VIRAL PREPARATIONS AND METHODS FOR TREATING AND MODULATING MITOCHONDRIAL EFFECTS OF CORONAVIRUS INFECTIONS.

20250327038 ยท 2025-10-23

    Inventors

    Cpc classification

    International classification

    Abstract

    Attenuate coronavirus species that are able to fully replicate and spread are proposed together with the methods of obtaining thereof. The proposed coronavirus species are intended to treat and prevent viral infections including all those caused by coronavirus species that affect humans as the COVID-19 caused by the SARS-CoV2. Compared with other treatment or vaccine alternatives, the availability of such attenuate coronavirus species does not require of significant distribution and production resources. Some of the embodiments of the invention involve the use of the attenuate coronavirus species in formulations or compositions that have to be approved as safe and effective for therapeutic use in specific territories by a valid regulatory agency as the Food and Drug Agency (FDA) in the United States.

    Claims

    1. A vaccine for preventing a condition characterized by impaired mitochondrial function in an animal or human subject, wherein the condition is caused directly or indirectly by infection with a first coronavirus strain characterized by having in its genome a gene that encodes a molecule that affects mitochondrial function in infected cells; the vaccine comprising: (a) a mutated second coronavirus strain obtained by removing or silencing said gene using a gene editing technique; and (b) a pharmaceutically acceptable carrier or excipient suitable for medical or veterinary administration.

    2. The vaccine of claim 1, wherein the first coronavirus strain is generated by applying a gene editing technique before obtaining the mutated second coronavirus strain.

    3. The vaccine of claim 1, wherein the removed or silenced gene is the nucleocapsid gene.

    4. The vaccine of claim 1, wherein the effect of the first coronavirus strain on mitochondrial function is more accentuated or intense than that of the mutated second coronavirus strain.

    5. The vaccine of claim 1, wherein the second coronavirus strain is able to infect cells and replicate within the infected cells.

    6. The vaccine of claim 1, wherein prevention of the condition characterized by impaired mitochondrial function involves treatment of an existing disease.

    7. The vaccine of claim 1, wherein prevention of the condition characterized by impaired mitochondrial function involves assessment of at least one unit selected from the group consisting of a health condition and disease in said animal or human subject.

    8. The vaccine of claim 1, wherein the second coronavirus strain has similar infection or replication rates to those of the first coronavirus strain.

    9. The vaccine of claim 1, wherein the molecule affecting mitochondrial function is a protein translated from an open reading frame at the nucleocapsid gene.

    10. The vaccine of claim 1, wherein the gene editing technique is performed at the nucleocapsid gene.

    11. The vaccine of claim 1, wherein the molecule affecting mitochondrial function is a protein translated from an open reading frame.

    12. The vaccine of claim 1, wherein the molecule is homologous to a protein translated from an open reading frame a virus selected from the group consisting of SARS-CoV and SARS-CoV-2.

    13. The vaccine of claim 1, wherein the first coronavirus strain is a naturally occurring virus.

    14. The vaccine of claim 1, wherein the viral content of the vaccine formulation does not exceed 200 plaque-forming units.

    15. The vaccine of claim 1, wherein the viral content of the vaccine formulation does not exceed 100 plaque-forming units.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0025] FIG. 1 is a schematic representation of the protein expressed translated by the OFR 9b gene of SARS-CoV, SEQ ID NO: 20.

    [0026] FIG. 2 is a schematic representation of the protein expressed translated by the OFR 9b gene of SARS-CoV2, SEQ ID NO: 21.

    [0027] FIG. 3 is a schematic representation of the suppression of the protein expressed translated by the OFR 9b gene of SARS-CoV, SEQ ID NO: 22.

    [0028] FIG. 4 is a schematic representation of the suppression of the protein expressed translated by the OFR 9b gene of SARS-CoV2, SEQ ID NO: 23 and, SEQ ID NO: 2.

    [0029] FIG. 5 is a schematic representation of the protein expressed translated by the OFR 10 gene of SARS-CoV2 and its suppression, SEQ ID NO: 24 and, SEQ ID NO: 3.

    [0030] FIG. 6 is a schematic algorithm for the obtaining of an attenuated CoV from other infecting CoV.

    [0031] FIG. 7 is a schematic algorithm for the obtaining of a vaccine or a treatment for a CoV disease.

    [0032] FIG. 8 is a schematic algorithm for the obtaining of an antidote for a CoV based weapon.

    [0033] FIG. 9 is a schematic representation of maps showing the geographical distribution of some mitochondrial haplogroups in Europe, part of Africa and part of Asia.

    [0034] Like reference numerals will be used to refer to like parts from Figure to Figure in the following description of the drawings.

    DETAILED DESCRIPTION OF THE INVENTION

    [0035] For obtaining the above attenuated viruses some some of the embodiments of the invention generally can involve a six steps procedure [0036] 1. Detecting at least one protein that affect mitochondrial function [0037] 2. Identifying in a virus the genes that produce these at least one protein [0038] 3. Creating a viral infecting clone of the virus [0039] 4. Deleting and/or silencing the genes of step 2 [0040] 5. Replicating the clone [0041] 6. Infecting cell, animals and/or human subjects to test the safety, effectiveness and infecting rate of the infecting clone virus.

