGTCGCGAA NLS1179 ref1_695522 8 GACGTGGTGACGGTGGCACCAGTCGCCCAGCGA AGCGGCTACTGTACTGAGCCCGCAGTCATGTCG GCTGAAGAAATGGTCGATATGCCCCAGGGAGGT CGGGCGTAGGTCGTACCTCAAATTCACCGGCAG GATCTTGTCCAGCAAGGCGTCCGAATTCGCATC GACCTGACTTAGGAAATTACCGAGGTAATCGCT CGGTCCGTTCGCGTCGGCGGCCTGCATCGCCAG CAGCGCCTTATGCTCGGTCGTCAACTCACGAGC GAATATTGTCCAGGACAGGTTGTCGACCTCGGC GAC NLS1179 ref1_705877 9 GAGCATGGCAGGCCACCACGCATCGCTTCTTCA TCACCTTGCTCGGACGACTTGCTGCTTTGTCGGT CTCTCTCTCAAGGACGAGACGCTGCGACACTTG CTTCGTCAGAGTGCCAGGATTAATCCCGGTCAAT ACCACTACTACGTCAGCTGGCGTGCGCCGGGCG GCACGAGGGACGTCGACGCGGAACGATTGATTC GAGACGCTAACTTTGACGTGTACAATTTAGTCAC GCTTTTCCTTAGCGACGCCGAGATAGCCTCGTTG GGCCGCTTGCTCACCGCCGATGCAGCCGAGTT NLS1181 ref1_54084 10 AACGCGATGGGAGCAGCACGTAATGGGCGTCAT ACAAGATATAAAAGAAGGACTTGAAGGTAGAAT AGATAACCTTAAGGAAAATATTGATAATATCAG TTCCAGTATCACATGCACAATACAAGGAGTGCC GAAGGTCGAGTCAGAAAGAATTTTGGGATGTGC AAACGCTTCGTTTGACCAAATACAGAAAATGTG GATGAATGGTCCTACGGATAGGGCTGCATTTCTC GACGCCGTGAAAAGTTTGATAGACCGCAACGCA AGTAATGGAAAATTCGGAGTTCCAGGATCATAT TG NLS1181 ref1_4816166 11 TTTTCCTTTCGCGCCTATGACCTGAGTGCGGCCG AAGCTGTCCGCTTATTAGAGTTTTACAACCAGAT GCGAGCGGCTTAGCTCTTCCTCCGTTATTAAGCA GGGCGCCTCTTCTTAGGGGCGCCCCTTCATATTT AATCTTGTCTGATGTCTGGCGCCATATCAGACAA ACATCAGCGTTGACCTTGATTTTGCATCTACATT AGGGTTGCTCCCAGAATGGAGCCGCCGATGTCC GTCCCGTACCTCAAGCGAGAGATGTGGGGTGTG TATTACATCCATTGGCGCGAGGGCGGCCGC NLS1181 ref1_2292077 12 GTTGGAGATGGTGCCGTTTGCAACCGTCAGATC GCCTACTGTGAATCCGGTGACCTCCCGAGAGAA CGTGAAGGTAACTGTCGTAGTCTCGCCAACTGC CAAAGAGGTGTCCGCAACGGCGATGGTCGCTGT CGGGGCGCTTGTTTGGACATCAACGGTGAGACC CGCCGAGGCAGGCCCCGTGTTACCAGCGGTATC GACGGCCCTAGCGGTGACCGTGTGCGATCCAGC CGTTAGCGTCGAACTGGTGATGCTATAGGTCCC GCCGATCGCCACTGCCGAGCCCAGAATGGTCGT GCC NLS0610 ref1_2810264 13 ACCGAAGGCGTCCCCGGACACGAAGGCCTGAAACAC CATATCTGTGGCGATCAGGCCGACGTGGTCGCGGAC TTCAACTGGCAGAGAATGCCAGGCCGCTTCGATTTCA GATGATACTGGTACGGACATAGGAGCGGCTTAGCTT TCTCAGTGCAAATGTGATTGATTCCGGCTCAAAAATG ATCTTGATCGGACGAGACGTTTTCAATCCATGTCGTG TTGCCATCGCCGATCGGTGCGTCAAGAGACAGATGG CGCCGACCGTAGATACGCGTTCGGGTTGCCCGCACC GCTTCTCCA NLS0610 ref1_322980 14 GGAGGTGTGATCTGATGATGTGCTGGATGAAAT TGGCGGTCGAGCACTTGTTCAGCTTGGCCAGCTC GACGAGATCGGCGTGATGCTCGGCGTCGATCAG GATGTTCAGCGAGACCGGACGTACGCAGGACTT GGTATTAGCGCCGTTGCGCATCAGCTTGCAGCCT TGCTCTGCTTCTCAGCGTGCCGCGTCAGGATGAC CCTGATGTAGCTGTTGAGGTTGATGCCGTAATAG CCTGCGGACTCTGTGAGATCCCGGCGAAGATCG TCGGCGAGGGTCAGGCGGATGGTGCTGGTCGG NLS0610 ref1_2785241 15 AAGTAACCGCTCAACATGATCTTCAGCATGTTGT CCAACAGCAGGAGAATACATGTAATTCACCATG ACCGGCAAGCTGCGACTGGCCATTGCTTCCACC GCTTGAATGTAGCGATCGAATTTCGCAAAATCA GGGTGGAATGAAAATATCGAACCAAACTGCGAG CCTTGAATCCGTTCTGCAAAATTATCGAAAAATT TTCTTGGCCGACTGCCGTTCGAAAACATTCTTAC GTTTACATGCGGCCCGCCTGAAACAAGACAGTC TACCAGCTCTGGGAAATGGGGGTGAAGGGTCGG
