MICROBIAL METHOD FOR REPRODUCING THE HUMAN UROLITHIN METABOTYPES IN VITRO AND IN VIVO

20250327022 · 2025-10-23

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a new bacterial strain and a new urolithin named urolithin G. The new strain of the invention is Enterocloster bolteae CEBAS S4A9 DSM 34392 and can customize urolithin production to mimic metabotype A and metabotype B in vitro and in vivo if combined with at least one bacterial strain belonging to the Gordonibacter and/or Ellagibacter and/or Slackia genera. The invention also refers to methods or uses of E. bolteae CEBAS S4A9 DSM 34392 or the consortium that comprises E. bolteae CEBAS S4A9 DSM 34392 and at least one bacterial strain belonging to the Gordonibacter and/or Ellagibacter and/or Slackia genera for producing urolithins. The invention also refers to compositions or food products that contain E. bolteae CEBAS S4A9 DSM 34392, the aforementioned consortium, or the new urolithin G.

    Claims

    1. A bacterial strain belonging to the Enterocloster genus that produces urolithins, wherein said strain is Enterocloster bolteae CEBAS S4A9 DSM 34392 in the form of a living or an inactivated cell.

    2. A culture or a lysate of the bacterial strain, according to claim 1.

    3. The in vitro use of the bacterial strain, according to claim 1, or the culture or lysate according to claim 2, for producing urolithins.

    4. The use, according to claim 3, wherein the production of urolithins is carried out starting from a first urolithin as raw material, wherein the first urolithin is urolithin M5 and the produced urolithin is urolithin D or E; or the first urolithin is urolithin M6 and the produced urolithin is M7; or the first urolithin is D and the produced urolithin is G; or the first urolithin is C, and the produced urolithin is A, or the first urolithin is isourolithin A and the produced urolithin is urolithin B wherein the urolithin G is a urolithin represented by the formula (I): ##STR00007##

    5. A urolithin-producing bacterial consortium that comprises: a. The bacterial strain, according to claim 1, or the culture or lysate according to claim 2 and, b. At least another living or inactivated bacterial strain belonging to the Gordonibacter and/or Ellagibacter and/or Slackia genera; or a culture or lysate of a bacterium belonging to the Gordonibacter and/or Ellagibacter and/or Slackia genera.

    6. The urolithin-producing bacterial consortium, according to claim 5, wherein: The bacterial strain belonging to the Gordonibacter genus is a bacterium belonging to Gordonibacter urolithinfaciens, Gordonibacter pamelaeae, and/or Gordonibacter massiliensis; and/or, The bacterial strain belonging to the Ellagibacter genus is a bacterium belonging to Ellagibacter isourolithinifaciens; and/or, The bacterial strain belonging to the Slackia genus is a bacterium belonging to Slackia heliotrinireducens.

    7. The urolithin-producing bacterial consortium according to claim 5 or 6, wherein the bacterial strain belonging to Gordonibacter is selected from Gordonibacter urolithinfaciens DSM27213, Gordonibacter pamelaeae DSM19378 and Gordonibacter 28C.

    8. The urolithin-producing bacterial consortium according to any of claims 5 to 7, wherein the bacterial strain belonging to Ellagibacter is Ellagibacter isourolithinifaciens DSM 104140.

    9. The urolithin-producing bacterial consortium according to any of claims 5 to 8, wherein the bacterial strain belonging to Slackia is Slackia heliotrinireducens DSM 20476.

    10. The in vitro use of the urolithin-producing bacterial consortium according to any of claims 5 to 9 for the production of urolithins from a raw material.

    11. The in vitro use according to claim 10, wherein the raw material comprises urolithin M5, ellagic acid, and/or ellagitannins.

    12. The use, according to claim 10 or 11, wherein the produced urolithins belong to the metabotype A when the urolithin-producing bacterial consortium comprises a) the bacterial strain according to claim 1 or the culture or lysate according to claim 2, and b) at least a living or inactivated bacterial strain belonging to the Gordonibacter genus or a culture or lysate of the bacterium belonging to the Gordonibacter genus; wherein the produced urolithin of the metabotype A are urolithin D, urolithin E, urolithin M6, urolithin C, urolithin G, urolithin M7 and/or urolithin A.

    13. The use, according to claim 10 or 11, wherein the produced urolithins belong to the metabotype B when the urolithin-producing bacterial consortium comprises a) the bacterial strain, according to claim 1, or the culture or lysate, according to claim 2, and b) at least a living or inactivated bacterial strain belonging to the Ellagibacter genus or a culture, lysate of the bacterium belonging to the Ellagibacter genus; wherein the produced urolithins of the metabotype B are urolithin C, urolithin G, urolithin M7, isourolithin A, urolithin A and/or urolithin B.

