COMPOSITION COMPRISING LACTOBACILLUS PLANTARUM FOR PREVENTING AND/OR TREATING MENTAL ILLNESS
20250332204 ยท 2025-10-30
Inventors
Cpc classification
A23V2002/00
HUMAN NECESSITIES
A61P25/18
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
A23V2200/322
HUMAN NECESSITIES
A23V2200/322
HUMAN NECESSITIES
A61K9/19
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
International classification
A23L33/135
HUMAN NECESSITIES
Abstract
The invention relates to compositions comprising Lactobacillus plantarum, and methods and uses of said compositions for preventing and/or treating mental illness, symptoms affecting mental health and/or conditions associated with chronic stress, in a mammal. The invention can be applied in restoring, maintaining, and/or promoting mental (including cognitive) health and has potential applications, inter alia, in the area of dietary and food supplements, medicaments and pharmaceuticals.
Claims
1. A method according to claim 11, wherein the composition comprises Lactobacillus plantarum strain LP12151 deposited with the DSMZ under deposit number DSM 32721.
2. A method according to claim 11, wherein the composition comprises Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655.
3. A method according to claim 11, wherein the composition comprises Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654.
4. A method according to claim 11, wherein the composition further comprises another bacterial strain.
5. A method according to claim 4, wherein the other bacterial strain is of the species.
6. A method according to claim 11, wherein the composition comprises (a) at least two Lactobacillus plantarum strains selected from the group consisting of: Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655, Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654, and Lactobacillus plantarum strain LP12151 deposited with the DSMZ under deposit number DSM 32721; and (b) Lactobacillus paracasei strain Lpc-37, deposited with the DSMZ under deposit number DSM 32661.
7. A method according to claim 11, wherein the composition is in the form of a food product, a beverage, a dietary supplement, or a pharmaceutically acceptable composition.
8. A method according to claim 11, wherein the is a spray dried or freeze-dried composition.
9. A method according to claim 11, wherein the composition comprises a cryoprotectant.
10. A method according to claim 11, wherein: the composition is in unit dosage form, and the Lactobacillus plantarum strain is present in the composition in an amount between 10.sup.6 and 10.sup.12 CFU.
11. A method for preventing and/or treating mental illness, a symptom affecting mental health and/or a condition associated with chronic stress, in a mammal in need thereof, wherein the method comprises administering to the mammal a composition comprising a Lactobacillus plantarum strain selected from the group consisting of: Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655, Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654, and Lactobacillus plantarum strain LP12151 deposited with the DSMZ under deposit number DSM 32721.
12. (canceled)
13. A method according to claim 11, wherein: the method comprises preventing and/or treating mental illness; and the mental illness is a mood disorder, an anxiety disorder and/or depression.
14. A method according to claim 11, wherein: the method comprises preventing and/or treating a symptom affecting mental health; and the symptom affecting mental health is anxiety, mood swings and/or depression.
15. A method according to claim 11, wherein; the mental illness results in diminished cognitive function, and/or the symptom affecting mental health is diminished cognitive function.
16. A method according to claim 11, wherein: the method comprises preventing and/or treating a condition associated with chronic stress; and the condition associated with chronic stress is a gastrointestinal disorder.
17. A method according to claim 11, wherein: the method comprises preventing and/or treating a condition associated with chronic stress, and the condition associated with chronic stress is irritable bowel syndrome.
18. A method according to claim 11, wherein the composition comprises at least two Lactobacillus plantarum strains selected from the group consisting of: Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655, Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654, and Lactobacillus plantarum strain LP12151 deposited with the DSMZ under deposit number DSM 32721.
Description
DESCRIPTION OF DRAWINGS
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION OF INVENTION
Bacteria and Deposit
[0035] The bacteria used in aspects of the invention are bacteria of the species Lactobacillus plantarum. Novel Lactobacillus plantarum strains of the invention are: [0036] a. Lactobacillus plantarum strain LP12151 deposited with the DSMZ (Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Inhoffenstrasse 7B, D-38124 BraunschweigGermany) under deposit number DSM 32721 on Jan. 9, 2018; [0037] b. Lactobacillus plantarum strain LP12418 deposited with the DSMZ (Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Inhoffenstrasse 7B, D-38124 BraunschweigGermany) under deposit number DSM 32655 on Sep. 27, 2017; and [0038] C. Lactobacillus plantarum strain LP12407 deposited with the DSMZ (Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Inhoffenstrasse 7B, D-38124 Braunschweig-Germany) under deposit number DSM 32654 on Sep. 27, 2017. [0039] The DSMZ deposit forms for LP12151, LP12418 and LP12407 giving relevant information on the characteristics of the strains are on record with this specification and incorporated by reference herein (LP12151, is referred to as DGCC 12151, LP12418 is referred to as DGCC12418 and LP12407 is referred to as DGCC12407).
[0040] The compositions of the invention may include one or more of the above strains, and may, in addition, comprise Lactobacillus paracasei strain Lpc-37, also known as DGCC4981 or Lbc81. Strain Lpc-37 is registered at the ATCC under deposit number PTA 4798 (deposited Nov. 15, 2002) and at the DSMZ (Leibniz-Institut DSMZ-Deutsche Sammlung von
[0041] Mikroorganismen und Zellkulturen GmbH, Inhoffenstrasse 7B, D-38124 Braunschweig-Germany) under deposit number DSM32661 on Oct. 5, 2017. The DSMZ deposit form for Lpc-37 giving relevant information on the characteristics of the strain is on record with this specification and incorporated by reference herein.
[0042] Thus, the compositions of the invention may comprise LP12151, LP12418 or LP12407, or any combination thereof. In addition, such compositions may comprise Lpc-37.
[0043] The novel Lactobacillus plantarum strains of the invention may also be used in combination with one or more other bacterial strains which have the ability to exert positive health benefits on a host to which they are administered. Preferably, the other bacterial strains, when used in aspects of the invention, are suitable for human and/or animal consumption. A skilled person will be readily aware of specific bacterial strains which are used in the food and/or agricultural industries and which are generally considered suitable for human and/or animal consumption.
