BIOTECHNOLOGICAL PRODUCTION OF DESFERRIOXAMINES AND ANALOGS THEREOF
20250340893 · 2025-11-06
Assignee
Inventors
- Steffen Schaffer (Herten, DE)
- Mirja Wessel (Bochum, DE)
- Alexander Thiemann (Hasloh, DE)
- Hans Henning Wenk (Mülheim an der Ruhr, DE)
Cpc classification
C12Y603/02
CHEMISTRY; METALLURGY
C12N9/0073
CHEMISTRY; METALLURGY
C12P13/02
CHEMISTRY; METALLURGY
International classification
C12P13/02
CHEMISTRY; METALLURGY
C12N9/00
CHEMISTRY; METALLURGY
Abstract
A recombinant microbial cell is capable of producing at least one compound having structural Formula II from a carbon source:
##STR00001##
In Formula II, n=2-3; R.sub.1=H or COCH.sub.3 or CH.sub.2CH.sub.2COX with X=OH or O; R.sub.2=CH.sub.3 or CH.sub.2CH.sub.2COX with X=OH or O where the cell comprises a genetic modification to increase activity relative to its wild-type cell of E.sub.4 where E.sub.4 is a desferrioxamine or bisucaberin synthetase (EC 6.3.-.-) (E.sub.4i) capable of converting N5-aminopentyl-N-(hydroxy)-succinamic acid to desferrioxamine B or H or at least one other linear desferrioxamine or bisucaberin according to Formula II.
Claims
1. A recombinant microbial cell for producing at least one compound having structural Formula II from a carbon source: ##STR00009## n=2-3 R.sub.1=H or COCH.sub.3 or CH.sub.2CH.sub.2COX with X=OH or O R.sub.2=CH.sub.3 or CH.sub.2CH.sub.2COX with X=OH or O wherein the cell comprises a genetic modification to increase activity relative to its wild-type cell of E.sub.4 wherein: E.sub.4 is a desferrioxamine or bisucaberin synthetase (EC 6.3.-.-) (E.sub.41) capable of converting N5-aminopentyl-N-(hydroxy)-succinamic acid to desferrioxamine B or H or at least one other linear desferrioxamine or bisucaberin according to Formula II.
2. The cell according to claim 1, wherein the cell comprises a further genetic modification to increase activity relative to its wild-type cell of at least one enzyme selected from E.sub.1, E.sub.2, and E.sub.3, wherein E.sub.1 is a lysine decarboxylase (EC: 4.1.1.18) capable of converting lysine to cadaverine; E.sub.2 is a cadaverine N5-monooxygenase (EC 1.14.13.-) capable of converting cadaverine to N5-hydroxy-cadaverine; and E.sub.3 is a N5-aminopentyl-N-(hydroxy)-succinamic acid synthase (EC: 2.3.-.-) capable of converting N5-hydroxy-cadaverine and succinyl-coenzyme A to N5-aminopentyl-N-(hydroxy)-succinamic acid.
3. The cell according to claim 2, wherein the cell comprises a genetic modification to increase activity relative to its wild-type cell of E.sub.4 and at least two other enzymes selected from the group consisting of E.sub.1, E.sub.2, and E.sub.3.
4. The cell according to claim 2, wherein the cell comprises a genetic modification to increase activity relative to its wild-type cell of all enzymes E.sub.2, E.sub.3 and E.sub.4.
5. The cell according to claim 2, wherein the genetic modification is (a) at least one promoter which is operably linked to gene(s) encoding the enzymes E.sub.1, E.sub.2, E.sub.3 and/or E.sub.4 introduced in a suitable chromosome of the cell, or (b) at least one expression vector to increase the copy number of gene(s) encoding the enzymes E.sub.1, E.sub.2, E.sub.3 and/or E.sub.4 in the cell, or (c) combination of (a) and (b) to increase the expression of the enzymes E.sub.1, E.sub.2, E.sub.3 and/or E.sub.4.
