Compositions comprising prebiotics and probiotics

Abstract

The present invention relates to a Lactobacillus spp. selective prebiotic composition comprising one, or a mixture of two or more, of: xylooligosaccharides, cellobiose and/or gentiooligosaccharides. The present invention also relates to a synbiotic composition comprising a probiotic component comprising one or more strains of Lactobacillus rhamnosus and/or one or more strains of Lactobacillus plantarum and a prebiotic component comprising a growth medium which is specific for the growth of the probiotic component, wherein the prebiotic growth medium comprises one or more, or a mixture of two of more, components selected from: xylooligosaccharides, cellobiose and/or gentiooligosaccharides. The present invention also relates to methods of producing and selecting such compositions.

Claims

1. A synbiotic composition comprising: a probiotic component, the probiotic component comprising Lactobacillus plantarum 2830 and/or Lactobacillus rhamnosus GG; and a prebiotic component comprising a growth medium which is specific for the growth of the probiotic component, wherein the prebiotic growth medium comprises xylooligosaccharides, cellobiose, gentiooligosaccharides, or any combination thereof.

2. The synbiotic composition of claim 1, wherein the composition or growth medium comprises up to 1 g of xylooligosaccharides, cellobiose, gentiooligosaccharides, or any combination thereof.

3. The synbiotic composition of claim 1, wherein the Lactobacillus spp. is in an amount in the range of 10.sup.5 cfu/g to 10.sup.12 cfu/g.

4. The synbiotic composition of claim 1, wherein Lactobacillus spp. and/or the growth medium is encapsulated.

5. The synbiotic composition as claimed in claim 4, wherein the growth medium is used to encapsulate the Lactobacillus spp.

6. The synbiotic composition of claim 1, wherein composition is in the form of one or more capsules, tablets, or sachets.

7. The synbiotic composition of claim 1, wherein the composition is in the form of a drinkable liquid and/or powder format and/or can be mixed with a solid or liquid food stuff.

8. The composition as claimed in claim 1, wherein the composition increases the population of Lactobacillus spp. in the gut of an individual.

9. The composition as claimed in claim 8, wherein the population is at least partially an indigenous population of the individual.

Description

DETAILED DESCRIPTION OF THE INVENTION

(1) Embodiments of the present invention will now be described, by way of example only and with reference to the following Figures:

(2) FIG. 1 shows a graph of pure culture screening of L. rhamnosus ATCC 53103 on commercially available oligo/polysaccharides in MRS modified growth media whereby the glucose content has been substituted with 1% (w/v) test oligo/polysaccharide (MRS+Glu+LR; Inulin (Raftiline HP); Orafti P95 (Raftilose); Orafti ST (Raftiline ST); Short FOS (Actilight); and Wheat Arabinoxylan (Low Viscosity);

(3) FIG. 2 shows a graph of pure culture screening of L. rhamnosus ATCC 53103 on commercially available oligo/polysaccharides (Resistant Dextrin (Nutriose); Lactulose-sucrose; Glucosyl-lactose; Lactosyl-fructoside; and GOS synthesized from lactulose DP3);

(4) FIG. 3 shows a graph of pure culture screening of L. rhamnosus ATCC 53103 on commercially available oligo/polysaccharides (Inulin (Raftiline); Orafti P95 (Raftilose); Orafti ST (Raftiline ST); Short FOS (Actilight); Wheat Arabinoxylan (Low Viscosity); Wheat Arabinoxylan (Medium Viscosity); Alpha-glucooligosaccharides (Bioecolians); Gentiooligosaccharides; Levan; Fibersol C*Actistar (Resistant Starch);

(5) FIG. 4 shows a graph of pure culture screening of L. rhamnosus ATCC 53103 on commercially available oligo/polysaccharides (Nutriose (Resistant Dextrin); Lactulose-sucrose; Glucosyl-lactose; Lactosyl-fructoside; Lactulose; Sunfiber (Glucomannan); alphaGOS from Olygose; and FOS from finefoods);