[0044] The Lactobacillus plantarum strains of the invention may be used in any form (for example viable, dormant, inactivated or dead bacteria) provided that the bacteria remain capable of exerting the effects described herein. Preferably, the Lactobacillus plantarum strains used in aspects of the invention are viable.
[0045] LP12151, LP12418, LP12407 and Lpc-37 are probiotic bacteria. The term probiotic bacteria is defined as covering any non-pathogenic bacteria which, when administered live in adequate amounts to a host, confer a health benefit on that host. For classification as a probiotic, the bacteria must survive passage through the upper part of the digestive tract of the host. They are non-pathogenic, non-toxic and exercise their beneficial effect on health on the one hand via ecological interactions with the resident flora in the digestive tract, and on the other hand via their ability to influence the host physiology and immune system in a positive manner. Probiotic bacteria, when administered to a host in sufficient number, have the ability to progress through the intestine, maintaining viability, exerting their primary effects in the lumen and/or the wall of the host's gastrointestinal tract. They then transiently form part of the resident flora and this colonisation (or transient colonisation) allows the probiotic bacteria to exercise a beneficial effect, such as the repression of potentially pathogenic micro-organisms present in the flora and interactions with the host in the intestine including the immune system.
[0046] Optionally the novel Lactobacillus plantarum strains of the invention are used in combination with other probiotic bacteria.
Compositions
[0047] The term composition is used in the broad sense to mean the manner in which something is composed, i.e. its general makeup.
[0048] In one aspect of the invention, the compositions may consist essentially of a single strain of Lactobacillus plantarum bacteria (e.g. LP12151, LP12418 or LP12407).
[0049] Alternatively, the compositions may comprise a combination of one or more of LP12151, LP12418 and LP12407.
[0050] The compositions of the invention may additionally comprise other components, such as other bacterial strains (e.g. Lpc-37), biological and chemical components, active ingredients, metabolites, nutrients, fibres, prebiotics, etc.
[0051] While it is not a requirement that the compositions of the invention comprise any support, diluent or excipient, such a support, diluent or excipient may be added and used in a manner which is familiar to those skilled in the art. Examples of suitable excipients include, but are not limited to, microcrystalline cellulose, rice maltodextrin, silicone dioxide, and magnesium stearate. The compositions of the invention may also comprise cryoprotectant components (for example, glucose, sucrose, lactose, trehalose, sodium ascorbate and/or other suitable cryoprotectants).
[0052] The terms composition and formulation may be used interchangeably.
[0053] Compositions used in aspects of the invention may take the form of solid, solution or suspension preparations. Examples of solid preparations include, but are not limited to: tablets, pills, capsules, granules and powders which may be wettable, spray-dried or freeze dried/lyophilized. The compositions may contain flavouring or colouring agents. The compositions may be formulated for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release applications.
[0054] By way of example, if the compositions of the present invention are used in a tablet form, the tablets may also contain one or more of: excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine; disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates; granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, gelatin and acacia; lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.
[0055] Examples of other acceptable carriers for use in preparing compositions include, for example, water, salt solutions, alcohol, silicone, waxes, petroleum jelly, vegetable oils, polyethylene glycols, propylene glycol, liposomes, sugars, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, perfume oil, fatty acid monoglycerides and diglycerides, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.
[0056] For aqueous suspensions and/or elixirs, the compositions of the present invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, propylene glycol and glycerin, and combinations thereof.
[0057] Specific non-limiting examples of compositions which can be used in aspects of the invention are set out below for illustrative purposes. These include, but are not limited to food products, functional foods, dietary supplements, pharmaceutical compositions and medicaments.
Dietary Supplements
[0058] The compositions of the invention may take the form of dietary supplements or may themselves be used in combination with dietary supplements, also referred to herein as food supplements.
[0059] The term dietary supplement as used herein refers to a product intended for ingestion that contains a dietary ingredient intended to add nutritional value or health benefits to (supplement) the diet. A dietary ingredient may include (but is not limited to) one, or any combination, of the following substances: bacteria, a probiotic (e.g. probiotic bacteria), a vitamin, a mineral, a herb or other botanical, an amino acid, a dietary substance for use by people to supplement the diet by increasing the total dietary intake, a concentrate, metabolite, constituent, or extract.
[0060] Dietary supplements may be found in many forms such as tablets, capsules, soft gels, gel caps, liquids, or powders. Some dietary supplements can help ensure an adequate dietary intake of essential nutrients; others may help reduce risk of disease.
Food Products
[0061] The compositions of the invention may take the form of a food product. Here, the term food is used in a broad sense and covers food and drink for humans as well as food and drink for animals (i.e. a feed). Preferably, the food product is suitable for, and designed for, human consumption.
[0062] The food may be in the form of a liquid, solid or suspension, depending on the use and/or the mode of application and/or the mode of administration.
[0063] When in the form of a food product, the composition may comprise or be used in conjunction with one or more of: a nutritionally acceptable carrier, a nutritionally acceptable diluent, a nutritionally acceptable excipient, a nutritionally acceptable adjuvant, a nutritionally active ingredient.
[0064] By way of example, the compositions of the invention may take the form of one of the following:
[0065] A fruit juice; a beverage comprising whey protein: a health or herbal tea, a cocoa drink, a milk drink, a lactic acid bacteria drink, a yoghurt and/or a drinking yoghurt, a cheese, an ice cream, a water ice, a desserts, a confectionery, a biscuit, a cake, cake mix or cake filling, a snack food, a fruit filling, a cake or doughnut icing, an instant bakery filling cream, a filling for cookies, a ready-to-use bakery filling, a reduced calorie filling, an adult nutritional beverage, an acidified soy/juice beverage, a nutritional or health bar, a beverage powder, a calcium fortified soy milk, or a calcium fortified coffee beverage.
[0066] Optionally, where the product is a food product, the Lactobacillus plantarum should remain effective through the normal sell-by or expiration date during which the food product is offered for sale by the retailer. Preferably, the effective time should extend past such dates until the end of the normal freshness period when food spoilage becomes apparent. The desired lengths of time and normal shelf life will vary from foodstuff to foodstuff and those of ordinary skill in the art will recognise that shelf-life times will vary upon the type of foodstuff, the size of the foodstuff, storage temperatures, processing conditions, packaging material and packaging equipment.