6. The cell according to claim 2, wherein E.sub.1 comprises at least 70% sequence identity relative to SEQ ID NO:15 (E.sub.1a), SEQ ID NO:25 (E.sub.1b) or SEQ ID NO:38 (E.sub.1c); E.sub.2 comprises at least 70% sequence identity relative to SEQ ID NO:4 (E.sub.2a), SEQ ID NO:16 (E.sub.2b), SEQ ID NO:26 (E.sub.2c), SEQ ID NO:33 (E.sub.2d), SEQ ID NO:56 (E.sub.2e) or SEQ ID NO:57 (E.sub.2f); E.sub.3 comprises at least 70% sequence identity relative to SEQ ID NO:5 (E.sub.3a), SEQ ID NO:17 (E.sub.3b), SEQ ID NO:27 (E.sub.3c), N-terminal domain of SEQ ID NO:55 (E.sub.3d), or SEQ ID NO:54 (E.sub.3e) or SEQ ID NO:34 (E.sub.3f); and E.sub.4 comprises at least 70% sequence identity relative to SEQ ID NO:6 (E.sub.4a), SEQ ID NO:18 (E.sub.4b), SEQ ID NO:28 (E.sub.4c), C-terminal domain of SEQ ID NO:34 (E.sub.4d), SEQ ID NO:54 (E.sub.4e) or SEQ ID NO:55 (E.sub.4f).
7. The cell according to claim 1, wherein the compound is desferrioxamine B or H.
8. The cell according to claim 1, wherein the cell is selected from the group consisting of Aspergillus sp., Corynebacterium sp., Brevibacterium sp., Bacillus sp., Acinetobacter sp., Alcaligenes sp., Lactobacillus sp., Paracoccus sp., Lactococcus sp., Candida sp., Pichia sp., Hansenula sp., Kluyveromyces sp., Saccharomyces sp., Escherichia sp., Zymomonas sp., Yarrowia sp., Methylobacterium sp., Ralstonia sp., Pseudomonas sp., Rhodospirillum sp., Rhodobacter sp., Burkholderia sp., Clostridium sp., and Cupriavidus sp.
9. The cell according to claim 1, wherein the carbon source is selected from the group consisting of glucose, sucrose, xylose, arabinose, mannose, glycerol, lysine and cadaverine.
10. The cell according to claim 1, wherein the cell comprises a further genetic modification to production of L-lysine.
11. The cell according to claim 10, wherein the further genetic modification in the cell includes an increase in activity relative to the wild-type cell of at least one of the following enzymes: pyruvate carboxylase (EC 6.4.1.1) (E.sub.6), aspartate amino transferase (EC 2.6.1.1) (E.sub.7), aspartate kinase, particularly feedback resistant aspartate kinase (EC 2.7.2.4) (E.sub.8), aspartate semialdehyde dehydrogenase (EC 1.2.1.11) (E.sub.9), dihydrodipicolinate synthase (EC 4.3.3.7) (E.sub.10), dihydrodipicolinate reductase (EC 30 1.17.1.8) (E.sub.11), diaminopimelate dehydrogenase (EC 1.4.1.16) (E.sub.12), diaminopimelate epimerase (EC 5.1.1.7) (E.sub.13), diaminopimelate decarboxylase (EC 4.1.1.20) (E.sub.14), N-succinyl-aminoketopimelate aminotranferase (EC 2.6.1.17) (E.sub.17), 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase (EC 2.3.1.117) (Eis), and/or succinyl-diaminopimelate desuccinylase (EC 3.5.1.18) (E.sub.19); and/or a decrease in activity relative to the wild-type cell of at least one of the following enzymes: phosphoenolpyruvate carboxykinase (EC 4.1.1.32) (Eis), and/or homoserine dehydrogenase (EC 1.1.1.3) (E.sub.16).
12. The cell according to claim 10, wherein the further genetic modification in the cell includes an increase in activity relative to the wild-type cell of at least one of pyruvate carboxylase (EC 6.4.1.1) (E.sub.6), aspartate kinase (EC 2.7.2.4) (E.sub.8), particularly feedback resistant aspartate kinase (EC 2.7.2.4) (E.sub.8), aspartate semialdehyde dehydrogenase (EC 1.2.1.11) (E.sub.9), dihydrodipicolinate synthase (EC 4.3.3.7) (E.sub.10), dihydrodipicolinate reductase (EC 30 1.17.1.8) (E.sub.11), diaminopimelate dehydrogenase (EC 1.4.1.16) (E.sub.12), and/or diaminopimelate decarboxylase (EC 4.1.1.20) (E.sub.14) and/or a decrease in activity relative to the wild-type cell of at least one of phosphoenolpyruvate carboxykinase (EC 4.1.1.32) (E.sub.15), and/or homoserine dehydrogenase (EC 1.1.1.3) (E.sub.16).