    [0042] Steps 2 and/or 3 can be replaced by any other gene editing technique that may reduce or increase the total number of the steps of the procedure.

    [0043] One of the mechanism in which SARSn-CoVs affect mitochondria may involve the release of proteins that interfere with mitochondrial function, as for example the one translated by the OFR 9b gene described in previous sections and its homologous. By affecting the mitochondrial immune function, virions can produce and replicate into the infected cells for longer times diminishing extracellular immune response and increasing viral production. In order to provide to host an immune response to those SARSn-CoVs, in some of the embodiments of the invention is obtained an infectious clone (ic) of CoVs in which the transcription of any protein that affect mitochondrial function is deactivated and or removed without affecting the viral capabilities to infect and replicate. Homologous to the OFR 9b protein in different CoVs can be translated by alternative OFRs as 10, 11, 13 or 14 depending on the specific CoV. These homologous are often slightly less than 100 amino acid viral accessory proteins encoded from a complete internal ORF within the N gene of bicistronic nature. In SARS-CoV2 some researches refer to the OFR 9b protein as OFR 9a or 14[22]. There are other SARSn-CoV proteins that are or were believed to affect mitochodnrial function. These include OFRs 8a and 3b in SARS-CoV and 8, 10 in SARS-CoV2, however a 382 nucleotide deletion covering almost the entire ORF8 of SARS-CoV was observed in eight hospitalized patients in Singapore[23] without a significant pathological difference compared to the cases where the OFR 8 is present. Remarkably, another genotype with a 415-nt deletion resulting in the loss of the whole ORF 8 region was isolated and confirmed in two Hong Kong patients with disease onset from mid-May 2003. Furthermore a natural occurring variation at the 29-tn that binds OFRs 8a and 8b in a single larger gene was also observed in some patients[24] without clinical effects. This indicates that the removal of OFR 8 alone is probably not effective as treatment. OFRs 3b and 8a from SARS-CoV were also found in mitochondria, however they are believe to induce cell apoptosis and therefore shortening cell life and viral production cycle, it is unclear any effect on mitochondrial function and their overall pathological effect is still unknown. By the other hand OFR 10 protein of SARS-CoV2 is also indicated to affect mitochondrial function. From computerized modeling secondary structure of OFR 10 seems to be composed by a pair of mostly polar anti parallel beta sheets and a third one in a perpendicular loop having three anchoring segments that predict a transmembrane domain that allows OFR 10 protein to bind and precipitate other proteins and to interact with intracellular membranes.

    [0044] One strategy to obtain an attenuated CoV with a minimized effect on mitochondrial is to remove or silence any gene with proven effect on mitochondrial function as can be OFR 9b or OFR 10 as are detailed in the examples bellow.

    Preparation of CoVs with Attenuated Effect on Mitochondrial Function

    Infectious OFR 9b or OFR 10 Free Mutant SARS-CoV-2

    [0045] SARS CoV 2 or infectious clone (ic) recombinant virus ic strains of SARS-CoV 2(NC_045512) are propagated on Vero E6 cells in Eagle's minimal essential medium supplemented with 10% fetal calf serum, kanamycin (0.25 g/ml), and gentamicin (0.05 g/ml) at 37 C. in a humidified CO2 incubator. For virus growth, cultures of Vero E6 cells are infected at a multiplicity of infection (MOI) of 5 for 1 h and the monolayer washed two times with 2 ml of phosphate-buffered saline (PBS) and overlaid with complete minimal essential medium. Virus samples are then harvested at different times postinfection and titered by plaque assay in 60 mm2 dishes. Plaques are visualized by neutral red staining and counted at 48 h. All virus work shall be performed in a biological safety cabinet in a biosafety level 3 (BSL3) laboratory containing redundant exhaust fans. Personnel shall to be double-gloved and dressed in appropriate suits with full hoods and face shields. Powered air-purifying respirators with high-efficiency particulate air and organic vapor filters shall to be used to provide a positive-pressure environment within the hoods.

    [0046] Viral RNA, extracted from the passage 4 SARS-CoV2 virus from Vero E6 cells, is used as a template for RT-PCR to produce cDNA fragments. Seven contiguous cDNA fragments F1 to F7 are constructed to cover the entire viral genome taking two different approaches. Some of the seven cDNA fragments are prepared through RT-PCR, whereas others are generated by chemical synthesis. First, the cDNAs of fragments F1, F4, F5, and F6 are synthesized from the GenScript company (Piscataway, NJ) and cloned into a high-copy plasmid pUC57. The F1 contains a T7 promoter sequence at the upstream of the 5 end of the SARS-CoV2 sequence. The cDNAs of fragments F2, F3, and F7 are obtained by reverse transcription and PCR (RT-PCR). RT is performed by using the SuperScript IV First-Strand Synthesis System (ThermoFisher Scientific) with random hexamer primers and extracellular viral RNA (extracted from the supernatants of SARS-CoV2 infected Vero E6 cells). The cDNA is used as a template to amplify the fragments F2, F3, and F7 by high fidelity PCR with the Platinum SuperFi II DNA Polymerase (ThermoFisher Scientific). A poly(T).sub.29 sequence is introduced by PCR to the 3 end of the untranslated region of viral genome. The amplicons are cloned into a single-copy vector pCC1BAC (Epicenter) to increase the stability of the cDNA plasmids when propagated in E. coli. To ensure a seamless assembly of the full-length cDNA, two cleavage sites of class IIS restriction enzymes (BsaI and Esp3I) are introduced at both ends of each sibling cDNA during PCR or gene synthesis. To differentiate the infectious clone-derived virus from the parental isolate silent mutations can be engineered at for example nucleotide positions 7,486 (A-to-T change), 7,489 (T-to-A change), and 18,058 (T-to-C change) corresponding to NC_045512 or their equivalent located using the BLAST database alternatively can be used other comparative method to differentiate muttants.