    14. The use according to claim 13, wherein the urolithin-producing bacterial consortium further comprises c) at least a living or inactivated bacterial strain belonging to the Slackia genus or a culture or lysate of the bacterium belonging to the Slackia genus.

    15. The use, according to claim 10 or 11, wherein the produced urolithins belong to the metabotype B when the urolithin-producing bacterial consortium comprises a) the bacterial strain, according to claim 1, or the culture or lysate, according to claim 2, and b) at least a living or inactivated bacterial strain belonging to the Gordonibacter genus or a culture or lysate of these bacteria, and c) at least a living or inactivated bacterial strain belonging to the Slackia genus or a culture or lysate of the bacterium belonging to the Slackia genus; wherein the produced urolithins of the metabotype B are urolithin C, urolithin G, urolithin M7, isourolithin A, urolithin A and/or urolithin B.

    16. A pharmaceutical composition, nutritional composition, beverage, dietary supplement, probiotic composition, postbiotic composition, food additive, and/or food that comprises the bacterial strain, according to claim 1; or the culture or lysate according to claim 2, the urolithin producing bacterial consortium according to any of claims 5 to 9, the urolithin G represented by the formula (I) according to claim 20, or a combination of urolithin G represented by the formula (I) according to claim 20 and at least one urolithin selected from the list consisting of urolithin M5, urolithin E, urolithin M6, urolithin D, urolithin C, urolithin M7, urolithin A, isourolithin A and/or urolithin B.

    17. The bacterial strain, according to claim 1, the culture or lysate according to claim 2, the urolithin-producing bacterial consortium according to any of claims 5 to 9, the pharmaceutical composition, nutritional composition, beverage, dietary supplement, probiotic composition, postbiotic composition, food additive and/or food, according to claim 16, the urolithin G represented by the formula (I), according to claim 20, or a combination of urolithin G represented by the formula (I) according to claim 20 and at least one urolithin selected from the list consisting of urolithin M5, urolithin E, urolithin M6, urolithin D, urolithin C, urolithin M7, urolithin A, isourolithin A and urolithin B, for the use as a medicament.

    18. The bacterial strain, according to claim 1, the culture or lysate according to claim 2, the urolithin producing bacterial consortium according to any of claims 5 to 9; or the pharmaceutical composition, nutritional composition, beverage, dietary supplement, probiotic composition, postbiotic composition food additive and/or food, according to claim 16, for the use in the treatment of human individuals and/or animals with the incapacity of producing urolithins.

    19. The bacterial strain, the culture or lysate, the urolithin producing bacterial consortium or the pharmaceutical composition, nutritional composition, beverage, dietary supplement, probiotic composition, postbiotic composition food additive and/or food, for the use according to claim 18, in the treatment and/or prevention of a disease or a condition selected from a muscle disease or a neuromuscular disease, a metabolic disorder, a neurological disorder, metabolic disorder and cancer.

    20. Urolithin G, represented by the formula (I): ##STR00008##

    21. The urolithin G, according to claim 20, or a combination of urolithin G represented by the formula (I) according to claim 20 and at least one urolithin selected from the list consisting of urolithin M5, urolithin E, urolithin M6, urolithin D, urolithin C, urolithin C, urolithin M7, urolithin A, isourolithin A and urolithin B, for the use in the treatment and/or prevention of a disease or a condition selected from muscle disease or a neuromuscular disease, a metabolic disorder, a neurological disorder, metabolic disorder or cancer; preferably wherein the muscle disease or neuromuscular disease is selected form myopathy, a muscular dystrophy, Duchenne muscular dystrophy, acute sarcopenia or muscle atrophy and/or cachexia associated with burns, bed rest, limb immobilization, or major thoracic, abdominal, orthopedic surgery; preferably wherein the neurological disorder or neurodegenerative disease is selected from Alzheimer's disease or Parkinson's disease; preferably wherein the metabolic disorder is selected from obesity, diabetes mellitus, cardiovascular disease, hyperlipidemia, hypertriglyceridemia, elevated free fatty acids or metabolic syndrome; preferably wherein cancer is selected from a sarcoma, a melanoma, a squamous cell carcinoma of the mouth, throat, larynx, or lung, a genitourinary cancer selected from cervical or bladder cancer, a hematopoietic cancer, a head and neck cancer, a nervous system cancer, prostate cancer, pancreatic cancer or colon cancer.

    Description

    DESCRIPTION OF THE DRAWINGS

    [0109] FIG. 1. HPLC-DAD chromatogram of in vitro metabolism of ellagic acid (EA) by (A) G. urolithinfaciens DSM 27213 and the strain of the invention, which mimics the urolithin metabotype A (UM-A) and by (B) E. isourolithinifaciens DSM 104140.sup.T and the strain of the invention (Enterocloster bolteae CEBAS S4A9=DSM 34392) co-culture, which mimics the urolithin metabotype B (UM-B). 1: Uro-M5; 2: Uro-D; 3: Uro-E; 4: EA; 5: Uro-M6; 6: Uro-C; 7: Uro-G; 8: Uro-M7; 9: IsoUro-A; 10: Uro-A; 11: Uro-B.

