Lactic acid bacteria and use thereof

12447184 ยท 2025-10-21

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a novel lactic acid bacterium, and more particularly, to a composition comprising Lactobacillus reuteri NK33 (KCCM12090P) or Bifidobacterium adolescentis NK98 (KCCM12297P), which is the novel lactic acid bacterium, useful in preventing and treating a neurological mental disease or an inflammatory disease. Also, the present invention relates to a composition for diagnosing a neurological mental disease, comprising a preparation for measuring a level of an intestinal microorganism, a kit comprising the same, and a method for diagnosing the neurological mental disease, comprising a step of measuring the level of the intestinal microorganism.

Claims

1. A method for treating a mental disorder or an inflammatory disease, comprising: administering a pharmaceutical composition comprising Lactobacillus reuteri NK33 (KCCM12090P) into a subject, wherein the inflammatory disease is colitis, and wherein the mental disorder is one or more selected from the group consist of anxiety, depression, and stress.

2. The method according to claim 1, wherein the Lactobacillus reuteri NK33 (KCCM12090P) is a live bacterial cell thereof, a dead bacterial cell thereof, a culture product thereof or a crushed product thereof.

3. The method according to claim 1, wherein the pharmaceutical composition further comprising Bifidobacterium adolescentis NK98 (KCCM12297P).

4. The method according to claim 3, wherein the Bifidobacterium adolescentis NK98 (KCCM12297P) is a live bacterial cell thereof, a dead bacterial cell thereof, a culture product thereof or a crushed product thereof.

5. A method for alleviating a mental disorder or an inflammatory disease, comprising: administering a health functional food comprising Lactobacillus reuteri NK33 (KCCM12090P) into a subject, wherein the inflammatory disease is colitis, and wherein the mental disorder is one or more selected from the group consist of anxiety, depression, and stress.

6. The method according to claim 5, wherein the Lactobacillus reuteri NK33 (KCCM12090P) is a live bacterial cell thereof, a dead bacterial cell thereof, a culture product thereof or a crushed product thereof.

7. The method according to claim 5, wherein the health functional food further comprising Bifidobacterium adolescentis NK98 (KCCM12297P).

8. The method according to claim 7, wherein the Bifidobacterium adolescentis NK98 (KCCM12297P) is a live bacterial cell thereof, a dead bacterial cell thereof, a culture product thereof or a crushed product thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows results of measuring anxious behaviors and blood indicators with regard to a mouse (IS) subjected to immobilization stress; (a) is a graph of identifying that time spent in open arms (OT) and open arm entries (OE) are decreased as a result of an elevated plus maze test; (b) is a graph of identifying that time in bright area is decreased as a result of a light/dark transition test; (c) is a graph of identifying that a marble-burying behavior is increased in a marble burying test; (d) is an image of identifying that an NF-B activity (p-p65/p65) is increased in a hippocampus and an expression level of a brain derivated neurotrophic factor (BDNF) is decreased; (e) is a graph of identifying that corticosterone in blood is increased; (f) is a graph of identifying that IL-6 in blood is increased; (g) is a graph of identifying that TNF- in blood is increased; and (h) is a graph of identifying that lipopolysaccharide (LPS) in blood is increased.

(2) FIG. 2 (a) is a diagram of identifying that there is a change in an intestinal microbial community in feces of a mouse (IS) subjected to immobilization stress; and FIG. 2 (b) is a graph of identifying that there is an increase in lipopolysaccharide (LPS) in feces of a mouse (IS) subjected to immobilization stress.

(3) FIG. 3 shows results of measuring colitis indicators with regard to a mouse (IS) subjected to immobilization stress; (a) is a graph of identifying that there is a decrease in a length of a colon of a mouse (IS) subjected to immobilization stress; (b) is a graph of identifying that myeloperoxidase is increased in the colon; (c) is a graph of identifying that TNF- is increased in the colon; (d) is an image of identifying that an NF-B activity (p-p65/p65) is increased and expressions of COX-2 and iNOS are increased in the colon; and (e) is an image of identifying that occludin and claudin-1 are decreased in the colon.

(4) FIG. 4 shows results of identifying a state of an animal model (FIS), administered with feces of an animal model with immobilization stress induced; (a) is a graph of identifying that time spent in open arms (OT) and open arm entries (OE) are decreased as a result of an elevated plus maze test; (b) is a graph of identifying that time in bright area is decreased as a result of a light/dark transition test; (c) is a graph of identifying that a marble-burying behavior is increased in a marble burying test; (d) is an image of identifying that an NF-B activity (p-p65/p65) is increased in a hippocampus and an expression level of a brain derivated neurotrophic factor (BDNF) is decreased; (e) is a graph of identifying that a length of a colon is decreased; and (f) is a graph of identifying that myeloperoxidase is increased in the colon.

(5) FIG. 5 shows results of measuring blood indicators with regard to an animal model (FIS) administered with feces of an animal model with immobilization stress induced; (a) is a graph of identifying that corticosterone in blood is increased; (b) is a graph of identifying that IL-6 in blood is increased; and (c) is a graph of identifying that TNF- in blood is increased.

(6) FIG. 6 shows results of identifying a change in colitis indicators and an intestinal microbial community with regard to an animal model (FIS) administered with feces of an animal model with immobilization stress induced; (a) is a graph of identifying that TNF- is increased; (b) is a graph of identifying that IL-6 is increased in a colon; (c) is a graph of identifying that IL-10 is decreased in the colon; (d) is an image of identifying that an NF-B activity (p-p65/p65) is increased and expressions of COX-2 and iNOS are increased in the colon; and (e) is a diagram of identifying that an intestinal microbial community in feces is changed.

(7) FIG. 7 shows results of measuring anxious behaviors and blood indicators with regard to a mouse (AP) subjected to antibiotic stress; (a) is a graph of identifying that time spent in open arms (OT) and open arm entries (OE) are decreased as a result of an elevated plus maze test; (b) is a graph of identifying that time in bright area is decreased as a result of a light/dark transition test; (c) is a graph of identifying that a marble-burying behavior is increased in a marble burying test; (d) is an image of identifying that an NF-B activity (p-p65/p65) is increased in a hippocampus and an expression level of a brain derivated neurotrophic factor (BDNF) is decreased; (e) is a graph of identifying that corticosterone in blood is increased; (f) is a graph of identifying that IL-6 in blood is increased; (g) is a graph identifying that TNF- in blood is increased; and (h) is a graph of identifying that lipopolysaccharide (LPS) in blood is increased.

(8) FIG. 8 (a) is a diagram of identifying that there is a change in an intestinal microbial community in feces of a mouse (AP) subjected to antibiotic stress; and FIG. 8 (b) is a graph of identifying that there is an increase in lipopolysaccharide (LPS) in feces of a mouse (AP) subjected to antibiotic stress.

(9) FIG. 9 shows results of measuring colitis indicators with regard to a mouse (AP) subjected to antibiotic stress; (a) is a graph of identifying that there is a decrease in a length of a colon; (b) is a graph of identifying that myeloperoxidase is increased in the colon; (c) is a graph of identifying that TNF- is increased in the colon; (d) is an image of identifying that an NF-B activity (p-p65/p65) is increased and expressions of COX-2 and iNOS are increased in the colon; and (e) is an image of identifying that occludin and claudin-1 are decreased in the colon.

(10) FIG. 10 (A) is a diagram of identifying which bacterium is increased as a result of culturing feces of a mouse (IS) subjected to immobilization stress and feces of a mouse (AP) subjected to antibiotic stress in a selective medium; and FIG. 10 (B) is a diagram of identifying which bacterium is decreased as a result of culturing feces of the mouse (IS) subjected to immobilization stress and feces of the mouse (AP) subjected to antibiotic stress in a selective medium.

(11) FIG. 11 shows results of measuring anxious behaviors and blood indicators with regard to a mouse (AP) administered with a microorganism increased in feces of mice subjected to immobilization stress and antibiotic stress; (a) is a graph of identifying that time spent in open arms (OT) and open arm entries (OE) are remarkably decreased in a group administered with Klebsiella oxytoca, as a result of an elevated plus maze test with mice administered with Klebsiella oxytoca (KO), Escherichia coli (EC), Aerococcus urinaeequi (AU) and Morganella morganii (MM); (b) is a graph of identifying that time spent in open arms (OT) and open arm entries (OE) are decreased as a result of an elevated plus maze test with a mouse administered with Klebsiella oxytoca (KO); (c) is a graph of identifying that time in bright area is decreased as a result of a light/dark transition test; (d) is a graph of identifying that a marble-burying behavior is increased in a marble burying test; (e) is an image of identifying that an NF-B activity (p-p65/p65) is increased in a hippocampus and an expression level of a brain derivated neurotrophic factor (BDNF) is decreased; (f) is a graph of identifying that corticosterone in blood is increased; (g) is a graph of identifying that IL-6 in blood is increased; (h) is a graph of identifying that TNF- in blood is increased; and (i) is a graph of identifying that lipopolysaccharide (LPS) in blood is increased.