Food Ingredients
[0067] Compositions of the present invention may take the form of a food ingredient and/or feed ingredient.
[0068] As used herein the term food ingredient or feed ingredient includes a composition which is or can be added to functional foods or foodstuffs as a nutritional and/or health supplement for humans and animals.
[0069] The food ingredient may be in the form of a liquid, suspension or solid, depending on the use and/or the mode of application and/or the mode of administration.
Functional Foods
[0070] Compositions of the invention may take the form of functional foods.
[0071] As used herein, the term functional food means food which is capable of providing not only a nutritional effect, but is also capable of delivering a further beneficial effect to the consumer.
[0072] Accordingly, functional foods are ordinary foods that have components or ingredients (such as those described herein) incorporated into them that impart to the food a specific functione.g. medical or physiological benefit-other than a purely nutritional effect.
[0073] Although there is no legal definition of a functional food, most of the parties with an interest in this area agree that they are foods marketed as having specific health effects beyond basic nutritional effects.
[0074] Some functional foods are nutraceuticals. Here, the term nutraceutical means a food which is capable of providing not only a nutritional effect and/or a taste satisfaction, but is also capable of delivering a therapeutic (or other beneficial) effect to the consumer. Nutraceuticals cross the traditional dividing lines between foods and medicine.
Medical Foods
[0075] Compositions of the present invention may take the form of medical foods.
[0076] By medical food it is meant a food which is formulated to be consumed or administered with or without the supervision of a physician and which is intended for a specific dietary management or condition for which distinctive nutritional requirements, based on recognized scientific principles, are established by medical evaluation.
Pharmaceutical Compositions
[0077] Compositions of the invention may be used asor in the preparation ofpharmaceuticals. Here, the term pharmaceutical is used in a broad senseand covers pharmaceuticals for humans as well as pharmaceuticals for animals (i.e. veterinary applications). In a preferred aspect, the pharmaceutical is for human use.
[0078] The pharmaceutical can be for therapeutic purposeswhich may be curative or palliative or preventative in nature.
[0079] A pharmaceutical may be in the form of a compressed tablet, tablet, capsule, ointment, suppository or drinkable solution.
[0080] When used asor in the preparation ofa pharmaceutical, the compositions of the present invention may be used in conjunction with one or more of: a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, a pharmaceutically acceptable adjuvant, a pharmaceutically active ingredient.
[0081] The pharmaceutical may be in the form of a liquid or as a soliddepending on the use and/or the mode of application and/or the mode of administration.
[0082] The Lactobacillus plantarum strains used in the present invention may constitute the pharmaceutically active ingredient or ingredients. In certain embodiments, the Lactobacillus plantarum strain or strains used may constitute the sole active ingredient or ingredients. Alternatively, LP12151, LP12407 and/or LP12418 may be present with one or more other pharmaceutically active ingredients.
Medicaments
[0083] Compositions of the invention may take the form of medicaments.
[0084] The term medicament as used herein encompasses medicaments for both human and animal usage in human and veterinary medicine. In addition, the term medicament as used herein means any substance which provides a therapeutic, preventative and/or beneficial effect. The term medicament as used herein is not necessarily limited to substances which need Marketing Approval, but may include substances which can be used in cosmetics, nutraceuticals, food (including feeds and beverages for example), probiotic cultures, and natural remedies. In addition, the term medicament as used herein encompasses a product designed for incorporation in animal feed, for example livestock feed and/or pet food.
Dosage
[0085] The compositions of the present invention may comprise from 10.sup.6 to 10.sup.12 colony forming units (CFU) of LP12151, LP12418 and/or LP12407 per dose or per gram of composition, and more particularly from 10.sup.8 to 10.sup.12 CFU per dose or per gram of composition. Optionally the compositions comprise about 10.sup.10 CFU LP12151, LP12418 and/or LP12407 per dose or per gram of composition.
[0086] The Lactobacillus plantarum strains of the invention (LP12151, LP12418 and/or LP12407) may be administered at a dosage of from about 10.sup.6 to about 10.sup.12 CFU of bacteria per dose, preferably about 10.sup.8 to about 10.sup.12 CFU of bacteria per dose. By the term per dose it is meant that this amount of bacteria is provided to a subject either per day or per intake, preferably per day. For example, if the bacteria are to be administered in a food product, for example in a yoghurt, then the yoghurt may contain from about 10.sup.6 to 10.sup.12 CFU of LP12151, LP12418 and/or LP12407. Alternatively, however, this amount of bacteria may be split into multiple administrations, each consisting of a smaller amount of microbial loading-so long as the overall amount of Lactobacillus plantarum received by the subject in any specific time, for instance each 24 hour period, is from about 10.sup.6 to about 10.sup.12 CFU of bacteria, optionally 10.sup.8 to about 10.sup.12 CFU of bacteria.
[0087] In accordance with the present invention an effective amount of LP12151, LP12418 and/or LP12407 may be at least 10.sup.6 CFU of bacteria/dose, optionally from about 10.sup.8 to about 10.sup.12 CFU of bacteria/dose, e.g., about 10.sup.10 CFU of bacteria/dose.
[0088] In one embodiment, the LP12151, LP12418 and/or LP12407 may be administered at a dosage of from about 10.sup.6 to about 10.sup.12 CFU of bacteria/day, optionally about 10.sup.8 to about 10.sup.12 CFU of bacteria/day. Hence, the effective amount in this embodiment may be from about 10.sup.6 to about 10.sup.12 CFU of bacteria/day, optionally about 10.sup.8 to about 10.sup.12 CFU of bacteria/day.
Effects/Subjects/Medical Indications
[0089] The compositions of the present invention can be used for administration to a mammal, including for example livestock (including cattle, horses, pigs, and sheep), and humans. In some embodiments of the present invention, the mammal is a companion animal (including pets), such as a dog or a cat for instance. In preferred embodiments, the compositions are for use in a human.