    [0110] FIG. 2. Time-course production of urolithins (Uros) from ellagic acid (EA). (A) Metabolism of EA by G. urolithinfaciens DSM27213.sup.T and the strain of the invention (Enterocloster bolteae CEBAS S4A9=DSM 34392) co-culture. (B) Metabolism of EA by E. isourolithinifaciens DSM 104140 and the strain of the invention co-culture.

    [0111] FIG. 3. .sup.1H NMR spectrum of urolithin G (3,4,8-trihydroxy urolithin).

    [0112] FIG. 4. In vivo metabolism of EA to urolithins and intestinal colonization of the gut bacterial consortia orally administered to rats from group A (FIG. 4A and FIG. 40), group B (FIG. 4B and FIG. 4E), and control group (FIG. 4C and FIG. 4F). The results represent the mean of 6 rats (3 males and 3 females) at different time points.

    EXAMPLES

    Example 1. Isolation of a New Urolithin-Producing Bacterium from Human Feces

    [0113] A healthy female donor (aged 30), who previously demonstrated to produce Uros in vivo, provided the stool samples. After 1/10 (w/v) fecal dilution in nutrient broth (Oxoid, Basingstoke, Hampshire, UK) supplemented with 0.05% L-cysteine hydrochloride (PanReac Quimica, Barcelona, Spain), the filtrated was homogenized and further diluted in Wilkins-Chalgren anaerobe medium (WAM, Oxoid). The metabolic activity was evaluated by first dissolving 15 M Uro-C (Dalton Pharma Services) in propylene glycol (PanReac Quimica SLU, Barcelona, Spain) and then adding it to the broth. After anaerobic incubation, a portion of the culture, having metabolic activity, was seeded on WAM agar. Approximately 200 colonies were collected and inoculated into 5 mL of WAM containing 15 M Uro-C, and after incubation, their capacity to convert Uro-C was assayed. Uro-C-transforming colonies were sub-cultured until single strains were isolated. The isolation procedure and plate incubation were achieved in an anaerobic chamber (Concept 400, Baker Ruskin Technologies Ltd., Bridgend, South Wales, UK) at 37 C. As explained below, samples (5 mL) were prepared for HPLC-DAD-MS analyses of urolithins. Pure bacterial cultures of the strain CEBAS S4A9 were isolated, which showed the capacity to metabolize Uro-C.

    [0114] The strain CEBAS S4A9 was phylogenetically identified. The almost-complete 16S rRNA gene sequence of the isolated bacterial strain (strain CEBAS S4A9) and the phylogenetic analysis were achieved as previously described (Beltran et al., 2018, Int. J. Syst. Evol. Microbiol. 68, 1707-1712)

    [0115] The phylogenetic tree, including the isolated strain CEBAS S4A9 and the most closely related species and known Uros-producing genera (Gordonibacter and Ellagibacter), were constructed using the Neighbor-joining treeing method as previously described (Selma et al., 2017, Front. Microbiol. 8, 1-8).

    [0116] The closest relatives of the strain CEBAS S4A9 are E. bolteae DSM15670.sup.T (99.8% 16S rRNA gene sequence similarity), E. asparagiformis DSM15981.sup.T (98.0%), E. citroniae DSM19261.sup.T (97.0%), and E. clostidioformis DSM933.sup.T (97.7%). A higher distance was observed with other known Uros-producing bacteria in the phylogenetic tree, i.e., G. pamelaeae DSM 19378.sup.T (80.9%), Gordonibacter urolithinfaciens DSM 27213.sup.T (78.2%), and Ellagibacter isourolithinifaciens DSM104140.sup.T (80.0%). The comparison of the 16S rRNA gene sequence of the strain showed that the isolate belongs to the Enterocloster bolteae species (99.8% similarity with the type strain E. bolteae DSM 15670) from the family Lachnospiraceae. Therefore, the strain CEBAS S4A9 is Enterocloster bolteae CEBAS S4A9. The strain E. bolteae CEBAS S4A9 was received on Sep. 26, 2022, for patent deposit according to the Budapest Treaty, at DSMZDeutsche Sammlung von Mikroorganismen und Zellkulturen GmbH.