(6) FIG. 5A-5C are graphs showing the pure culture growth rates of L. rhamnosus ATCC 53103 on (A) Gentiooligosaccharides; (B) Galactomannan (Sunfiber); and (C) Xylooligosaccharides;

(7) FIG. 6 is a graph showing growth rates (μ.sub.max(h.sup.−1)) for L. rhamnosus ATCC 53103 on a range of commercially available oligo/polysaccharides;

(8) FIG. 7 is a graph showing Delta Yield (OD, 620 nm) for L. rhamnosus ATCC 53103 on a range of commercially available oligo/polysaccharides;

(9) FIG. 8 is a graph showing growth rates (μ.sub.max(h.sup.−1)) for L. rhamnosus ATCC 53103 on Glucose; Sophorose; D-cellobiose; Gentiooligosaccharides; and Laminarobiose;

(10) FIG. 9 is a graph showing the growth curves (OD, 620 nm) for L. rhamnosus ATCC 53103 on Gentiooligosaccharides; D-cellobiose; Sophorose; and Laminarobiose;

(11) FIG. 10 is a graph showing the pure culture growth of L. rhamnosus ATCC 53103 in modified MRS broth (1% w/v glucose content substituted with the same amount of test carbohydrate (Cellobiose; Glucose; GeOS; XOS; Fructans: Inulin HP, OF P95, and Synergy 1);

(12) FIG. 11A-11B are graphs showing cumulative gas determination for L. rhamnosus ATCC 53103 over 24 h non-pH controlled faecal fermentation with Inulin and Gentiooligosaccharides. Each graph, from left to right, shows three bars (prebiotic with faeces, prebiotic with faeces plus L. rhamnosus ATCC 53103-low dose, prebiotic with faeces plus L. rhamnosus ATCC 53103-high dose) relating to Donor 1, Donor 2, Donor 3, Donor 4, Donor 5 and Donor 6. L. rhamnosus ATCC 53103 was tested at two doses, 0.75×10.sup.4 cfu (low) and 5.36×10.sup.4 cfu (high) relevant to the number of viable L. rhamnosus ATCC 53103 delivered in the proximal colon (10.sup.6CFU);

(13) FIG. 11C-11D are graphs showing cumulative gas determination for L. rhamnosus ATCC 53103 over 24 h fermentation with Xylooligosaccharides and Cellobiose. Each graph, from left to right, shows three bars relating to Donor 1, Donor 2, Donor 3, Donor 4, Donor 5 and Donor 6;

(14) FIG. 12A-12B are graphs showing the negative controls where (A) depicts faecal slurry and (B) depicts L. rhamnosus ATCC 53103 in faecal culture without carbohydrate source present. The graph in FIG. 11A, from left to right, shows three bars relating to Donor 1, Donor 2, Donor 3, Donor 4, Donor 5 and Donor 6;

(15) FIG. 13 are graphs showing the rate of gas determination in faecal culture for each of six faecal donors: Inulin (black=Inulin, green=Inulin+LR Low dose, red=Inulin+LR High dose);

(16) FIG. 14 are graphs showing the rate of gas determination in faecal culture for each of six faecal donors: Gentiooligosaccharides (black=Gentiooligosaccharides, green=Gentiooligosaccharides+LR Low dose, red=Gentiooligosaccharides+LR High dose);

(17) FIG. 15 are graphs showing the rate of gas determination in faecal culture for each of six faecal donors: Cellobiose (black=Cellobiose, green=Cellobiose+LR Low dose, red=Cellobiose+LR High dose);

(18) FIG. 16 are graphs showing the rate of gas determination in faecal culture for each of six faecal donors: Xylooligosaccharides (black=Xylooligosaccharides, green=Xylooligosaccharides+LR Low dose, red=Xylooligosaccharides+LR High dose);

