Construction of engineering bacteria for high expression of recombinant human serum albumin

Abstract

Provided is a method for the high expression of a recombinant human serum albumin, characterized in comprising the step of co-expressing: (a) a human serum albumin gene, and (b) one or more rHSA expression promoting factor genes in a yeast host cell.

Claims

1. A method for highly expressing recombinant human serum albumin (rHSA) in a yeast host cell, comprising co-expressing a human serum albumin gene, a gene encoding protein disulfide isomerase (PDI), and a gene encoding transcriptional activator HAC1, wherein the yeast host cell is Pichia pastoris.

2. The method according to claim 1, wherein the gene encoding PDI and the gene encoding transcriptional activator HAC1 are introduced into the yeast host cell.

3. The method according to claim 1, wherein the human serum albumin gene is transformed into the yeast host cell by a plasmid.

4. The method according to claim 1, wherein the gene encoding PDI and the gene encoding transcriptional activator HAC1 are transformed into the yeast host cell by one or more plasmids.

5. An engineered yeast that highly expresses recombinant human serum albumin (rHSA) and comprises: a human serum albumin gene, a gene encoding PDI, and a gene encoding transcriptional activator HAC1, wherein the yeast is Pichia pastoris, and wherein the gene encoding PDI and the gene encoding transcriptional activator HAC1 are introduced into the engineered yeast.

6. The engineered yeast according to claim 5, wherein the human serum albumin gene is transformed into the engineered yeast by a plasmid.

7. The engineered yeast according to claim 5, wherein the gene encoding PDI and the gene encoding transcriptional activator HAC1 are transformed into the engineered yeast by one or more plasmids.

8. The method according to claim 1, wherein the gene encoding PDI is transformed into the yeast host cell by a pPICZ vector, and the gene encoding transcriptional activator HAC1 is transformed into the yeast host cell by a pPIC6 vector.

9. The engineered yeast according to claim 5, wherein the gene encoding protein PDI is transformed into the yeast host cell by a pPICZ vector, and the gene encoding transcriptional activator HAC1 is transformed into the yeast host cell by a pPIC6 vector.

10. The engineered yeast according to claim 5, wherein the gene encoding PDI and the gene encoding transcriptional activator HAC1 are integrated into a chromosome of the yeast host cell.

11. A method for highly expressing recombinant human serum albumin (rHSA) in Pichia pastoris, comprising co-expressing a gene encoding rHSA, a gene encoding protein disulfide isomerase (PDI), and a gene encoding transcriptional activator HAC1, wherein co-expressing rHSA, PDI, and HAC1, increases expression of rHSA relative to co-expressing rHSA and PDI alone.

12. The method of claim 1, wherein highly expressing rHSA comprises expressing up to 18.2 grams of rHSA per liter of culture.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a DNA sequence encoding HSA. SEQ ID NO: 13 is shown.

(2) FIG. 2 shows an amino acid sequence of HSA encoded by the DNA sequence shown in FIG. 1. SEQ ID NO: 14 is shown.

(3) FIG. 3 shows a DNA sequence encoding Pichia ERO1. SEQ ID NO: 15 is shown.

(4) FIG. 4 shows an amino acid sequence of ERO1 encoded by the DNA sequence shown in FIG. 3. SEQ ID NO: 16 is shown.

(5) FIG. 5 shows a DNA sequence encoding Pichia HAC1. SEQ ID NO: 17 is shown.

(6) FIG. 6 shows an amino acid sequence of HAC1 encoded by the DNA sequence shown in FIG. 5. SEQ ID NO: 18 is shown.

(7) FIG. 7 shows a DNA sequence encoding Pichia PDI. SEQ ID NO: 19 is shown.

(8) FIG. 8 shows an amino acid sequence of PDI encoded by the DNA sequence shown in FIG. 7. SEQ ID NO: 20 is shown.

(9) FIG. 9 shows a DNA sequence encoding Pichia PPI. SEQ ID NO: 21 is shown.

(10) FIG. 10 shows an amino acid sequence of PPI encoded by the DNA sequence shown in FIG. 9. SEQ ID NO: 22 is shown.

(11) FIG. 11 shows a DNA sequence encoding Pichia KAR2. SEQ ID NO: 23 is shown.

(12) FIG. 12 shows an amino acid sequence of KAR2 encoded by the DNA sequence shown in FIG. 11. SEQ ID NO: 24 is shown.

(13) FIG. 13 shows a rHSA Pichia secretion expression vector.

(14) FIG. 14 shows a pPICZ-ERO1 Pichia expression vector.