    Example 2. Conversion Testing of EA and Intermediary Uros

    [0117] The isolated strain E. bolteae CEBAS S4A9 DSM 34392 and representative strains of the closest relatives (Enterocloster bolteae DSM 29485, DSM 15670.sup.T Enterocloster asparagiformis DSM 15981.sup.T, Enterocloster citroniae DSM 19261.sup.TEnterocloster clostidioformis DSM933.sup.T), obtained from DSMZ culture collection, were used to investigate their capacity to produce final Uros in the presence of EA and other Uro intermediaries. Briefly, isolated and DSMZ strains were separately incubated on the WAM agar plate for 6 days. A single colony was cultivated in a 5 mL WAM tube. Two milliliters of diluted inoculum were transferred to WAM (20 mL), obtaining an initial load of 10.sup.4 CFU/mL. EA, Uro-M6, Uro-D, Uro-C, Uro-A, IsoUro-A, and Uro-B were dissolved in propylene glycol and added to the 20 mL cultures to obtain a final concentration of 15 M each.

    [0118] After incubation in an anoxic environment at 37 C., aliquots (5 mL) were taken for HPLC analyses. The HPLC-MS analyses showed that, in contrast to G. urolithinfaciens and E. isourolithinifaciens, the isolate CEBAS S4A9 or the closest relatives (E. bolteae DSM 29485, DSM15670.sup.T, E. asparagiformis DSM15981.sup.T, E. citroniae DSM19261.sup.T, E. clostidioformis DSM933.sup.T) did not metabolize EA (Table 1). However, all the Enterocloster species tested, except E. clostidioformis DSM933.sup.T metabolized Uro-M6 to other Uros, such as Uro-A, via Uro-M7. Table 1 shows the specific Uros produced by each microbial species after incubation with the different precursors. G. urolithinfaciens and E. isourolithinifaciens also transformed Uro-M6, but G. urolithinfaciens rendered Uro-C, whereas E. isourolithinifaciens produced IsoUro-A via Uro-C. Uro-D was also transformed by most of the Enterocloster species tested, rendering a novel trihydroxy urolithin described below and named Urolithin G (Uro-G). In contrast, G. urolithinfaciens transformed Uro-D into Uro-C, whereas E. isourolithinifaciens transformed Uro-D into IsoUro-A via Uro-C (Table 1).

    TABLE-US-00001 TABLE 1 Main metabolites produced and the yield (%) after incubating bacterial strains and co-culture with EA and Uros. EA Uro-M6 Uro-D Uro-C IsoUro-A Strain E. bolteae Uro-M7 Uro-G Uro-A Uro-B CEBAS S4A9 DSM (100%) (99.4%) (100%) (99.6%) 34392 E. bolteae DSM Uro-M7 Uro-A 15670.sup.T (100%) (100%) E. bolteae DSM 29485 Uro-M7 Uro-G Uro-A Uro-B (100%) (52%) (100%) (81%) E. asparagiformis Uro-A Uro-G Uro-A Uro-B DSM 15981.sup.T (100%) (48%) (100%) (68%) E. citroniae DSM Uro-A Uro-G Uro-A Uro-B 19261.sup.T (100%) (53%) (100%) (19%) E. clostidioformis DSM 933.sup.T G. urolithinfaciens Uro-M5, Uro-C Uro-C DSM 27213.sup.T Uro-M6, (100%) (54%) Uro-C E. isourolithinifaciens Uro-M5, Uro-C Uro-C IsoUro-A DSM 104140.sup.T Uro-M6, (100%) (100%) (100%) Uro-C, IsoUro-A S. heliotrinireducens IsoUro-A DSM 20476.sup.T (100%)

    [0119] Most of the Enterocloster species tested completely transformed Uro-C into Uro-A except E. clostidioformis which gave negative reactions for Uros production. E. isourolithinifaciens and S. heliotrinireducens also transformed Uro-C, but into IsoUro-A. Unlike S. heliotrinireducens, E. isourolithinifaciens, and G. urolithinfaciens, the Enterocloster species further converted IsoUro-A into Uro-B. Interestingly, the type strain of E. bolteae neither transformed IsoUro-A into Uro-B, unlike the other strains of E. bolteae tested (CEBAS S4A9 and DSM 29485) (Table 1). None of these bacterial strains metabolized Uro-A or Uro-B (as reported previously, all metabolites were identified by direct comparison (UV spectra and MS) with standards and confirmed by their spectral properties and molecular mass (Garcia-Villalba et al., 2013, J. Agric. Food Chem. 61, 8797-8806).

    Example 3. In Vitro Conversion of EA with Gut Bacterial Consortia to Reproduce UMs

    [0120] Gordonibacter urolithinfaciens DSM 27213.sup.T, Ellagibacter isourolithinifaciens DSM 104140.sup.T obtained from DSMZ culture collection, and E. bolteae CEBAS S4A9 DSM 34392 were cultivated anaerobically in 5 mL WAM tubes. First, 2 mL of a diluted aliquot of G. urolithinfaciens and E. bolteae CEBAS S4A9 DSM 34392 (consortium 1) were transferred to WAM (100 mL), obtaining initial loads of 10.sup.4 CFU/mL. Similarly, 2 mL of diluted aliquots of E. isourolithinifaciens and E. bolteae CEBAS S4A9 DSM 34392 (consortium 2) were transferred to WAM (100 mL), obtaining initial loads of 10.sup.4 CFU/mL. Next, EA dissolved in propylene glycol was added to the 100 mL cultures to obtain a final concentration of 25 M. Then, during incubation in an anoxic environment at 37 C., aliquots (5 mL) were taken for HPLC analyses as described below. Incubations were made in triplicate, and the experiment was repeated twice.

