Neurodegenerative disorders

Abstract

The invention relates to neurodegenerative disorders, and in particular to novel oligonucleotides for treating such conditions, for example Alzheimer's disease. The invention provides novel antisense oligonucleotides, and compositions comprising such oligos, and therapies and methods for treating neurodegenerative disorders. The invention includes genome editing techniques for achieving similar results as using the novel antisense oligonucleotides.

Claims

1. An antisense oligonucleotide (AON) capable of reducing or preventing exon 7 and/or exon 8 inclusion into an amyloid precursor protein (APP) mRNA produced by splicing from an APP transcript, wherein the AON has a length of up to 42 nucleotides, wherein the AON comprises internucleosidic linkages which are chemically modified, or wherein the AON comprises a phosphorodiamidate morpholino oligomer (PMO), and wherein the AON promotes exon skipping to increase the expression of the APP.sub.695 mRNA isoform, and reduces the amount of the APP.sub.751 and APP.sub.770 isoforms.

2. An AON according to claim 1, wherein a protein made by skipping exon 7 and 8 comprises the following features: 1) Exon 6 is joined with exon 9, maintaining the reading frame and resulting in a protein with 695 amino acids; 2) the Kunitz-type protease inhibitor domain (KPI), which is within exon 7, is removed; and/or 3) a domain sharing homology with the OX-2 antigen of thymus-derived lymphoid cells, which is within exon 8, is removed.

3. An AON according to claim 1, wherein the AON is capable of binding to and/or is complementary to a target region within: (i) the 3′ part of intron 6-7 and/or the 5′ part of exon 7 of the APP gene; (ii) exon 7 of the APP gene; (iii) the 3′ part of exon 7 and/or the 5′ part of intron 7-8 of the APP gene; (iv) the 3′ part of intron 7-8 and/or the 5′ part of exon 8 of the APP gene; (v) exon 8 of the APP gene; and/or (vi) the 3′ part of exon 8 and/or the 5′ part of intron 8-9 of the APP gene.

4. An AON according to claim 3, wherein the AON is complementary to at least 8 nucleotides in the target region, or from 8 to 50 nucleotides, or from 12 to 50 nucleotides, in the target region, or wherein the AON has a length of from 18 to 42 nucleotides, or from 22 to 42, or from 27 to 39 nucleotides.

5. An AON according to claim 1, wherein when the AON is capable of reducing or preventing exon 7 inclusion into an APP mRNA produced by splicing from an APP transcript, the target region for the AON is between 150 nucleotides upstream of the intron 6/exon 7 junction (−150) and 150 nucleotides downstream of the exon 7/intron 7 junction (+150).

6. An AON according to claim 1, wherein the AON target region spans 15 nucleotides upstream and 150 nucleotides downstream of exon 7 of the human APP gene (−15 to +50), and is represented as SEQ ID NO: 5.

7. An AON according to claim 1, wherein the AON is complementary to a target region within, or adjacent to, exon 7, and comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, 7, 8, 9 and 10.

8. An AON according to claim 7, wherein the AON comprises a nucleotide sequence of SEQ ID No: 7.

9. An AON according to claim 1, wherein when the AON is capable of reducing or preventing exon 8 inclusion into an APP mRNA produced by splicing from an APP transcript, the target region for the AON is between 150 nucleotides upstream of the intron 7/exon 8 junction (−150) and 150 nucleotides downstream of the exon 8/intron 8 junction (+150).

10. An AON according to claim 1, wherein the AON target region spans nucleotides 50 nucleotides upstream and 50 nucleotides downstream of exon 8 of the human APP gene (−50 to +50), and is represented as SEQ ID NO: 11.

11. An AON according to claim 1, wherein the AON is complementary to a target region within, or adjacent to, exon 8, and comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 12, 13, 14 and 15.

12. An AON according to claim 1, wherein the AON comprises a nucleotide sequence of SEQ ID No: 13.

13. A method of treating or ameliorating a neurodegenerative disorder in a subject, the method comprising, administering to a subject in need of such treatment, a therapeutically effective amount of an antisense oligonucleotide (AON) according to claim 1.

14. A method according to claim 13, wherein the neurodegenerative disorder is Alzheimer's disease.

15. A method according to claim 13, wherein one or more AON for causing exon 7 skipping is used in combination with one or more AON for causing exon 8 skipping.

16. An antisense oligonucleotide (AON) according to claim 1 comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 6, 7, 8, 9, 10, 12, 13, 14 and 15.

17. A pharmaceutical composition comprising a therapeutically effective amount of the antisense oligonucleotide (AON) according to claim 1, and optionally a pharmaceutically acceptable vehicle.

18. The antisense AON of claim 1 wherein the chemically modified internucleosidic linkages are phosphorothioate linkages.

19. The method of claim 15 wherein any one of the AON is selected from the group consisting of SEQ ID NO: 6, 7, 8, 9 and 10 and used in combination with any one of the AON selected from the group consisting of SEQ ID NO: 12, 13, 14 or 15.