13. The cell according to claim 10, wherein the further genetic modification is: a) at least one promoter which is operably linked to a gene encoding any one of the enzymes E.sub.6-E.sub.14, and E.sub.17-E.sub.19 in the suitable chromosome of the cell, or b) at least one expression vector in the cell to increase the copy number of gene(s) encoding any one of the enzymes E.sub.6-E.sub.14, and E.sub.17-E.sub.19, or c) combination of (a) and (b) to increase the activity of any one of the enzymes E.sub.6-E.sub.14, and E.sub.17-E.sub.19 in the cell and/or d) a foreign DNA in the gene encoding at least one of enzymes E.sub.15 and E.sub.16; e) deletion of at least one part of the gene encoding at least one of enzymes E.sub.15 and E.sub.16; f) at least one point mutation, RNA interference (siRNA), antisense RNA in the gene and/or regulatory sequences of the gene encoding at least one of enzymes E.sub.15 and E.sub.16; or g) combinations of (d), (e) and/or (f) to decrease the activity of at least one of the enzymes E.sub.15 and E.sub.16 in the cell.
14. A method of producing at least one compound having structural Formula II from at least one carbon source: ##STR00010## n=2-3 R.sub.1=H or COCH.sub.3 or CH.sub.2CH.sub.2COX with X=OH or O R.sub.2=CH.sub.3 or CH.sub.2CH.sub.2COX with X=OH or O the method comprising: (a) contacting the cell according to claim 1 with at least one carbon source.
15. The method according to claim 14, wherein the activity of the enzyme is increased in the cell by a method selected from the group consisting of a) introducing at least one promoter which is operably linked to the gene encoding the enzymes into the chromosome of the cell, b) increasing copy number of the gene encoding the enzyme by introducing at least one expression vector into the cell, and c) combinations thereof.
16. Use of the cell according to claim 1 for producing at least one compound having structural Formula II from at least one carbon source: ##STR00011## n=2-3 R.sub.1=H or COCH.sub.3 or CH.sub.2CH.sub.2COX with X=OH or O R.sub.2=CH.sub.3 or CH.sub.2CH.sub.2COX with X=OH or O.
Description
BRIEF DESCRIPTION OF FIGURES
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
EXAMPLES
[0155] The foregoing describes preferred embodiments, which, as will be understood by those skilled in the art, may be subject to variations or modifications in design, construction or operation without departing from the scope of the claims. These variations, for instance, are intended to be covered by the scope of the claims.
Example 1
Construction of a C. glutamicum expression vector for the Streptomyces coelicolor desferrioxamine biosynthesis genes desBCD_Sco
[0156] For the heterologous expression of the desB gene (SEQ ID NO: 1), desC gene (SEQ ID NO: 2) and desD gene (SEQ ID NO: 3) from Streptomyces coelicolor CAI-140 the plasmid pXMJ19{Ptac}[desBCD_Sco]{T} was constructed. The synthetic operon consisting of desB_Sco encoding a lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein (DesB, EC 1.14.13.-, SEQ ID NO: 4), desC_Sco encoding an acetyltransferase (DesC, EC 2.3-.-, SEQ ID NO: 5) and desD_Sco encoding a IucA/IucC family siderophore biosynthesis protein (DesD, EC 6.3.-.-, SEQ ID NO: 6), respectively, was cloned under the control of the IPTG inducible promoter Ptac into the E. coli/C. glutamicum shuttle vector pXMJ19. Downstream of the synthetic operon a terminator sequence is located. The complete synthetic operon including the terminator sequence (3732 bp, SEQ ID NO: 7) was ordered for gene synthesis from Eurofins Genomics Germany GmbH (Ebersberg, Germany). The E. coli/C. glutamicum shuttle vector pXMJ19 carries a pUC origin of replication for E. coli and a pBL1 origin of replication for the replication in C. glutamicum ATCC 13032. For cloning the synthetic operon was cut with the restriction enzyme Hindlll and ligated into pXMJ19 cut with the same enzyme. The ligation product was transformed into 10-beta electrocomponent E. coli cells (New England BioLabs Inc., Ipswich, USA, Cat. No. C3020K).
[0157] Procedure of cloning and transformation were carried out according to manufacturer's manual. The correct insertion of the target genes was checked by restriction analysis and the authenticity of the introduced DNA fragment was verified by DNA sequencing. The resulting expression vector was named pXMJ19{Ptac}[desBCD_Sco]{T}(SEQ ID NO: 8, see Table 2 below).