    [0121] For the HPLC-DAD-MS analyses, aliquots (5 mL) collected during the incubation of single and combined bacterial strains were extracted and analyzed by HPLC-DAD-ESI-Q (MS). Briefly, the fermented medium (5 mL) was extracted with ethyl acetate (5 mL) (Labscan, Dublin, Ireland), acidified with 1.5% formic acid (Panreac), vortexed for 2 minutes, and centrifuged at 3500 g for 10 min. The organic phase was separated and evaporated, and the dry samples were then re-dissolved in methanol (250 L) (Romil, Barcelona, Spain). An HPLC system (1200 Series, Agilent Technologies, Madrid, Spain) equipped with a photodiode-array detector (DAD) and a single quadrupole mass spectrometer detector in series (6120 Quadrupole, Agilent Technologies, Madrid, Spain) was used. Calibration curves were obtained for EA, Uro-M6, Uro-D, Uro-C, Uro-A, Uro-B, and IsoUro-A with good linearity (R.sup.2>0.998).

    [0122] The in vitro co-culture of G. urolithinfaciens and E. bolteae CEBAS S4A9 DSM 34392 strains (consortium 1) and that of E. isourolithinifaciens and E. bolteae CEBAS S4A9 DSM 34392 strains (consortium 2) were followed to study their Uros-production patterns (FIG. 1). HPLC-DAD chromatogram after 15 h incubation showed the production of Uro-M5, Uro-D, Uro-E, Uro-M6, Uro-C, Uro-G, Uro-M7, and Uro-A from EA by the bacterial consortium 1 (potential UM-A reproducer) (FIG. 1A). In the case of the bacterial consortium 2 (potential UM-B reproducer), the HPLC-DAD chromatogram showed the production of Uro-M5, Uro-C, Uro-G, Uro-M7, IsoUro-A, Uro-A, and Uro-B from EA (FIG. 1B). Uro-E and the novel Uro-G were quantified with the Uro-M7 standard, whereas Uro-M5 was quantified with Uro-M6 as there were no available standards for these urolithins.

    [0123] When EA was incubated with consortium 1 (potential UM-A reproducer), Uros started to be detected after 15 h incubation (FIG. 2A). Uro-M6 and Uro-E (tetrahydroxy-urolithins) also appeared at 15 h with a concentration of 3.34 and 0.21 M, respectively (FIG. 2A). Regarding trihydroxy-urolithins, Uro-C also peaked after 15 h. Uro-M7 started to be detected after 15 h incubation and then progressively decreased. Concerning dihydroxy-urolithins, only Uro-A was detected, reaching a maximum concentration of 18.71 M (FIG. 2A). Most EA disappeared on the third day of incubation, with remaining unmetabolized EA concentrations in the medium lower than 0.06 M after 5 days (FIG. 2A). When EA was incubated with consortium 2 (potential UM-B reproducer), EA started to be converted to Uro-M7 and Uro-C via Uro-M5 and Uro-M6. The maximum Uro-M7, Uro-C, and Uro-G concentrations were achieved at 19 h. Then, a plateau was maintained but only in the case of Uro-C. Uro-A started to be detected after 15 h incubation and reached a concentration of 23.4 M (FIG. 2B). Similarly, IsoUro-A and Uro-B started to be detected after 15 h. Most EA was metabolized, and no EA was detected after 7 days (FIG. 2B).

    Example 4. Isolation of the New Urolithin (urolithin G) and .SUP.1.H NMR Analysis

    [0124] During the experiments of example 3, one of the chromatographic peaks, identified as an unknown Uro, was isolated by analytical HPLC with a semipreparative purpose as previously described (Garcia-Villalba et al., 2013, J. Agric. Food Chem. 61, 8797-8806).

    [0125] The new peaks identified at 305 nm were manually collected. After five injections, the samples collected were taken to dryness in a speed vacuum concentrator, and the residue was re-dissolved in 500 L of deuterated acetonitrile (ACN-d3) for nuclear magnetic resonance (NMR) analysis as previously described (Garcia-Villalba et al., 2019). The isolated new trihydroxy-urolithin was analyzed by .sup.1H NMR (500 MHz ACN-d3) with chemical shift values (6) in ppm: 48 (d; 1H, J.sub.H1-H.sub.2=8.2 Hz, H1); 6.82 (d, 1H, J.sub.H2-H1=8.20 Hz, H2); 7.61 (d, 1H, J.sub.H7-H-9=2.2 Hz, H7); 7.33 (dd, 1H, J.sub.H9-H10=8.53 Hz, J.sub.H9-H7=2.2 Hz, H9); 8.03 (d, H, J.sub.H10-H9=8.5 Hz, H1), (FIG. 3).