Description

(1) For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying FIGS., in which:

(2) FIG. 1 shows a prediction of potential exonic splicing enhancers (ESEs) and exonic splicing silencers/suppressors (ESSs) for exon 7 (FIG. 1A) and exon 8 (FIG. 1B) using the Human Splicing Finder 2.4;

(3) FIG. 2 shows an illustration of the genomic organization of the Amyloid Precursor Protein (APP) gene, and the localization of antisense oligonucleotides antisense oligonucleotides (AONs) in relation to the targeted exons 7 (SEQ ID No: 5) and 8 (SEQ ID No: 11). Exonic sequences are represented with capital letters, and intronic sequences are presented with small letters. Five sequences (PMO 7.1, 7.2, 7.3, 7.4 and 7.5) were chosen to target exon 7, and four sequences (PMO 8.1, 8.2, 8.3 and 8.4) were chosen for targeting exon 8. Phosphorodiamidate morpholino antisense oligonucleotides (i.e. PMO) sequences produced are shown in coloured boxes;

(4) FIG. 3 shows a selection of the most thermodynamically favourable structure for APP exon 7 flanked by 50 nucleotides of intronic sequences using mfold analysis and illustrates the target sites for the designed PMOs shown in FIG. 2 (the coloured lines represent the PMOs aligned to their corresponding target sites);

(5) FIG. 4 shows a selection of the most thermodynamically favourable structure for APP exon 8 flanked by 50 nucleotides of intronic sequences by mfold and illustrates the target sites for the designed PMOs shown in FIG. 2 (the coloured lines represent the PMOs aligned to their corresponding target sites);

(6) FIG. 5(A) shows an agarose gel illustrating the RT-PCR products of mRNAs isolated from non-transfected cells (Blank), cells transfected with a control PMO (E2) and cells transfected with 500 nM of PMOs 7.2, 8.2 and a combination of PMOs 7.2 and 8.2 (500 nM each). FIG. 5(B)-(C) show the relative amount of each transcript was calculated as a ratio of the intensity of each PCR product over the intensity of all PCR products combined. (B) Transfection of 500 nM of PMOs 7.1, 7.2, 7.3 and 7.4 increased the relative expression of APP695 and promoted the exclusion of exon 7, whereas PMO 7.5 did not display significant activity. (C) Transfection of 500 nM of PMOs 8.1, 8.2 and 8.3 promoted the exclusion of exons 7 and 8 predominately from APP770 and less from APP751, increasing the relative amount of APP695, whereas PMO 8.4 promoted the exclusion of exon 8 only from APP751. n=3 independent experiments for all conditions. ***p≤0.0001, **p≤0.0014, *p=0.0248, n=3 for all conditions;

(7) FIG. 6 shows the quantification of the relative amount of the different APP isoforms by RT-PCR from SH-SY5Y transfected with increasing amounts of PMOs 7.2, 8.2 and a combination of both. (A) Transfection of 250 nM of PMO 7.2 is sufficient to induce skipping of exon 7 from APP770 and 500 nM from both, APP770 and APP695. (B) Transfection of 500 nM of PMO 8.2 is sufficient to induce skipping of exon 7 and 8 from APP770 and increase the relative amount of APP 695. (C) Transfection of 7.2 and 8.2 effectively reduces the levels of APP770 and 751 at relatively low concentrations (500 nM each);

(8) FIG. 7(A) shows a representative image of a western blot illustrating the protein levels of APP from homogenates of non-transfected cells (Blank), cells transfected with a control PMO (E2) and cells transfected with 500 nM of PMOs 7.2, 8.2 and a combination of 7.2 and 8.2 (500 nM each). (B) The relative amount of APP695 calculated as a ratio of the intensity of APP695 over the intensity of all APP products showed a significant increase of APP695 in cells transfected with the designed PMOs. ***p=0.0001, n=3 for all conditions; and

(9) FIG. 8 shows gene expression levels of NEP by qPCR from SH-SY5Y neuroblastoma cells transfected with PMOs 7.2, 8.2 and a combination of both. Transfection of the PMOs enhances the expression levels of NEP compared to non-transfected cells, or cells transfected with a control PMO.

EXAMPLES

(10) A significant contributor to the manifestation and progression of AD is the accumulation of amyloid beta produced by the proteolytic processing of APP. In the brain, three major transcripts of APP have been identified generated from alternative splicing either of exon 7 (APP751) or of exons 7 and 8 (APP695). Even though under physiological conditions, the predominant transcript in the brain is APP695, a significant increase in the levels of the longer transcripts (APP751 as well as the full length APP770 containing both exons 7 and 8) has been linked with the progression of AD. As described below, the inventors designed phosphorodiamidate morpholino antisense oligonucleotides (PMOs) to induce skipping of exons 7 and 8 and restore the non-disease associated splicing pattern of APP. The ability of several PMOs to induce exon skipping of exons 7 and 8 was tested in vitro in SH-SY5Y human neuroblastoma cells that express all three isoforms. The inventors have identified antisense oligonucleotides that efficiently reduce the inclusion of exons 7 and 8 from the mature mRNA that resulted in the increased expression of APP695 protein with an associated decrease in APP751 and APP770. This study demonstrates the feasibility of this exon skipping approach to alter APP splicing in AD.

(11) Materials and Methods

(12) Antisense oligonucleotide (AON) design

(13) AONs were designed to exons 7 and 8 of the human APP gene using knowledge of putative SR protein binding motifs which are implicated in pre-mRNA splicing, as predicted by Human Splicing Finder 2.4.1 [40] analysis of exon/intron sequences and secondary structure via MFold [41] and calculations of the AON-target binding energies as predicted by Sfold [42]. For the analysis, the corresponding exons along with 50 nucleotides 3′ and 5′ of the exons were used. All AONs were synthesised as PMOs by GeneTools, LLC.

(14) Cell Culture and Transfection

(15) Human Neuroblastoma SH-SY5Y cells were grown in DMEM complete culture media-DMEM High Glucose (SIGMA) supplemented with 10% FBS (GIBCO), ix PenStrep (GIBCO), 1× Non-Essential Amino Acids (SIGMA) and 1× GlutaMAX (GIBCO) and incubated at 37° C. with 5% CO2. The cells were seeded into 12 well plates in DMEM high glucose complete culture media for transfections. Undifferentiated cells were transfected with Endoporter/DMSO (Gene Tools) at a ratio of 6 ul of Endoporter per 1 ml of media according to manufacturer's instructions. PMO concentrations ranged from 50 nM to 1 μM.