(12) FIG. 12 (a) is a diagram of identifying that there is a change in an intestinal microbial community in feces of a mouse (KO) administered with Klebsiella oxytoca; and FIG. 12 (b) is a graph of identifying that there is an increase in lipopolysaccharide (LPS) in feces of a mouse (KO) administered with Klebsiella oxytoca.

(13) FIG. 13 shows results of measuring colitis indicators with regard to a mouse (KO) administered with Klebsiella oxytoca; (a) is a graph of identifying that a length of a colon is decreased; (b) is a graph of identifying that myeloperoxidase is increased in the colon; (c) is a graph of identifying that TNF- is increased in the colon; (d) is an image of identifying that an NF-B activity (p-p65/p65) is increased and expressions of COX-2 and iNOS are increased in the colon; and (e) is an image of identifying that occludin and claudin-1 are decreased in the colon.

(14) FIG. 14 shows results of measuring anxious behaviors with regard to and comparing blood indicators between a group (IS), in which a mouse subjected to immobilization stress is administered with physiological saline solution, and a group administered with Lactobacillus reuteri NK33 (IS+LR), a novel lactic acid bacterium; (a) is a graph of identifying that time spent in open arms (OT) and open arm entries (OE) are increased as a result of an elevated plus maze test with the group administered with Lactobacillus reuteri NK33 (IS+LR), the novel lactic acid bacterium; (b) is a graph of identifying that time in bright area is increased as a result of a light/dark transition test; (c) is a graph of identifying that a marble-burying behavior is decreased in a marble burying test; (d) is an image of identifying that an NF-B activity (p-p65/p65) is inhibited in a hippocampus and an expression level of a brain derivated neurotrophic factor (BDNF) is increased; (e) is a graph of identifying that corticosterone in blood is decreased; (f) is a graph of identifying that IL-6 in blood is decreased; and (g) is a graph of identifying that TNF- in blood is decreased.

(15) FIG. 15 shows results of measuring colitis indicators with regard to a group (IS), in which a mouse subjected to immobilization stress is administered with physiological saline solution, and a group administered with Lactobacillus reuteri NK33 (IS+LR), a novel lactic acid bacterium; (a) is a graph of identifying that a length of a colon is recovered; (b) is a graph of identifying that myeloperoxidase is decreased in the colon; (c) is a graph of identifying that TNF- is decreased in the colon; and (d) is an image of identifying that an NF-B activity (p-p65/p65) is decreased and expressions of COX-2 and iNOS are decreased in the colon.

MODE FOR INVENTION

(16) Hereinafter, the present invention will be described in detail through preferred Examples and Experimental Examples for better understanding of the present invention. However, the following Examples and Experimental Examples are provided only for the purpose of illustrating the present invention, and thus the present invention is not limited thereto.

Experimental Example 1. Animal Model with a Mental Disorder Induced

(1) Immobilization Stress

(17) In order to induce a mental disorder such as anxiety, depression, stress or the like, a mouse was fixed to a 310 cm cylindrical-shaped immobilization stress apparatus, such that the mouse may not move therein at all.

(18) Particularly, in order to prepare a mouse with anxiety induced by immobilization stress, the said mouse, which had been fixed to the apparatus, was repeatedly subjected to immobilization stress five times, in such a way that the mouse was held with its head up for two hours once every other day, and then a behavioral experiment was performed in two hours after a final immobilization stress.

(19) Also, in order to prepare a mouse with depression induced by immobilization stress, the said mouse, which had been fixed to the apparatus, was repeatedly subjected to continuous immobilization stress once daily for two days, in such a way that the mouse was held with its head up for 12 hours. A lactic acid bacterium was administered once daily for five days, and a behavioral experiment was performed in one hour after a final administration.

(2) Antibiotic Stress

(20) In order to induce a mental disorder such as anxiety, depression, stress or the like, a mouse was administered ampicillin (100 mg/kg) for two days in a row. An anxiety behavior was measured in 10 days after administration.

(3) Experimental Method on an Animal Model with a Mental Disorder Induced

(21) For a mouse model with immobilization stress induced, a lactic acid bacterium or physiological saline solution was administered thereto depending on an experimental group once daily for three days from Day 7 after starting the immobilization stress. For a mouse model with antibiotic stress induced, a lactic acid bacterium or physiological saline solution was administered thereto depending on an experimental group once daily for three days from Day 7 after starting the antibiotic stress.

(22) An anxiety behavior was measured in five hours after administering the lactic acid bacterium or physiological saline solution, and blood indicators (corticosterone, IL-6, TNF-, etc.) were measured by collecting blood in one hour after finishing an elevated plus maze test.

Experimental Example 2. Behavior Measurement Method for Stress Diagnosis

(1) Elevated Plus Maze (EPM) Test

(23) An elevated plus maze is an experimental apparatus to measure a degree of a mental disorder such as stress, anxiety or the like. An elevated plus maze experimental apparatus used in the present experiment is a black plexiglass apparatus, in which two open arms (307 cm) and two enclosed arms (307 cm) with 20 cm-high walls stand 50 cm high above a floor, each extending 7 cm away from a center platform. In the present test, a mouse was placed in the elevated plus maze in a room, where a video camera of 20 Lux was installed high up there, and then a movement of the mouse was recorded.

(24) Particularly, a C57BL/6 mouse (male, 19-22 g) was placed in the middle of the elevated plus maze, in such a way that a head of the mouse faced toward an open arm. Time spent in open and closed arms as well as the number of arm entries were measured for five minutes. An arm entry was defined as a case in which the mouse entered an arm with all four feet.

(25) Out of a whole test time, the time spent in open arms (OT) was calculated via [Time spent in open arms (OT)/(Time spent in open arms (OT)+Time spent in closed arms)]100. And open arm entries (OE) were calculated via [Open arm entries (OE)/(Open arm entries (OE)+Closed arm entries)]100. After the end of each behavioral experiment, remaining smell was eliminated by means of 70% ethanol.

(26) According to a known interpretation of test results, it was interpreted that a mental disorder symptom such as anxiety, depression or the like occurs, if OT and OE decrease.

(2) Light/Dark Transition Test

(27) An apparatus used for a light/dark transition test consisted of a bright area (214225 cm, 390 Lux white diode) and a dark area (214225 cm, 2 Lux), which were of a size and partitioned off with a door (7.57.5 cm). A mouse was placed in a bright area and observed for five minutes, during which time in bright area and the number of transitions into the bright area were measured. After the end of each behavioral experiment, remaining smell was eliminated by means of 70% ethanol.

(28) According to a known interpretation of test results, it was interpreted that a mental disorder symptom such as anxiety, depression or the like occurs, if the time in bright area and the number of transitions into the bright area decrease.

(3) Marble Burying Test

(29) A mouse was placed in a transparent cage filled with sawdust 5 cm deep, and stayed there for 15 minutes. Then, 25 marbles (transparent, 2 cm in diameter) were placed on the sawdust at an interval of 5 cm. The mouse was placed again in the middle of one side and the number of marbles that the mouse buried for 30 minutes was measured.

(30) According to a known interpretation of test results, it was interpreted that a mental disorder symptom such as anxiety, depression or the like occurs, if the mouse's behavior of burying and hiding marbles increases.

(4) Forced Swimming Test (FST)

(31) According to a method of Porsolt et al. (Porsolt R D, Le Pichon, Jalfre M (1977) Depression: A new animal model sensitive to antidepressant treatments, Nature, Vol. 266; pp. 730-732), water at 251 C. was filled into a water tank 40 cm in height and 20 cm in diameter, until a water level reached 25 cm high. A laboratory mouse was put into each tank and stayed there for total six minutes, out of which first two minutes were not measured as an adaptive time, and then for the last four minutes, an immobility time of the laboratory animal was measured. The immobility means a state that the mouse is floating in the water motionlessly except the least movement to keep its head only above the water.