Example 2
Construction of a C. glutamicum expression vector for the Streptomyces coelicolor desferrioxamine biosynthesis genes desBCD_Sco codon-optimized for expression in C. glutamicum
[0158] For the heterologous expression of the desB gene (SEQ ID NO: 1), desC gene (SEQ ID NO: 2) and desD gene (SEQ ID NO: 3) from Streptomyces coelicolor CAI-140 the plasmid pXMJ19{Ptac}{RBSopt}[desBCD_Sco(co_Cg)]{T} was constructed. The synthetic operon consisting of desB_Sco encoding a lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein (DesB, EC 1.14.13.-, SEQ ID NO: 4), desC Sco encoding an acetyltransferase (DesC, EC 2.3-.-, SEQ ID NO: 5) and desD_Sco encoding a IucA/IucC family siderophore biosynthesis protein (DesD, EC 6.3.-.-, SEQ ID NO: 6), respectively, was cloned under the control of the IPTG inducible promoter Ptac into the E. coli/C. glutamicum shuttle vector pXMJ19. Upstream of the operon an optimized ribosome binding site (RBS) for C. glutamicum was added and downstream of the synthetic operon a terminator sequence is located. The complete synthetic operon including the RBS and the terminator sequence (3779 bp, SEQ ID NO: 9) was ordered for gene synthesis from Eurofins Genomics Germany GmbH (Ebersberg, Germany) and the DNA sequence of the gene fragment was codon-optimized for expression in C. glutamicum ATCC 13032. The E. coli/C. glutamicum shuttle vector pXMJ19 carries a pUC origin of replication for E. coli and a pBL1 origin of replication for the replication in C. glutamicum ATCC 13032. For cloning the synthetic operon was cut with the restriction enzyme Hindlll and ligated into pXMJ19 cut with the same enzyme. The ligation product was transformed into 10-beta electrocomponent E. coli cells (New England BioLabs Inc., Ipswich, USA, Cat. No. C3020K). Procedure of cloning and transformation were carried out according to manufacturer's manual. The correct insertion of the target genes was checked by restriction analysis and the authenticity of the introduced DNA fragment was verified by DNA sequencing. The resulting expression vector was named pXMJ19{Ptac}{RBSopt}[desBCD_Sco(co_Cg)]{T}(SEQ ID NO: 10, see Table 2 below).
Example 3
Construction of a C. glutamicum expression vector for the Streptomyces violaceoruber desferrioxamine biosynthesis genes desABCD_Svi
[0159] For the heterologous expression of the desA gene (SEQ ID NO: 11), desB gene (SEQ ID NO: 12), desC gene (SEQ ID NO: 13) and desD gene (SEQ ID NO: 14) from Streptomyces violaceoruber A3(2) the plasmid pXMJ19{Ptac}[desABCD_Svi] was constructed. The complete operon consisting of desA encoding a lysine decarboxylase (DesA, EC 4.1.1.18, SEQ ID NO: 15, desB_Sco encoding a lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein (DesB, EC 1.14.13.-, SEQ ID NO: 16), desC Sco encoding an acetyltransferase (DesC, EC 2.3-.-, SEQ ID NO: 17) and desD_Sco encoding a lucA/lucC family siderophore biosynthesis protein (DesD, EC 6.3.-.-, SEQ ID NO: 18), respectively, was cloned under the control of the IPTG inducible promoter Ptac into the E. coli/C. glutamicum shuttle vector pXMJ19. The complete operon was amplified via PCR using the primer pair MW22_001fw/MW22_002rv (SEQ ID NO: 44, SEQ ID NO: 45, see Table 1 above) and genomic DNA from Streptomyces violaceoruberA3(2) as template. The E. coli/C. glutamicum shuttle vector pXMJ19 carries a pUC origin of replication for E. coli and a pBL1 origin of replication for the replication in C. glutamicum ATCC 13032. The PCR product (5120 bp, SEQ ID NO: 19) was cloned into the vector pXMJ19 using the restriction site Hindlll and NEBuilder HiFi DNA Assembly Cloning Kit from New England BioLabs Inc., Ipswich, USA, Cat. No. E.sub.5520. The ligation product was transformed into 10-beta electrocomponent E. coli cells (New England BioLabs Inc., Ipswich, USA, Cat. No. C3020K). Procedure of cloning and transformation were carried out according to manufacturer's manual. The correct insertion of the target genes was checked by restriction analysis and the authenticity of the introduced DNA fragment was verified by DNA sequencing. The resulting expression vector was named pXMJ19{Ptac}[desABCD_Svi](SEQ ID NO: 20, see Table 2 below).