(19) FIG. 17 is a graph showing the average concentrations (Log cells/ml culture) of L. rhamnosus ATCC 53103 (LR; tested at high dose: 5.36×10.sup.4 cfu) in 36 h anaerobic pH controlled faecal batch cultures, determined using quantitative Polymerase Chain Reaction (qPCR);

(20) FIG. 18 are graphs showing L. rhamnosus ATCC 53103 (LR) growth in faecal culture; inulin; GeOS; Cellb; XOS and FOS and the impact on different donors in 36 h, anaerobic, pH controlled faecal batch cultures, determined using quantitative Polymerase Chain Reaction (qPCR);

(21) FIG. 19 are graphs showing metabolite synthesis (short chain fatty acids (SCFA) and lactate) in 36 h, anaerobic pH control culture in the absence (prebiotics) and presence (synbiotics) of L. rhamnosus ATCC 53103 (5.36×10.sup.4 cfu) of: Lactate prebiotics; SCFA prebiotics; Lactate synbiotics; and SCFA synbiotics;

(22) FIG. 20 shows FISH images of commensal bacterial populations in faecal culture using DAPI (total bacterial counts) and Bif164 (Bifidobacterium);

(23) FIG. 21 is a graph showing the impact on commensal microbiota: Lactobacillus/Enterococcus (Lab158) in 36 h, anaerobic, pH controlled faecal culture in basal media containing faecal slurry; GeOS; Cellb; XOS; FOS; and Inulin in the presence and absence of L. rhamnosus ATCC 53103 (LR; 5.36×10.sup.4 cfu) determined by fluorescent in situ hybridisation (FISH);

(24) FIG. 22 shows the impact on commensal microbiota: Bifidobacterium (Bif164) in 36 h, anaerobic, pH controlled faecal culture in basal media containing faecal slurry; GeOS; Cellb; XOS; FOS; and Inulin in the presence and absence of L. rhamnosus ATCC 53103 (LR; 5.36×10.sup.4 cfu) determined by fluorescent in situ hybridisation (FISH);

(25) FIG. 23 shows the impact on commensal microbiota: Dominant bacterial groups (E. rectale/C. coccoides (Erec482); Bacteroides/Prevotella (Bac303); and Clostridium histo/yticum (Chis150));

(26) FIG. 24 shows graphs illustrating individual responses of L. rhamnosus ATCC 53103 (LR) to cellobiose, gentiooligosaccharides (GeOS), xylooligosaccharides (XOS), inulin (Beneo HP) and FOS (Beneo P95) at 0, 10 and 24 h pH controlled faecal batch culture fermentation, determined by qPCR using LR specific primers;

(27) FIG. 25 shows graphs bacterial concentrations in pH controlled anaerobic faecal cultures (Ato291 (Atopobium) Clostridium cluster IX (Prop853); Roseburia intestinalis (Rrec584); and Desulfovibrio (DSV687)) using faeces from each of six healthy adults where the bacterial concentrations were obtained using fluorescent in situ hybridisation (FISH); and

(28) FIG. 26 shows a graph of the growth of Lactobacillus plantarum 2830 (ECGC 13110402) on a range of substrates including, MRS+LP2830, Glucose, Lactose, aGOS (Olygose), Raffinose, Galactose, Cellobiose, FOS (short chain), Sucrose, GOSI, GOSII, GOSIII and GeOS.

EXAMPLE 1

(29) Experiments were conducted to identify any prebiotics which could be used in a combination formulation to support and enhance the growth of Lactobacillus rhamnosus ATCC 53103 (herein after referred to as “LR” and also used interchangeably).