(103) Regions in SEQ ID NOS: 1-15 where corresponding regions in other Methylobacterium strains were identified as having one or more nucleotide mismatches from the target Methylobacterium strain sequence were selected, and qPCR primers designed using Primer3 software (Untergasser et al. (2012), Koressaar et al. (2007)) to flank the mismatch regions, have a melting temperature (Tm) in the range of 55-60 degrees, and to generate a PCR DNA fragment of approximately 100 bp. The probe sequence was designed with a 5 FAM reporter dye, a 3 Iowa Black FQ quencher, and contains one to six LNA bases (Integrated DNA Technologies, Coralville, Iowa). At least 1 of the LNA bases is in the position of a mismatch, while the other LNA bases are used to raise the Tm. The Tm of the probe sequence is targeted to be 10 degrees above the Tm of the primers.
(104) Primer and probe sequences for specific detection of NLS0497 (ISO22), NLS0693 (ISO23), NLS1179 (ISO24), NLS1181 (ISO25), NLS0610 (ISO26), and variants thereof, are provided as SEQ ID NOS: 16-51 in Table 6. Each of the probes contains a 5 FAM reporter dye and a 3 Iowa Black FQ quencher.
(105) TABLE-US-00006 TABLE6 PrimersandProbesforSpecificDetectionofStrains Primer/Probe SEQIDNO Sequence* NLS0497_ref011_46464_For 16 CACGTGTTCTGTCACTCTATT NLS0497_ref011_46464_Rev 17 GAACCGGAAACCACTCTATG NLS0497_ref011_46464_Probe 18 AGCAATCATCTCGCGGCTC NLS0497_ref022_85227_For 19 GCGCACTGAGCAAATTTATAG NLS0497_ref022_85227_Rev 20 CTGAATTGCGAGCAGACA NLS0497_ref022_85227_Probe 21 AGTGAAGGTTTAGCAGTCCG NLS0497_ref015_98103_For 22 CTACTTGATGCGACGATACAC NLS0497_ref015_98103_Rev 23 GGTTGGAAGTGATCGGAATAG NLS0497_ref015_98103_Probe 24 TCGTTCGCCATACATACACG NLS0693_ref1_622066_For 25 GCTCCTTCCTCATATACGCTTC NLS0693_ref1_622066_Rev 26 CCGTGTGATGCTGGACTAATAA NLS0693_ref1_622066_Probe 27 TAATTTCGACCGTAATCGCC NLS0693_ref6_2496_For 28 TGATCGCACAAGTCAGCTATAC NLS0693_ref6_2496_Rev 29 CGAGCTTGACCAGGCTAAAT NLS0693_ref6_2496_Probe 30 ACGCCTTTGTTGGCTTTCAG NLS0693_ref1_2640477_For 31 CGGAGCGATTGGAGGTAAAG NLS0693_ref1_2640477_Rev 32 CTCCGCGGACACAAAGATATTA NLS0693_ref1_2640477_Probe 33 AATCTCAACTTTGCGGCCC NLS1179_ref1_687571_For 34 CTTCTCCCTCTTCTGCGATTAG NLS1179_ref1_687571_Rev 35 GACGCTGTCTTCAAAGGAAAC