(16) RNA extraction and RT-PCR

(17) Cells were typically incubated for 24 hours post transfection before RNA was extracted by the RNeasy kit (Qiagen) as per the manufacturer's instruction. RNA was quantified on a nanodrop and 500 ng was used for a RT-PCR reaction with the GeneScript RT-PCR kit (Genesys) according to manufacturer's instructions. The primer sequences used were:

(18) TABLE-US-00018 (SEQ ID No: 16) fRT - GTGATGAGGTAGAGGAAGAGG, (SEQ ID No: 17)  rRT - GTTGTAGAGCAGGGAGAGAG.

(19) RT PCR conditions were: reverse transcription at 45° C. for 30 min, followed by: initial denaturation 92° C. for 2 min, 10 cycles of denaturation 92° C. for 30 s, annealing 62° C. for 30 s, extension 68° C. for 45s, 25 cycles of denaturation 92° C. for 30 s, annealing 62° C. for 30 s, extension at 68° C. for 45 s+5 s/cycle, followed by final extension at 68° C. for 10 min, hold at 4° C. infinite.

(20) A 1 μl aliquot of the RT-PCR product was used as template for a 30-cycle second round nested PCR reaction using 2× PCR Master Mix (Quantig Ltd.). Nested primer sequences used were:

(21) TABLE-US-00019 (SEQ ID No: 18) fNes - CACAGAGAGAACCACCAGCA, (SEQ ID No: 19)  rNes - CTTGACGTTCTGCCTCTTCC.

(22) Nester PCR conditions were: Initial denaturation 92° C. for 5 mins, 30 cycles denaturation 92° C. for 30 s, annealing 60° C. for 30 s, extension 68° C. for 45 s, followed by a final extension at 68° C. for 10 min, hold at 4° C. infinite.

(23) PCR products were analysed on a 1% (w/v) agarose gel in TAE buffer and products were visualized with SyBr Safe. Exon skipping levels were determined by analysis of the PCR gels by densitometric analysis with Fiji image J [43].

(24) Western Blotting

(25) Protein samples were prepared by lysing SH-SY5Y cells 72 hrs after transfection, with RIPA buffer (150 mM NaCl, 10 mM EDTA, 50 mM HEPES, 1% (v/v) NP-40, 0.5% (w/v) Sodium Deoxycholate, 0.1% (w/v) SDS) with a protease inhibitor cocktail (Roche). Protein samples were prepared in 1× LDS sample buffer and 1× Reducing agent (Invitrogen) before being denatured at 75° C. for 8 minutes.

(26) Samples were resolved on 10% (w/v) Tris-Glycine gels and transferred to an Amersham Protran 0.45 μM nitrocellulose membrane (GE Life Sciences). Membranes were blocked for 1 hour in TBS containing 0.05% (v/v) Tween-20, and 2.5% (w/v) dried milk powder. Membranes were then incubated with Anti-APP N terminal antibody MAb 348 (Sigma Aldrich) at a dilution of 1:1000 overnight at 4° C. in blocking buffer before being washed with TBS and then incubated with an anti-mouse IgG Dylight 680 secondary antibody (Cell Signalling) 1:5000 in TBS containing 2.5% dried milk powder (w/v). Detection was performed using Odyssey infrared imaging system from LI-COR biosciences and densitometric analysis was performed with Fiji Image J [43].

(27) Modifying Expression of Neprilysin and APP

(28) 1) cDNA Synthesis

(29) For each cDNA synthesis reaction, 0.5 μg random primers (Invitrogen), 0.5 μg Oligo(dT) (Promega) and 600 ng of RNA were added to a single tube, making up the volume to lovtl with HyPure molecular grade water (LifeSciences). The reaction mixture was incubated at 70° C. for 5 minutes before being placed on ice. A master mix containing GoScript 5× buffer (Promega), GoScript enzyme (Promega), 2.5 mM MgCL2 (Promega), 0.5 mM dNTP (Promega), and HyPure molecular grade water (LifeSciences) made up to 15 ul was added to each reaction and run in a cDNA synthesis reaction. cDNA synthesis conditions were: annealing 25° C. 5 min, extension 42° C. 1 hour, inactivation of reverse transcriptase 70° C. 15 min, hold at 4° C. infinite. RNA from 3 biological replicates for each condition (7, 8, 7+8, E2, Blank) were used to perform this cDNA synthesis.

(30) 2) qPCR

(31) cDNA was diluted to required concentration and added to a well of a 384 well plate, followed by the required master mix being added. Master mixes consisted of 2× Light Cycler 480 Syber green I (Roche) and 0.5 μM appropriate primers (Sigma). Primer sequences are described below:

(32) TABLE-US-00020 NEP: (SEQ ID No: 23) F-CCTGGAGATTCATAATGGATCTTGT (SEQ ID No: 24) R-AAAGGGCCTTGCGGAAAG APP: (SEQ ID No: 25) F-GATCCATCAGGGACCAAAAC (SEQ ID No: 26) R-AGCGGTAGGGAATCACAAAG

(33) Three biological replicates were used for each condition, and for each of these biological replicates, three technical replicates were performed.

(34) The expression of at least one gene of interest and one housekeeping gene was studied in each experiment, and standards ranging from 1/20 to 1/2500 were used to allow for analysis of results. qPCR was run in a LightCycler480 qPCR machine (Roche). The PCR conditions were: pre-incubation 95° C. 5 min, 40 cycles of amplification 95° C. 15 sec, 60° C. sec, 72° C. 15 sec. qPCR was analysed using LightCycler480 software (Roche).