(15) FIG. 15 shows a pPIC6-HAC1 Pichia expression vector.

(16) FIG. 16 shows a pPICZ-PD1 Pichia expression vector.

SEQUENCE LISTING

(17) The Sequence Listing is submitted as an ASCII text file in the form of the file named Sequence.txt (40 Kb), which was created on Apr. 11, 2019, which is incorporated by reference herein.

DETAILED DESCRIPTION OF THE INVENTION

(18) The term rHSA expression promoting factor as used herein refers to various protein factors capable of promoting the expression of rHSA, the source of which is not limited to a particular species. Specifically, proteins having molecular chaperone activity, such as KAR2; folding enzymes such as PDI; and transcriptional regulators, such as HAC1 and the like are included.

(19) Specific rHSA expression promoting factors particularly suitable for the present invention include: transcriptional activator HAC1, binding protein KAR2, protein disulfide isomerase (PDI), endoplasmic reticulum oxidoreductase (ERO1), and peptidyl-prolyl cis-trans isomerase (PPI) and the like.

(20) The source of the rHSA expression promoting factor is not limited to a particular species. For example, an rHSA expression promoting factor derived from Saccharomyces cerevisiae, such as PDI, can function well in Pichia.

(21) Those skilled in the art will appreciate that the rHSA expression promoting factor also includes a protein or an active fragment having a substitution, addition or deletion of one or several amino acid residues in amino acid sequence compared to the above expression promoting factor, and having substantially similar biological functions. It may also include modified products, fusion proteins and complexes containing these proteins or active fragments thereof.

(22) Preferably, the rHSA expression promoting factor is derived from the host cell. For example, the rHSA expression promoting factor from Pichia is preferably introduced into Pichia host cell for expression.

(23) Those skilled in the art will appreciate that different combinations of different types of promoting factors can produce different technical effects. For example, the simultaneous addition of the transcriptional regulator HAC1 and the folding enzyme PDI results in better expression of rHSA than PDI alone.

(24) The rHSA expression promoting factor may be introduced alone or in combination.

(25) For example, in some embodiments of the present invention, an rHSA expression promoting factor (including ERO1, HAC1, KAR2, PDI, PPI, etc.) is introduced into a host cell alone, co-expressed with rHSA, and significantly increase the expression. For example, the co-expression of PDI with rHSA results in an increase in the expression level of rHSA by 160% compared to the expression level when no expression promoting factor is used.

(26) In some embodiments of the present invention, the rHSA expression promoting factors may be introduced into a host cell in pairs. For example, the combination of PDI and HAC1 resulted in a nearly two-fold increase in the expression level of rHSA compared to the expression level when no expression-promoting factor is used.

(27) In some embodiments of the present invention, three or more rHSA expression promoting factors may be introduced into a host cell. For example, in a particular embodiment of the present invention, rHSA is co-expressed with three expression promoting factors PDI. PPI and HAC1 in a host cell, significantly increasing the expression level of rHSA.

(28) In some embodiments of the present invention, the inventor cloned the ERO1, HAC1, KAR2, PDI, and PPI genes of Pichia GS115 strain by genetic engineering techniques, and constructed an inducible expression vector. By co-expression of these proteins with rHSA, a variety of combinations were screened to obtain an engineered fungus of yeast with high expression and high efficiency.

EXAMPLES

(29) 1. HSA Cloning and Construction of Expression Vector

(30) The expression vector pPIC9K (purchased from Invitrogen) carries a yeast -factor signal peptide that can be used to secrete and express foreign proteins. The following primers were designed according to the sequence of NM_000477.5 published by GenBank: (the enzyme cleavage sites are underlined)

(31) TABLE-US-00001 HSAForward: (SEQIDNO:1) CCGCTCGAGAAAAGAGACGCTCACAAGAGTGAGGT HSAReverse: (SEQIDNO:2) CCGGAATTCTTATAAGCCTAAGGCAGCTTGACTTGC

(32) The human liver cDNA library was used as a template to carry out polymerase chain reaction (PCR) under specific conditions: denaturation at 94 C. for 3 minutes; denaturation at 94 C. for 30 seconds, annealing at 55 C. for 30 seconds, extension at 72 C. for 2 minutes, a total of 30 cycles; then extension at 72 C. for 10 minutes. The obtained PCR product was enzymatically digested with XhoI and EcoRI, and inserted into the pPIC9K vector to obtain the vector pPIC9K-HSA, and the structure is shown in FIG. 13. The HSA DNA sequence was verified by sequencing and the result is shown in FIG. 1. The corresponding amino acid sequence is shown in FIG. 2.