    [0047] The suppression of ORF9b in the N gene coding region at F7 is achieved by mutating the initiation codon of ORF9b at F7 from ATG to ACG, located at position 28284 in ascension NC_045512.

    [0048] The suppression of ORF10 in the coding region at F7 is achieved by mutating the initiation codon of ORF10 at F7 from ATG to ACG, located at position 29558 in ascension NC_045512. It may be also possible to delete the complete ORF 10, however is still unclear if the ORF 10 is totally or partially part of a bigger bicistronic ORF structure.

    [0049] If desired deletion of OFR 8 gene can be introduced by overlap extension PCR in the F7 plasmid template. Mutated plasmids can be confirmed by sequence analysis.

    [0050] To assemble the full-length cDNA, subject cDNA plasmids are digested and purified each cDNA fragment. Specifically, F1, F2, F3 and F4 cDNA fragments are obtained by digesting the corresponding plasmids with enzyme BsaI. F5 and F6 fragments are obtained by digesting the plasmids with enzymes Esp3I and PvuI. F7 and F7-mNG cDNA fragments are obtained by digesting the corresponding plasmids by Esp3I and SnaBI. PvuI and SnaBI are included in the digestion to eliminate undesired DNA bands that co-migrated with the targeted fragments on agarose gels. All fragments after restriction enzyme digestion are separated on 0.6% agarose gels, visualized under a darkreader lightbox (Clare Chemical Research, Dolores, CO), excised, and purified using the QIAquick Gel Extraction Kit (QIAGEN, Germantown, MD). To assemble the full-length cDNA, the seven cDNA fragments are ligated in a three-step manner. First, equimolar amounts of F1 (0.61 g), F2 (0.65 g), F3 (0.75 g), and F4 (0.94 g) are ligated in a PCR tube using T4 DNA ligase in a 40 l-reaction at 4 C. for 18 h, resulting in F1-4 DNA. Second, equimolar amounts of fragments F5 (0.75 g), F6 (0.72 g), and F7 (0.60 g) are ligated in a separate PCR tube to produce F5-7 DNA using the same ligation conditions. Third, without any DNA purification, the two reactions (containing F1-4 and F5-7) are combined (total 80 l) and topped with additional T4 ligase (2 l), buffer (2 l) and nuclease-free water (16 l) to a 100 L reaction. The final reaction is incubated at 4 C. for 18 h to produce the full-length F1-7 DNA. Afterward, the full-length cDNA is phenol/chloroform extracted, isopropanol precipitated, and resuspended in 10 L nuclease-free water.

    [0051] To recover recombinant SARS-CoV2 from the infectious cDNA clone (icSARS-CoV2), the in-vitro-transcribed genome-length RNA is electroporated into Vero E6 cells. RNA transcript can be in vitro synthesized by electroporating the RNA transcription mixture into cells without purificationfor using for example the mMESSAGE mMACHINE T7 Transcription Kit (ThermoFisher Scientific). A 50 L reaction is set up by adding 1 g DNA template and 7.5 L GTP (cap analog-to-GTP ratio of 1:1). The reaction is incubated at 32 C. for 5 h. After removing the template DNA by nuclease per manufacturer's protocol, the RNA is phenol/chloroform extracted and isopropanol precipitated. Given that N protein was reported to enhance the infectivity of coronavirus RNA transcripts [Curtis et al., 2002; Yount et al., 2003; Yount et al., 2002], an mRNA is co-electroporated encoding the SARS-CoV-2 N protein with the full-length RNA. A SARS-CoV2 N gene transcript is in vitro transcribed from a DNA template using the mMESSAGE mMACHINE T7 Transcription Kit with a 2:1 ratio of cap analog to GTP. The N gene DNA template is prepared by PCR using primer Cov-T7-N-F (tactgTAATACGACTCACTATAGGatgtctgataatggaccccaaaatc; the uppercase sequence represents T7 promoter; the underlined sequence represents the 5 end of N gene. SEQ ID NO: 4 and primer polyT-N-R [(t).sub.37aggcctgagttgagtcagcac. SEQ ID NO: 5. In order to delete the ORF 9b the initiation codon of ORF 9b at gene N is mutated from ATG to ACG, located at position 10 of the gene, however this step is not necessary if ORF 9b deletion is not pursued. Mutated plasmids can be confirmed by sequence analysis. RNA transcripts are electroporated into Vero E6 cells. Twenty micrograms of total RNA transcripts (containing both full-length RNA and short RNAs) and 20 g N gene transcript are mixed and added to a 4-mm cuvette containing 0.8 mL of Vero E6 cells (810.sup.6) in Ingenio Electroporation Solution (Mirus). Single electrical pulse was given with a GenePulser apparatus (Bio-Rad) with setting of 270 V at 950 F. After 5 min recovery at room temperature, the electroporated cells are seeded into a T-75 flask and incubated at 3720 C. with 5% CO,. On the next day, the culture fluid is replaced with 2% FBS DMEM medium. The cells are monitored daily for virus-mediated cytopathic effect (CPE). One milliliter of the PO virus is inoculated to a T-175 flask containing 80% confluence Vero E6 cells. The infected cells are incubated at 37 C. with 5% CO.sub.2 for 2-3 days. Culture supernatants (P1) are harvested when CPE occurred. The amount of infectious virus is determined by a standard plaque assay on Vero E6 cells. All virus cultures shall to be performed in a biosafety level 3 (BSL-3) laboratory with redundant fans in the biosafety cabinets. Personnel shall to wear powered air purifying respirators with appropiate suits, aprons, booties, and double gloves.