[0090] The compositions of the present invention can be used for the prevention and/or treatment of a mental illness, a symptom affecting mental health and/or a condition associated with chronic stress, such as for example, neurological and gastrointestinal disorders.
[0091] The term mental illness can be defined as a health condition that changes a person's thinking, feelings, or behaviour (or all three) and that causes the person distress and problems functioning in social, work or family activities. Mental illness encompasses a wide range of disorders related to anxiety, mood, psychosis, eating behaviour, impulse control and addiction, personality, sociability, dissociation, obsessive-compulsive and post-traumatic stress. Each illness alters a person's thoughts, feelings, and/or behaviours in distinct ways. As used herein, mental illness also includes neurological disorders and conditions related to mental illness which may be a cause or symptom of a mental illness or be a condition that can increase the chance of one developing.
[0092] Disorders associated with anxiety are categorised under mental illness. The term anxiety disorder refers to a specific mental illness that involves extreme fear or worry, and includes generalized anxiety disorder (GAD), panic disorder and panic attacks, agoraphobia, social anxiety disorder, selective mutism, separation anxiety, and specific phobias. Obsessive-compulsive disorder (OCD) and posttraumatic stress disorder (PTSD) are closely related to anxiety disorders, which some may experience at the same time as depression. GAD represents more than the normal level of anxiety individuals experience from day to day and is characterised by chronic worry and tension. Compositions of the invention can be used to treat and/or prevent recognised anxiety disorders as well as symptoms of anxiety more generally.
[0093] As used herein, mental illness also includes associated neurological disorders, including memory disorders, mild cognitive impairment, dementia and Alzheimer's disease. Cognition denotes a relatively high level of processing of specific information including thinking, memory, perception, motivation, skilled movements and language. Cognitive disorders are defined as those with a significant impairment of cognition or memory that represents a marked deterioration from a previous level of function (Guerrero, Anthony (2008). Problem-Based Behavioral Science of Medicine. New York: Springer. pp. 367-79). They can be categorised into three main areas: (1) Delirium, a disorder affecting situational awareness and processing of new information; (2) Dementia, a disorder which can erase all or parts of an individual's memory; and (3) Amnesia, a disorder in which the individual afflicted has trouble retaining long term memories.
[0094] The compositions of the invention can be used to promote, restore and/or maintain an individual's mental health, such as to prevent mental illness or any associated disorders and/or symptoms affecting an individual's mental health.
[0095] Symptoms affecting mental health include; feeling sad or down, confused thinking or reduced ability to concentrate, excessive fears or worries, or extreme feelings of guilt, extreme mood changes of highs and lows, withdrawal from friends and activities, detachment from reality, paranoia or hallucinations, inability to cope with daily problems or stress, trouble understanding and relating to situations and to people, alcohol or drug abuse, major changes in eating habits, sex drive changes, excessive anger, hostility or violence and suicidal thoughts.
[0096] For the purposes of the present invention, mental illness and symptoms affecting mental health, also encompass conditions affecting an individual's cognitive function. Such conditions may include or overlap with various cognitive disorders. Examples include, but are not limited to, agnosia, amnesia, dementia, Alzheimer's disease, Parkinson's disease, and chronic stress, which has been shown to negatively affect brain function.
[0097] Intense acute and chronic stress can negatively impact both physical and mental health, increasing risk of developing mental illness. For example, chronic stress has been correlated with the development of mood disorders, anxiety disorders and depression. The compositions of the invention can be used to prevent and/or treat a mental illness or symptoms affecting mental health, resulting from chronic or acute stress.
[0098] The compositions of the invention can also be used to treat and/or prevent other (including physical) conditions associated with chronic or acute stress. For example, in one embodiment, the compositions of the invention are used to treat and/or prevent gastrointestinal disorders, for example, IBS, associated with chronic or acute stress. By addressing the symptoms of mental illness associated with gastrointestinal disorders, it is possible that such treatment may have a beneficial effect on the gastrointestinal disorders themselves.
[0099] More generally, the compositions of the invention can be used for the prevention and/or treatment of one or more of the mental illnesses, symptoms affecting mental health and/or conditions associated with chronic or intense acute stress as set out above.
[0100] In particular embodiments, the compositions of the invention can be used for the prevention and/or treatment of anxiety, depression, and/or diminished cognitive function.
[0101] When compositions of the invention are used for the prevention of a mental illness or a symptom affecting mental health, they can be used for maintaining a normal level of mental health in an already healthy individual. Alternatively, when compositions of the invention are used to treat a mental illness or symptom affecting mental health, they can be used for restoring or partially restoring a normal level of mental health in an individual suffering from the mental illness or symptom in question.
[0102] The compositions described herein can also be used for normalising gamma-aminobutyric acid (GABA) A and B receptor expression in the brain in response to stress. In one embodiment, compositions comprising LP12418 are used for normalising GABA A and B receptor expression in the brain in response to stress. The term normalising when used in this context includes increasing the expression of GABA A and B receptors in a mammal exposed to stress, relative to the levels of expression which would otherwise be observed in the mammal in the absence of treatment or prevention using the compositions of the invention. Furthermore, the term normalising also includes restoring the expression of GABA A and B receptors in a mammal exposed to stress, to a level which would otherwise be observed in the mammal in the absence of stress exposure.