(30) Initially, oligosaccharides or formulations specifically designed to selectively enhance the survival and activity of LR in the human gut were assessed. Experiments were conducted in a multi-phase approach, exploring existing prebiotics and other oligo and polysaccharides to generate synbiotic formulations for LR: (i) oligosaccharide screening of prebiotics and other oligo and polysaccharides in pure culture to support LR growth; (ii) in vitro assessment of consumer acceptability of the synbiotic in terms of the potential to mediate gas related side effects in 24 h faecal culture models; and (iii) in vitro determination of optimum probiotic dose to minimise gas related side effects in in vitro faecal culture model.

(31) Synbiotic potential of the selected oligosaccharides/blends was then to be determined in 24 h, anaerobic, pH and temperature controlled micro-scale faecal (10 ml working volume) faecal batch culture models.

(32) The models had been optimised to work at 1% w/v test oligosaccharide concentration and carried out at pH6.8, which is relevant to the distal colon. Conditions in the distal colon (carbohydrate availability, very slow transit time) are more relevant to batch culture design. Fermentations were to be set up in parallel in identical conditions with the only variable being the test oligosaccharides. The following combinations were to be tested in each experimental run: Faeces (prebiotic negative control) Faeces+LR (synbiotic negative control) Faeces+LR+GeOS (gentiooligosaccharides) Faeces+LR+Cellb (cellobiose) Faeces+LR+XOS (xylooligosaccharides) Faeces+GeOS Faeces+Cellb Faeces+XOS Feces+inulin (positive prebiotic control for test prebiotics) Faeces+FOS (positive prebiotic control for test prebiotics) Faeces+LR+inulin (positive prebiotic control for test synbiotics) Faeces+LR+FOS (positive prebiotic control for test synbiotics)

(33) All vessels, run in parallel, were to be inoculated with the same faecal sample and the experiment repeated using a faecal sample from each of six different healthy donors. Samples were to be obtained at inoculation (0 h) and then at 8 and 24 h of fermentation for: determination of LR levels in faecal culture using qPCR; and determination of the impact of each intervention on commensal faecal microbiome composition using FISH to ensure novel prebiotic will not be fermented by undesirable bacteria and ensure selectivity in a complex, competitive culture environment. Analysis targeted numerically dominant and functionally significant faecal bacterial groups including Bacteroides, Clostridium, Eubacterium, Propionibacterium, Bifidobacterium, Lactobacillus, Faecalibacterium, Atopobium, and Desulfovibrio.

(34) Lastly, determination of faecal microbiome activity through organic acid (SOFA and lactate) measurement was to be conducted at each sampling point. Information will indicate potential fermentation rates of each novel prebiotic.

(35) Oligosaccharide Screening/Novel Synbiotic Formulation to Selectively Support LR Growth

(36) Commercially available prebiotics and other oligo and polysaccharides were first screened using a fast throughput automated growth culture system under anaerobic conditions to establish ability to support LR growth and define growth rates (1% w/v). The following test substrates had been initially identified for further consideration: Short chain fructooligosaccharides (scFOS), oligofructose P95 (FOS), Orafti ST, Orafti HP, Synergy 1, Bioecolians (glucooligosaccharides), gentiooligosaccharides, fucosyllactose, ß glucan (low/medium/high molecular weight; derived from oats), yeast ß glucan, arabinoxylan, xylooligosaccharides, caseinoglycomacropeptide (cgmp), raffinose, stachyose and Bio-Mos.

(37) Substrates shown to be able to support LR growth at high growth rates were then selected for side effect determination.

(38) Lactobacillus rhamnosus ATCC 53103 Pure Culture Growth Screening on Commercially Available Oligo/Polysaccharides

(39) The aim of the experiment was to investigate the growth behavior of L. rhamnosus ATCC 53103 under a wide variety of commercially available, oligo and polysaccharides and to evaluate impact of test substrate physical characteristics on screening process and investigate growth on GOS synthesized by L. rhamnosus GR1 β-galactosidases. Results would be evaluated on the basis of: microbial growth (OD-Fermentation time); growth rate [μ.sub.max(h.sup.−1)]; and change in optical density (max-min). Growth preferences of Lactobacillus rhamnosus ATCC 53103 would be used to determine target structures and carbohydrates for use as prebiotics for L. rhamnosus species or strains.