    Infectious OFR 9b free mutant SARS-CoV

    [0052] Strains of SARS-CoV are propagated in VeroE6 cells in MEM supplemented with 10% FCS, kanamycin (0.25 g/ml), and gentamyacin (0.05 g/ml) at 37 C. in a CO.sub.2 incubator. Cultures of VeroE6 cells are infected at a multiplicity of infection of 0.1 for 30 min, washed, and titered by plaque assay. At 1 h after infection, some cultures are treated with the cysteine protease inhibitor (2S,3S)-transepoxysuccinyl-L-leucylamido-3-methylbutane ethyl ester (E64-d) at a concentration of 500 g/ml. Virus plaques are visualized by neutral red staining at 2 d after infection. Reverse transcription is performed by using SuperScript II, oligodeoxynucleotide primers, and intracellular RNA from SARS-infected cultures. The cDNA is denatured for 2 min at 94 C. and amplified by PCR with Expand Long TAQ polymerase (Roche Molecular Biochemicals) for 25 cycles at 94 C. for 30 sec, 58 C. for 25-30 sec, and 68 C. for 1-7 min. The amplicons are cloned into Topo II TA (Invitrogen) (SARS subclones D-F) or in pSMART vectors (Lucigen, Middleton, WI) (SARS subclones A-C). All cDNAs are assembled as CSs based on independent sequence analysis of four to seven sibling clones and the reported Urbani sequence. The following primers are used in the isolation of the SARS A subclone (forward, tactaatacgactcactatagatattaggtttttacctacctacccagg-1, SEQ ID NO: 6. Reverse, acaccatagtcaacgatgcc-4452, SEQ ID NO: 7); SARS B subclone (forward, gcctatatgcatggatgttagat-4359, SEQ ID NO: 8. Reverse, tgaaccgccacgctggctaaacc-8727,-SEQ ID NO: 9); SARS C, subclone (forward, agccagcgtggcggttcatac-8710, SEQ ID NO: 10. Reverse, aggcctcttgggcagtggcataag-12085, SEQ ID NO: 11); SARS D subclone (forward, actgcccaagatgcctatgagc-12070, SEQ ID NO: 12. Reverse, cagccaggagggcagacttcacaacc- 18939, SEQ ID NO: 13); SARS E subclone (forward, gtctgccctcctggctgataagtttccag-18923,SEQ ID NO: 14. Reverse, gagcagccgtgtaggcagcaat-24066, SEQ ID NO: 15); and SARS F subclone (forward, attgctgcctacacggctgctc-24045, SEQ ID NO: 16. Reverse, (ttt) 7 gtcattctcctaagaagc-29710, SEQ ID NO: 17).

    [0053] To repair sibling clones, primer pairs are designed that contained a class IIS restriction enzyme, like AarI. By using high fidelity PCR, the consensus portions of different sibling clones are amplified, digested with AarI, and ligated into plasmid. The AarI junctions are designed to seamlessly link consensus fragments, resulting in the production of a full-length cDNA fragment for each of the various SARS cDNA subclones. By using an automated Applied Biosystems DNA sequencer, two to three candidate DNAs are sequenced to identify the consensus clone.