Methods and Other Embodiments of the Invention
[0103] For the avoidance of doubt, any of the compositions described herein and set out above can be utilised in the methods of the invention. Further embodiments include, but are not limited to, those set out below: [0104] Embodiment 1: A method for preventing and/or a treating a mental illness, a symptom affecting mental health or a condition associated with chronic stress, in a mammal, comprising administering to the mammal a composition comprising Lactobacillus plantarum strain LP12151 deposited with the DSMZ under deposit number DSM 32721 on Jan. 9, 2018 [0105] Embodiment 2: A method for preventing and/or a treating a mental illness, a symptom affecting mental health or a condition associated with chronic stress, in a mammal, comprising administering to the mammal a composition comprising Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655 on Sep. 27, 2017 [0106] Embodiment 3: A method for preventing and/or a treating a mental illness, a symptom affecting mental health or a condition associated with chronic stress, in a mammal, comprising administering to the mammal a composition comprising Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654 on Sep. 27, 2017 [0107] Embodiment 4: A method as any one of embodiments 1 or 3, wherein the composition further comprises another bacterial strain [0108] Embodiment 5: A method as in embodiment 4, wherein the other bacterial strain is of the species, Lactobacillus paracasei, e.g. strain Lpc-37, deposited with the DSMZ under deposit number DSM 32661 on Oct. 5, 2017 [0109] Embodiment 6: A method for preventing and/or a treating a mental illness, a symptom affecting mental health or a condition associated with chronic stress, in a mammal, comprising administering to the mammal a composition comprising (a) at least two Lactobacillus plantarum strains selected from the group consisting of Lactobacillus plantarum strain LP12151 deposited with the DSMZ under deposit number DSM 32721 on Jan. 9, 2018, Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655 on Sep. 27, 2017, and Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654 on Sep. 27, 2017, and (b) Lactobacillus paracasei strain Lpc-37, deposited with the DSMZ under deposit number DSM 32661 on Oct. 5, 2017 [0110] Embodiment 7: A method as in any of embodiments 1 to 6, wherein the composition is in the form of a food product, a beverage, a dietary supplement or a pharmaceutically acceptable composition [0111] Embodiment 8: A method as in any of embodiments 1 to 7, wherein the composition is a spray-dried or freeze-dried composition [0112] Embodiment 9: A method as in embodiment 8, wherein the composition comprises a cryoprotectant [0113] Embodiment 10: A method as in any of embodiments 1 to 9, wherein the composition is in unit dosage form and wherein the Lactobacillus plantarum strain is present in the composition in an amount between 10.sup.6 and 10.sup.12 CFU, e.g. between 10.sup.8 and 10.sup.12 CFU, optionally 10.sup.10 CFU [0114] Embodiment 11: A method as in any of embodiments 1 to 10, for normalising gamma-aminobutyric acid (GABA) A and B receptor expression in response to stress [0115] Embodiment 12: A method as in any of embodiments 1 to 11, for preventing or treating anxiety [0116] Embodiment 13: A method as in any of embodiments 1 to 11, for prevention or treating depression [0117] Embodiment 14: A method as in any of embodiments 1 to 11, for preventing or treating mood swings [0118] Embodiment 15: A method as in any of embodiments 1 to 11, for preventing or treating memory loss or diminished cognitive function [0119] Embodiment 16: A method as in any of embodiments 1 to 11, wherein the condition associated with chronic stress is a gastrointestinal disorder, e.g. irritable bowel syndrome [0120] Embodiment 17: A composition comprising Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655 on Sep. 27, 2017, for preventing or treating anxiety [0121] Embodiment 18: A composition comprising Lactobacillus plantarum strain LP12151 deposited with the DSMZ under deposit number DSM 32721 on Jan. 8, 2018, for preventing or treating depression [0122] Embodiment 19: A composition comprising Lactobacillus plantarum strain LP12151 deposited with the DSMZ under deposit number DSM 32721 on Jan. 8, 2018, for preventing or treating mood swings [0123] Embodiment 20: A composition comprising Lactobacillus plantarum strain LP12151 deposited with the DSMZ under deposit number DSM 32721 on Jan. 8, 2018, for preventing or treating memory loss or diminished cognitive function [0124] Embodiment 21: A composition comprising Lactobacillus plantarum strain LP12151 deposited with the DSMZ under deposit number DSM 32721 on Jan. 8, 2018, for preventing or treating a condition associated with chronic stress, e.g. irritable bowel syndrome [0125] Embodiment 22: A composition comprising Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655 on Sep. 27, 2017, for preventing or treating depression [0126] Embodiment 23: A composition comprising Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655 on Sep. 27, 2017, for preventing or treating mood swings [0127] Embodiment 24: A composition comprising Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655 on Sep. 27, 2017, for preventing or treating memory loss or diminished cognitive function [0128] Embodiment 25: A composition comprising Lactobacillus plantarum strain LP12418 deposited with the DSMZ under deposit number DSM 32655 on Sep. 27, 2017, for preventing or treating a condition associated with chronic stress, e.g. irritable bowel syndrome [0129] Embodiment 26: A composition comprising Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654 on Sep. 27, 2017, for preventing or treating anxiety [0130] Embodiment 27: A composition comprising Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654 on Sep. 27, 2017, for preventing or treating depression [0131] Embodiment 28: A composition comprising Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654 on Sep. 27, 2017, for preventing or treating mood swings [0132] Embodiment 29: A composition comprising Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654 on Sep. 27, 2017, for preventing or treating memory loss or diminished cognitive function
[0133] Embodiment 30: A composition comprising Lactobacillus plantarum strain LP12407 deposited with the DSMZ under deposit number DSM 32654 on Sep. 27, 2017, for preventing or treating a condition associated with chronic stress, e.g. irritable bowel syndrome
EXAMPLES
[0134] The following examples are provided in order to demonstrate and further illustrate specific embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
Example 1; Initial Screening of Candidate Strains
[0135] Multiple probiotic candidates were initially screened for probiotic characteristics, safety and manufacturing performance. Most of these candidates were discarded due to poor performance. Efficacy testing was conducted on the remaining candidates and from these, 5 strains were selected for further experimental testing, as reported in the examples below.