(5) Tail Suspension Test (TST)

(32) According to a method of Steru et al. (Steru L, Chermat R, Thierry B, Simon P (1985) The tail suspension test: A new method for screening antidepressants in mice, Psychopharmacology, Vol. 85; pp. 367-370), a mouse was hanged up in a container 35 cm in diameter and 50 cm in height by placing a fixing device approximately 1 cm from the tip of a tail thereof of a mouse, such that the mouse was suspended 50 cm above a floor. For six minutes in total, an immobility time of the laboratory animal was measured.

Experimental Example 3. Experiment on Identification of an Intestinal Microbial Community

(33) A real-time PCR or 454 pyrosequencing was performed to measure the shares of firmicutes, proteobacteria, actinobacteria, bacteroidetes and the like in an intestinal microbial community.

(34) Particularly, DNA of feces obtained from an animal model was isolated by means of QIAamp DNA stool mini kit (Qiagen, Germany). Pyrosequencing was performed by means of a barcoded primer (V1 to V3 domains of a bacterial 16S rDNA gene). qPCR was analyzed by means of a primer shown in a following table 1.

(35) TABLE-US-00001 TABLE1 Type Sequence(5-3) Firmicutes Forward(F) (SEQIDNO:2)GGAGYATGTGGTTTAATTCGAAGCA Reverse(R) (SEQIDNO:3)AGCTGACGACAACCATGCAC Bacteroidetes Forward(F) (SEQIDNO:4)GTTTAATTCGATGATACGCGAG Reverse(R) (SEQIDNO:5)TTAASCCGACACCTCACGG -Proteobacteria Forward(F) (SEQIDNO:6)AACGCGAAAAACCTTACCTACC Reverse(R) (SEQIDNO:7)TGCCCTTTCGTAGCAACTAGTG /-Proteobacteria Forward(F) (SEQIDNO:8)GCTAACGCATTAAGTRYCCCG Reverse(R) (SEQIDNO:9)GCCATGCRGCACCTGTCT -Proteobacteria Forward(F) (SEQIDNO:10)TAGGCTTGACATTGATAGAATC Reverse(R) (SEQIDNO:11)CTTACGAAGGCAGTCTCCTTA Actinobacteria Forward(F) (SEQIDNO:12)TGTAGCGGTGGAATGCGC Reverse(R) (SEQIDNO:13)AATTAAGCCACATGCTCCGCT TM Forward(F) (SEQIDNO:14)AYTGGGCGTAAAGAGTTGC Reverse(R) (SEQIDNO:15)TACGGYTACCTTGTTACGACTT Verrucomicrobia Forward(F) (SEQIDNO:16)TCAKGTCAGTATGGCCCTTAT Reverse(R) (SEQIDNO:17)CAGTTTTYAGGATTTCCTCCGCC Enterobacteriaceae Forward(F) (SEQIDNO:18)CATTGACGTTACCCGCAGAAGAAGC Reverse(R) (SEQIDNO:19)CTCTACGAGACTCAAGCTTGC Escherichiacoli Forward(F) (SEQIDNO:20)CGCGTACTATACGCCATGAACGTA Reverse(R) (SEQIDNO:21)ACCGTTGATCACTTCGGTCAGG Klebsiellaspp. Forward(F) (SEQIDNO:22)GATACGGAGTATGCCTTTACGGTG Reverse(R) (SEQIDNO:23)TAGCCTTTATCAAGCGGATACTGG Klebsiellaoxytoca Forward(F) (SEQIDNO:24)GTTAATACCTTTGCTCATTGA Reverse(R) (SEQIDNO:25)ACCAGGGTATCTAATCCTGTT Morganellamorganii Forward(F) (SEQIDNO:26)CTCGCACCATCAGATGAACCCATAT Reverse(R) (SEQIDNO:27)CAAAGCATCTCTGCTAAGTTCTCT GGATG Lactobacillusreuteri Forward(F) (SEQIDNO:28)GAACGCAYTGGCCCAA Reverse(R) (SEQIDNO:29)TCCATTGTGGCCGATCAGT Lactobacillusjohnsonii Forward(F) (SEQIDNO:30)CACTAGACGCATGTCTAGAG Reverse(R) (SEQIDNO:31)AGTCTCTCAACTCGGCTATG Lactobacillus Forward(F) (SEQIDNO:32)TCATGATTTACATTTGAGTG plantarum Reverse(R) (SEQIDNO:33)GACCATGCGGTCCAAGTTGTT Lactobacillus Forward(F) (SEQIDNO:34)CGCCCTTAACAGCAGTCTTC rhamnosus Reverse(R) (SEQIDNO:35)GCCCTCCGTATGCTTAAACC Bacterial16SrDNA Forward(F) (SEQIDNO:36)TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAGGTGCCAGCMGCCGCGGTAA Reverse(R) (SEQIDNO:37)GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAGGGACTACHVGGGTWTCTAAT

Experimental Example 4. Method for Measuring Lipopolysaccharide

(1) Method for Measuring Lipopolysaccharide in Feces

(36) Feces (20 mg) were suspended in 30 mL of PBS, then microorganisms thereof were crushed by means of ultrasonic treatment for one hour, and then centrifuged at 500 rpm for 15 minutes. A resulting supernatant was filtered with a 0.45 m filter, then filtered again with a 0.22 m filter, then treated at 70 C. for 10 minutes, and then used as a specimen. For the said specimen, lipopolysaccharide was measured by means of Limulus amoebocyte lysate (LAL) assay kit (Cape Cod Inc., East Falmouth, MA, U.S.A.).

(2) Method for Measuring Lipopolysaccharide in Blood

(37) Blood was diluted 10 times with PBS, then centrifuged, and then a resulting supernatant was treated at 0 C. for 10 minutes. A resulting supernatant was filtered with a 0.45 m filter, then filtered again with a 0.22 m filter, and then used as a specimen. For the said specimen, lipopolysaccharide was measured by means of Limulus amoebocyte lysate (LAL) assay kit (Cape Cod Inc., East Falmouth, MA, U.S.A.).

Experimental Example 5. Method for Measuring Colitis Indicators

(1) Measurement of Myeloperoxidase Activity

(38) 200 l of 10 mM potassium phosphate buffer, pH 7.0 containing 0.5% hexadecyl trimethyl ammonium bromide was put into 100 mg of a colon tissue, and then subjected to homogenization. A resulting mixture was centrifuged for 10 minutes on condition of 4 C. and 10,000 g, so as to obtain a supernatant. 50 l of the supernatant was put into 0.95 ml of a reaction solution (containing 1.6 mM tetramethyl benzidine and 0.1 mM H.sub.2O.sub.2), then subjected to reaction at 37 C., and then an observance was microscopically measured at 650 nm. An activity of the said myeloperoxidase (MPO) was calculated with a resulting reactant H.sub.2O.sub.2 1 mol/ml=1 unit.

(2) Measurement of Inflammatory Indicators

(39) Inflammatory reaction biomarkers such as p-p65, p65, iNOS, COX-2 and -actin were measured by means of a western blotting method. Particularly, 50 g of supernatant, which had been obtained by the same method as shown in the said experiment for measuring the activity of myeloperoxidase (MPO), was taken and then immune blotting was performed thereon. Also, an expression level of cytokines was measured by means of ELISA kit, and LPS was measured by means of LAL assay kit.

Example 1: Identification of a State of an Animal Model with Immobilization Stress Induced

(40) According to Experimental Examples 2 to 5, an experiment was performed on a mouse (IS), which had been subjected to immobilization stress once every other day for five times in total by the same method as shown in the Experimental Example 1-(1) above.

(41) As a result of performing Experimental Example 2, it was identified that time spent in open arms (OT) and open arm entries (OE) are decreased in an elevated plus maze test; time in bright area is decreased in a light/dark transition test; and a marble-burying behavior is increased in a marble burying test (FIGS. 1 (a) to (c)).

(42) Also, as a result of identifying with western blotting, it was identified that an NF-B activity (p-p65/p65) is increased in a hippocampus; an expression level of a brain derivated neurotrophic factor (BDNF) is decreased (FIG. 1 (d)); and amounts of corticosterone, IL-6, TNF- and lipopolysaccharide in blood are increased (FIGS. 1 (e) to (h)).

(43) As a result of performing Experimental Example 3, it was identified that bacteroidetes, actinobacteria and firmicutes in feces are decreased and , -proteobacteria and -proteobacteria are increased. As a result of performing Experimental Example 4, it was identified that lipopolysaccharide in feces is increased (FIG. 2).