(40) LR was pre-grown on MRS solid and liquid media, and growth curve experiments were carried out in 96 well plates using modified MRS broth (no glucose present); glucose content substituted by 1% (w/v) of each of the test substrates. Three experimental repeats were carried out—each test conducted in triplicate for 48 h under anaerobic growth conditions. Negative control: modified MRS broth, modified MRS broth+lactose without carbohydrate source, MRS broth (quality control). Positive control: modified MRS+1% glucose+LR. Continuous optical density (OD) measurements were obtained under anaerobic conditions. A reducing agent was added to the modified MRS (L-cysteine HCl, 0.08 g/L) and an indicator of anaerobiosis (resazurin, 4 mL/L solution of 0.025 g/100 mL) was used to ensure anaerobic conditions. Microbial streaking on MRS petri dishes was carried out at the end of each experiment to exclude contamination.

(41) Microbial Growth

(42) As illustrated in FIGS. 1 to 8, all test substrates demonstrated average growth rates and yields with the exception of gentiooligosaccharides. The highest growth rates and yields were observed on gentiooligosaccharides, and xylooligosacharides but not galactomannan.

(43) The next phase was to evaluate cellobiose, laminaribiose and sophorose at 1% (w/v) substrate concentrations to further investigate L. rhamnosus ATCC 53103 preference for specific structures and the most promising substrates to be screened in faecal culture gas experiments under anaerobic conditions for 24 h.

(44) High growth yields were achieved by all test di and oligo-saccharides as illustrated in FIG. 9. All disaccharides exhibit higher growth yields than gentiooligosaccharides. Cellobiose exhibits notably longer lag phase compared to all other test di- and oligo-saccharides. Clear indications of β-glucosidase activity was seen.

(45) Rate of Gas Determination

(46) The aims of this experiment were to determine: (i) the total gas production over a 24 h fermentation period of each of carbohydrate of interest; (ii) the kinetics of gas production (rate) to evaluate the potential of increased abdominal discomfort in vivo upon the ingestion of the carbohydrates of interest; and (iii) the impact of using the selected carbohydrates in combination with LR on total and rate of gas production.

(47) Determination of rate of gas was of particular importance as gas generation at specific time points rather than continuously at low or moderate levels may correlate with abdominal discomfort in vivo and important in relevance to consumer acceptability.

(48) The experiments investigated the potential for gastrointestinal discomfort in vitro, through the determination of rate of gas and cumulative gas production in faecal culture. The cultures were non-pH controlled and six experimental runs were conducted using faeces from six different healthy adults. Headspace gas readings collected every 3 h over a 24 h period for rate of gas determination

(49) The experimental design was as follows: Faeces Faeces+L. rhamnosus ATCC 53103 (negative control) Faeces+Inulin HP (positive prebiotic control) Faeces+Inulin HP+L. rhamnosus ATCC 53103 (positive synbiotic control) Faeces+test carbohydrate Faeces+test carbohydrate+L. rhamnosus ATCC 53103
Lactobacillus rhamnosus ATCC 53103 Test Dose Determination

(50) Previous LR probiotic products were known to deliver 10.sup.6 cfu LR in the gut in vivo. Therefore, it was estimated that this would be equivalent to 10.sup.6 cfu in the proximal vessel (V.sub.1=280 ml) of an in vitro, three stage continuous culture model of the human colon (gut model) as described by Gibson and Macfarlane (1998). This model has been validated to simulate growth substrate availability and luminal bacterial populations in the human gut. Interventions can be tested in directly relevant doses to those used in vivo in humans.