TABLE-US-00001 Table1 Primerlist Name 5-3 SEQIDS MW22_001fw ACAGGAAACAGAATTAATTAAGCTTCCCCACCGGAGGA SEQIDNO:44 CCCCCCCATG MW22_002rv AGTCGACCTGCAGGCATGCAAGCTTCCGGTTGGCTAC SEQIDNO:45 CGGCCTGCCAGG MW22_004fw ACAGGAAACAGAATTAATTAAGCTTGTCCCCACCGGAG SEQIDNO:46 GACCCCCACATG MW22_005rv AGTCGACCTGCAGGCATGCAAGCTTTTCGTGGGTCAG SEQIDNO:47 AACTCCGCGAGGGGGTTC MW_21_80_fw ACAGCTATGACATGATTACGGACGGCGAATTCCTCCTC SEQIDNO:48 GTTG MW_21_81_rv GGCGCGCCTCCTGACATCCTGCTTGCAAAG SEQIDNO:49 MW_21_82_fw GCAGGATGTCAGGAGGCGCGCCTCCACAGTTTTCCCG SEQIDNO:50 GTTCATCTTG MW_21_83_rv ATCCCCGGGTACCGAGCTCGAATTCATCGTCTTCCTTG SEQIDNO:51 GTCTGCAGTTAG MW_21_93_fw GCAAGCAGGATGTCAGGAGGACCGGTGTTTTAG SEQIDNO:52 MW_21_94_rv AACCGGGAAAACTGTGGAGGCGGAT SEQIDNO:53
Example 4
Construction of a C. glutamicum expression vector for the Streptomyces pilosus desferrioxamine biosynthesis genes desABCD_Spi
[0160] For the heterologous expression of the desA gene (SEQ ID NO: 21), desB gene (SEQ ID NO: 22), desC gene (SEQ ID NO: 23) and desD gene (SEQ ID NO: 24) from Streptomyces pilosus ATCC19797 the plasmid pXMJ19{Ptac}[desABCD_Spi] was constructed. The complete operon consisting of desA encoding a lysine decarboxylase (DesA, EC 4.1.1.18, SEQ ID NO: 25, desB_Sco encoding a lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein (DesB, EC 1.14.13.-, SEQ ID NO: 26), desC Sco encoding an acetyltransferase (DesC, EC 2.3-.-, SEQ ID NO: 27) and desD_Sco encoding a IucA/IucC family siderophore biosynthesis protein (DesD, EC 6.3.-.-, SEQ ID NO: 28), respectively, was cloned under the control of the IPTG inducible promoter Ptac into the E. coli/C. glutamicum shuttle vector pXMJ19. The complete operon was amplified via PCR using the primer pair MW22_004fw/MW22_005rv (SEQ ID NO: 46, SEQ ID NO: 47, see Table 1 above) and genomic DNA from Streptomyces pilosus ATCC19797 as template. The E. coli /C. glutamicum shuttle vector pXMJ19 carries a pUC origin of replication for E. coli and a pBL1 origin of replication for the replication in C. glutamicum ATCC 13032. The PCR product (5104 bp, SEQ ID NO: 29) was cloned into the vector pXMJ19 using the restriction site Hindlll and NEBuilder HiFi DNA Assembly Cloning Kit from New England BioLabs Inc., Ipswich, USA, Cat. No. E5520. The ligation product was transformed into 10-beta electrocomponent E. coli cells (New England BioLabs Inc., Ipswich, USA, Cat. No. C3020K). Procedure of cloning and transformation were carried out according to manufacturer's manual. The correct insertion of the target genes was checked by restriction analysis and the authenticity of the introduced DNA fragment was verified by DNA sequencing. The resulting expression vector was named pXMJ19{Ptac}[desABCD_Spi](SEQ ID NO: 30, see Table 2 below).
Example 5
Construction of a C. glutamicum expression vector for the Erwinia amylovora desferrioxamine biosynthesis genes dfoAC_Eam
[0161] For the heterologous expression of the dfoA gene (SEQ ID NO: 31) and dfoC gene (SEQ ID NO: 32) from Erwinia amylovora CFBP1430 the plasmid pXMJ19{Ptac}[dfoAC_Eam]{T} was constructed. The operon consisting of dfoA_Eam encoding a lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein (DfoA, EC 1.14.13.-, SEQ ID NO: 33) and dfoC_Eam encoding an GNAT family N-acetyltransferase (DfoC, EC 2.3.-.-, SEQ ID NO: 34) was cloned under the control of the IPTG inducible promoter Ptac into the E. coli/C. glutamicum shuttle vector pXMJ19. Downstream of the synthetic operon a terminator sequence is located. The complete synthetic operon including the terminator sequence (3830 bp, SEQ ID NO: 35) was ordered for gene synthesis from Eurofins Genomics Germany GmbH (Ebersberg, Germany). The E. coli/C. glutamicum shuttle vector pXMJ19 carries a pUC origin of replication for E. coli and a pBL1 origin of replication for the replication in C. glutamicum ATCC 13032. For cloning the synthetic operon was cut with the restriction enzyme Hindlil and ligated into pXMJ19 cut with the same enzyme. The ligation product was transformed into 10-beta electrocomponent E. coli cells (New England BioLabs Inc., Ipswich, USA, Cat. No. C3020K). Procedure of cloning and transformation were carried out according to manufacturer's manual. The correct insertion of the target genes was checked by restriction analysis and the authenticity of the introduced DNA fragment was verified by DNA sequencing. The resulting expression vector was named pXMJ19{Ptac}[dfoAC_Eam]{T}(SEQ ID NO: 36, see Table 2 below).