(44) As a result of performing Experimental Example 5, it was identified that as indicators of colitis, a length of a colon is decreased; myeloperoxidase is increased; TNF- of the colon is increased; expressions of COX-2 and iNOS of the colon are increased; an NF-B activity is increased; and occludin and claudin-1, tight junction proteins, are decreased (FIGS. 3 (a) to (e)).

Example 2: Identification of a State of an Animal Model Administered with Feces of the Animal Model with Immobilization Stress Induced

(45) According to Experimental Examples 2 to 4, an experiment was performed on a mouse (FIS), which was administered with feces of a mouse, which had been subjected to immobilization stress once every other day for five times in total by the same method as shown in the Experimental Example 1-(1) above.

(46) As a result of performing Experimental Example 2, it was identified that OT and OE are decreased in an elevated plus maze test; time in bright area is decreased in a light/dark transition test; and a marble-burying behavior is increased in a marble burying test (FIGS. 4 (a) to (c)).

(47) As a result of identifying with western blotting, it was identified that an NF-B activity (p-p65/p65) is increased in a hippocampus; an expression level of a brain derivated neurotrophic factor (BDNF) is decreased (FIG. 4 (d)); and amounts of corticosterone, IL-6 and TNF- in blood are increased (FIGS. 5 (a) to (c)).

(48) As a result of performing Experimental Example 5, it was identified that as indicators of colitis, a length of a colon is decreased; myeloperoxidase is increased (FIGS. 4 (e) and (f); TNF- and IL-6 of the colon are increased; IL-10 of the colon is decreased; expressions of COX-2 and iNOS of the colon are increased; and an NF-B activity is increased (FIGS. 6 (a) to (d)).

(49) As a result of performing Experimental Example 3, it was identified that bacteroidetes, actinobacteria and firmicutes in feces are decreased and -proteobacteria and -proteobacteria are increased (FIG. 6 (e)).

Example 3: Identification of a State of an Animal Model with Antibiotic Stress Induced

(50) According to Experimental Examples 2 to 5, an experiment was performed on a mouse (AP), which had been subjected to antibiotic stress with an administration of ampicillin (100 mg/kg) for consecutive two days by the same method as shown in the Experimental Example 1-(2) above.

(51) As a result of performing Experimental Example 2, it was identified that OT and OE are decreased in an elevated plus maze test; time in bright area is decreased in a light/dark transition test; and a marble-burying behavior is increased in a marble burying test (FIGS. 7 (a) to (c)).

(52) It was identified that an NF-B activity (p-p65/p65) is increased in a hippocampus; an expression level of a brain derivated neurotrophic factor (BDNF) is decreased (FIG. 7 (d)); and amounts of corticosterone, IL-6, TNF- and lipopolysaccharide in blood are increased (FIGS. 7 (e) to (h)).

(53) As a result of performing Experimental Example 3, it was identified that bacteroidetes, actinobacteria and firmicutes in feces are decreased and , -proteobacteria and -proteobacteria are increased. As a result of performing Experimental Example 4, it was identified that lipopolysaccharide in feces is increased (FIGS. 8 (a) and (b)).

(54) As a result of performing Experimental Example 5, it was identified that as indicators of colitis, a length of a colon is decreased; myeloperoxidase is increased; TNF- of the colon is increased; expressions of COX-2 and iNOS of the colon are increased; an NF-B activity is increased; and occludin and claudin-1, tight junction proteins, are decreased (FIGS. 9 (a) to (e)).

Example 4: Identification of a State of an Animal Model Administered with Microorganisms Isolated from Feces of the Animal Model with Stress Induced

(1) Isolation of Microorganisms from Feces of the Animal Model with Stress Induced

(55) Feces of a mouse subjected to immobilization stress and faces of a mouse subjected to antibiotic stress were cultured in a selective medium, respectively. As a result, it was identified that enterobacteriaceae grown in a DHL medium is increased, and in particular Klebsiella oxytoca, Escherichia coli and Morganella morganii are increased (FIG. 10 (A)).

(56) On the other hand, it was identified that bifidobacteria and lactobacilli grown in a BL medium are decreased, and in particular Lactobacillus reuteri, Lactobacillus johnsonii, Lactobacillus rhamnosus and Bifidobacterium animalis are decreased (FIG. 10 (B)).

(2) Identification of a State of an Animal Model Administered with Microorganisms

(57) After administering to each mouse 110.sup.9 cfu of Klebsiella oxytoca, Escherichia coli and Morganella morganii respectively, which had been increased in feces of the mouse subjected to immobilization stress and the mouse subjected to antibiotic stress, an elevated plus maze test was performed according to Experimental Example 2-(1) above. As a result, it was identified that OT and OE are remarkably decreased in a group administered with Klebsiella oxytoca compared to a group administered with other microorganisms (FIG. 11 (a)).

(58) After that, according to Experimental Examples 2 to 5, an experiment was performed on a mouse (KO) administered with Klebsiella oxytoca.

(59) As a result of performing Experimental Example 2, it was identified that OT and OE are decreased in an elevated plus maze test; time in bright area is decreased in a light/dark transition test; and a marble-burying behavior is increased in a marble burying test (FIGS. 11 (b) to (d)).

(60) It was identified that an NF-B activity (p-p65/p65) is increased in a hippocampus; an expression level of a brain derivated neurotrophic factor (BDNF) is decreased (FIG. 11 (e)); and amounts of corticosterone, IL-6, TNF- and lipopolysaccharide in blood are increased (FIGS. 11 (f) to (i)).

(61) As a result of performing Experimental Example 3, it was identified that bacteroidetes, actinobacteria and firmicutes in feces are decreased and , -proteobacteria and -proteobacteria in feces are increased. As a result of performing Experimental Example 4, it was identified that lipopolysaccharide in feces is increased (FIGS. 12 (a) and (b)).

(62) As a result of performing Experimental Example 5, it was identified that as indicators of colitis, a length of a colon is decreased; myeloperoxidase is increased; TNF- of the colon is increased; expressions of COX-2 and iNOS of the colon are increased; an NF-B activity is increased; and occludin and claudin-1, tight junction proteins, are decreased (FIGS. 13 (a) to (e)).

Example 5: Isolation and Identification of Lactic Acid Bacteria

(1) Isolation of Lactic Acid Bacteria from Human and Mouse Feces

(63) Fresh human and mouse feces were inserted and suspended in a GAM liquid medium (GAM broth; Nissui Pharmaceutical, Japan), respectively. After that, supernatant was taken and implanted to MRS, BHI (Brain-Heart-Infusion) or BL agar medium (Nissui Pharmaceutical, Japan), then anaerobically cultured at 37 C. for about 48 to 72 hours, and then strains forming a colony were isolated therefrom.

(2) Identification of Isolated Lactic Acid Bacteria

(64) Physiological characteristics and 16S rDNA sequences of strains isolated from human or mouse feces were analyzed, then species of the strains were identified, and then names were given to the strains. Strain names given to lactic acid bacteria are as shown in a following table 2. Particularly, lactic acid bacteria isolated from human or mouse feces were 9 types of Lactobacillus spp. and 22 types of Bifidobacterium spp.

(65) TABLE-US-00002 TABLE 2 Management no. Strain name 1 Lactobacillus reuteri NK31 2 Lactobacillus reuteri NK32 3 Lactobacillus reuteri NK33 4 Lactobacillus reuteri NK34 5 Lactobacillus reuteri NK35 6 Lactobacillus johnsonii NK36 7 Lactobacillus johnsonii NK37 8 Lactobacillus johnsonii NK38 9 Lactobacillus johnsonii NK39 10 Bifidobacterium longum NK81 11 Bifidobacterium longum NK82 12 Bifidobacterium longum NK83 13 Bifidobacterium longum NK84 14 Bifidobacterium bifidum NK85 15 Bifidobacterium bifidum NK86 16 Bifidobacterium infantis NK87 17 Bifidobacterium infantis NK88 18 Bifidobacterium infantis NK89 19 Bifidobacterium breve NK90 20 Bifidobacterium breve NK91 21 Bifidobacterium choerinum NK92 22 Bifidobacterium catenulatum NK93 23 Bifidobacterium catenulatum NK94 24 Bifidobacterium adolescentis NK95 25 Bifidobacterium pseudolongum NK96 26 Bifidobacterium adolescentis NK97 27 Bifidobacterium adolescentis NK98 28 Bifidobacterium adolescentis NK99 29 Bifidobacterium pseudocatenulatum NK100 30 Bifidobacterium pseudocatenulatum NK101 31 Bifidobacterium minimum NK102

(3) Physiological Characteristics of Lactobacillus reuteri NK33, a Novel Lactic Acid Bacterium

(66) Out of strains described in Table 2 above, it was identified that Lactobacillus reuteri NK33 (accession number KCCM12090P) is a gram-positive bacillus. Also, it was shown that a 16S rDNA of Lactobacillus reuteri NK33 has a sequence of SEQ ID NO: 1. As a result of comparing the 16S rDNA sequences of Lactobacillus reuteri NK33 by means of BLAST search, it was identified that a Lactobacillus reuteri strain having the same 16S rDNA sequence is not searched at all, and 99% homologous to the 16S rDNA sequence of a known Lactobacillus reuteri strain.