(51) Intervention dose used in the non-pH controlled gas determination experiments and the pH controlled faecal batch culture experiments was calculated based on the relative amounts of faecal inoculum and LR viable counts in the gut model (low dose, 0.75×10.sup.4 cfu) and the relative concentrations of total bacteria to LR viable counts in the gut model (high dose, 5.36×10.sup.4 cfu). Both doses were tested in the non-pH controlled gas determination faecal cultures to determine the possible role of LR in rate and cumulative gas production.

(52) The main test outcomes for these experiments were the impact of LR addition to culture at two different doses and the gas related side effect potential of the synbiotic relevant to inulin.

(53) As shown in FIGS. 11A-11C, no dose effect relevant to LR observed in total gas production. No impact of LR addition on total gas production. There was also donor response variability to different test oligosaccharides. Donors 4 and 7 were seen to be sensitive to Inulin and gentiooligosaccharides, whereas Donor 5 was sensitive to inulin. Donors 4 and 7 were seen to be sensitive to xylooligosaccharides and cellobiose, donor 5 was sensitive to cellobiose. In general gas generated in anaerobic culture was due to the prebiotic component and not the probiotic and was not correlated to the growth and activity of LR.

(54) FIGS. 12-16 show that there is no effect of LR dose on total gas and rate of gas profiles and no impact of LR addition on total gas and rate of gas production compared to the prebiotic alone. Combinations generating high total gas also exhibited high rates of gas production. Xylooligosaccharides and Gentiooligosaccharides were tolerated the best by the majority of donors.

(55) The rate of gas and total gas profiles observed, indicated stimulation of the activity of gas producing members of the faecal microbiota either through cross-feeding or direct fermentation of the test substrates.

(56) In Vitro Assessment of Synbiotic Efficacy in Faecal Culture

(57) An in vitro assessment of synbiotic efficacy in faecal culture using a pH controlled, anaerobic, temperature controlled cultures. The cultures were inoculated with faecal slurry of each of 6 healthy adults. The combinations included: Faeces (prebiotic negative control) Faeces+LR (synbiotic negative control) Faeces+LR+GeOS (gentiooligosaccharides) Faeces+LR+Cellb (cellobiose) Faeces+LR+XOS (xylooligosaccharides) Faeces+GeOS Faeces+Cellb Faeces+XOS Feces+inulin (positive prebiotic control for test prebiotics) Faeces+FOS (positive prebiotic control for test prebiotics) Faeces+LR+inulin (positive prebiotic control for test synbiotics) Faeces+LR+FOS (positive prebiotic control for test synbiotics)

(58) FIG. 17 shows real-time PCR determination of LR concentrations in anaerobic, pH control faecal culture slurries (TaqMan system, reactions performed in triplicate). Average concentrations suggest growth of LR in faecal culture on cellobiose and XOS. No commensal LR was detected in the prebiotic only cultures (data not shown).

(59) The primers for the real-time PCR determination was as follows:

(60) TABLE-US-00001 LR-F (SEQ ID No. 1) Forward primer GCCCTTAACAGCAGTCTTC LR-R (SEQ ID No. 2) Reverse primer GCCCTCCGTATGCTTAAACC LR-P (SEQ ID No. 3) Probe FAM- TGTTGATCAATCAGAGGAT-BHQ1

(61) FIGS. 18-19 show L. rhamnosus ATCC 53103 (LR) growth in faecal culture; inulin; GeOS; Cellb; XOS and FOS and the impact on different donors and the comparative metabolite synthesis by L. rhamnosus ATCC 53103 of: Lactate prebiotics; SOFA prebiotics; Lactate synbiotics; and SOFA synbiotics.

(62) Fluorescent in situ hybridisation (FISH) experiments were then conducted to investigate the impact on commensal gut microbiome bacterial populations in faecal culture and the fluorescently labelled micrographs are shown in FIG. 20. FISH is a fully quantitative methodology for determining bacterial concentrations at the genus and species level. Oligonucleotide probes targeted 16S rRNA and allowed for direct enumeration of whole bacterial cells in biological samples including non-cultivable cells. The cells are labelled with a fluorescent dye (Cy3) for visualisation by fluorescent microscopy.