    [0126] The unknown trihydroxy urolithin ([M-H].sup. at m/z 243) showed a Rt at 12.58 min that did not coincide, under the same assay conditions, with the already known trihydroxy urolithins, Uro-C(Rt 12.44 min) and Uro-M7 (Rt 13.59 min) (FIG. 1), suggesting a new metabolite (peak 7 in FIGS. 1A and 1B). UPLC-QTOF-MS analyses showed a molecular formula of C.sub.13H.sub.8O.sub.5 with a score of 98.57 and an error of 1.47 for that metabolite. Its MS-MS fragments were similar to those of Uro-M7. The observed NMR spectrum for compound 7 was consistent with the reported spectra of trihydroxy urolithins (Garcia-Villalba et al., 2019, J. Agric. Food Chem. 67, 11099-11107).

    Example 5. In Vivo Administration of Consortia of Urolithin-Producing Bacteria

    [0127] Gordonibacter urolithinfaciens DSM 27213.sup.T, Ellagibacter isourolithinifaciens DSM 104140.sup.T (110.sup.7 CFU/mL) obtained from DSMZ culture collection, and E. bolteae CEBAS S4A9 DSM 34392 (219 CFU/mL) were cultivated anaerobically in Wilkins-Chalgren anaerobe medium (WAM, Oxoid) tubes at 37 C. for 48 h in a Concept 400 anaerobic chamber (Baker Ruskin Technologies Ltd., Bridgend, South Wales, UK) and resuspended in PBS supplemented with 10% of glycerol and 0.05% L-cysteine hydrochloride (PanReac Quimica, Barcelona, Spain). After anaerobic incubation, consortia were prepared as described before in example 3. Briefly, bacterial consortium A consisted of 1:1 (v/v) of G. urolithinfaciens and E. bolteae CEBAS S4A9 DSM 34392 cultures; bacterial consortium B consisted of 1:1 (v/v) E. isourolithinifaciens and E. bolteae CEBAS S4A9 DSM 34392 cultures, and the control cocktail consisted of sterile PBS with 10% glycerol and 0.05% L-cysteine hydrochloride. All cocktails were distributed in aliquots of 3.5 mL and frozen at 80 C.

    [0128] Uros-non-producing Wistar rats (n=18; female=9, male=9) weighing 24031 g were provided by the Animal Experimentation Centre of the University of Murcia (Spain). Three groups (A, B, and C) were formed by randomly assigning 6 animals each (3 female and 3 male rats) per group. Each rat group was housed in two different cages, dividing animals by sex, in a room with a temperature-controlled environment (222 C.), 5510% relative humidity, and a controlled light-dark cycle (12 h). The rats received a standard chow (Panlab, Barcelona, Spain) containing (%/100 g fresh weight) 14.5% proteins, 63.9% carbohydrates and 4% fat (3.2 kcal/g), 4.6% fiber and 13% moisture, supplemented with EA (3.6 mg/100 g of chow). EA was mixed homogenously with ground standard feed and re-pelleted. The EA-enriched diet was stored away from moisture and light. The EA dose given to the rats in the diet was approximately 0.72 mg/rat/day diet (EA 1 diet), equivalent to 41 mg/human/day following the HED (human equivalent dose) formula. All groups were fed the EA 1 diet and tap water ad libitum throughout the experiment (6 weeks). At week 3, an extra dose of 1.5 mg EA/rat/day dissolved in water was oral-gavaged to the animals (EA 3 diet). Finally, at week 4, animals returned to the EA 1 diet plus 5 g walnuts per rat/day, and this was maintained until the end of the study. Weight and food and water intake were measured every week.

    [0129] Group A received oral gavage of 500 L of bacterial consortium A. Group B received 500 L of bacterial consortium B, and Group C (control) received 500 L of PBS. Oral gavages were performed every 2 days during the first two weeks and every weekday during the next 2 weeks. The last week (from day 28 to 35) was a washout week, and the animals were not given oral gavage. Animals were sacrificed with carbon dioxide, and organs were collected and weighed after sacrifice.