(67) Out of physiological characteristics of Lactobacillus reuteri NK33, availability of carbon source was analyzed with a sugar fermentation test using API 50 CHL kit (BioMerieux's, USA). The results thereof are as shown in a following table 3. In Table 3 below, + indicates that availability of carbon source is positive and indicates that availability of carbon source is negative.

(68) TABLE-US-00003 TABLE 3 Carbon source L. reuteri NK33 CONTROL Glycerol Erythritol D-arabinose L-arabinose + D-ribose + D-xylose + L-xylose D-adonitol Methyl--D-xylopyranoside D-galactose + D-glucose + D-fructose + D-mannose + L-sorbose Rhamnosus Dulcitol Inocitol Mannitol + Sorbitol -methyl-D-mannoside -methyl-D-glucoside N-acetyl-glucosamine + Amygdalin + Arbutin + Esculin + Salicin + Cellobiose + Maltose + Lactose + Melibiose + Sucrose + Trehalose + Inulin Melezitose + Raffinose + Starch Glycogen Xylitol Gentiobiose + D-turanose + D-lixose D-tagatose D-fucose L-fucose D-arabitol L-arabitol Gluconate 2-keto-gluconate 5-keto-gluconate

(4) Physiological Characteristics of Bifidobacterium adolescentis NK98, a Novel Lactic Acid Bacterium

(69) Out of strains described in Table 2 above, it was shown that a 16S rDNA of Bifidobacterium adolescentis NK98 (accession number KCCM12297P) has a sequence of SEQ ID NO: 38. As a result of comparing the 16S rDNA sequences of Bifidobacterium adolescentis NK98 by means of BLAST search, it was identified that a Bifidobacterium adolescentis NK98 strain having the same 16S rDNA sequence is not searched at all, and 98% homologous to the 16S rDNA sequence of a known Bifidobacterium adolescentis strain.

(70) Out of physiological characteristics of Bifidobacterium adolescentis NK98, availability of carbon source was analyzed with a sugar fermentation test using API kit (API 20A, BioMerieux's, USA). The results thereof are as shown in a following table 4. In Table 4 below, + indicates that availability of carbon source is positive and indicates that availability of carbon source is negative.

(71) TABLE-US-00004 TABLE 4 Carbon source Reaction/Enzyme B. adolescentis NK98 L-tryptophan Indole formation Urea Urease D-glucose Acidification (glucose) + D-mannitol Acidification (mannitol) + D-lactose Acidification (lactose) + D-saccharose Acidification (saccharose) + D-maltose Acidification (maltose) + Salicin Acidification (salicin) + D-xylose Acidification (xylose) L-arabinose Acidification (arabinose) + Gelatin Hydrolysis (protease) + Esculin ferric citrate Hydrolysis (-glucosidase) + Glycerol Acidification (glycerol) D-cellobiose Acidification (cellobiose) D-mannose Acidification (mannose) D-melezitose Acidification (melezitose) D-raffinose Acidification (raffinose) + D-sorbitol Acidification (sorbitol) L-rhamnose Acidification (rhamnose) D-trehalose Acidification (trehalose) + Catalase Spores Gram reaction + Morphology

Example 6: Comparison of Activity of Isolated Lactic Acid Bacteria

(1) Antioxidant Activity (In Vitro)

(72) DPPH (2,2-Diphenyl-1-picrylhydrazyl) was dissolved in ethanol to reach a 0.2 mM concentration, such that a DPPH solution was prepared. A suspension of lactic acid bacteria (110.sup.8 CFU/ml) or a vitamin C solution (1 g/ml) was inserted into 0.1 ml of the said DPPH solution, and then cultured at 37 C. for 20 minutes. A culture fluid was centrifuged at 3000 rpm for five minutes, such that supernatant was obtained. After that, an absorbance of the supernatant was measured at 517 nm, and then antioxidant activity of isolated lactic acid bacteria was calculated accordingly. Antioxidant activity of each lactic acid bacterium is as shown in following table 5 (Lactobacillus spp.) and table 6 (Bifidobacterium spp.).

(2) Measurement of Inflammatory Indicators in Macrophage

(73) 2 ml of sterilized 4% thioglycolate was intraperitoneally administered into a C57BL/6 mouse (male, 6-week old, 20-23 g). In 96 hours later, the mouse was anesthetized, and then 8 ml of RPMI 1640 medium was intraperitoneally administered to the mouse. In 5 to 10 minutes later, an RPMI medium (macrophage) was intraperitoneally extracted from the mouse, then centrifuged at 1000 g for 10 minutes, and then washed twice again with an RPMI 1640 medium. The said macrophage was spread into a 24-well plate at 0.510.sup.6 cells per well, then treated with isolated Lactobacillus spp. lactic acid bacteria and lipopolysaccharide, an inflammatory reaction inducer for 2 or 24 hours, and then supernatant and cells were obtained. The obtained cells were inserted into an RIPA buffer (Gibco) and homogenized. An expression level of cytokines such as TNF- was measured from a culture supernatant treated for 24 hours, and then expression levels of p65 (NF-B), p-p65 (phosphor-NF-B) and -actin were measured from the cells obtained with treatment for two hours by means of an immunoblotting method. Expression levels of inflammatory indicators for each Lactobacillus spp. lactic acid bacterium are as shown in a following table 5.

(3) Measurement of Inflammatory Indicators in Microglia

(74) A BV-2 microglia was spread into a 24-well plate at 0.510.sup.6 cells per well, then treated with isolated Bifidobacterium spp. lactic acid bacteria and lipopolysaccharide, an inflammatory reaction inducer, for 2 or 24 hours, and then supernatant and cells were obtained. The obtained cells were inserted into an RIPA buffer (Gibco) and homogenized. Expression levels of p65 (NF-B), p-p65 (phosphor-NF-B) and -actin were measured from the cells obtained with treatment for two hours by means of an immunoblotting method. Expression levels of inflammatory indicators for each Bifidobacterium spp. lactic acid bacterium are as shown in a following table 6.

(4) Effect of Brain Derivated Neurotrophic Factor (BDNF) Expression and NF-B Activation on SH-SY5Y Cells

(75) SH-SY5Y cells, which are a nerve call, were purchased from Korean Cell Line Bank, then cultured in a DMEM medium containing 10% FBS and 1% antibiotics, and then divided into a 12-well plate at 210.sup.6 cells per well. After that, corticosterone was added into each well at a concentration of 300 mg/ml along with lactic acid bacteria (110.sup.4 CFU/ml), then cultured, and then expression levels of NF-B (p65, p-p65) and brain derivated neurotrophic factor (BDNF) were measured by means of an immunoblotting method. The BDNF expression levels and NF-B activation levels for each lactic acid baterium are as shown in following table 5 (Lactobacillus spp.) and table 6 (Bifidobacterium spp.).