(63) Analyses of commensal bacterial populations: molecular probe specificity shown below in Table 1.

(64) TABLE-US-00002 TABLE 1 Probe Fermentation name Target species products Bif164 Bifidobacterium genus A, L, e, f Lab158 Lactobacillus-Enterococcus L Bac303 most Bacteroidaceae and Prevotellaceae, A, P, S some Porphyromonadaceae Chis150 most of the Clostridium histolyticum group A, P, B, L, e (Clostridium cluster I and II) Ato291 Atopobium cluster A, L, f Erec482 most of the A, B, L Clostridium coccoides-Eubacterium rectale group (Clostridium cluster XIVa and XIVb) Prop853 Clostridium cluster IX P Fpra655 Faecalibacterium prausnitzii B Rrec482 Roseburia genus B (E. rectale, R. intestinalis) DSV687 Desulfovibrio (Key: A: acetate, B: butyrate, P: propionate, S: succinate, L: lactate, f: formate, e: ethanol)

(65) The variability in Lactobacillus/Enterococcus response between different faecal donors is shown in FIG. 21. Negative controls appear to stimulate concentration in certain cultures, whereas FIG. 22 shows that Bifidobacterium populations stimulated by all test oligosaccharides. The addition of LR did not appear to impact Bifidobacterium concentrations. Low variability in volunteer response was also seen.

(66) FIG. 23 shows the impact on commensal microbiota: Dominant bacterial groups Erec482: high variability noted between faecal donors/trend for decrease observed. Bac303: some impact on Bacteroides/Prevotella noted with GeOS, Cellobiose and XOS however it is unlikely to be statistically significant when compared to positive/negative controls, Chis150: Identical patterns of increase noted in Clostridium histolyticum for all tests including the negative and positive controls. It is unlikely the observed effect was relevant to any of the test interventions.

(67) The measurement of enzyme activity secreted by Lactobacillus rhamnosus was investigated for the trisaccharide fraction obtained using cellobiose as carbon source during enzymatic synthesis. FIG. 24 show graphs illustrating individual responses of L. rhamnosus ATCC 53103 to cellobiose, gentiooligosaccharides (GeOS), xylooligosaccharides (XOS), inulin (Beneo HP) and FOS (Beneo P95) at 0, 10 and 24 h pH controlled faecal batch culture fermentation, determined by qPCR using LR specific primers. Ellipses and arrows signify increases in cellobiose and XOS respectively, in each volunteer. The impact of the test carbohydrates on commensal L. rhamnosus ATCC 53103 was also investigated, however levels were below the detection limit at all time points (not shown). Five out of the six volunteers used for the culture showed an increase of L. rhamnosus ATCC 53103 concentrations upon fermentation of cellobiose and XOS;

(68) pH controlled anaerobic faecal culture experiments were conducted using faeces from each of six healthy adults were undertaken and the bacterial concentrations obtained using fluorescent in situ hybridisation (FISH) and the results illustrated in FIGS. 13 to 23 and 27. The experiement shows a significant increase in Lab158 in particular with XOS, cellobiose and gentiooligosaccharides. More responders within the 6 faecal donors responding with cellobiose and XOS compared to the positive controls (inulin and FOS). No significant impact was seen on Bacteroides and significant increases in Bifidobacterium with all test combinations. No significant impact of any of the treatments on Erec482 and Chis150 cells compared to the positive and negative controls. As shown in FIG. 25, some increases observed in Ato291 concentrations with inulin and cellobiose, but no significant impact on Prop853, Rrec584 and DSV687 levels.