[0136] Bacterial mucus adhesion properties were tested using mucus collected from five individual patients with colorectal cancer. First, the mucus was diluted with an equal volume of 0.1 M HEPES-Hank's buffer and shook vigorously for 5 min. The dilution was centrifuged once at 11,000 g for 10 min (4 C.) and then at 26.000 g for 15 min (4 C.) to remove cells and cellular debris. The supernatant was then transferred to a clean tube, and its protein content was measured using the PIERCE BCA protein assay kit. The mucus was adjusted to a protein concentration of 0.1 mg/ml using HEPES-Hank's buffer. 96-well plates were then incubated with 300 l of mucus or the negative control bovine serum albumin (BSA) for 24 h at 4 C. to coat the wells with mucus. The bacteria were grown to OD600 in MRS broth, harvested by centrifugation (8500 rpm, 15 min), and the bacterial pellet was washed once with HBSS. The bacteria were then incubated with a fluorescent Syto24 dye for 15 min on ice, centrifuged and suspended to HBSS. The coated plates were washed with HEPES-Hank's buffer to remove excess mucus or BSA, and 200 l of bacterial suspension was added to the wells and incubated for 1 h at 37 C. The plates were again washed and the fluorescence of the adhered bacterial cells was measured. The adhesion ratio (%) was calculated by comparing the fluorescence of adhered bacterial cells to the fluorescence of unwashed cells (i.e. maximum fluorescence): Adhesion %=(Fluorescence after adhesionBlank)/(Maximum fluorescenceBlank)100.
[0137] The average CV % of triplicate samples varied between 15-30% depending on mucus. To determine how specifically bacteria adhered to mucus vs. other protein, an adherence ratio was calculated as: Adhesion ratio=Adhesion to mucus/Adhesion to BSA. Values above 1 indicate better affinity to mucus than BSA.
[0138] The mucus layer is the first physical barrier to host-cell stimulation by bacteria in the gut. Adhesion to this mucus is therefore the first step required for probiotic organisms to interact with host cells and elicit a response. As shown in
Example 2; Materials and MethodsGeneral
Animals
[0139] Male Swiss mice, 5 weeks old and weighing 30-35 g, from JANVIER (Saint Berthevin, France), were used, and experiments took place at Amylgen (Direction Rgionale de l'Alimentation, de l'Agriculture et de la Fort du Languedoc-Roussillon, agreement #A 34-169-002 from May 2, 2014). Animals were housed in groups of six mice with access to food and water ad libitum, except during behavioural experiments. Each cage contained mice from a single treatment group. They were kept in a temperature and humidity controlled animal facility on a 12-hour light/dark cycle (lights off at 07:00 pm). All animal procedures were conducted in strict adherence to the European Union directive of Sep. 22, 2010 (2010/63/UE).
Bacterial Strain Formulation and Administration
[0140] The bacterial strains were solubilized in 0.9% NaCl and administered orally by gavage (100 L per mouse) at 9:00 a.m. each morning, corresponding to a dose of 109 CFU/day per mouse. Vehicle mice received 0.9% NaCl without bacterial strains. The duration of the treatment was 33 days in total.
Chronic Stress Procedure
[0141] The chronic stress procedure was carried out as previously described (Espallergues et al., Psychoneuroendocrinology, 2009). Mice were repeatedly placed in Plexiglas transparent restraint tubes (12 cm length, 3 cm diameter) under bright light for a period of 180 min per day (11:00 a.m. to 2:00 p.m.), for 5 consecutive days per week, over three weeks. Control group animals (No stress mice/Vehicle) were never placed in restraint tubes and remained undisturbed during the stress procedure in a room different from the one where stress was taking place.
Randomisation of the Animals
[0142] In each cage (N=6), animals received the same treatment. Treatments and stress procedure were performed in a random manner by an experimenter not involved in the behavioural and biochemical experiments. The behavioural procedures were conducted by a second different experimenter.
Schedule of Experimental Procedures
[0143] On day 01, animals were randomly assigned to an experimental group, weighed and treated with the appropriate strain or vehicle. [0144] From day 01 to day 33, animals were treated with appropriate strain or vehicle. [0145] From day 08 to day 28, animals were submitted to chronic stress, 3 hours per day, five days per week from Monday to Friday, in accordance with the chronic stress procedure described above. [0146] On day 29, animals performed the elevated-plus maze procedure. [0147] On day 30, animals performed the open field procedure, which was also habituation to the day 31-32 tasks. [0148] From day 30 to day 32, animals performed the object recognition memory task. [0149] On day 33, animals performed the forced swim test. [0150] On day 36, animals were euthanized. Blood plasma samples were collected from each animal. Adrenals were collected and weighed.
[0151] During the treatment period, acute or delayed mortality was checked every day.
Endpoint Measurements
[0152] Elevated plus maze: On day 29, the anxious state of mice was measured by evaluating their ability to explore open and enclosed arms of an elevated plus-maze. The clear plexiglass apparatus consisted of two open arms (23.58 cm) and two enclosed arms (23.5820 cm high), extending from a central platform and placed 50 cm above the floor. Each mouse was placed at the center of the plus-maze facing a closed arm and its exploration behaviour was recorded by Ethovision XT 9.0 (Noldus Information Technology) for 10 min. The results were expressed as locomotor activity, time spent in the open arms, and number of open arm entries. The gravity center of animal was considered by Ethovision XT 9.0 software to calculate the position of the animal in the elevated-plus maze.
[0153] Open field: On day 30, mice were placed individually in a squared open-field (50 cm50 cm50 cm high) made from white plexiglass with a floor equipped with infrared light emitting diodes. Mice were habituated to the open-field for 10 minutes and their locomotor activity captured through an IR-sensitive camera and analyzed using the Ethovision XT 9.0 software (Noldus Information Technology). Behaviour was analyzed as locomotor activity (distance traveled, cm), locomotor activity in the 2525 cm central area defined by the software, and number of stereotypies (sum of the number of rearing and grooming episodes) presented by the mice.
[0154] Novel object recognition: On day 31, two identical objects (50 ml plastic vials with caps) were placed at defined positions (position #1 and position #2, at two opposite edges of the central area) of the open-field plexiglass arena. Each mouse was placed in the open-field and the exploratory activity recorded during a 10-min duration session. The activity was analyzed using the nose tracking protocol, in terms of number of contacts with objects and duration of contacts. The results are expressed as percentage of object interactions and percentage of the total interaction duration with the object in position #2.
[0155] On day 32, the object in position #2 was replaced by a novel one differing in color shape and texture from the familiar object. Each mouse was placed again in the open-field and the exploratory activity recorded during a 10-min duration session. The activity was analyzed similarly. The preferential exploration index was calculated as the ratio of the number (or duration) of contacts with the object in position #2 over the total number and duration of contacts with the two objects. Animals showing less than 10 contacts with objects during the sessions were discarded from the study.