(76) TABLE-US-00005 TABLE 5 Macrophage SH-SY5Y cell TNF- IL-10 NF-B BDNF Antioxidant inhibitory expression inhibitory Expression NF-B Strain name activity capacity increase capacity increase inhibition L. reuteri NK31 + + + + + + L. reuteri NK32 ++ ++ ++ ++ + ++ L. reuteri NK33 +++ ++ ++ ++ ++ ++ L. reuteri NK34 + + + + + + L. reuteri NK35 + + + + + + L. johnsonii NK36 ++ ++ ++ + ++ + L. johnsonii NK37 ++ ++ ++ ++ + ++ L. johnsonii NK38 + + + + + + L. johnsonii NK39 + + + + +

(77) TABLE-US-00006 TABLE 6 Microglia NF-B SH-SY5Y cell Antioxidant inhibitory BDNF expression Strain name activity capacity capacity Untreated L. reuteri NK33 +++ ++ ++ B. longum NK81 + + + B. longum NK82 + + + B. longum NK83 ++ + + B. longum NK84 ++ ++ + B. bifidum NK85 ++ ++ + B. bifidum NK86 + + B. infantis NK87 ++ + + B. infantis NK88 + + ++ B. infantis NK89 + + + B. breve NK90 + + ++ B. breve NK91 ++ + + B. choerinum NK92 + + + B. catenulatum NK93 + + + B. catenulatum NK94 + + + B. adolescentis NK95 ++ + + B. pseudolongum NK96 ++ + + B. adolescentis NK97 + + + B. adolescentis NK98 ++ +++ +++ B. adolescentis NK99 + ++ ++ B. pseudocatenulatum ++ + ++ NK100 B. pseudocatenulatum ++ + + NK101 B. minimum NK102 + + + * , <10%; +, 10~30%; ++, 30~50%; +++, >50%

(5) Experimental Results

(78) As a result of evaluating the activity of isolated lactic acid bacteria, it was identified that out of isolated Lactobacillus spp. or Bifidobacterium spp. lactic acid bacteria, Lactobacillus reuteri NK33 and Bifidobacterium adolescentis NK98 herein have a remarkably excellent effect on promoting antioxidant activity and inhibiting inflammatory reactions. In particular, it was identified that Lactobacillus reuteri NK33 and Bifidobacterium adolescentis NK98 inhibit the activity of NF-B, known as a substance of inducing aging-related diseases such as Alzheimer's disease, inhibit an inflammatory reaction of microglia present in aging, dementia and the like, and increase an expression of a brain derived neurotrophic factor (BDNF) which is produced by a brain nerve, but decreased in aging, dementia and the like (Tables 5 and 6).

Example 7: Evaluation of an Immunoregulatory Effect of Isolated Bifidobacterium Spp. Lactic Acid Bacteria

(79) To evaluate an immunoregulatory effect of Bifidobacterium spp. lactic acid bacteria isolated from feces, the effect of Bifidobacterium spp. lactic acid bacteria on an immuno reaction of macrophage and spleen cells was measured.

(1) Immuno Reaction in Macrophage

(80) 2 ml of sterilized 4% thioglycolate was intraperitoneally administered into a C57BL/6 mouse (male, 6-week old, 20-23 g, Raonbio Co., Ltd.). In 96 hours after administration, the mouse was anesthetized, and then 8 ml of RPMI 1640 medium was intraperitoneally administered to the mouse. In 5 to 10 minutes later, an RPMI medium (including macrophage) was intraperitoneally extracted from the mouse, then centrifuged at 1000 rpm for 10 minutes, and then washed twice again with an RPMI 1640 medium. The said macrophage was spread over a 24-well plate at 0.510.sup.6 cells per well, then cultured for 24 hours, and then unattached cells were removed and used.

(81) The said macrophage culture fluid was treated with Bifidobacterium adolescentis NK98 and lipopolysaccharide, an inflammatory reaction inducer, for 2 or 24 hours, and then supernatant and cells were obtained, wherein a concentration for treating lactic acid bacteria was 110.sup.4 CFU/ml. The obtained cells were inserted into an RIPA buffer (Gibco) and homogenized. An expression level of TNF- from the obtained supernatant was measured by means of ELISA kit, and then expression levels of p65 (NF-B), p-p65 (phosphor-NF-B) and -actin from the obtained cells were measured by means of an immunoblotting method. Particularly, 50 g of the supernatant was taken and subjected to electrophoresis in SDS 10% (w/v) polyacrylamide gel for one and half an hour. A sample subjected to electrophoresis was transferred onto a nitrocellulose paper on condition of 100 V and 400 mA for one hour and 10 minutes. The nitrocellulose paper, onto which the sample was transferred, was subjected to blocking by means of 5% skimmed milk for 30 minutes, then washed with PBS-Tween three times each for five minutes, and then subjected to reaction overnight with primary antibodies (Santa Cruz Biotechnology, the U.S.) at a ratio of 1:100. After that, such paper was washed three times each for 10 minutes, and subjected to reaction with secondary antibodies (Santa Cruz Biotechnology, the U.S.) at a ratio of 1:1000 for one hour and 20 minutes. Then, such paper was washed three times each for 15 minutes, then subjected to fluorescence and luminescence, then developed, and then intensity of a chromophore band was measured, wherein the results thereof are as shown in a following table 7.

(82) TABLE-US-00007 TABLE 7 NF-B inhibitory TNF- capacity inhibitory Strain name (p-p65/p65) capacity Untreated B. adolescentis NK98 + ++ * Inhibition rate: , <10%; +, 10~30%; ++, 30~60%; +++, >60

(2) Immuno Reaction in Spleen Cells

(83) A spleen of a C57BL/6 mouse (male, 6-week old, 20-22 g, OrientBio Co., Ltd.) was isolated and crushed, and then suspended in an RPMI 1640 medium containing 10% FCS. CD4 T cells were isolated therefrom by means of CD4 T cell isolation kit (MiltenyiBiotec, Bergisch Gladbach, Germany), and then the isolated CD4 T cells were divided into a 12-well plate at 510.sup.5 cells per well.

(84) The cells were cultured with an addition of anti-CD3, anti-CD28, IL-2 and IL-12 to induce differentiation of T cells into Th1 cells; anti-CD3, anti-CD28, IL-2 and IL-4 to induce differentiation of T cells into Th2 cells; anti-CD3, anti-CD28, IL-6 and TGF- to induce differentiation of T cells into Th17 cells; and anti-CD3 and anti-CD28 to induce differentiation of T cells into Treg cells, then lactic acid bacteria were inserted thereinto at 110.sup.5 CFU/ml per well, and then cultured for four days.

(85) After that, a differentiation potency of T cells isolated from the spleen into Th1 cells, Th2 cells, Th17 cells and Treg cells was measured. Particularly, cells of culture fluid were stained with anti-FoxP3 or anti-IL-17A antibodies, and then a distribution of Th1 cells, Th2 cells, Th17 cells and Treg cells was analyzed by means of FACS (fluorescence-activated cell sorting) device (C6 Flow Cytometer System, San Jose, CA, USA), wherein the results thereof are as shown in a following table 8.

(86) TABLE-US-00008 TABLE 8 Differentiation Strain Differentiation inhibition rate increase rate name Th1 cell Th2 cell Th17 cell Treg cell Untreated B. longum NK81 + ++ + + B. longum NK82 + ++ + + B. longum NK83 + ++ ++ + B. longum NK84 +++ + +++ ++ B. bifidum NK85 +++ + +++ ++ B. bifidum NK86 + + +++ + B. infantis NK87 + + +++ ++ B. infantis NK88 + + +++ + B. infantis NK89 + + +++ + B. breve NK90 + +++ ++ ++ B. breve NK91 ++ ++ + + B. choerinum NK92 + + B. catenulatum NK93 + ++ ++ + B. catenulatum NK94 ++ + + ++ B. adolescentis NK95 ++ + + + B. pseudolongum NK96 ++ ++ ++ + B. adolescentis NK97 + ++ + + B. adolescentis NK98 ++ ++ +++ +++ B. adolescentis NK99 + + ++ + B. pseudocatenulatum ++ ++ + + NK100 B. pseudocatenulatum + ++ + + NK101 B. minimum NK102 + + + + * Inhibition rate: , <10%; +, 10-30%; ++, 30-60%; +++, >60 * Increase rate: , <10%; +, 10-50%; ++, 50-100%; +++, >100%

(87) Also, expression rates of transcription factors and cytokines of Th1 cells, Th2 cells, Th17 cells and Treg cells isolated from the spleen T cells were measured. Particularly, the expression levels of T-bet, IFN- and IL-12 from a Th1 cell differentiation-inducing culture fluid; GATA3 and IL-5 from a Th2 cell differentiation-inducing culture fluid; RORt and IL-17 from a Th17 cell differentiation-inducing culture fluid; and Foxp3 and IL-10 from a Treg cell differentiation-inducing culture fluid were analyzed by means of qRT-PCR, wherein the results thereof are as shown in a following table 9.