    [0130] Fecal samples (0.2-0.5 g) were extracted, in a proportion of 1:10, with a solution of MeOH/H.sub.2O (80/20), acidified with 0.1% HCl and homogenized by vortexing for 2 min and shaking them at 1500 rpm at room temperature for 10 min in a thermoblock. The suspension was centrifugated at 14,000 g at 4 C. for 10 min, and the supernatant was filtered through a 0.22 m PVDF membrane filter (Millipore Corp., Bedford, MA) and diluted 3 with MeOH (0.1% formic acid) before injection in UPLC-ESI-QTOF-MS system. A UPLC system (Agilent 1290 Infinity) coupled to a Quadrupole time-of-flight (QTOF) (6550 Accurate-Mass) (Agilent Technologies, Waldbronn, Germany) was used to analyze the fecal samples for metabolites detection. Briefly, a Poroshell 120 EC-C18 reverse-phase column was used for metabolite separation using a gradient mode with HPLC-grade water as mobile phase A and acetonitrile as mobile phase B, both acidified with 0.1% formic acid. The flow rate was 0.4 mL/min, and 5 L the injection volume. MassHunter Qualitative Analysis software (version B.1, Agilent Technologies, Waldbronn, Germany) was used to process the data.

    [0131] Data are expressed as meanstandard deviation (SD). Statistical analysis was performed with SPSS Software version 27.0 (SPSS Inc., Chicago, IL, USA), and differences with p<0.05 were considered statistically significant. Data normality was evaluated with the Shapiro-Wilk test. Comparisons between different treatment groups were carried out using repeated measured analysis of variance (ANOVA) with Bonferroni's or Dunnett's T3 post hoc test, depending on whether the data presented a normal or non-normal distribution, respectively. Pearson correlation was used to analyze possible associations between variables when data distribution was normal, while Spearman correlation was applied in non-normal data distribution. Data plots were performed using Sigma Plot 14.5 (Systat Software, San Jose, CA, USA).

    [0132] The Uro analysis in feces showed that initially (TO), the rats did not produce Uros after ingesting EA powder (FIGS. 4A, 4B, 4C). However, after administering the bacterial consortia A (FIG. 4A) and B (FIG. 4B), rats became capable of producing Uros. During the first three weeks, when the rats from groups A and B only ingested EA powder, the detection of Uros (range: 0-1.43 g/g) and their EA precursor (range: 0.07-4.54 g/g) in feces was low. However, from day 21, when the consumption of walnuts started as a second EA source, there was a very significant increase in fecal EA (FIGS. 4A, 4B, 4C) and Uros production in group A (FIG. 4A) and B (FIG. 4B). Moreover, differences in the Uro profile were observed between groups A and B. In group A, fecal Uro-C, Uro-M6, Uro-M7, and the final metabolite Uro-A were predominant. In contrast, in group B, the three final Uros (Uro-A, Uro-B, and IsoUro-A) were present, whereas the intermediates were scarce. However, a higher fecal concentration of the recently described Uro-G was detected in group B than in group A. In addition, the Uro-B concentration was lower than Uro-A and IsoUro-A in group B. Furthermore, Uro-A and IsoUro-A, but not Uro-B, were produced in all rats of group B (FIG. 4B). When walnuts were added to the diet of control rats (group C) on day 21, a higher fecal concentration of EA was also observed than before walnut consumption, where fecal EA concentration was scant (FIG. 4C). However, neither EA powder intake nor walnut consumption promoted the production of Uros in the gut of control rats (i.e., with no bacterial consortia).

    [0133] The levels of Uros-producing bacteria in the fecal samples of rats were also analyzed.

    [0134] DNA extraction from fecal samples was performed with the NucleoSpin Tissue DNA Purification Kit (Macherey-Nagel, Germany). DNA was then quantified through Fluorimetry (Qubit 3.0ThermoFisher Scientific, UK) and Spectrophotometry (NanoDropThermoFisher Scientific, UK). The primers and probe designed for detecting and quantifying Ellagibacter and Enterocloster are shown in Table 2. RTi-PCR was performed using an ABI 7500 sequence detection system. Final concentrations of each primer and probe of 300 and 375 nM for the Ellagibacter genus and 200 and 500 nM for the Enterocloster genus, respectively, were used. A conventional RTi-PCR protocol was carried out for the DNA amplification of the Enterocloster genus. The ramping profile was 1 cycle at 95 C. for 5 min, followed by 40 cycles of 95 C. for 15 s, 65 C. for 40 s, and 72 C. for 31 s. Finally, 1 cycle at 72 C. for 5 min was added.

    TABLE-US-00002 TABLE2 TaqManprimersandprobefordetectingandquantifyingtheGordonibacter genusandthenoveldesignedsetsfordetectingandquantifyingtheEllagibacterand Enteroclostergenera. Primer SEQID Oligonucleotidesequence5-3 Gordonibacter SEQIDNO.1 GGCTCGAGTTTGGTAGAGGAAGAT Forward Gordonibacter SEQIDNO.2 GGCCCAGAAGACTGCCTT Reverse Gordonibacter SEQIDNO.3 6FAM- Probe AATTCCCGGTGTAGCGGTGGAATGC-BBQ Ellagibacter SEQIDNO.4 GCTAGGTGTGGGGAAAC Forward Ellagibacter SEQIDNO.5 CTCAAAGGAATTGACGG Reverse Ellagibacter SEQIDNO.6 6FAM-TACGGCGGCAACGC-BBQ Probe Enterocloster SEQIDNO.7 ACGTCCCAGTTCGGACTGTA Forward Enterocloster SEQIDNO.8 GTTGCTGACTCCCATGGTGT Reverse Enterocloster SEQIDNO.9 6FAM-CAACCCGACTACACGAAGCTGGAA- Probe BBQ .sup.a16S ribosomal RNA gene.