NLS1179_ref1_687571_Probe 36 TGATGGCGAACAACCTACT NLS1179_refl_695522_For 37 GCATCGACCTGACTTAGGAAA NLS1179_ref1_695522_Rev 38 GAGTTGACGACCGAGCATAA NLS1179_ref1_695522_Probe 39 AGGTAATCGCTCGGTCCGT NLS1179_ref1_705877_For 40 CTTTGTCGGTCTCTCTCTCAAG NLS1179_ref1_705877_Rev 41 CAGCTGACGTAGTAGTGGTATTG NLS1179_ref1_705877_Probe 42 TCGTCAGAGTGCCAGGATT NLS1181_ref1_54084_For 43 GTTCCAGTATCACATGCACAATAC NLS1181_ref1_54084_Rev 44 CGTAGGACCATTCATCCACAT NLS1181_ref1_54084_Probe 45 TTTGGGATGTGCAAACGCT NLS1181_ref1_4816166_For 46 GCTTAGCTCTTCCTCCGTTATT NLS1181_ref1_4816166_Rev 47 ATTCTGGGAGCAACCCTAATG NLS1181_ref1_4816166_Probe 48 ATCTTGTCTGATGTCTGGCG NLS1181_ref1_2292077_For 49 CGTGAAGGTAACTGTCGTAGTC NLS1181_ref1_2292077_Rev 50 CACCGTTGATGTCCAAACAAG NLS1181_ref1_2292077_Probe 51 AACTGCCAAAGAGGTGTCC NLS0610_ref1_2810264_For 52 CATAGGAGCGGCTTAGCTTTCT NLS0610_ref1_2810264_Rev 53 GATGGCAACACGACATGGATTG NLS0610_ref1_2810264_Probe 54 CAGTGCAAATGTGATTGATTC NLS0610_ref1_322980_For 55 GACGTACGCAGGACTTGGTATTAG NLS0610_refl_322980_Rev 56 CTCAACAGCTACATCAGGGTCATC NLS0610_ref1_322980_Probe 57 TTGCTCTGCTTCTCAGCGTG NLS0610_refl_2785241_For 58 AACCAAACTGCGAGCCTTGA NLS0610_ref1_2785241_Rev 59 GGGCCGCATGTAAACGTAAGA NLS0610_ref1_2785241_Probe 60 TTCTTGGCCGACTGCCG *Bold and underlined letters represent the position of an LNA base
Use of Primer/Probe Sets on Isolated DNA to Detect Specific Methylobacterium Isolates and Variants Thereof and Distinguish from Related Methylobacterium Isolates
(106) Each 10 ul qPCR reaction contains 5 ul of Quantabio PerfeCTa qPCR ToughMix 2 Mastermix, Low ROX from VWR, 0.05 ul of 100 uM forward primer, 0.05 ul of 100 uM reverse primer, 0.05 ul of 50 uM probe, 2.85 ul nuclease free water and 2 ul of DNA template. Approximately 1 ng of DNA template is used per reaction. The reaction is conducted in a ThermoFisher QuantStudio 6 Flex Real-Time PCR System with the following program: 95 C. for 3 min, then 40 cycles of 95 C. for 15 sec and 60 C. for 45 seconds. The analysis software on the PCR instrument calculates a threshold and Ct value for each sample. Each sample is run in triplicate on the same qPCR plate. A positive result is indicated where the delta Ct between positive and negative controls is at least 5.
(107) Other Methylobacterium isolates listed in Table 1 and variants thereof are identified by the presence of DNA fragments using assays as described above. Unique fragments for use in such methods are provided in Table 7.