(88) TABLE-US-00009 TABLE 9 Expression inhibition rate Expression IL-5 increase rate Strain name T-bet IFN- GATA3 cell RORt IL-17 FOXp3 IL-10 Untreated B. longum NK81 ++ + + + + + + B. longum NK82 + + + + + + + + B. longum NK83 + + + + + + + + B. longum NK84 ++ ++ + + +++ +++ ++ ++ B. bifidum NK85 +++ +++ + + + + ++ ++ B. bifidum NK86 - - + + + + + + B. infantis NK87 + + + + + + + + B. infantis NK88 + + ++ ++ + + + + B. infantis NK89 + + + + ++ ++ + + B. breve NK90 + + +++ +++ ++ ++ ++ ++ B. breve NK91 + + + + + +++ ++ + B. choerinum NK92 + + + + + ++ + ++ B. catenulatum NK93 + + + + + + + + B. catenulatum NK94 ++ + + + + + + + B. adolescentis NK95 + + + + ++ ++ ++ ++ B. pseudolongum NK96 + + + + + + + + B. adolescentis NK97 + + + + + + + + B. adolescentis NK98 ++ ++ ++ ++ +++ +++ +++ +++ B. adolescentis NK99 + ++ + + + + + + B. pseudocatenulatum NK100 ++ + + + + + B. pseudocatenulatum NK101 ++ + + + + + B. minimum NK102 + + + + + * Inhibition rate: , <10%; +, 10-30%; ++, 30-60%; +++, >60 * Increase rate: , <10%; +, 10-50%; ++, 50-100%; +++, >100%

(89) As identified in Tables 8 and 9 above, it was identified that Bifidobacterium adolescentis NK98 has a high inhibition rate on the differentiation of T cells into Th1 cells, Th2 cells and Th17 cells and in particular has a high increase rate on the differentiation of T cells into Treg cells, thus effectively inhibiting an inflammatory reaction, and effectively improving an inflammatory disease accordingly.

Example 8: Effect of Lactobacillus reuteri NK33 on Reducing Stress

(90) From Day 7 after starting a immobilization stress process with regard to a mouse, which had been subjected to immobilization stress as shown in Experimental Example 1 above, 110.sup.9 cfu of Lactobacillus reuteri NK33, a novel lactic acid bacterium, or physiological saline solution was administered once daily for five days to the mouse. According to Experimental Examples 2 to 5, an experiment was performed on the mouse above.

(91) As a result of performing Experimental Example 2, it was identified in a group (IS) administered with physiological saline solution that OT and OE are decreased in an elevated plus maze test; time in bright area is decreased in a light/dark transition test; and a marble-burying behavior is increased in a marble burying test. However, it was identified in a group (IS+LR) administered with Lactobacillus reuteri NK33 that OT and OE are increased; time in bright area is increased; and a marble-burying behavior is decreased in a marble burying test (FIGS. 14 (a) to (c)).

(92) It was identified in the group (IS) administered with physiological saline solution that an NF-B activity (p-p65/p65) is increased in a hippocampus; an expression level of a brain derivated neurotrophic factor (BDNF) is decreased; and amounts of corticosterone, IL-6, TNF- and lipopolysaccharide in blood are increased. However, it was identified in the group (IS+LR) administered with Lactobacillus reuteri NK33 that an NF-B activity (p-p65/p65) is inhibited; an expression level of a brain derivated neurotrophic factor (BDNF) is increased; and amounts of corticosterone, IL-6, TNF- and lipopolysaccharide in blood are decreased (FIGS. 14 (d) to (g)).

(93) As a result of performing Experimental Example 5, it was identified in the group (IS) administered with physiological saline solution that as indicators of colitis, a length of a colon is decreased; myeloperoxidase is increased; TNF- of the colon is increased; expressions of COX-2 and iNOS of the colon are increased; and an NF-B activity is increased. However, it was identified in the group (IR) administered with Lactobacillus reuteri NK33 that a length of a colon is recovered to a normal level; myeloperoxidase is decreased; TNF- of the colon is decreased; expressions of COX-2 and iNOS of the colon are decreased; and an NF-B activity is inhibited (FIGS. 15 (a) to (d)).

(94) From the results, it was identified that Lactobacillus reuteri NK33, the novel lactic acid bacterium, has an excellent effect of improving a mental disorder, such as anxiety, depression, stress and the like.

Example 9: Effect of Bifidobacterium adolescentis NK98 on Reducing Stress

(95) From Day 7 after starting the immobilization stress process with regard to the mouse, which had been subjected to immobilization stress as shown in Experimental Example 1 above, 110.sup.9 cfu of Bifidobacterium adolescentis NK98 (NK98), 110.sup.9 cfu of Bifidobacterium adolescentis IM38 (IM38), physiological saline solution (IS) or 1 mg/kg of Buspirone was administered once daily for three days to a mouse. Then, according to Experimental Examples 2 and 5 above, an experiment was performed.

(1) Elevated Plus Maze Test

(96) Along with an elevated plus maze test of Experimental Example 2-(1) above, an amount of corticosterone (BC) in blood was measured, wherein the results thereof are as shown in a following table 10.

(97) TABLE-US-00010 TABLE 10 Anxious mouse Depressive mouse BC BC OT (%) OE (%) (ng/mL) OT (%) OE (%) (ng/mL) Normal 17.1 35.2 0.8 18.2 38.5 0.7 control IS 5.2 16.1 2.8 3.4 13.5 7.4 NK98 16.2 34.1 1.2 16.2 32.3 3.5 IM38 14.3 32.6 1.5 13.3 28.6 4.1 Buspirone 16.7 33.8 1.2 15.7 29.8 3.8

(98) As identified in Table 10 above, it was identified in the group (IS) of immobilization stress models administered with physiological saline solution that both OT and OE are decreased in an elevated plus maze test compared to a normal control group without immobilization stress. However, it was identified in a group administered with Bifidobacterium adolescentis NK98 that time spent in open arms (OT) and frequency of open arm entries (OE) are increased; and an amount of corticosterone in blood is remarkably decreased, thus showing a more excellent effect compared to Bifidobacterium adolescentis IM38.

(2) Light/Dark Transition Test

(99) According to Experimental Example 2-(2) above, a light/dark transition test was performed, wherein the results thereof are as shown in a following table 11.

(100) TABLE-US-00011 TABLE 11 Time in Number of bright area (%) transitions Normal control 46.5 23.5 IS 23.1 13.8 NK98 39.4 21.9 IM38 35.8 18.3 Buspirone 40.1 19.6

(101) As identified in Table 11 above, it was identified in a group (IS) of immobilization stress models administered with physiological saline solution that time in bright area is decreased compared to a normal control group without immobilization stress, but in a group administered with Bifidobacterium adolescentis NK98 that time in bright area is increased compared to a group administered with Bifidobacterium adolescentis IM38.

(3) Forced Swimming Test

(102) According to Experimental Example 2-(4) above, a forced swimming test was performed, wherein the results thereof are as shown in a following table 12.

(103) TABLE-US-00012 TABLE 12 Immobility time (%) Normal control 28.5 IS 46.7 NK98 31.2 IM38 38.2 Buspirone 32.1

(104) As identified in Table 12 above, it was identified in a group (IS) of depressed mouse models administered with physiological saline solution that an immobility time is increased compared to a normal control group without immobilization stress, and in a group administered with Bifidobacterium adolescentis NK98 that the immobility time is decreased compared to a group administered with Bifidobacterium adolescentis IM38.

(4) Tail Suspension Test (TST)

(105) According to Experimental Example 2-(5) above, a tail suspension test (TST) was performed, wherein the results thereof are as shown in a following table 13.

(106) TABLE-US-00013 TABLE 13 Immobility time (%) Normal control 21.5 IS 37.9 NK98 24.2 IM38 26.9 Buspirone 25.2

(107) As identified in Table 13 above, it was identified in a group (IS) of depressed mouse models administered with physiological saline solution that an immobility time is increased compared to a normal control group without immobilization stress, but in a group administered with Bifidobacterium adolescentis NK98 that the immobility time is decreased.

(5) Measurement of Biomarkers

(108) In two hours after performing a last behavioral experiment on a depressed mouse, the mouse was anesthetized, and corticosterone in blood was measured by means of ELISA, and a brain derivated neurotrophic factor (BDNF) and NF-B of a brain and NF-B of a colon were measured by means of immunoblotting by the same method as shown in Experimental Example 5 above, wherein the results thereof are as shown in a following table 14.