Example 1

Design of Antisense Oligonucleotides (AONs)

(35) Since APP695 and APP751 isoforms are produced as a result of splicing out of exons 7 (APP751) or exons 7 and 8 (APP695), respectively, a unique set of AONs was designed to target these two exons. Referring first to FIG. 1, each exon sequence was analyzed for the presence of exonic splicing enhancers (ESEs) and exonic splicing suppressors or silencers (ESSs) using Human Splicing Finder 2.4.1. Referring to FIG. 2, to induce exon skipping, an AON was designed to specifically target ESEs, avoiding ESSs, if possible. Using the output from Human Splicing Finder 2.4.1, several 25 mer or 30 mer AONs targeting both exons were designed.

(36) It has previously been established that a more efficacious AON would have its ends in open loop structures since this allows easier strand invasion and would bind to open conformation sequences more readily [44] Referring to FIGS. 3 and 4, respectively, the predicted secondary structure of the pre-mRNA was therefore assessed for exon 7 and exon 8 using mfold and the binding sites of the designed AONs plotted.

(37) Further to the open conformation of the target sequence, AONs that bind to their target more strongly are also predicted to be more efficacious [44]. Thermodynamic analysis of the binding of designed AONs to their target was performed using sfold and the results are summarised in Table 1.

(38) TABLE-US-00021 TABLE 1 A summary of the sequence and properties of the selected AONs ΔG- ΔG-   ΔG-  GC Free Hair- Inter- Total Tar- Con- energy pin ΔG- mole- Bind- PMO  get tent of struc- PMO- cular ing name Length Exon Target Sequence PMO Sequence (%) Exon ture PMO Dimers energy 7.1 30 bp 7 TGTGCTCTGAACAAG ACGGCCCCGTCTCGGCTTG 63.3 −74.11  −8.84  −9.28 −5.5 −50.49 CCGAGACGGGGCCGT TTCAGAGCACA 7.2 30 bp 7 GGTACTTTGATGTGA CACACTTCCCTTCAGTCAC 46.7 −74.11 −1.82  −4.88 −6.5 −60.91 CTGAAGGGAAGTGTG ATCAAAGTACC 7.3 30 bp 7 TTACGGCGGATGTGG TTGTTCCGGTTGCCGCCAC 60 −74.11 −4.85  −9.75 −2.7 −56.81 CGGCAACCGGAACAA ATCCGCCGTAA 7.4 30 bp 7 CTTTGACACAGAAGA ACGGCCATGCAGTACTCTT 50 −74.11 −5.37  −9.28 −9.6 −49.86 GTACTGCATGGCCGT CTGTGTCAAAG 7.5 30 bp 7 CGCCAgtaagtggac caggctcgaagaagggtcc 60 −74.11 −7.3  −6.76 −8.5 −51.55 ccttcttcgagcctg acttacTGGCG 8.1 25 bp 8 ttttttccatagTGT AAACTTTGGGACActatgg 32 −30.09 −4.48  −3.89 −4.6 −17.12 CCCAAAGTTT aaaaaa 8.2 25 bp 8 ACTCAAGACTACCCA AAGAGGTTCCTGGGTAGTC 48 −30.09 −2.7  −5.12 −9.4 −12.87 GGAACCTCTT TTGAGT 8.3 25 bp 8 GCCCGAGATCCTGTT acgtacGTTTAACAGGATC 48 −30.09 −2.95 −13.55 −9.8  −3.79 AAACgtacgt TCGGGC 8.4 25 bp 8 tgtcattcacctgag cttcccttccctcaggtga 52 −30.09 −5.32  −4.67 −9.4 −10.7 ggaagggaag atgaca

(39) PMO 7.1=SEQ ID No: 6

(40) PMO 7.2=SEQ ID No: 7

(41) PMO 7.3=SEQ ID No: 8

(42) PMO 7.4=SEQ ID No: 9

(43) TABLE-US-00022 TABLE 1 A summary of the sequence and properties of the selected AONs ΔG-  ΔG-    ΔG-  GC  Free  Hair- Inter- Total Tar- Con- energy pin ΔG- mole- Bind- PMO get tent   of struc- PMO- cular ing name Length Exon Target Sequence PMO Sequence (%) Exon ture PMO Dimers energy 7.1 30 bp 7 TGTGCTCTGAACAAG ACGGCCCCGTCTCGGCTTG 63.3 −74.11  −8.84  −9.28 −5.5 −50.49 CCGAGACGGGGCCGT TTCAGAGCACA 7.2 30 bp 7 GGTACTTTGATGTGA CACACTTCCCTTCAGTCAC 46.7 −74.11 −1.82  −4.88 −6.5 −60.91 CTGAAGGGAAGTGTG ATCAAAGTACC 7.3 30 bp 7 TTACGGCGGATGTGG TTGTTCCGGTTGCCGCCAC 60 −74.11 −4.85  −9.75 −2.7 −56.81 CGGCAACCGGAACAA ATCCGCCGTAA 7.4 30 bp 7 CTTTGACACAGAAGA ACGGCCATGCAGTACTCTT 50 −74.11 −5.37  −9.28 −9.6 −49.86 GTACTGCATGGCCGT CTGTGTCAAAG 7.5 30 bp 7 CGCCAgtaagtggac caggctcgaagaagggtcc 60 −74.11 −7.3  −6.76 −8.5 −51.55 ccttcttcgagcctg acttacTGGCG 8.1 25 bp 8 ttttttccatagTGT AAACTTTGGGACActatgg 32 −30.09 −4.48  −3.89 −4.6 −17.12 CCCAAAGTTT aaaaaa 8.2 25 bp 8 ACTCAAGACTACCCA AAGAGGTTCCTGGGTAGTC 48 −30.09 −2.7  −5.12 −9.4 −12.87 GGAACCTCTT TTGAGT 8.3 25 bp 8 GCCCGAGATCCTGTT acgtacGTTTAACAGGATC 48 −30.09 −2.95 −13.55 −9.8  −3.79 AAACgtacgt TCGGGC 8.4 25 bp 8 tgtcattcacctgag cttcccttccctcaggtga 52 −30.09 −5.32  −4.67 −9.4 −10.7 ggaagggaag atgaca