(69) Conclusions

(70) Lactobacillus rhamnosus ATCC 53103 has very narrow carbohydrate utilisation preferences and can grow in pure culture on beta glucooligosaccharides such as cellobiose. XOS, GeOS and cellobiose. The rate and cumulative gas production were comparable to that of inulin and as such are unlikely to generate severe gas related side effects in vivo.

(71) Cellobiose, was identified to be the best growth substrate for LR, as determined in pH controlled faecal batch cultures and mediated increases in LR concentration and activity (organic acid synthesis). XOS showed similar efficacy. This effect was not dependent on faecal donor enterotype, which implies direct fermentation of cellobiose and XOS by LR and not stimulation of LR through cross feeding.

(72) For the fructans, the effect was volunteer dependent and implies the necessity of cross-feeding relationships to generate fermentable substrates for LR. LR in pure culture showed poor growth on fructans indicating that LR cannot directly grow on fructans (FIG. 10), it requires the fermentation activity of other species/genera the presence of which depends on each individual's commensal microbiome.

(73) All test prebiotics stimulated Bifidobacterium populations, key bacteria in promoting a healthy gut environment. No effect was seen on Eubacterium rectale/Clostridium coccoides, Clostridium histolyticum or Bacteroides, Desulfovibrio and Propiobibacterium (Clostridium cluster IX). However analysis of SOFA profiles does not suggest an impact in these groups. Overall, no impact was observed on health negative bacterial groups.

(74) The systematic screening program has identified two oligosaccharides (XOS/Cellobiose) which have high potential to selectively stimulate growth/activity of Lactobacillus rhamnosus ATCC 53103 (LR) in the GI tract.

(75) The experiments showed the potential of cellobiose and XOS to enhance the numbers and activity of LR in faecal cultures.

EXAMPLE 2

(76) Similar growth experiments to Example 1 above were conducted on Lactobacillus plantarum 2830 (ECGC 13110402) on a range of substrates including, MRS+LP, Glucose, Lactose, LP GOS, alphaGOS (a proprietary GOS product), Raffinose, Galactose, Cellobiose, FOS (short chain), Sucrose, GOS I (a proprietary GOS product), GOS II (a proprietary GOS product), GOS III (a proprietary GOS product) and Gentiooligosaccharides (GeOS).

(77) FIG. 26 shows growth of Lactobacillus plantarum LP-LDL in modified MRS media, whereby the glucose (1% wt/vol) has been substituted with each of a of a selection of carbohydrate sources, to evaluate its capacity to support LPLDL. Experiments were carried out under anaerobic conditions on a 96-well microtiter plate system (FLUOstar Omega, BMG LABTECH) in a final volume of 200 μL using an inoculum size 10% (w/v), previously diluted to obtain an initial OD620 nm=0.2. Incubation was conducted under anaerobic conditions at 37° C. with interval shaking at 500 rpm every 5 min. Optical density measurements at 620 nm were employed to assess microbial growth.

(78) Out of the oligosaccharides tested (cellobiose, FOS, gentiooligosaccharides, alphaGOS, GOS I, II & Ill and raffinose) cellobiose, followed by FOS, GOS II and GeOS (gentiooligosaccharides) supported the highest growth rates but also the highest growth yields of LP-LDL in pure culture, indicating a strong potential to be used as synbiotics to support its growth and activity in vivo.

(79) The forgoing embodiments are not intended to limit the scope of the protection afforded by the claims, but rather to describe examples of how the invention may be put into practice.

BIOLOGICAL DEPOSITS

(80) The application refers to the following indications of deposited biological material:

(81) Name: European Collection of Cell Cultures

(82) Address: Public Health England Porton Down,

(83) National Collection of Type Cultures, PHE Culture Collections, Microbiological Services, Porton Down, Sailsbury, SP4 OJG United Kingdom
Sample deposited: Lactobacillus plantarum 2830.
Sample genus: Lactobacillus.
Sample species: plantarum.
Sample strain no.: 2830.
Date: 4 Nov. 2013
Accession Number: 13110402