TABLE-US-00002 TABLE 2 List of C. glutamicum/E. coli expression plasmids Plasmid Cloned gene pXMJ19{Ptac}[desBCD_Sco]{T} desBCD_Sco pXMJ19{Ptac}{RBSopt}[desBCD_Sco(co_Cg)]{T} desBCD_Sco(co_Cg) pXMJ19{Ptac}[desABCD_Svi] desABCD_Svi pXMJ19{Ptac}[desABCD_Spi] desABCD_Spi pXMJ19{Ptac}[dfoAC_Eam]{T} dfoAC_Eam
Example 6
Construction of a C. glutamicum based cadaverine producer by introduction of L-lysine decarboxylase IdcC from E. coli into the L-lysine producer strain C. glutamicum DM1933
[0162] For construction of a C. glutamicum based cadaverine producer the E. coli/dcC gene (SEQ ID NO: 37) encoding a L-lysine decarboxylase (LdcC, EC 4.1.1.18, SEQ ID NO: 38) was integrated into the genome of the lysine producer C. glutamicum DM1933. The detailed construction of DM1933 is 15 described in Blomberg et al., 2009 (doi:10.1128/AEM.01844-08). For the integration of the IdcC gene the plasmid pK18mobsacB KI {Ptuf}[ldcC_Ec(co_Cg)] was constructed. The/dcC gene was integrated into the intergenic region between ORF NCg10013 and ORF NCg10014 and was cloned under the control of the constitutive C. glutamicum promoter P.sub.tuf. The {Ptuf}[IdcC_Ec(co_Cg)] fusion product (SEQ ID NO: 39) was ordered for gene synthesis from Eurofins Genomics Germany GmbH (Ebersberg, Germany).
[0163] In the first cloning step the two flanking regions of the chromosomal none-coding region between NCg10013 and NCg10014 were amplified by PCR using the primer pairs MW_21_80/MW_21_81 (SEQ ID NO: 48, SEQ ID NO: 49) and MW_21_82/MW_21_83 (SEQ ID NO: 50, SEQ ID NO: 51, see table 1), resulting in fragments HomA (1046 bp, SEQ ID NO: 40) and HomB (1028 bp, SEQ ID NO: 41). The two fragments were cloned into the vector pK18mobsacB (Schafer et al., 1994, DOI: 10.1016/0378-1119(94)90324-7) using the restriction site EcoRI and NEBuilder HiFi DNA Assembly Cloning Kit from New England BioLabs Inc., Ipswich, USA, Cat. No. E.sub.5520. Additionally, an Ascl restriction site was introduced between HomA and HomB via primers MW_21_81/MW_21_82. The assembled product was transformed into 10-beta electrocomponent E. coli cells (New England BioLabs Inc., Ipswich, USA, Cat. No. C3020K). Procedure of cloning and transformation were carried out according to manufacturer's manual. The correct insertion of the target gene was checked by restriction analysis and the authenticity of the introduced DNA fragment was verified by DNA sequencing. The resulting expression vector was named pK18mobsacB[KI NCg0013 locus](SEQ ID NO: 42).
[0164] In the second cloning step the {Ptuf}[ldcC_Ec(co_Cg)] fusion product (SEQ ID NO: 39, 2433 bp) was amplified via PCR using the primer pair MW_21_93/MW_21_94 (SEQ ID NO: 52, SEQ ID NO: 53) and cloned into the vector pK18mobsacB[KI NCg10013 locus](SEQ ID NO: 42) using the restriction sites Ascl and NEBuilder HiFi DNA Assembly Cloning Kit from New England BioLabs Inc., Ipswich, USA, Cat. No. E.sub.5520. The assembled product was transformed into 10-beta electrocomponent E. coli cells (New England BioLabs Inc., Ipswich, USA, Cat. No. C3020K). Procedure of cloning and transformation were carried out according to manufacturer's manual. The correct insertion of the target gene was checked by restriction analysis and the authenticity of the introduced DNA fragment was verified by DNA sequencing. The resulting knock-in plasmid was named pK18mobsacB KI {Ptuf}[IdcC_Ec(co_Cg)](SEQ ID NO: 43).