    [0054] The SARS A-F inserts are restricted, separated through 0.8% agarose gels, visualized with a darkreader lightbox (Clare Chemical Research, Dolores, CO), excised, and purified by using the Qiaex II DNA purification kit. The SARS A+B, C+D, and E+F subclones are ligated overnight and isolated. The SARS AB+CD+EF cDNAs are ligated overnight at 4 C., phenol/chloroform extracted and precipitated. Transcripts are generated in vitro (TmMessage mMachine, Ambion) as described by the manufacturer with certain modifications. For SARS N transcripts, 1 g of plasmid DNA encoding the N gene (primer: 5-nnggcctcgatggccatttaggtgacactatagatgtctgataatgg-accccaatc-3, SEQ ID NO: 18, and reverse primer (5-nnnttttttttttttttttttttttttt-tatgcctgagttgaatcagcag-3, SEQ ID NO: 19) were transcribed by SP6 RNA polymerase with a 2:1 ratio of cap analog to GTP. The deletion of ORF9b in the N gene coding region at was achieved by mutating the initiation codon of ORF9b at F7 as well at the SARS N transcripts, from ATG to ACG, located at position 10 in the SARS N sequence, equivalent to the 28130 and 28277 positions at the Urbani and the obtained mutated infecting clone respectively. If desired, the deletion of OFRs 8a and/or 8b genes can be implemented by overlap extension PCR in the F7 plasmid template. Mutated plasmids can be confirmed by sequence analysis.

    [0055] RNA transcripts are added to 800 l of the BHK cell suspension (8.010.sup.6), and three electrical pulses of 850 V at 25 F are given with a Gene Pulser II electroporator (Bio-Rad). The BHK cells are seeded with 1.0-2.010.sup.6 VeroE6 cells in a 75-cm 2 flask and incubated at 37 C. for 2 d. Virus progeny are then purified by plaque assay. For fluorescent Ab staining, cells are washed in PBS and incubated with goat serum for 20 min at room temperature. The cells are washed, incubated with a 1:200 dilution of MHV polyclonal antiserum that cross reacts with the SARS N protein, and then incubated in Alexa 488 diluted 1:400 for 30 min. The cells can be fixed in 10% neutral, phosphate-buffered formalin for 24 h, rinsed for 30 min, and visualized under a fluorescent microscope.

    [0056] To detect marker mutations inserted in the infectious clone (ic)SARS-CoV, intracellular RNA is isolated from either WT or icSARS-CoV-infected cells at 24 h after infection. After RT-PCR, should be obtained a 1668-nt amplicon (nucleotide positions 1007-2675) spanning the BglI site at position 1557 that had been ablated in the icSARS-CoV component clones, but not WT SARS-CoV.

    [0057] Other PCR products included a 799-nt amplicon spanning the SARS-CoV B/C junction (nucleotide positions 8381-9180), a 544-nt amplicon (nucleotide positions 11721-12265) spanning the SARS-CoV C/D junction, a 652-nt amplicon spanning the SARS-CoV D/E junction, and a 1594-nt amplicon (nucleotide positions 23665-25259) spanning the SARS-CoV E/F junction. The 1594-nt SARS E/F junction-containing amplicon was subcloned and sequenced. Alternatively to the Urbani sequence for obtaining an infectious clone, the TOR-1, 0.2 or any other SARS-CoV sequence can be used and adapted.

    [0058] The above example strategies to obtain an attenuate CoV can be applied to several CoV including some SARS-CoV and bat CoV species that are believed the larger animal reservoir able to infect humans and that were largely studied[20]. The in vivo validation of the virus attenuation depends on the viral load. The viral pathological effects on mitochondrial immune mechanism modulates how long cells will survive producing virions and/or viral particles and providing a high initial viral dose may hide this effect. The vaccine effect in living beings have to be validated for being included in an accepted medical or veterinary formulation by providing doses comparable to natural occurring viral infective exposure and by evaluating kinetic curves of immune response, symptoms and infectious propagation rate. Low doses, less than 200 plaque forming units (PFU), of the above attenuated SARS-CoV in hACE-2 Tg mice, cause faster indication of infection as weight loss and fever than wild type SARS-CoV, however the mortality of the former is lower than the later. The same results are expected for SARS-CoV2. It have to be noted that the attenuation of the viral effect on mitochondrial function may decrease viral replication and release during the cell cycle but will not necessarily increase cell survival, therefore in vitro studies may not be indicative of the vaccine or therapeutic effects of the attenuated CoVs. 100 pfu is the expected dosage for human beings that may vary according to clinical and preclinical studies as well as clinical practice. A dosage greater than 200 pfu is expected to produce symptomatic illness in humans and may be not suitable for therapeutic use against most CoVs. All these variations are contemplated in the scope of the invention.

    [0059] There are also alternative genome engineering approaches to obtain attenuated CoVs. These include for example meganucleases, zinc finger nucleases (ZFNs), transcription-activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR/Cas9) system. All them fall in the scope of the invention including the use of engineered nucleases and/or any future or existing method of gene editing. Furthermore in alternative embodiments of the invention the RNA editing can be achieved directly by CRISPR. In 2016, researchers demonstrated that CRISPR from an ordinary mouth bacterium could be used to edit RNA[26]. The researchers searched databases containing hundreds of millions of genetic sequences for those that resembled CRISPR genes. They considered the fusobacteria Leptotrichia shahii. It had a group of genes that resembled CRISPR genes, but with important differences. When the researchers equipped other bacteria with these genes, which they called C2c2, they found that the organisms gained a novel defense. Bacteria with C2c2 make molecules that can dismember RNA, destroying the virus. Tailoring these genes opened any RNA molecule to editing.