[0156] Forced swim test: Behavioural despair, a measure of susceptibility to depression, was assessed using the forced swim test. Each mouse was placed individually in a glass cylinder (diameter 12 cm, height 24 cm) filled with water at a height of 12 cm. Water temperature was maintained at 22-23 C. The animal was forced to swim for 6 min. The session was recorded by a CCD camera connected to a computer and movements were analyzed using Ethovision XT 9.0 software (Noldus Information Technology). Two levels of pixel changes were analyzed to discriminate between immobility, struggling, and swimming. Analyses were performed min per min the last five minutes of the procedure.
[0157] Collection of brain samples: In example 3 below, brain samples are taken following euthanasia (see below). Brains were collected and dissected out on a cold plate. The hippocampus and frontal cortex were divided in two halves, dissected out and frozen on dry ice, then stored at minus 80 C. BDNF levels were measured in one half of the hippocampus.
[0158] Measurements of stress hormone release: In many species, including in rodents, corticosterone is the principle glucocorticoid involved in regulation of stress responses. In humans, cortisol is the principle glucocorticoid. Mouse plasma corticosterone levels were measured with an enzyme-linked immunosorbent assay (ELISA) from plasma samples. At sacrifice, whole blood was collected in 2 ml EDTA microtubes (ref. 061666100, Sarstedt), and immediately centrifuged at 3,000 g for 15 min in a refrigerated centrifuge at +4 C. Plasma was carefully collected and transferred to new Eppendorf tubes using a Pasteur pipette to constitute two equivalent volume aliquots. The samples were maintained at 4 C. in ice during handling, then stored at minus 20 C. until analysis. Plasma corticosterone was assayed with a colorimetric kit (Corticosterone (CSCI) ELISA kit, ab108821, Abcam, France) from a 25-l sample. Mouse plasma samples were diluted 1:200 in 1 diluent M, and directly assayed according to manufacturer's instructions. The intra-and inter-assay coefficients of variation are routinely 5% and 7%, respectively. The sensitivity of the assay is routinely 0.3 ng/ml for corticosterone. Samples were assayed in duplicate. Plasma ACTH was assayed with a colorimetric kit (ACTH ELISA kit, ENZ-KIT 138, Enzo Life Science, France) in a 25-l sample. Mouse plasma samples were diluted in 1:1 1 diluent M, and directly assayed according to manufacturer's instructions. BDNF content measurement was performed on hippocampus samples. After thawing, the hippocampal tissue was homogenized in 50 mM Tris-150 mM NaCl buffer, pH 7.5, and sonicated for 20 seconds. After centrifugation, (16,100 g for 15 minutes at 4 C.), supernatants were used in a BDNF ELISA according to the manufacturer's instructions (Promega, #7610). Absorbance was read at 450 nm and sample concentration was calculated using the standard curve. ACTH and BDNF were both analyzed in singlets due to low sample volume, and therefore, data were analyzed for outliers with the ROUT method. Three outliers were identified for each outcome and removed from analysis.
[0159] Body weight and adrenal weight: To evaluate long-term stress hormone release, adrenals were dissected at sacrifice and weighed. Results were expressed as ratio of adrenals/body weight.
[0160] GABA receptor expression in cortex: GABA.sub.A2 and GABA.sub.B1 expression was measured from frontal cortex from six mice in each group. Tissues were immersed in 1 ml of lysis reagent (QIAzol) and homogenized using high-speed shaking with a single 1 mm stainless steel bead (tissue Lyzer Qiagen, 22 min at 20 Hz). Chloroform was added and the sample was centrifuged to collect the RNA-containing aqueous phase. RNA was then purified using a Qiacube robotic workstation and the miRNeasy Mini kit (Qiagen). Residual DNA removal was performed using the Turbo DNase kit (Ambion), and RNA was then transcribed to cDNA using ReadyScript cDNA Synthesis Mix (Sigma-Aldrich) following the manufacturer's protocol. Individual qPCR was performed in triplicate using SYBR Green, using ACTB as the housekeeping gene. The primer sequences were as follows: GABAA2 forward: GGAAGCTACGCTTACACAACC, reverse: CCATCGGGAGCAACCTGAA, GABAB1b forward: CGCACCCCTCCTCAGAAC, reverse: GTCCTCCAGCGCCATCTC, ACTB forward: ATGCTCCCCGGGCTGTAT, reverse: CATAGGAGTCCTTCTGACCCATTC.
[0161] Statistical analysis: Values were expressed as meanStandard Error of Mean (SEM). Statistical analyses were performed using Prism 5.0a (GraphPad Software, Inc.) on the different conditions depending on results from Shapiro-Wilk normality test: [0162] With a one-way ANOVA (F value), followed by the Dunnett's post-hoc multiple comparison test to compare individual groups to each other, if data followed a Gaussian distribution. [0163] With a Kruskal-Wallis non-parametric ANOVA (H value), followed by a Dunn's multiple comparison test if data did not follow a Gaussian distribution.
[0164] p<0.05 was considered to be statistically significant.
Example 3; Study AM306.3 Characterisation of the Effect of Three Selected Strains (LP12151, LP12407, LP12418) on Repeated Stress in Mice
Study Protocol
[0165] Sixty Swiss mice (30 to 35g) were used in this study. Five animal groups were constituted in the following manner, according to Table 1 below.
TABLE-US-00001 TABLE 1 Treatment groups in Study AM306.3 n 1. No stress male mice/Vehicle 12 2. Chronic stressed male mice/Vehicle 12 3. Chronic stressed male mice/Lactobacillus plantarum 12 LP12151, 10.sup.9 CFU/day 4. Chronic stressed male mice/Lactobacillus plantarum 12 LP12407, 10.sup.9 CFU/day 5. Chronic stress male mice/Lactobacillus plantarum 12 LP12418, 10.sup.9 CFU/day Total mice 60
[0166] Animals were randomly assigned to an experimental group, weighed and treated with the appropriate strain/vehicle in accordance with the methods set out in Example 2 above. From day 01 to day 33, animals were treated in accordance with the treatment schedule described in Example 2 above.