[0165] This plasmid was transformed into C. glutamicum DM1933 via elctroporation. By application of the method described by Schafer et al. 1994 (DOI: 10.1016/0378-1119(94)90324-7), the gene Idc_Ec(co_Cg) under the control of the promoter P.sub.tuf was integrated into the chromosome of C. glutamicum DM1933 via homologous recombination (double crossover), resulting in C. glutamicum DM1933 int.NCG10013/0014::{Ptuf}[ldcC_Ec(coCg)].
Example 7
Construction of a C. glutamicum based desferrioxamine producer
[0166] For the construction of a C. glutamicum based desferrioxamine producer the plasmids described in Examples 2-4 and listed in Table 2 above were transformed into C. glutamicum DM1933 int.NCGI0013/0014::{Ptuf}[ldcC_Ec(coCg)] by means of electroporation. The cells were plated onto LB-agar plates supplemented with chloramphenicol (7.5 mg/L). Transformants were checked for the presence of the correct plasmid by plasmid preparation and analytic restriction analysis. The resulting strains were listed in Table 3.
TABLE-US-00003 TABLE 3 List of C. glutamicum based desferrioxamine producer strains Plasmid Recipient strain Resulting strain pXMJ19{Ptac}{RBSopt}[ C. glutamicum C. glutamicum DM1933 desBCD_Sco(co_Cg)]{T} DM1933 int.NCGI0013/0014::{Ptuf}[IdcC_Ec(coCg)] int.NCGI0013/0014::{ pXMJ19{Ptac}{RBSopt}[desBCD_Sco(co_Cg) Ptuf}[IdcC_Ec(coCg)] ]{T} pXMJ19{Ptac}[desABCD C. glutamicum C. glutamicum DM1933 _Svi] DM1933 int.NCGI0013/0014::{Ptuf}[IdcC_Ec(coCg)] int.NCGI0013/0014::{ pXMJ19{Ptac}[desABCD_Svi] Ptuf}[IdcC_Ec(coCg)] pXMJ19{Ptac}[desABCD C. glutamicum C. glutamicum DM1933 _Spi] DM1933 int.NCGI0013/0014::{Ptuf}[IdcC_Ec(coCg)] int.NCGI0013/0014::{ pXMJ19{Ptac}[desABCD_Spi] Ptuf}[IdcC_Ec(coCg)]
Example 8
Construction of a E. coli based desferrioxamine producer
[0167] For the construction of a E. coli based desferrioxamine producer the plasmids described in Example 1 and 5 and listed in Table 2 were transformed into E. coli W3110 by means of electroporation. The cells were plated onto LB-agar plates supplemented with chloramphenicol (20 mg/L). Transformants were checked for the presence of the correct plasmid by plasmid preparation and analytic restriction analysis. The resulting strains were listed in Table 4.
TABLE-US-00004 TABLE 4 List of E. coli based desferrioxamine producer strains Plasmid Recipient strain Resulting strain pXMJ19{Ptac}[desBCD.sub. E. coli W3110 E. coli W3110 Sco]{T} pXMJ19{Ptac}[desBCD_Sco]{T} pXMJ19{Ptac}[dfoAC_Ea E. coli W3110 E. coli W3110 m]{T} pxMJ19{Ptac}[dfoAC_Eam]{T}
Example 9
Production of linear desferrioxamine with C. glutamicum derivatives
[0168] To produce a linear desferrioxamine derivative (DesB/DesH) 10 ml BHI medium (GranuCultTM BHI (Brain Heart Infusion) broth, Merck, Darmstadt, Germany, Cat-No: 1.10493.0500) supplemented with chloramphenicol (7.5 mg/L) in 100 ml baffled shake flasks were inoculated with 0.1 ml of a stock culture and incubated for 16 h at 30 C. and 200 rpm. The pre-culture was harvested by centrifugation (10 min, 4000 g, 4 C.) and the pellet was washed twice with 10 ml 0.9% (w/v) NaCl. For the main culture, a FlowerPlate with pH and dissolved oxygen optodes (48 well MTP, flower, Beckman Coulter Life Sciences, Baesweiler, Germany, Cat.