(44) PMO 7.5=SEQ ID No: 10

(45) PMO 8.1=SEQ ID No: 12

(46) PMO 8.2=SEQ ID No: 13

(47) PMO 8.3=SEQ ID No: 14

(48) PMO 8.4=SEQ ID No: 15

(49) The overall analysis showed that all of the designed AONs target sequences rich in exonic splicing enhancers (ESE) motifs, have a high proportion of their target in open conformations, with all but one having at least one end in a predicted open loop structure and they all bind strongly to their target (see FIGS. 3, 4 and Table 1). Since PMO chemistries were used in this work, the % GC content (ideally 40-60%) for each AON designed, the length of any contiguous G stretches (less than 4), and the degree of self-complementarity (little or none) were also taken into consideration since these factors were believed to have a significant effect on synthesis yield, solubility and efficacy.

Example 2

Efficiency of PMOs Promoting Exclusion of Exons 7 & 8 in APP mRNA

(50) The inventors next tested the activity of five PMOs targeting exon 7 and four PMOs targeting exon 8 by performing reverse transcription PCR (RT-PCR) of mRNA isolated from SH-SY5Y human neuroblastoma cells treated with each PMO at 500 nM for 48 hours. SH-SY5Y were used for this work due to their similarity to primary human neuronal cells and because they express all three neuronal APP mRNA variants [45].

(51) First, the inventors examined the activity of PMOs targeting exon 7. Referring to FIG. 5A, transfection of SH-SY5Y cells with 500 nM of PMO was followed by a nested RT-PCR designed to detect the three variants of APP in one reaction. To quantitate the activity of the PMOs, the intensity of the characteristic band for each mRNA variant was measured using densitometry and was subsequently calculated as a percentage over the intensity of all PCR products. For consistency purposes, the cultures were renewed after 25-30 passages and each graph presented here is the average of three independent experiments performed in the same batch of cells. The relative amounts of the three isoforms were APP770: 34.1±3.3%, APP751: 44.6±0.9% and APP695: 21.2±2.6% for control (non-transfected) cells, and APP770: 31.8±2%, APP751: 45.4±1.2% and APP695:23.2±1.6% for cells transfected with a control PMO (E2, targeting the human dystrophin gene). The sequence of this control PMO is OCAGCCCATCTTCTCCTGGTCCTGG (SEQ ID No: 20).

(52) Referring to FIG. 5B, the results showed that PMOs 7.1, 7.2, 7.3 and 7.4, when used at 500 nM, significantly reduced the inclusion of exon 7 in the transcript increasing the amount of APP695 to 71.5±3.2%, 75.9±4.1%, 64.1±2.4% and 74.7±0.1%, respectively, compared to control (p≤0.0001, n=3). PMO 7.5 did not affect the splicing pattern of the mRNA of APP as much as the others, and the amount of APP695 was similar to control conditions (28.6±4.6%, p=0.656, n=3).

(53) Referring to FIGS. 5A and 5B, in addition, a novel product corresponding to an APP mRNA including exon 8 but not exon 7 was surprisingly generated. This mRNA has not been previously described and it likely corresponds to a non-physiological variant.

(54) Next, the inventors examined the activity of four PMOs targeting exon 8 in SH-SY5Y cells transfected with 500 nM of each oligo. Referring to FIGS. 5A and 5C, the results showed that PMOs 8.1, 8.2 and 8.3 efficiently induced the exclusion of exon 8 and no detectable band corresponding to APP 770 could be detected. Quantification of the PCR products showed that the relative amount of APP751 was decreased for PMOs 8.1 and 8.2, but less so for PMO 8.3 (31.9±0.3%, 35.8±0.2% and 39.8±1.02%, respectively, compared to C: 44.6±0.9%. p=0.0014, 0.025 and p>0.05 respectively, n=3). Surprisingly, an increase in the relative levels of the shorter APP695 transcript was more prominent for PMOs 8.1, 8.2 and 8.3 (64.1±0.3%, 68±0.2% and 60±1.02% respectively, compared to C: 21.2±2.6%. p≤0.0001, n=3) suggesting a possible link between splicing of exon 7 with exon 8.

(55) Similar to the other PMOs, PMO 8.4 increased the levels of APP695 (54.7±0.01% compared to C: 21.2±2.6%, p≤0.0001, n=3) and reduced the relative amount of APP751 (APP751: 10.5±0.6% compared to C: 44.6±0.9%, p≤0.0001, n=3). Surprisingly, however, the relative expression of APP770 was not affected (34.7±0.6% compared to control 34.1±3.37), suggesting that this PMO could only target APP751.