Results and Comments
[0167] Animals weight;
[0168] Anxiety in the open field procedure;
[0169] Recognition memory in the novel object recognition procedure;
[0170] Forced swim test;
[0171] Corticosterone contents measurement by ELISA;
[0172] General conclusions from AM306.3 study; The following conclusions can be drawn from the results described above.
Chronic Stress-Induced Behavioural Deficits
[0173] Induced a body weight decrease as compared to non-stressed mice [0174] Induced an anxiety-like state in mice in open field test and in elevated-plus maze test. [0175] Showed a very significant recognition long-term memory deficit in mice as compared to non-stressed mice. [0176] Showed a significant depressive-like state observed by behavioural despair in the forced swim test. [0177] Showed no significant effect on blood plasma corticosterone levels under the conditions tested.
Treatment with L. plantarum LP12151 [0178] Reduced the loss of body weight as compared to chronically stressed mice in a non-significant manner. [0179] Showed no effect on anxiety-like state in mice in the elevated plus maze test. [0180] Very significantly but partially reduced the anxiety-like state in mice in the open field test. [0181] Showed no effect on recognition long-term memory deficit in mice compared to chronically stressed mice. [0182] Showed a very significant antidepressant-like effect observed as behavioural despair in the forced swim test, compared to chronically stressed mice. [0183] Showed no effect on plasma corticosterone levels.
Treatment With L. plantarum LP12407 [0184] Reduced the loss of body weight as compared to chronically stressed mice in a non-significant manner. [0185] Very significantly but partially reduced the anxiety-like state in mice in the elevated plus maze test and in the open field test. [0186] Showed no effect on recognition long-term memory deficit in mice compared to chronically stressed mice. [0187] Showed a very significant antidepressant-like effect observed as behavioural despair in the forced swim test, compared to chronically stressed mice. [0188] Dramatically increased the level of corticosterone in plasma.
Treatment With L. plantarum LP12418 [0189] Reduced the loss of body weight as compared to chronically stressed mice in a non-significant manner. [0190] Very significantly but partially reduced the anxiety-like state in mice in the elevated plus maze test and in the open field test. [0191] Showed no effect on recognition long-term memory deficit in mice compared to chronically stressed mice. [0192] Showed a very significant antidepressant-like effect observed as behavioural despair in the forced swim test, compared to chronically stressed mice. [0193] Showed no effect on plasma corticosterone levels.
Example 4; Study AM306.5 Characterisation of the Effect of Three Selected Strains (Lpc-37, LP12418 and LP12407) on Repeated Stress in Mice
Study Protocol
[0194] Seventy-two Swiss mice (30 to 35 g) were used in this study. Five animal groups were constituted in the following manner, according to Table 2 below.
TABLE-US-00002 TABLE 2 Treatment groups in Study AM306.5 n n* 1. No stress male mice/Vehicle 12 6* 2. Chronic stressed male mice/Vehicle 12 6* 3. Chronic stressed male mice/Lactobacillus paracasei, 12 Lpc-37, 10.sup.9 CFU/day 4. Chronic stressed male mice/Lactobacillus plantarum, * 12* LP12418, 10.sup.9 CFU/day 5. Chronic stress male mice/Lactobacillus plantarum, 12 LP12407, 10.sup.9 CFU/day Total mice 48 24 *Due to an unexpected mortality in Group 4 caused by aggressive behaviour in on cage, the 12 planned animals were discarded and this group was planned with an additional six animals per control group in a second session of experiments.
[0195] Animals were randomly assigned to an experimental group, weighed and treated with the appropriate strain/vehicle. From day 01 to day 33, animals were treated in accordance with the treatment schedule described in Example 2 above. In addition, on day 28, blood was sampled and plasma prepared from the samples. Also, following euthanasia, brains were removed and the hippocampus and frontal cortex dissected out and weighed before storing at minus 80 C. (also in accordance with the methods described in Example 2). Corticosterone, and ACTH levels in the plasma at day 28 were measured. BDNF content was also measured in hippocampus samples following euthanasia of mice.
Results and Comments
[0196] Animals weight;
[0197] Anxiety measurement in the elevated-plus maze procedure; The effects of treatment on anxiety are illustrated in the results observed in the elevated-plus maze procedure. As seen in
[0198] Anxiety in the open field procedure;
[0199] Recognition memory in the novel object recognition procedure;
[0200] Forced swim test;
[0201] Biochemical marker measurement by ELISA;
[0202] GABA receptor expression;
General Conclusions From AM306.5 Study
[0203] The following conclusions can be drawn from the results described above.
Chronic Stress-Induced Behavioural Deficits
[0204] Induced a partial body weight decrease as compared to non-stressed mice [0205] Induced an anxiety-like state in mice in open field test and in elevated-plus maze test. [0206] Showed a very significant recognition long-term memory deficit in mice as compared to non-stressed mice. [0207] Showed a significant depressive-like state observed by behavioural despair in the forced swim test paradigm [0208] Significantly increased blood plasma corticosterone concentration.
Treatment with Either L.paracasei Lpc-37, L.plantarum LP12418, L.plantarum, or LP12407 [0209] Had no effect on the loss of body weight as compared to chronically stressed mice [0210] Very significantly and fully alleviated anxiety-like state in mice in the elevated-plus maze test. [0211] Very significantly and fully alleviated anxiety-like state in mice in the open-field procedure. [0212] Very significantly and fully alleviated the recognition long-term memory deficit in mice compared to chronically stressed mice. [0213] Very significantly and fully alleviated the depression-like behaviour observed by a behavioural despair in the forced swim test paradigm, compared to the chronically stressed group treated with vehicle alone [0214] Showed differential effect on corticosterone, ACTH and BDNF concentrations. [0215] Treatment with LP12418 restored GABA A and B receptor expression in the brain (frontal cortex), whereas Lpc-37 and LP12407 showed no effect.