(108) TABLE-US-00007 TABLE7 SEQID Strain Fragment NO Sequence NLS0017 ref4_930 61 GCAAAACGACCTAATAGTTCTACAGCGGCATGCG CCAAGTCAGCGCGGTGAACAGTATACCTGGGAG CAACTTGTCCTCCGAAACCCACATAAAACAAATT ACTCCTGGCAGTGCCCAGTCCATCAAAATCGAAT ACAATATTTCTCGAGGAGGCATCTGTAATAGCCT GCCAAAGCAACAAAGCTATGGCGCCGTTATGACT TTCATTGCTTCTGGTAGACATAAAATAATATGCC GATTTGTGATCCCAAATGTAGAATATTGCCGCAT CAATTGCGCCAAGTTTATTTCGGATCGAT NLS0017 ref1_142021 62 GGCGCCAACGGTATGATCGCATGATTTTCCTGCG GCATAGCTTGCGGGAATGGCGTATTTGGCGCTCT CCTCAGGAATTTCTAAGGGCATACGCAGGAACTC TACAGCACTTTTACTGGTATTTTGTAGTGACAGC GGAGGAGGCTGGTGCTCAAGGTAATCGTGATGA AGTGATCCGGGCCATTCGGGGCGCGTTTCTAGTC TTTCCAATCCGCGCCCTGTACCACGTATTACGCC GGACCGGTCTGCGCCGCGCCGCCCTCTTGACCGC CCTAAATGTCTAAGAGCGTCTAACAAAGC NLS0017 ref1_142636 63 GACGATATCGCTCATCTTCACTGCATTGAAGCTG GTGCCGTACTGCATAGGGATGAAAAAGTGATGC GGATAGACGGCTGACGGGAAAGCGCCTGGTCGA TCGAAGACTTTGCTGACGAGGTTGTGGTAGCCCC GGATATAGGCATCGAAGGCCGGGACGTTGATCCC ATCCTTTGCCTTATCTTGACTGGCGTCGTCGCGTG CCGTCAGAACGGGCACGTCGCAGGTCATCGAGG CCAGCACCTTGCGGAACACCTGCGTTCCGCCGTT GGGATTATCGACGGCGAACGCGGTGGCCGC NLS0020 ref3_25009 64 GCCCTTCTGTCAGGCGATATTGTATAATGGCGTT GCCCCAATAGAAGCAGCCATTCGTGCGAGGGCA GCAGCGACGCTAGGTCGAAAGAGCATCCTAATCT CGATCAAGATGCGACTGAGATTTCTGATGAAAAT ATCTAGACACAAGCAAAGCTGGTGAAATTACAA CGATCATGGCGACAATTGCGGCCAATTCGGCCGG AACTTGAAGGAACATAAAAATGAATATTACAAA TATACCGCAAAGCATGTAGAGTTGCTACACCAAG GGTCGGGACGTCCAAAAAAACTCACTGAGGA NLS0020 ref3_25219 65 GGAACATAAAAATGAATATTACAAATATACCGC AAAGCATGTAGAGTTGCTACACCAAGGGTCGGG ACGTCCAAAAAAACTCACTGAGGAAGTCGACTG GAAGCACGAGGCGCCCCCCCCAGGAGCGGGGCG ACCGGCAAGGGGGCCCGCAATTGTCGCCATGATC GACCAGCTTAGGTAGGATCCTCTTTCGACCTAAC GAATGGCTGCTTCTATTGGGGCAACGCCATTATA CAATATCGCCTGACCATCTGGAACGCGGCCCGGT CCACCGGCAGGTTGGCGACGACAGCGTCGGAG NLS0020 ref1_4361220 66 CGGCGTCGACCAGCCGGGCGAACTGCTTGGGCAT GCTCTCCCGCGACGCCGGCCACAGCCGCGTCCCC GTCCCTCCGCACAGGATCATCGGGTGGATTTGAA AGGCAAAACGGGACATCAGGATAGGCCGCTCAG GCGTTGGCGCTGAGGCGCTTGATGTCGGCGTCGA CCATCTCGGTGATCAGCGCCTCGAGGCTGGTCTC GGCCTCCCAGCCGAAGGTCGCCTTGGCCTTGGCG GGGTTGCCCAGCAGCACCTCGACCTCTGCCGGCC GGAACAGCGCCGGGTCGACGATCAGGTGG NLS0020 ref1_4602420 67 CTGGACATGCGCCCACCCCGGCCAAGTCCGACCG CACCGGCAACCGCTCCTGTAGTCGTCGTCATCGT TCTCACCCCTGAGGCGGAGACCGTCCGCTAACGG GGTGTCTCAAGCAACCGTGGGGCGGAGGAACAC GCACGTAGTCGCGTTTCAAGGTTCGCACGAACGC CTCGGCCATGCCGTTGCTCTGCGGGCTCTCCAGC GGCGTCGTTTTTGGCACCAAACCAAGGTCGCGGG CGAAGCGGCGCGTGTCGCGGGGACTGTCAGGAA TTTCGTGTGGGGGCGGCCATAGTGGATCCG NLS0089 ref1_194299 68 