(33) 2. Construction and Screening of rHSA Yeast Secretion and Expression Strain

(34) In the present invention, Pichia GS115 (purchased from Invitrogen) was used as a host strain, and the pPIC9K-HSA vector was linearized by SalI digestion and electrotransformed into the GS115 strain. Methods for competent preparation and electrotransformation were referred to the literature (James M. Cregg, Pichia Protocols, 2.sup.nd Edition). The insert was integrated into the HIS4 locus of GS115 chromosome, and the transformed strain was subjected to antibiotic enrichment screening using YPD (Yeast extract Peptone Dextrose) solid medium containing 2 mg/mL geneticin (G418) to obtain yeast strain GS115-rHSA capable of secreting rHSA.

(35) 3. Cloning and Vector Construction of Pichia ERO1 Gene

(36) The DNA sequence of the Pichia ERO1 gene was obtained from the NCBI database, and the following primers were designed for gene amplification: (the enzyme cleavage sites are underlined)

(37) TABLE-US-00002 EROForward: (SEQIDNO:3) CGGTTCGAAAGCATGAACCCTCAAATCCCTTT EROReverse: (SEQIDNO:4) GCTGGCGGCCGCTTACAAGTCTACTCTATATGTGG

(38) Using the genomics of Pichia GS115 strain as a template, the ERO1 gene was obtained by PCR, enzymatically digested with both SnaBI and NotI, and inserted into the expression vector pPICZ (purchased from Invitrogen) to obtain the vector pPICZ-ERO1, and the structure is shown in FIG. 14. The ERO1 DNA sequence was verified by sequencing, as shown in FIG. 3. The corresponding amino acid sequence is shown in FIG. 4.

(39) 4. Cloning and Vector Construction of Pichia HAC1 Gene

(40) The DNA sequence of the Pichia HAC1 gene was obtained from the NCBI database, and the following primers were designed for gene amplification: (the enzyme cleavage sites are underlined)

(41) TABLE-US-00003 HACForward: (SEQIDNO:5) CGGTTCGAAACGATGCCCGTAGATTCTTCT HACReverse: (SEQIDNO:6) GCTGGCGGCCGCCTATTCCTGGAAGAATACAAAGTC

(42) Yeast RNA extraction and reverse transcription methods were referred to the literature (J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3.sup.rd Edition). Using the cDNA of Pichia GS115 as a template, the HAC1 gene was obtained by PCR, enzymatically digested with both SnaBI and NotI, and inserted into the expression vector pPIC6 (purchased from Invitrogen) to obtain the vector pPIC6-HAC1, and the structure is shown in FIG. 15. The HAC1 DNA sequence was verified by sequencing and the result is shown in FIG. 5. The corresponding amino acid sequence is shown in FIG. 6.

(43) 5. Cloning and Vector Construction of Pichia PDI Gene

(44) The DNA sequence of the Pichia PDI gene was obtained from the NCBI database, and the following primers were designed for gene amplification: (the enzyme cleavage sites are underlined)

(45) TABLE-US-00004 PPIForward: (SEQIDNO:7) CGGTTCGAAACGATGCAATTAACTGGAATATT PPIReverse: (SEQIDNO:8) GCTGGCGGCCGCTTAAAGCTCGTCGTGAGCGTCTGC

(46) Using the genomics of Pichia GS115 as a template, the PDI gene was obtained by PCR, enzymatically digested with both SnaBI and NotI, and inserted into the expression vector pPICZ (purchased from Invitrogen) to obtain the vector pPICZ-PDI, and the structure is shown in FIG. 16. The PDI DNA sequence was verified by sequencing and the result is shown in FIG. 7. The corresponding amino acid sequence is shown in FIG. 8.

(47) 6. Cloning and Vector Construction of Pichia PPI Gene

(48) The DNA sequence of the Pichia PPI gene was obtained from the NCBI database, and the following primers were designed for gene amplification: (the enzyme cleavage sites are underlined)

(49) TABLE-US-00005 PPIForward: (SEQIDNO:9) CGGTTCGAAACGATGGAATTAACCGCATTGCGCAGC PPIReverse: (SEQIDNO:10) GCTGGCGGCCGCTTACAACTCACCGGAGTTGGTGATC

(50) Using the genomics of Pichia GS115 strain as a template, the PPI gene was obtained by PCR enzymatically digested with both SnaBI and NotI, and inserted into the expression vector pPIC6 (purchased from Invitrogen) to obtain the vector pPIC6-PPI, and the structure is shown in FIG. 17. The DNA sequence was verified by sequencing, and the sequence is shown in FIG. 9. The corresponding amino acid sequence is shown in FIG. 10.