    [0060] Some of the above strategies to obtain an attenuated CoV leaves intact the gene S responsible of allowing cell penetration, however the invention is not limited to leave unaltered any specific gene. Gene S highly mutate and it is almost unique between different CoV species. Unlike the ACE2 receptor produced by the S gene of SARS-CoV which is activated by the serine protease TMPRSS2 which is very specific and located in cells of the upper respiratory tract in humans, the homologous ACE2 receptor of SARS-CoV2 is activated by the enzyme furin in a similar process as occur in other viruses as HIV and also some other CoVs as fpr example the MERS-CoV. Examination of the protein sequence of the S glycoprotein of SARS-CoV-2 reveals the presence of a furin cleavage sequence (PRRARS|V). The CoV with the highest nucleotide sequence homology, isolated from a bat in Yunnan in 2013 (RaTG-13)[27],does not have the furin cleavage sequence. Because furin proteases are abundant in the respiratory tract, it is possible that SARS-CoV2 S glycoprotein is cleaved upon exit from epithelial cells and consequently can efficiently infect other cells. In contrast, the highly related bat CoV RaTG-13 lacks the furin cleavage site. The second most closely related to SARS-CoV2 nucleotide sequence homology comes from pangolin-CoV which was discovered during the first half of 2019[29]. In fact the only known and identical homologous to OFR 10 protein was found in pangolin-CoV. Current genetic data show that until now, none of the coronaviruses caused epidemics are derived from a previously used virus template neither is evidence of the direct use of cDNA. However the possibility of an engineered recombination in vivo and/or in vitro exists. It may be possible to culture CoV RaTG-13 with other full CoV and, for example adding plasmids containing the S gene of other CoVs as can be MERS-CoV and later on to infect animals with one or more of the resulting CoV spices. Other co infection strategies can involve infecting with CoV RaTG-13 pangolins already infected with pangolin-CoV. As today there is no empirical evidence that these strategies to produce any CoV that may affect humans were used and any of these hypotheses has to be experimentally validated.

    [0061] Referring to FIG. 1. An schematic computer rendered representation of the OFR 9b translated protein from SARS-CoV denoted as 100 is showed. Residues are represented by different filling layouts indicated as 101 hydrophobic residues without filling, 102 polar residues filled with a pattern of lines, 103 arg, lys, asp, glu charged residues filled in solid black. A central hydrophobic cavity 104 can be visualized. The corresponding protein sequence is in FIG. 105. SEQ ID NO: 20.

    [0062] Referring to FIG. 2. An schematic computer rendered representation of the OFR 9b, also referred as 9a by some researchers, translated protein from SARS-CoV2 denoted as 200 is showed. Residues are represented by different filling layouts indicated as 201 hydrophobic residues filled with a pattern of lines, 202 polar residues without filling, 203 arg, lys, asp, glu chsarged residues filled in solid black. A central hydrophobic cavity 204 can 21be visualized. The corresponding protein sequence it is shown in 205. SEQ ID NO: 21.

    [0063] Referring to FIG. 3. 300 shows the edition of the first codon from the OFR 9b SARS-CoV sequence ATG, 301, that is transformed into ATC, 302, at the b 10.sup.th+2 position of the N gene as an example to suppress gene translation into protein. SEQ ID NO: 22 and SEQ ID NO: 1.

    [0064] Referring to FIG. 4. 400 shows the edition of the first codon from the OFR 9b SARS-CoV2 sequence ATG, 401, that is transformed into ATC, 402, at the 10.sup.th+2 position of the N gene as an example to suppress gene translation into protein. SEQ ID NO: 23 and SEQ ID NO: 2.

    [0065] Referring to FIG. 5. An schematic computer rendered representation of the OFR 10 translated protein from SARS-CoV2 denoted as 500a is showed. Residues are represented by different filling patterns indicated as 501 hydrophobic residues without filling, 502 polar residues filled in solid black, 503 arg, lys, asp, glu charged residues filled with a pattern of lines. The protein sequence is in 504, SEQ ID NO: 24. 500b shows the edition of the first codon from the OFR 10 sequence ATG, 505, SEQ ID NO: 25 that is transformed into ATC, 506, SEQ ID NO: 3, as an example to suppress gene translation into protein.