GGAAATCGGCTTCAAGTACGACGTCACGCCGGCC ATGCAGGTCACGGGTGCACTGTTCAATCTCGAGC GCGACAACCAGCCGTTCCCCTCGAACGTGGAGTC CGGCCTCGTCCTTGGCGCAGGTCAGACACGCACC CAGGGCGCGGAAATCGGCCTGGCCGGCTATCTAA CCGATTGGTGGCAGGTCTTTGGCGGCTACGCTTA TACCGAGGCACGCGTACTCTCGCCACTGGAAGAC GATGGAGACGTGATCGCAGCAGGTAATCTCGTCG GCAACGTTCCGCTAAATACTTTCAGTCT NLS0089 ref1_194305 69 CGGCCTGGCCGGCTATCTAACCGATTGGTGGCAG GTCTTTGGCGGCTACGCTTATACCGAGGCACGCG TACTCTCGCCACTGGAAGACGATGGAGACGTGAT CGCAGCAGGTAATCTCGTCGGCAACGTTCCGCTA AATACTTTCAGTCTGTTCAACAAGTTCGATATCA ACGAGAATTTCTCCGTTGCTCTGGGCTATTACTAT CAGGATGCCAGCTTTGCCTCCTCAGACAATGCAG TGCGTTTGCCAAGTTATTCGCGGTTCGATGGCGG GTTGTTCTATCGATTCGACGAGTTGAC NLS0089 ref1_194310 70 ACGTTCCGCTAAATACTTTCAGTCTGTTCAACAA GTTCGATATCAACGAGAATTTCTCCGTTGCTCTG GGCTATTACTATCAGGATGCCAGCTTTGCCTCCTC AGACAATGCAGTGCGTTTGCCAAGTTATTCGCGG TTCGATGGCGGGTTGTTCTATCGATTCGACGAGT TGACACGCGTTCAGCTTAGCGTCGAGAACATTTT CGACAGGCGTTACATCATCAACTCCAACAACAAC AACAACCTCACGCCTGGCGCGCCGAGAACAGTCC GCGTGCAATTGATCGCTCGGTTCTAAA NLS0042 ref1_86157 71 AGCCCACAAGCCTGATGCACTTAACTACATCCTC TAATGTCGCGCCAATTTGCTTGGCGGCAGGGGAT GTTGTATCGTCATAGGCTTGTCTAACCGGAACTT GTTTGCCAATCTCTTTGGCGATCGCAACCGCCAT CTCGTGTTCGTCAACCATGTGCGCGTTCCTCTAAT TGCACTCATGGTGCCACGTGCACCTCCGATCGTC TCGTGTCTAGAATGAAGGTGGGAACAACCTTACA CAGGCTTTCGCGACGCGCGAATTTCTGGTTTCTCC GCCTCGGATGTGGGTTTGAGCGCTTC NLS0042 ref1_142469 72 CTTTTCATTTGTCATGATCTCGACCAAGGTATTCA CGGCAAGCTCGGTCTGTTGCTTAGCAAGTGCCTG AACTTCGCGAACGATCGGCTCTCGACCCTTCGGG TTCGAGACCTGTCCCTTTTGAAAACCACGTGCCC TACACTTTTCGGGATCAAGGTGCGGGTTGGCTTT GGTCAAAATTCTCTGGCGTCCCATTACACGCCCT CCGCATCATCGTTCCCGCGAACGATCTGACCCCC GACTTCCGCGAGGAAGCGTGTGGCGTGATCCTCG AAGCGGAATGCCACCTCGAACTGTTCC NLS0042 ref1_142321 73 CAGCAGCAAGCAGATCGTTGAAAACCGCTTGAA CCGCATCTTGATCGGGACCGGAACCAATCAGGTC ATCTAGGTAAACCGAGACGTAAACTCGTTTGCGC TCGGCATCTTTCAGAACGTCCGTGATGCCAGACC GCATTAGTACCATCGTCGCCAAGGCGGGCGACTG AACGAAGCCGATCGGCAGAGAGTAACGGGGACC GCCCCTAATCGGGTTGCGAACGCAAGACCACTTA GCAAAGGTTCGAGCACGGCCGAACTTCGCATGGT GGAGAGCCGCGGCAACACGGTTCCGTGATA NLS0064 ref1_153668 74 TAGACATTCCAACAAACCGGCAAGAGGCTCGTCC TCACTCGAGGATTTGTTGGGACTTGCATGATGTC GAAGCGGAGCCGTTATGACCTGGGTGCGATCATG CGCCGAGCATGGGAGATGGCTCGGGAGGCGGCA TTCGCGGTTGGCGAGCGGGCACGGACTCACCTTG CTGCCGCGATGCGCAGCGCGTGGGCCGAAGCCA AGTTGGCACTCGCGCCCACGAAGACGGAGCAGG ATCGTCTCTCTCCGAGCGACATGATCGGACATGA GGACGCCTACCAAGGCCGGGTTCTAAAATAT NLS0064 ref1_3842117 75 AAGATGGATACGACAAGCGCGATTACATTATTTG CGAAATAGATGGACAAATAAAAGACAAAGGACT