(56) Having shown that the PMOs described herein can effectively induce skipping of the targeted exons 7 and 8, the inventors selected PMOs 7.2 and 8.2 and investigated in more detail their efficiency in promoting the exclusion of their target exons. To do so, SH-SY5Y cells were transfected with increasing concentrations of PMOs and RT-PCR of mRNA harvested from the transfected cells was performed to assess the extent of exon skipping, as shown in FIGS. 6A and 6B). First, with reference to FIG. 6A, the inventors calculated the relative amount of the full-length variant (APP770 that includes exon 7), in SH-SY5Y cells transfected with 50 nM, 250 nM, 500 nM, 750 nM and 1000 nM of PMO 7.2. The results showed that the expression of APP770 was similar between cells transfected with 50 nM of PMO oligo and control (38.1±2.5% and 41.3±1.4%, respectively), whereas transfection with 250 nM of PMO 7.2 or higher, was sufficient to completely abolish the inclusion of exon 7 from APP751. Interestingly, exon skipping of exon 7 from APP751 required higher concentrations of the PMO (500 nM). Finally, the inventors also noticed that at higher concentrations of the oligonucleotide (1 μM), exon 8 was also excluded, as shown in FIG. 6A, suggesting m again a link between the splicing of exons 7 and 8.

(57) Next, referring to FIG. 6B, the inventors assessed the efficiency of exon 8 exclusion by PMO 8.2. The results showed that complete skipping of exon 8 from APP770 was achieved with transfection of 500 nM of the oligonucleotide. Consistent to previous observations, the inventors noticed again a progressive increase of the relative amount of APP695 rather than the expected APP751 isoform (32.6±2%, 39.8±1.2%, 44.1±1.2%, 47.2±0.9% and 50.38±0.5% with 50 nM, 250 nM, 500 nM, 750 nM and 1000 nM, respectively, for APP695 and 43.12±11.2%, 42.3±10.4%, 51.8±12.5%, 52.8±5.9% and 49.6±4.2% for 50 nM, 500 nM, 750 nM and 1000 nM respectively for APP751). These results suggest that the oligonucleotides that have been designed were efficiently inducing exon skipping of their targets, eliminating the inclusion of exons 7 and 8.

(58) The inventors then went on to examine if a combination of both optimal antisense oligonucleotides, PMOs 7.2 and 8.2, would be effective in inducing the exclusion of both exons. To do so, SH-SY5Y cells were transfected with various concentrations of equimolar concentrations of a combination of PMOs 7.2 and 8.2 and compared the relative levels of APP variants by RT-PCR.

(59) Referring to FIG. 6C, the results showed that the combination of both PMOs induced a concentration-dependent reduction of APP770 (from 14.8±2.7% to 11.7±2.2% at 50 nM, 3.9±3.4% at 100 nM and 0 at higher concentrations) and APP751 (from 37.8±2.3% to 37.5±1.1% at 50 nM, 22.9±1.7% at 100 nM, 3.5±4.9% at 500 nM and 0 at higher concentrations) with a related increase in APP695 (from 47.3±5% to 50.7±3.1% at 50 nM, 73±2.8% at 100 nM, 96.4±4.9% at 500 nM and 100% at higher concentrations).

Example 3

Examination of Protein Concentrations Resulting from Exon Skipping

(60) Having shown that the PMOs that have been designed could effectively induce the skipping of their target exons at the mRNA level, the inventors then examined the protein levels produced by the three mRNA variants to ensure that the exon skipping events at the mRNA level could also be observed at the protein level. To do so, SH-SY5Y cells were transfected with 1 μM of PMO 7.2, PMO 8.2 and their combination for 72 h before lysing and their protein extracts were probed with an antibody detecting all variants of APP.

(61) As shown in FIG. 7, APP770 and APP751 are very similar in size and could not be separated in the western blots (FIG. 7A). They thus measured the relative amount of APP695 over total APP. Their results showed that the shift in APP695 that was detected from the RT-PCRs was also reflected at the protein level. The relative amount of APP695 in cells transfected with PMO 7.2 was significantly increased (77.49±3.7%, p=0.0001, n=3) compared to control and E2 transfected cells (57.7±2.5% and 55±3% respectively). Similarly, in cells transfected with PMO 8.2, the relative amount of APP695 was also increased (72.1±4%, p=0.001, n=3) confirming the previous observations that at the mRNA level, skipping of exon 8 results in an increase of APP695 rather than APP751. Finally, in cells transfected with both PMOs, the relative amount of APP695 over total APP was 86.6±2.8% (p=0.0001, n=3).

Example 4

Modifying Expression of Neprilysin and APP

(62) Referring to FIG. 8, the inventors went on to investigate the treatment of neuroblastoma cells with the designed PMOs, and demonstrated an increase in expression of two candidate marker genes, i.e. Neprilysin (NEP) and APP itself. Neprilysin is a zinc-dependent metalloprotease, which inactivates (i.e. cleaves) several peptides, including amyloid beta (Aβ). It has been suggested that its expression depends on APP695, the small isoform of APP that the inventors are attempting to enrich. Its connection to degrading amyloid beta shows how enriching for APP695 can benefit AD patients. Increase of APP expression has also been associated to APP695 and the results shown in FIG. 8 confirm that another transcriptional target of APP695 responds appropriately when the ratio is shifted. These results demonstrate that the predicted downstream effects are being exhibited by the influence of the PMOs described herein.

Example 5

CRISPR

(63) The inventors envisage the use of the genome editing tool, CRISPR, for modifying the target sequences, as well as introducing insertions/deletions at splice acceptor and donor sites in order to mimic the results exhibited using the PMOs described herein. Furthermore, CRISPR can also be used to (i) try and delete both exons from neuronal cells, or (ii) replace the endogenous gene by a cDNA without exons 7 and 8, using homology-independent targeted integration (HITI). In other words, a “knock-in” of a synthetic gene which lacks exons 7 and 8 could be performed. Alternatively, it is possible to knock-in a mini gene into intron 6-7 that will have a strong splice acceptor site followed by a cDNA of exons 9-18. This would bypass the transcription of exons 7 & 8, and produce the 695cDNA.