    [0066] Referring to FIG. 6. An simplified algorithm of an preferred method to obtain an attenuated coronavirus from a existing species is shown as a schematic flux diagram denoted as 600. An existing CoV is considered in box 610. The source of the CoV can be for example a biological sample originated from either an human or non human subject, cell cultures or it can be generated from an artificial or natural occurring genome. At step 620 a candidate protein is identified following different possible strategies that can include genome recognition, screening for for known homologous proteins, intracelullar characterization of cultures, molecular imaging, or even epidemiological correlation with mitochondrial haplogroups. In many published works, the effect in mitochondrial function was assessed by direct observation and localization at mitochondria after labeling the viral protein with a molecular imaging method as fluorescence, or by looking for labeling precipitates of proteins related to mitochondrial function [2]. Another possible approaches include changes in the characterization of mitochondrial DNA( mitDNA) for example using circulsar dichronism [25]. These techniques are only examples and there are many existing of future methods to assess the effect of viral composition on mitochondrial function and all of them fall into the scope of the invention. The result of this step leads to the obtaining of an attenuated CoV candidate if it is positive or, if it is negative, the method is discarded and the process finishes as shown in 630. Once at least one candidate gene and/or translated protein that affect mitochondrial function are identify, gene editing techniques are applied to remove any of them in step 640. These techniques can include the building of cDNA from RNA, full or partial genomes of infecting clones, the use of meganucleases, zinc finger nucleases (ZFNs), transcription- activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR/Cas9) system or any existing or future gene editing technique. Once the new edited genome is obtained a new CoV is produced at 650 by a combination of for example reverse genetics, in vitro or in vivo injection of genetic material to bacteria or cells, in vitro or in vivo recombination of a combination of CoV strains, mRNA, cDNA plasmids or a combination thereof. The pathological effect of the newly obtained CoV candidate is addressed in 660 using any of the methods described in 620. If there no signification suppression of mitochondrial activity the candidate protein is discarded, step 695, and the process comes back to 620 for looking and alternative protein. In a further step it is evaluated by in vitro and in in vivo studies if the resulting CoV of step 650 can infect and replicate in cells. A preferred method to perform 670 is to collect the supernatant of infected cell cultures and look for released viral particles using a microscopy technique, but other existent and/or future method used in virology can be applied for this step. If proper infection and replication rates are measured then the desired attenuated new CoV was obtained, the algorithm moves to step 699 and finishes. Otherwise it should to be evaluated if the gene editing strategy was adequate. Step 680 considers if there exists an alternative gene strategy, if yes it is changed at step 690 and then step 650 and its subsequents are repeated. Otherwise there is no alternative gene editing technique to apply, the protein is discarded in step 695 and a new candidate protein have to be identified in step 620. There are a finite number number of proteins and gene editing techniques to test and at the overall after a finite number of steps the algorithm have to give one result. A new CoV is obtained, box 699, or the method have to be discarrded, box 630.

    [0067] Referring to FIG. 7. An simplified algorithm of a preferred method to obtain a vaccine or treatment for an existing CoV is shown as a schematic flux diagram 700. It starts with box 710 when is established that a CoV infect an human and/or a non human subject or population. Once the CoV is identified and characterized the next step 720 is to verify if it both affects mitochondrial function and there is possible to obtain and attenuated CoV that less affects mitochondrial function. This step can be performed for example using the algorithm 600 of FIG. 6 that specifically can return only to results, the attenuated CoV an be obtained or not, however other alternative processes can be used. If such attenuated CoV cannot be obtained then the desired treatment cannot be achieved, the process finishes in step 730 and an alternative solution must be found as treatment. For the purposes of this example method if the original CoV does not affect mitochondrial function is established that the attenuated CoV does not exists and the algorithm goes to 730. In the case the candidate attenuated CoV is obtained the method moves to step 731 wherein the original and the attenuated CoVs are characterized and compared considering their pathological effects in hosts, reproducibility, kinetics, tissue distribution. Several published studies that compare engineered edited CoV with their original wild types often are done with animal models administering viral dosages significantly higher than the natural occurring ones. These studies are often performed on E6 Vero cells from monkeys and/or in small rodents where the CoV viral particles are searched in different organs and tissues after the animals dissection. At the current understanding by attenuating the effect of CoVs on mitochondrial function mitochondrial division is preserved and therefore cell signaling as well as cell cycle may be accelerated and/or even driven to apoptosis. This may result in a diminished release of CoV virons from infected cells and the capability of the immune system to response to them increased compared to the infection by the original CoV. By administering viral loads significantly higher than those common in natural transmission between hosts it can overcame immune host response and may represent infection dynamics and/or transmission rates, but gross virulence characteristics of both CoVs. In most cases this comparison is preclinical and may not involve the testing in human subjects. In step 740 the safety of the candidate CoV is tested, this step may vary depending on the population defined at 710 and/or at 731-740 for testing purposes. For human populations it may involve full phase I studies, for non human ones it can be enough to obtain the results of the previous step 731 and to define safety as relative to the original CoV and therefore to determinate the inclusion of the attenuated CoV in an accepted medical or veterinary formulation. This safety testing involves also determining the adequate safe dosage to be provided to the intended subject or population of step 710. If safety testing fails then the candidate CoV discarded, box 750, and the flow goes back to step 720 to find a new CoV candidate. If the algorithm depicted in 600 is used, it will provide a new attenuated CoV candidate or an indication that the candidate does not exists. In the case of the safety tests 740 succeeded then it is evaluated at step 750 if the candidate CoV prevents the infection by the original CoV at the same population and/or to a representative subject of those depicted at step 710. There are several ways to preform this testing the most commons involve a two stages infection exposition to a number of subjects, first to the attenuated CoV candidate and secondly to the original CoV. Clinical development of human vaccines is a three-phase process. During Phase I, small groups of people receive the trial vaccine. In Phase II, the clinical study is expanded and vaccine is given to people who have characteristics (such as age and physical health) similar to those for whom the new vaccine is intended. In Phase III, the vaccine is given to thousands of people and tested for efficacy and safety. Many vaccines undergo Phase IV formal, ongoing studies after the vaccine is approved and licensed for post market surveillance/confirmatory assessment. In a preferred method to evaluate the prevention of infection rates, the candidate CoV is administered to certain subjects of a population and the infection rates are compared to a control population wherein either none of the subjects was exposed to the candidate CoV or they were exposed to a placebo. This preferred method is of special interest because, contrarily to most common vaccines, the attenuated CoV candidate can infect and spread to more subjects that those who received the doses saving significantly in production and distribution costs. Once the candidate CoV is validated on the target population it can be cleared to be included in an accepted medical or veterinary formulation, depending on the regulation of each country, as a vaccine as shown in step 780. There can be different reasons to a vaccine candidate to fail as for example unexpected mutations or because molecular differences between the original and attenuated CoV. There is then room to ask if the attenuated CoV will serve as treatment for infected subject by the original CoV. This question is done at step 770. There are many steps to validate the candidate CoV as a treatment, some of them may be done already in step 760. Preferred methods include administering the attenuated CoV to infected groups and compare it with placebos or a treatment considered a gold standard. Once the candidate CoV is validated as a treatment for the target population it can be cleared to be included in an accepted medical or veterinary formulation, depending on the regulation of each country, as a treatment as shown in step 790. Following the algorithm 700 it can be obtained one of the following three results in a finite number of steps. 1) an attenuated CoV can be used as a vaccine; 2) an attenuated CoV can be used as a treatment; or 3) is not possible to obtain an attenuate CoV to be used as a vaccine and/or treatment by attenuating its effect on mitochondrial function using gene editing techniques. The method depicted at algorithm 700 is only an example, it is possible between other possibilities to swap between steps 760 and 770 and obtain an attenuated CoV that serves as treatment but not as a vaccine.