GATGTATTTCCTTAAATCTGGACAAGTTGACCTCT TTCACATAGAAGTCACCACTCCCTTTGGGACAAT TTGGTGTCACGAAAACATAGAGGCCGAACTTCTT AGCTGAATTATCGCGCTCCGGGTTCTTATGCGGC TGAGTGAAGCGCGGGACAGCTTGCGAGCAGGGC CGCCAATGGCAGCCGGGATGACACAATGCTCGGT CTCCCGACGCTTCTTCAATCGGGAGCGCT NLS0064 ref1_3842278 76 AGCTGAATTATCGCGCTCCGGGTTCTTATGCGGC TGAGTGAAGCGCGGGACAGCTTGCGAGCAGGGC CGCCAATGGCAGCCGGGATGACACAATGCTCGGT CTCCCGACGCTTCTTCAATCGGGAGCGCTTCGCA GCCCGGGGCGGCGCGCTCATGCGTCACGACCTGG GCCCTGCGCACCTTCGCGGCCCCGCCGTCCCGGC AGATCCCTGATGCCCCAAGTGGGCGGCCACTCCA TCAAAGAACCCCGGCCTGTGGCAGATCTCGTAGG CATACCGAGGTTCCGCAGTGCCCCCACC NLS0109 ref1_135566 77 ACGGTCACCCCACGGACTGGGCGAGTACCTCACC GGTGTTCTATCATAACGCCGAGTTAGTTTTCGAC CGTCCCTTATGCGATGTACCACCGGTGTCGGCAG CCGATTTCGTCCCACCGGGAGCTGGCGTTCCGGT TCAGACCACCATCATCGGTCACGATGTCTGGATT GGACACGGGGCCTTCATCTCCCCCGGCGTGACTA TAGGAAACGGCGCGATCGTCGGGGCCCAGGCGG TCGTCACAAGAGATGTCCCACCCTATGCGGTAGT TGCTGGCGTCCCCGCGACCGTACGACGAT NLS0109 ref1_135772 78 CCAATAAAAGCGTTGGCCGCCTGGGCAACCCGAT CCGAGCCTAAGACTCAAAGCGCAAGCGAACACT TGGTAGAGACAGCCCGCCGACTACGGCGTTCCAG CACTCTCCGGCTTTGATCGGATAGGCATTGGTCA AGGTGCCGGTGGTGATGACCTCGCCCGCCGCAAG CGGCGAATTACTCGGATCAGCGGCCAGCACCTCG ACCAAGTGTCGGAGCGCGACCAAAGGGCCACGT TCGAGGACGTTTGAGGCGCGACCAGTCTCGATAG TCTCATCGTCGCGGCGAAGCTGCACCTCGA NLS0109 ref1_169470 79 CGATGGCACCGACCTGCCATGCCTCTGCCGTCCG CGCCAGAATGGTAAAGAGGACGAAGGGGGTAAG GATCGTCGCTGCAGTGTTGAGCAGCGACCAGAGA AGGGGGCCGAACATCGGCATCAAACCTCGATTGC CACTCGGACGCGAAGCGCGTCTTGAAGGAGGGA TGGAAGCGAAACGGCCGCAGAGTAACCGCCGAC GAAAGATTGCACCCCTCATCGAGCAGGATCGGA GGTGAAGGCAAGCGTGGGTTATTGGTAAGTGCA AAAAATATAATGGTAGCGTCAGATCTAGCGTTC
REFERENCES
(109) Altschul S. F., Gish W., Miller W., Myers E. W., Lipman D. J. (1990) Basic local alignment search tool. J. Mol. Biol. 215:403-410 Bentley D. R., Balasubramanian S., Swerdlow H. P., Smith G. P., Milton J., Brown D. G., Hall K. P., Evers D. J., Barnes C. L., Bignell H. R. et al. (2008) Accurate whole human genome sequencing using reversible terminator chemistry. Nature 456:53-59. Caporaso J. G., Lauber C. L., Walters W. A., Berg-Lyons D., Huntley J., Fierer N., Owens S. M., Betley J., Fraser L., Bauer M., Gormley N., Gilbert J. A., Smith G., Knight R. (2012) Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J 6:1621-1624. Comai et al. (1983) An altered aroA gene product confers resistance to the herbicide glyphosate. Science 221 (4608): 370-371. Green, P. N. 2005. Methylobacterium. In Brenner, D. J., N. R. Krieg, and J. T. Staley (eds.). Bergey's Manual of Systematic Bacteriology. Volume two, The Proteobacteria. Part C, The alpha-, beta-, delta-, and epsilonproteobacteria. Second edition. Springer, New York. Pages 567-571. Green, P. N. 2006. Methylobacterium. In Dworkin, M., S. Falkow, E. Rosenberg, K.