    [0135] Initially, before the rats of groups A and B started the consumption of the bacterial cocktails A and B, respectively, the Gordonibacter or Ellagibacter genera were under the limit of detection in the fecal samples (FIGS. 40, 4E). However, the Enterocloster genus was detected in the rat feces from all groups (A, B, and C) at baseline (FIGS. 4D, 4E, and 4F). The relative abundance (meanS.D.) of the Enterocloster genus in groups A, B, and C was 0.030.02, 0.040.06 and 0.130.17, respectively, but without significant differences (p=0.570). The consumption of the bacterial consortia A (Gordonibacter and Enterocloster genera) and B (Ellagibacter and Enterocloster genera) in rat groups A and B resulted in the appearance and gradual increase of the Gordonibacter (FIG. 40) and Ellagibacter (FIG. 4E), respectively, at one time-point. The fecal Enterocloster levels also increased throughout the study in groups A and B (FIGS. 40, 4E). However, a reduced concentration of the administered bacteria was detected 1 week after stopping the consumption of the bacterial cocktails (end time of the study), which resulted in a significant decrease in the production of Uros too (FIG. 4). In the control group, the Ellagibacter genus was under the limit of detection throughout the study, and the Enterocloster and Gordonibacter genera remained at very low levels (FIG. 4F).

    [0136] Potential side effects from ingestion of the bacterial consortia were investigated. No adverse effects on growth, food intake, and vital organs were observed after 4 weeks of oral administration by gavage of bacterial consortia in rats from groups A and B compared to the control group. An analysis of the hematological variables was performed (number of platelets, hematocrit, erythrocytes, hemoglobin, neutrophils, lymphocytes, monocytes, eosinophils, basophils, Mean Corpuscular Volume, Mean Corpuscular Hemoglobin, Mean Corpuscular Hemoglobin Concentration, Erythrocyte Distribution, Mean Platelet Volume, Plateletcrit, Platelet Distribution Width, Mean Platelet Component, Mean Platelet Mass, Platelet Count, Reticulocyte Haemoglobin Content, and Mean Reticulocyte Corpuscular Volume, observing some differences between males and females in some variables, such as erythrocyte levels (p=0.05) (females control: 6.80.8, females group A: 7.21.2, females group B: 7.200.4, males control: 6.30.5, males group A: 7.61.3, males group B: 7.70.2, values expressed as 10.sup.6 cells/L), red blood cell distribution index (RDW) (p=0.005) (females control: 10.60.3, females group A: 11.10.7, females group B: 10.30.5, males control: 11.20.2, males group A: 11.50.2, males group B: 11.40.5, values expressed as %), and the number of leukocytes (p=0.006) (females control: 3.00 0.6, females group A: 4.00.9, females group B: 4.92.0, males control: 5.70.8, males group A: 7.30.9, males group B: 4.90.4, values expressed as 10.sup.3 cells/L). However, no differences were observed for any variables between groups that consumed the bacterial consortia (groups A and B) and the control group (group C). The serobiochemical values were also analyzed (Total Proteins, Albumin; Globulin, Creatinine, Glucose, Cholesterol, Triglycerides, Calcium, Phosphorus, Alkaline Phosphatase, Gamma Glutamyl Transpeptidase, Aspartate Aminotransferase, Alanine Aminotransferase etc) and differences were also detected only between males and females in some variables such as creatinine index (females control: 0.60.0, females group A: 0.70.0, females group B: 0.60 0, males control: 0.60.0, males group A: 0.60.0, males group B 0.60.0, values expressed as mg/dL, p<0.001), phosphorus (females control: 7.51.6, females group A: 10.40.9, females group B: 8.12.1, males control: 10.01.9, males group A: 10.32.1, males group B: 11.53.0, values expressed as mg/dL, p=0.007), alkaline phosphatase (ALP) (females control: 207.2131.5, females group A: 236.260.6, females group B: 321.571.8, males control: 453.9158.3, males group A: 360.752.5, males group B: 497.3116.0, values expressed as UI/L p=0.003), and thyroxine (T4) (females control: 3.61.1, females group A: 3.60.2, females group B: 4.10.9, males control: 3.71.6, males group A: 4.00.3, males group B: 4.40.7, values expressed as g/dL, p=0.002). However, no differences were observed for any variable between the groups that consumed the bacterial cocktails (groups A and B) and the control group (group C).