(51) 7. Cloning and Vector Construction of Pichia KAR2 Gene

(52) The DNA sequence of the Pichia KAR2 gene was obtained from the NCBI database, and the following primers were designed for gene amplification: (the enzyme cleavage sites are underlined)

(53) TABLE-US-00006 KAR2Forward: (SEQIDNO:11) CGGTTCGAAACGATGCTGTCGTTAAAACCATCT KAR2Reverse: (SEQIDNO:12) GCTGGCGGCCGCCTATGATCATGATGAGTTGTAG

(54) Using the genomics of Pichia GS115 strain as a template, the KAR2 gene was obtained by PCR, enzymatically digested with both SnaBI and NotI, and inserted into the expression vector pPIC6 (purchased from Invitrogen) to obtain the vector pPIC6-KAR2, and the structure is shown in FIG. 18. The DNA sequence was verified by sequencing, and the sequence is shown in FIG. 11. The corresponding amino acid sequence is shown in FIG. 12.

(55) 8. Construction and Screening of an ERO1 and rHSA Co-Expression Strain

(56) The rHSA secretion and expression strain GS115-rHSA was used as the original strain, and the above constructed pPICZ-ERO1 vector was linearized by SacI digestion and electrotransformed into the GS115-rHSA strain. Methods for competent preparation and electrotransformation were referred to the literature (James M. Cregg, Pichia Protocols, 2.sup.nd Edition). The insert was integrated into the chromosome 5 AOX site of the GS115-rHSA strain. The transformed strain was subjected to antibiotic enrichment screening using YPD solid medium containing 2 mg/mL zeocin to obtain the ERO1 and rHSA co-expression yeast strain GS115-rHSA-ERO1.

(57) 9. Construction and Screening of an HAC1 and rHSA Co-Expression Strain

(58) The rHSA secretion and expression strain GS115-rHSA was used as the original strain, and the pPIC6-HAC1 vector constructed in Example 4 was linearized by SacI digestion and electrotransformed into the GS115-rHSA strain. Methods for competent preparation and electrotransformation were referred to the literature (James M. Cregg, Pichia Protocols, 2.sup.nd Edition). The insert was integrated into the chromosome 5 AOX site of the GS115-rHSA strain. The transformed strain was subjected to antibiotic enrichment screening using YPD solid medium containing 1 mg/mL blasticidin to obtain the HAC1 and rHSA co-expression yeast strain GS115-rHSA-HAC1.

(59) 10. Construction and Screening of a PDI and rHSA Co-Expression Strain

(60) The rHSA secretion and expression strain GS115-rHSA was used as the original strain, and the above constructed pPICZ-PDI vector was linearized by SacI digestion and electrotransformed into the GS115-rHSA strain. Methods for competent preparation and electrotransformation were referred to the literature (James M. Cregg, Pichia Protocols, 2.sup.nd Edition). The insert was integrated into the chromosome 5 AOX site of the GS115-rHSA strain. The transformed strain was subjected to antibiotic enrichment screening using YPD solid medium containing 2 mg/mL zeocin to obtain the PDI and rHSA co-expression yeast strain GS115-rHSA-PDI.

(61) 11. Construction and Screening of a PPI and rHSA Co-Expression Strain

(62) The rHSA secretion and expression strain GS115-rHSA was used as the original strain, and the pPIC6-PPI vector constructed in Example 6 was linearized by PmeI digestion and electrotransformed into the GS115-rHSA strain. Methods for competent preparation and electrotransformation were referred to the literature (James M. Cregg, Pichia Protocols, 2.sup.nd Edition). The insert was integrated into the chromosome 5 AOX site of the GS115-rHSA strain. The transformed strain was subjected to antibiotic enrichment screening using YPD solid medium containing 1 mg/mL blasticidin to obtain the PPI and rHSA co-expression yeast strain GS115-rHSA-PPI.

(63) 12. Construction and Screening of a KAR2 and rHSA Co-Expression Strain

(64) The rHSA secretion and expression strain GS115-rHSA was used as the original strain, and the pPIC6-KAR2 vector constructed in Example 7 was linearized by PmeI digestion and electrotransformed into the GS115-rHSA strain. Methods for competent preparation and electrotransformation were referred to the literature (James M. Cregg, Pichia Protocols, 2.sup.nd Edition). The insert was integrated into the chromosome 5 AOX site of the GS115-rHSA strain. The transformed strain was subjected to antibiotic enrichment screening using YPD solid medium containing 1 mg/mL blasticidin to obtain the KAR2 and rHSA co-expression yeast strain GS115-rHSA-KAR2.