(64) Discussion

(65) The results show that modified complementary oligonucleotides (i.e. the PMOs described herein) can be efficiently used to increase the expression of the APP695 mRNA variant in neuroblastoma cells. The primary goal was to design PMOs that would target two alternatively spliced exons of APP, i.e. exons 7 and 8. The inventors designed five PMOs targeting exon 7 and four PMOs targeting exon 8. Two of the designed PMOs were less active in inducing exon skipping of their targets than the others. Two of the most potent PMOs were selected, one for each exon (PMO 7.2 and PMO 8.2), and the inventors showed that it is possible to achieve 100% skipping of the targeted exons even at relatively low concentrations. Moreover, the inventors also showed that the abundancy of APP695 that was observed at the mRNA level was also apparent at the protein level when the optimal PMOs were used in combination.

(66) These data clearly demonstrate that restoration of APP695 levels in vitro using PMOs is feasible, and so one can be optimistic of the implementation of the strategies described herein as a therapeutic approach to AD. In order to be able to use PMOs targeting the brain, significant amounts of PMOs have to be delivered in the brain. Although PMOs do not readily cross the blood brain barrier, several strategies have been described to deliver AONs to the brain overcoming the blood brain barrier that are yet to be tested in human subjects [46-48].

REFERENCES

(67) 1. Vuong, C. K., D. L. Black, and S. Zheng, The neurogenetics of alternative splicing. Nat Rev Neurosci, 2016. 17(5): p. 265-81.

(68) 2. Mills, J. D. and M. Janitz, Alternative splicing of mRNA in the molecular pathology of neurodegenerative diseases. Neurobiology of Aging, 2012. 33(5): p. 1012.e11-1012.e24.

(69) 3. Huang, Y. and L. Mucke, Alzheimer mechanisms and therapeutic strategies. Cell, 2012. 148(6): p. 1204-22.

(70) 4. Muller, U. C., T. Deller, and M. Korte, Not just amyloid: physiological functions of the amyloid precursor protein family. Nat Rev Neurosci, 2017. 18(5): p. 281-298.

(71) 5. Goldgaber, D., et al., Characterization and chromosomal localization of a cDNA encoding brain amyloid of Alzheimer's disease. Science, 1987. 235(4791): p. 877-80.

(72) 6. Tanzi, R. E., et al., Amyloid beta protein gene: cDNA, mRNA distribution, and genetic linkage near the Alzheimer locus. Science, 1987. 235(4791): p. 880-4.

(73) 7. Yoshikai, S., et al., Genomic organization of the human amyloid beta-protein precursor gene. Gene, 1990. 87(2): p. 257-63.

(74) 8. Kang, J., et al., The precursor of Alzheimer's disease amyloid A4 protein resembles a cell-surface receptor. Nature, 1987. 325(6106): p. 733-6.

(75) 9. Shariati, S. A. and B. De Strooper, Redundancy and divergence in the amyloid precursor protein family. FEBS Lett, 2013. 587(13): p. 2036-45.

(76) 10. Tanaka, S., et al., Three types of amyloid protein precursor mRNA in human brain: their differential expression in Alzheimer's disease. Biochem Biophys Res Commun, 1988. 157(2): p. 472-9.

(77) 11. Sandbrink, R., C. L. Masters, and K. Beyreuther, APP gene family. Alternative splicing generates functionally related isoforms. Ann N Y Acad Sci, 1996. 777: p. 281-7.

(78) 12. Weidemann, A., et al., Identification, biogenesis, and localization of precursors of Alzheimer's disease A4 amyloid protein. Cell, 1989. 57(1): p. 115-26.

(79) 13. Moir, R. D., et al., Relative increase in Alzheimer's disease of soluble forms of cerebral Abeta amyloid protein precursor containing the Kunitz protease inhibitory domain. J Biol Chem, 1998. 273(9): p. 5013-9.

(80) 14. Spillantini, M. G., et al., Expression and cellular localization of amyloid beta-protein precursor transcripts in normal human brain and in Alzheimer's disease. Brain Res Mol Brain Res, 1989. 6(2-3): p. 143-50.

(81) 15. Sandbrink, R., C. L. Masters, and K. Beyreuther, APP gene family: unique age-associated changes in splicing of Alzheimer's betaA4-amyloid protein precursor. Neurobiol Dis, 1994. 1(1-2): p. 13-24.

(82) 16. Zhan, S. S., et al., APP with Kunitz type protease inhibitor domain (KPI) correlates with neuritic plaque density but not with cortical synaptophysin immunoreactivity in Alzheimer's disease and non-demented aged subjects: a multifactorial analysis. Clin Neuropathol, 1995. 14(3): p. 142-9.

(83) 17. Willoughby, D. A., et al., Beta-amyloid precursor protein (APP) and APP-RNA are rapidly affected by glutamate in cultured neurons: selective increase of mRNAs encoding a Kunitz protease inhibitor domain. J Mol Neurosci, 1995. 6(4): p. 257-76.

(84) 18. Sandbrink, R., et al., Expression of the APP gene family in brain cells, brain development and aging. Gerontology, 1997. 43(1-2): p. 119-31.

(85) 19. Panegyres, P. K., The effects of excitotoxicity on the expression of the amyloid precursor protein gene in the brain and its modulation by neuroprotective agents. J Neural Transm (Vienna), 1998. 105(4-5): p. 463-78.

(86) 20. Matsui, T., et al., Expression of APP pathway mRNAs and proteins in Alzheimer's disease. Brain Res, 2007. 1161: p. 116-23.