    [0068] Referring to FIG. 8. An simplified algorithm of a preferred method to obtain a vaccine or treatment for an engineered CoV developed as weapon is shown as a schematic flux diagram 800. It starts with box 810 when the weaponized CoV is detected. The following steps 820, 830, 831, 840 and 850 are similar to 720, 730, 731, 740 and 750 from the algorithm depicted at 700 respectively. If the safety tests of step 840 succeeded then it is evaluated at step 860 if the candidate CoV can be used as a treatment. Preferred methods include administering the attenuated CoV to infected groups and compare it with placebos or a treatment considered a gold standard. Once the candidate CoV is validated as a treatment for the target population it can be cleared to be included in an accepted medical or veterinary formulation, depending on the regulation of each country, as an antidote as shown in step 880. If the attenuated CoV is not effective as an antidote then at step 870 is evaluated if it prevents the infection at the same population and/or to a representative subject of those affected of the weapon of step 810. This testing is performed at the same manner as step 760 of algorithm 700 resulting in a vaccine at box 890 or in the discarding of the attenuated CoV candidate at step 850 seconded by a new iteration to find an alternative attenuated CoV candidate at step 82, By following this algorithm always will achieved one of three results in a finite number of steps. 1) an attenuated CoV can be used as an antidote; 2) an attenuated CoV can be used as a vaccine; or 3) is not possible to obtain an attenuate CoV that serves neither as antidote or vaccine for the weapon by attenuating its effect on mitochondrial function using gene editing techniques. The method depicted at algorithm 800 is only an example, it is possible between other possibilities to swap between steps 860 and 870 and obtain an attenuated CoV that serves as vaccine but not as antidote.

    [0069] Referring to FIG. 9. Maps[3] converted to black and white images of the prevalence of two different mitochondrial haplogroups in Europe, North Africa and West Asia 900 are shown. 910 represent the prevalence of the combined H1 and H3 haplogroups that show some direct correlation with the initial spreading rate of the COVID-19 pandemic and mortality rate. 910 represent the prevalence of the U3 haplogroup that shows some inverse correlation with the initial spreading rate of the COVID-19 pandemic and mortality rate. Even if a first instance these maps appears to be well adjusted to variation on population density and age, they need further research, validation and characterization. There are areas as South Italy, West Russia and Mid Turkey that do not correlate so well with the pandemic evolution. These maps lost accuracy due to black an white conversion compared to the original reference[3] and the original reference should be consulted for more accurate information.

    [0070] Any of the embodiments described herein may be modified to include any of the structures or methodologies disclosed in connection with different embodiments. Further, the present disclosure is not limited to attenuated coronavirus treatments and vaccines of the type specifically shown.

    [0071] Numerous modifications to the present invention will be apparent to those skilled in the art in view of the foregoing description. Accordingly, this description is to be construed as illustrative only and is presented for the purpose of enabling those skilled in the art to make and use the invention and to teach the best mode of carrying out same. The exclusive rights to all modifications which come within the scope of the objectives are reserved and can be included totally or partially as part of the claims of the definitive patent application of this invention.