(109) TABLE-US-00014 TABLE 14 NF-kB activation BDNF Blood inhibitory expression corticosterone capacity level (ng/mL) Normal control 0.7 IS 7.4 NK98 +++ +++ 3.5 IM38 ++ ++ 4.1 Buspirone 3.8 * , <10%; +, 10~30%; ++, 30~50%; +++, >50%

(110) As identified in Table 14 above, it was identified in a group (IS) administered with physiological saline solution that an NF-B activity (p-p65/p65) is increased in a hippocampus; an expression level of a brain derivated neurotrophic factor (BDNF) is decreased; and an amount of corticosterone in blood is increased. However, it was identified in a group administered with NK98 that an NF-B activity is inhibited; an expression level of the BDNF is increased; and an amount of corticosterone in blood is decreased, wherein such effect is excellent compared to a group administered with IM38.

(6) Effect of Improving Colitis

(111) In two hours after performing a last behavioral experiment on an anxious mouse in Experimental Example 1, the mouse was anesthetized, and a colon length and activations of MPO, COX-2, TNF- and NF-Kb were measured by the same method as shown in Experimental Example 5, wherein the results thereof are as shown in a following table 15.

(112) TABLE-US-00015 TABLE 15 Colon MPO Inflammatory indicator length inhibitory inhibition rate (cm) capacity NF-B COX-2 TNF- Normal 6.2 control IS 5.1 NK98 5.7 +++ +++ +++ +++ IM38 5.5 +++ ++ ++ ++ Buspirone 5.2 + + + + * , <10%; +, 10~30%; ++, 30~50%; +++, >50%

(113) As identified in Table 15 above, it was identified in a group (IS) of immobilization stress models administered with physiological saline solution that a colon length is decreased and MPO and inflammatory indicators are increased compared to a normal control group without immobilization stress, but in a group administered with Bifidobacterium adolescentis NK98 that a colon length is recovered, and the MPO inhibitory capacity and inflammatory indicators are improved.

(7) Effect of Reducing Antibiotics-Induced Stress

(114) According to Experimental Examples 2 to 5, an experiment was performed on a mouse, which had been subjected to antibiotic stress with an administration of ampicillin (100 mg/kg) for consecutive two days by the same method as shown in Experimental Example 1-(2) above, wherein the results thereof are as shown in following Tables 16 and 17.

(115) TABLE-US-00016 TABLE 16 Time spent Open arm Blood in open entries corticosterone arms (%) (%) (ng/ml) Normal 16.8 33.5 0.8 control IS 4.9 13.4 3.2 NK98 14.3 30.5 1.6 IM38 12.9 29.2 1.9 Buspirone 14.1 31.3 1.6

(116) TABLE-US-00017 TABLE 17 Colon MPO Inflammatory indicator length inhibitory inhibition rate (cm) capacity NF-B COX-2 TNF- Normal 6.3 control IS 5.4 NK98 6.1 +++ +++ +++ +++ IM38 5.8 ++ ++ ++ ++ Buspirone 5.5 + + + + * , <10%; +, 10~30%; ++, 30~50%; +++, >50%

(117) As identified in Table 16 above, it was identified in a group (IS) of antibiotics-induced stress models administered with physiological saline solution that OT and OE are decreased compared to a normal control group in an elevated plus maze test, and in a group administered with Bifidobacterium adolescentis NK98 that OT and frequency of OE are increased and an amount of corticosterone in blood is remarkably decreased, wherein such effect is excellent compared to Bifidobacterium adolescentis IM38.

(118) As identified in Table 17 above, it was identified in a group (IS) of antibiotics-induced stress models administered with physiological saline solution that a colon length is decreased compared to a normal control group, and MPO and inflammatory indicators are increased, but in a group administered with Bifidobacterium adolescentis NK98 that a colon length is recovered and MPO inhibitory capacity and inflammatory indicators are improved.

Example 10: Effect of Bifidobacterium adolescentis NK98 on Improving a Cognitive Function

(119) On a following day after intraperitoneally administering LPS isolated from E. coli (0.5 mg/kg/day) to a mouse for five days, lactic acid bacteria were administered thereto, and an effect of lactic acid bacteria on improving a cognitive function was identified in such a way that an object recognition test and a Y maze test were performed and BDNF in a hippocampus was measured by immunoblotting, wherein the results thereof are as shown in a following table 18.

(120) Particularly, as an object recognition test method, two objects (A, A) of the same shape and size were fixed into a box (404040 cm), of which outside is not visible from the inside, then a mouse was allowed to start moving at the center of the box, and then the number of touching the two objects was recorded for 10 minutes. In 24 hours later, one of the two objects was replaced with a new one (A, B), and then the number of touching an old one and a new one was recorded and quantified.

(121) Also, as a Y maze test method, a test apparatus consisted of the three identical arms (8 cm in length, 30 cm in width, 14 cm in height), each positioning at a certain angle of 120. The mouse was placed at the end of one arm and allowed to freely move in a Y maze for eight minutes, after which the number and order of entering respective arms were measured, so as to evaluate a spontaneous alteration (%). The alteration was defined as an alphabetical character order, in which the mouse sequentially entered into three arms, i.e. ABC, BCA, CAB, etc.
% alteration=[Total number of alterations]/[Total number of arm entries2]100

(122) TABLE-US-00018 TABLE 18 Object Y maze Hippocampus recognition test BDNF test (%) (%) expression capacity Normal 52.1 76.5 control IS 38.5 56.7 NK98 48.6 68.4 +++ IM38 46.5 64.5 ++ Buspirone 42.9 62.4 + * , <10%; +, 10~30%; ++, 30~50%; +++, >50%

(123) As identified in Table 18 above, it was identified in a group administered with Bifidobacterium adolescentis NK98 that a cognitive function is improved and an expression of BDNF is increased through the object recognition test and the Y maze test.

Example 11: Effect of Reducing Stress According to a Co-Administration of Two Types of Lactic Acid Bacteria

(124) Lactobacillus reuteri NK33, a novel lactic acid bacterium, Bifidobacterium adolescentis IM38 (accession number: KCCM11807P), a bacterium disclosed in Korean patent publication No. 10-2017-0090359, or a mixture thereof were compared to each other in terms of an effect of reducing stress.

(125) Particularly, physiological salt solution (IS), 110.sup.9 cfu of Lactobacillus reuteri NK33 (NK33), 110.sup.9 cfu of Bifidobacterium adolescentis IM38 (IM38) or a combination of the said lactic acid bacteria (NK33+IM38) each 0.510.sup.9 cfu was administered into a model with immobilization stress induced as shown in Experimental Example 1-(1) above, and then an elevated plus maze test was performed. After that, blood was collected from each group, and then an amount of corticosterone in blood was measured, wherein the results thereof are as shown in a following table 19.

(126) TABLE-US-00019 TABLE 19 Time spent Open Blood in open arm corticosterone arms (%) entries (%) (ng/mL) Normal 16.1 34.0 0.9 control IS 5.4 16.1 2.4 NK33 14.1 33.5 1.4 IM38 14.8 31.5 1.5 NK33 + IM38 17.3 36.5 1.2

(127) As identified in Table 19 above, it was identified in a co-administration group that time spent in open arms and open arm entries are increased and an amount of corticosterone in blood is remarkably decreased compared to a group administered with lactic acid bacteria alone.

(128) Also, an effect of a mixture of Lactobacillus reuteri NK33 and Bifidobacterium adolescentis NK98 on reducing stress was compared by the same method as shown in an experiment on a co-administration of NK33 and IM38 above, wherein the results thereof are as shown in a following table 20.

(129) TABLE-US-00020 TABLE 20 Time spent Open Blood in open arm entries corticosterone arms (%) (%) (ng/mL) Normal 18.1 34.2 0.9 control IS 5.5 17.1 2.9 NK33 14.1 33.5 1.4 NK98 16.8 33.3 1.3 NK33 + NK98 18.5 38.2 1.1

(130) As identified in Table 20 above, it was identified in the co-administration group that time spent in open arms and open arm entries are increased and an amount of corticosterone in blood is remarkably decreased compared to a group administered with lactic acid bacteria alone.

(131) <Accession Information of Lactic Acid Bacteria>

(132) The present inventors deposited Lactobacillus reuteri NK33 for the purpose of patent to the Korean Culture Center of Microorganisms, a certified depository institution (address: Yulim Building, 45, Hongjenae 2ga-gil, Seodaemun-gu, Seoul, South Korea) on Aug. 4, 2017, and received an accession number of KCCM12090P.

(133) Also, the present inventors deposited Bifidobacterium adolescentis NK98 for the purpose of patent to the Korean Culture Center of Microorganisms, a certified depository institution (address: Yulim Building, 45, Hongjenae 2ga-gil, Seodaemun-gu, Seoul, South Korea) on Aug. 3, 2018, and received an accession number of KCCM12297P.