(65) 13. Construction and Screening of an HAC1, PDI and rHSA Co-Expression Strain

(66) The expression strain GS115-rHSA-PDI was used as the original strain, and the above constructed pPIC6-HAC1 vector was linearized by SacI digestion and electrotransformed into the GS115-rHSA-PDI strain. Methods for competent preparation and electrotransformation were referred to the literature (James M. Cregg, Pichia Protocols, 2.sup.nd Edition). The insert was integrated into the chromosome 5 AOX site of the GS115-rHSA-PDI strain. The transformed strain was subjected to antibiotic enrichment screening using YPD solid medium containing 1 mg/mL blasticidin to obtain the HAC1, PDI and rHSA co-expression yeast strain GS115-rHSA-PDI-HAC1.

(67) 14. Construction and Screening of a PPI, PDI and rHSA Co-Expression Strain

(68) The expression strain GS115-rHSA-PDI screened in Example 10 was used as the original strain, and the pPIC6-PPI vector constructed in Example 6 was linearized by PmeI digestion and electrotransformed into the GS115-rHSA-PDI strain. Methods for competent preparation and electrotransformation were referred to the literature (James M. Cregg, Pichia Protocols, 2.sup.nd Edition). The insert was integrated into the chromosome 5 AOX site of the GS115-rHSA-PDI strain. The transformed strain was subjected to antibiotic enrichment screening using YPD solid medium containing 1 mg/mL blasticidin to obtain the PPI, PDI and rHSA co-expression yeast strain GS115-rHSA-PDI-PPI.

(69) 15. Induced Expression of rHSA Co-Expression Strain in Shake Flask

(70) The single colonies of GS115-rHSA-ERO1, GS115-rHSA-HAC1, GS115-rHSA-PDI, GS115-rHSA-PPI, GS115-rHSA-KAR2, GS115-rHSA-PDI-HAC1 and GS115-rHSA-PDI-PPI strains screened in the above examples were separately picked, inoculated into 2 ml of MGY medium (1.34% yeast nitrogen source base; 1.0% glycerol; 4.010.sup.5 biotin), and cultured at 30 C. for 16 hours. After centrifugation, the thalluses were collected and transferred to 20 ml of BMMY medium (1.0% yeast extract: 2.0% peptone; 0.1 M potassium phosphate buffer, pH 6.0; 1.34% yeast nitrogen source base; 0.5% anhydrous methanol) for culture, and induced to express for 72 hours, wherein 50 l of anhydrous methanol was added every 12 hours. After the end of the induction, the culture supernatant was taken for SDS-PAGE electrophoresis (FIG. 19). Compared with the control strain (GS115-rHSA), the expression levels of rHSA were improved in all of the seven co-expression strains. The analysis was performed using Quantity One software, and the expression ratios are shown in Table 1.

(71) TABLE-US-00007 TABLE 1 Strain Expression ratio GS115-rHSA 100% GS115-rHSA-PDI 260% GS115-rHSA-HAC1 210% GS115-rHSA-KAR2 168% GS115-rHSA-PPI 162% GS115-rHSA-ERO1 150% GS115-rHSA-PDI-HAC1 280% GS115-rHSA-PDI-PPI 220%
16. Fermentation of rHSA Co-Expression Strains

(72) GS115-rHSA strain and GS115-rHSA-ERO1, GS115-rHSA-HAC1, GS115-rHSA-PDI. GS115-rHSA-PPI, GS115-rHSA-KAR2, GS115-rHSA-PDI-HAC1 and GS115-rHSA-PDI-PPI strains screened in Example 15 were fermented using 5-liter fermentors, and the fermentation conditions were referred to Pichia Fermentation Process Guidelines published by Invitrogen. The fermentation was terminated after 80 hours of the induced expression, and the culture supernatant was taken to analyze the expression level of rHSA. The results are shown in Table 2. When the fixed fermentation time was 80 hours, the expression level of rHSA in the co-expression strain was significantly increased, up to 18.2 g/L of fermentation supernatant, which laid a foundation for large-scale industrial production of rHSA.

(73) TABLE-US-00008 TABLE 2 Strain Maximum expression (g/L) GS115-rHSA 5.98 GS115-rHSA-PDI 16.9 GS115-rHSA-HAC1 12.6 GS115-rHSA-KAR2 10.0 GS115-rHSA-PPI 9.7 GS115-rHSA-ERO1 8.9 GS115-rHSA-PDI-HAC1 18.2 GS115-rHSA-PDI-PPI 13.1