(87) 21. Smith, P., et al., In vivo regulation of amyloid precursor protein neuronal splicing by microRNAs. Journal of Neurochemistry, 2011. 116(2): p. 240-247.

(88) 22. Bordji, K., et al., Activation of Extrasynaptic, But Not Synaptic, NMDA Receptors Modifies Amyloid Precursor Protein Expression Pattern and Increases Amyloid-Production. Journal of Neuroscience, 2010. 30(47): p. 15927-15942.

(89) 23. Palmert, M. R., et al., The beta-amyloid protein precursor of Alzheimer disease has soluble derivatives found in human brain and cerebrospinal fluid. Proc Natl Acad Sci USA, 1989. 86(16): p. 6338-42.

(90) 24. Hyman, B. T., et al., Kunitz protease inhibitor-containing amyloid beta protein precursor immunoreactivity in Alzheimer's disease. J Neuropathol Exp Neurol, 1992. 51(1): p. 76-83.

(91) 25. Belyaev, N. D., et al., The transcriptionally active amyloid precursor protein (APP) intracellular domain is preferentially produced from the 695 isoform of APP in a {beta}-secretase-dependent pathway. J Biol Chem, 2010. 285(53): p. 41443-54.

(92) 26. Ho, L., K. Fukuchi, and S. G. Younkin, The alternatively spliced Kunitz protease inhibitor domain alters amyloid beta protein precursor processing and amyloid beta protein production in cultured cells. J Biol Chem, 1996. 271(48): p. 30929-34.

(93) 27. Goodger, Z.V., et al., Nuclear signaling by the APP intracellular domain occurs predominantly through the amyloidogenic processing pathway. J Cell Sci, 2009. 122(Pt 20): p. 3703-14.

(94) 28. Flammang, B., et al., Evidence that the amyloid-beta protein precursor intracellular domain, AICD, derives from beta-secretase-generated C-terminal fragment. J Alzheimers Dis, 2012. 30(1): p. 145-53.

(95) 29. Nielsen, P. E., et al., Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide. Science, 1991. 254(5037): p. 1497-500.

(96) 30. Govindaraju, T. and V. A. Kumar, Backbone-extended pyrrolidine peptide nucleic acids (bepPNA): design, synthesis and DNA/RNA binding studies. Chem Commun (Camb), 2005(4): p. 495-7.

(97) 31. Egholm, M., et al., PNA hybridizes to complementary oligonucleotides obeying the Watson-Crick hydrogen-bonding rules. Nature, 1993. 365(6446): p. 566-8.

(98) 32. Morita, K., et al., 2′-O, 4′-C-ethylene-bridged nucleic acids (ENA) with nuclease-resistance and high affinity for RNA. Nucleic Acids Res Suppl, 2001(1): p. 241-2.

(99) 33. Gorman, L., et al., Stable alteration of pre-mRNA splicing patterns by modified U7 small nuclear RNAs. Proc Natl Acad Sci USA, 1998. 95(9): p. 4929-34.

(100) 34. Suter, D., et al., Double-target antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human beta-thalassemic mutations. Hum Mol Genet, 1999. 8(13): p. 2415-23.

(101) 35. Dayton, R. D., D. B. Wang, and R. L. Klein, The advent of AAV9 expands applications for brain and spinal cord gene delivery. Expert Opin Biol Ther, 2012. 12(6): p. 757-66.

(102) 36. McCarty, D. M., et al., Mannitol-facilitated CNS entry of rAAV2 vector significantly delayed the neurological disease progression in MPS IIIB mice. Gene Ther, 2009. 16(11): p. 1340-52.

(103) 37. Chiorini, J. A., et al., Cloning and characterization of adeno-associated virus type 5. J Virol, 1999. 73(2): p. 1309-19.

(104) 38. Thompson, J. D., et al., The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res, 1997. 25(24): p. 4876-82.

(105) 39. Thompson, J. D., D. G. Higgins, and T. J. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res, 1994. 22(22): p. 4673-80.

(106) 40. Desmet, F. O., et al., Human Splicing Finder: an online bioinformatics tool to predict splicing signals. Nucleic Acids Res, 2009. 37(9): p. e67.

(107) 41. Zuker, M., Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res, 2003. 31(13): p. 3406-15.

(108) 42. Ding, Y., C. Y. Chan, and C. E. Lawrence, Sfold web server for statistical folding and rational design of nucleic acids. Nucleic Acids Res, 2004. 32(Web Server issue): p. W135-41.

(109) 43. Schindelin, J., et al., Fiji: an open-source platform for biological-image analysis. Nat Methods, 2012. 9(7): p. 676-82.

(110) 44. Popplewell, L. J., et al., Design of phosphorodiamidate morpholino oligomers (PMOs) for the induction of exon skipping of the human DMD gene. Mol Ther, 2009. 17(3): p. 554-61.

(111) 45. Konig, G., C. L. Masters, and K. Beyreuther, Retinoic acid induced differentiated neuroblastoma cells show increased expression of the beta A4 amyloid gene of Alzheimer's disease and an altered splicing pattern. FEBS Lett, 1990. 269(2): p. 305-10.

(112) 46. Alvarez-Erviti, L., et al., Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nat Biotechnol, 2011. 29(4): p. 341-5.

(113) 47. Ding, H., et al., Inhibition of brain tumor growth by intravenous poly (beta-L-malic acid) nanobioconjugate with pH-dependent drug release [corrected]. Proc Natl Acad Sci USA, 2010. 107(42): p. 18143-8.

(114) 48. Rosi, N.L., et al., Oligonucleotide-modified gold nanoparticles for intracellular gene regulation. Science, 2006. 312(5776): p. 1027-30.