-H. Schleifer, and E. Stackebrandt (eds.). The Prokaryotes. A Handbook on the Biology of Bacteria. Volume 5. Proteobacteria: Alpha and Beta Subclasses. Third edition. Springer, New York. Pages 257-265. Green and Ardley (2018) Review of the genus Methylobacterium and closely related organisms: a proposal that some Methylobacterium species be reclassified into a new genus, Methylorubrum gen. nov. International Journal of Systematic and Evolutionary Microbiology 68:2727-2748. Konstantinidis, K. T. and Tiedje J. M. (2005) Proc. Nat. Acad. Sci. USA 102:2567-2572. Lidstrom, M. E. 2006. Aerobic methylotrophic prokaryotes. In Dworkin, M., S. Falkow, E. Rosenberg, K.-H. Schleifer, and E. Stackebrandt (eds.). The Prokaryotes. A Handbook on the Biology of Bacteria. Volume 2. Ecophysiology and biochemistry. Third edition. Springer, New York. Pages 618-634. Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA. 74 (12): 5463-5467 Sy, A., Giraud, E., Jourand, P., Garcia, N., Willems, A., De Lajudie, P., Prin, Y., Neyra, M., Gillis, M., Boivin-Masson, C., and Dreyfus, B. 2001. Methylotrophic Methylobacterium Bacteria Nodulate and Fix Nitrogen in Symbiosis with Legumes. Jour. Bacteriol. 183 (1): 214-220. Vogel, H. J., and D. M. Bonner. 1956. Acetylornithinase of Escherichia coli: Partial purification and some properties. J. Biol. Chem. 218:97-106. Whittenbury, R., S. L. Davies, and J. F. Wilkinson. 1970. Enrichment, isolation and some properties of methane-utilizing bacteria. J. Gen. Microbiol. 61:205-218.
(110) Having illustrated and described the principles of the present disclosure, it should be apparent to persons skilled in the art that the disclosure can be modified in arrangement and detail without departing from such principles.
(111) Although the materials and methods have been described in terms of various embodiments and illustrative examples, it will be apparent to those of skill in the art that variations can be applied to the materials and methods described herein without departing from the concept, spirit and scope of the disclosure. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.