-No: M2P-MTP-48-BOH1) containing 0.7 ml CGXII medium (15 g/L glucose, 20 g/L (NH.sub.4).sub.2SO.sub.4, 5 g/L urea, 1 g/L K.sub.2HPO.sub.4, 1 g/L KH.sub.2PO.sub.4, 0.25 g/L MgSO.sub.47 H.sub.2O, 42 g/L MOPS, 13.2 mg/L CaCl.sub.2, 0.2 mg/L biotin, 30 mg/L protocatechuic acid, trace element solution: 10 g/L FeSO.sub.47 H.sub.2O, 10 g/L MnSO.sub.4H.sub.2O, 1 g/L ZnSO.sub.47 H.sub.2O, 0.2 g/L CuSO.sub.4, 20 mg/L NiCl.sub.26 H.sub.2O, pH 7) supplemented with chloramphenicol (7.5 mg/L) in each well was inoculated with the preculture to reach a start OD600 of 0.5. The main culture was incubated for 24 h at 30 C. and 1400 rpm and a relative humidity (85%) in a BioLector I system (Beckman Coulter Life Sciences, Baesweiler, Germany). At the beginning of exponential phase, the expression of the targe genes was induced with 0.5 mM IPTG. At the end of cultivation, the cells were harvested, and supernatants were sterile-filtered with an 0.2 m PVDF filter and stored at 20 C. before analysis. Desferrioxamine concentration of all strains was analyzed via LC-UV-MS (see Example 11). In the supernatant of all strains desferrioxamine H could be detected as seen in
Example 10
Production of Linear Desferrioxamine with E. Coli Derivatives
[0169] To produce a linear desferrioxamine derivative (DesB/DesH) 10 ml LB medium (Carl Roth, Karlsruhe, Germany, Cat-No: X968.1) supplemented with chloramphenicol (20 mg/L) in 100 ml baffled shake flasks were inoculated with 0.1 ml of a stock culture and incubated for 16 h at 37 C. and 200 rpm. For the main culture, a FlowerPlate with pH and dissolved oxygen optodes (48 well MTP, flower, Beckman Coulter Life Sciences, Baesweiler, Germany, Cat-No: M2P-MTP-48-BOH1) containing 0.7 ml LB medium (Carl Roth, Karlsruhe, Germany, Cat-No: X968.1), buffered with 100 mM MOPS, pH 7.2 and supplemented with chloramphenicol (20 mg/L) in each well was inoculated with the preculture to reach a start OD600 of 0.1. The main culture was incubated for 24 h at 37 C. and 1400 rpm and a relative humidity (85%) in a BioLector I system (Beckman Coulter Life Sciences, Baesweiler, Germany). At the beginning of exponential phase, the expression of the targe genes was induced with 0.5 mM IPTG. At the end of cultivation, the cells were harvested, and supernatants were sterile-filtered with an 0.2 m PVDF filter and stored at 20 C. before analysis.
[0170] Desferrioxamine concentration of all strains was analyzed via LC-UV-MS (see Example 11). In the supernatants of all strains desferrioxamine H could be detected as shown in
Example 11
HPL C-based quantification of desferrioaxmine B/H
[0171] Quantification of linear desferrioxamine derivatives was carried out by means of HPLC. Before analysis samples were centrifuged for 5 min at 16100 g and filtrated using a 0.22 m PVDF filter. 20 l of the filtrated supernatant were mixed with 80 l ferric ammonium sulfate solution and filled into a HPLC vial. Samples were stored at 20 C. before measurement.
[0172] For the detection and quantification of linear desferrioxamine derivatives a DAD detector (198 and 430 nm) was used. The measurement was carried out by means of Agilent Technologies 1200 Series (Santa Clara, Calif., USA) and a XB-C18 column (100 A, 4.6100 mm, 2.6 m, Phenomenex Kinetex). The injection volume was 5 l and the run time was 25 min at a flow rate of 0.8 ml/min. Mobile phase A: 1 L pure water, 1 ml formic acid, mobile phase B: 1 L acetonitrile, 1 ml formic acid. The column temperature was 40 C. As reference material desferrioxamine B mesylate salt (Merck KGaA, Darmstadt, Germany, Cat-No. D9533) and ferrioxamine E from Streptomyces antibioticus (Merck KGaA, Darmstadt, Germany, Cat.-No. 38266) was used (both as iron complex). Gradient:
TABLE-US-00005 t [%] [%] Flow Max [min] A B [ml/min] pressure [bar] 0.0 95 5 0.8 400 5.0 95 5 0.8 400 13.0 70 30 0.8 400 15.0 2 98 0.8 400 20.0 2 98 0.8 400 20.01 95 5 0.8 400 25.0 95 5 0.8 400
[0173] For analytes with a concentration below the limit of quantification (LOQ), the identification was performed by means of HPLC/ESI-MS-MS. The Multiple reaction monitoring mode (MRM) of a Triple Quadrupol Mass Spectrometer (Agilent 6410B, Santa Clara, Calif., USA) was used for these measurements.