METHOD OF AMPLIFYING MRNAS AND FOR PREPARING FULL LENGTH MRNA LIBRARIES

Abstract

An inventive method for amplifying at least one RNA which is contained in a sample includes reverse transcribing the at least one RNA using a first primer, adding a dideoxy nucleotide which is modified in the 3′-position with a first partner of a pair of azide and alkyne molecules by action of a template independent polymerase to attach a single 3′-azide- or 3′-alkyne-modified dideoxy nucleotide at the 3′-end of the obtained cDNA, adding an adapter molecule which comprises a polynucleotide sequence and at its 5′-end a second partner of such pair of azide and alkyne molecules and ligating the adapter to the 3′-modified cDNA under formation of a triazole linkage, adding a second primer which is complementary to at least a part of the adapter molecule and which contains at its 3′-end a nucleotide which is complementary to the dideoxy nucleotide at the 3′-end of the cDNA to effect hybridization and binding of the second primer overlapping the triazole linkage, adding a third primer and amplifying the full length cDNA. Variations of this method are also disclosed. Uses of such method especially for preparing a full length RNA library and for sequencing of a plurality of RNAs contained in a sample, as well as reagent kits for performing such methods are also disclosed and included in the invention.

Claims

1. Method for amplifying and/or sequencing at least one RNA, preferably mRNA, contained in a sample, the method comprising: a) providing at least one first primer, which first primer includes a sequence which is complementary to a sequence which is located at or near the 3′-end of the at least one RNA to be amplified, and adding said at least one first primer to the sample under conditions which allow for hybridization of at least one first primer to at least one RNA, b) reverse transcribing the at least one RNA under conditions including addition of a reverse transcriptase and nucleotides to the sample to provide full length cDNA(s) of the at least one RNA, c) purifying the sample at least from excess nucleotides d) adding a dideoxy nucleotide, which dideoxy nucleotide is modified at the 3′-position to include a first partner of a pair of azide and alkyne molecules, and a template-independent polymerase to attach a single 3′-azide- or 3′-alkyne modified dideoxy nucleotide at the 3′-end of the cDNA(s) obtained in step b), e) purifying the sample at least from excess modified dideoxy nucleotide added in step d), f) adding an adapter molecule, the adapter molecule comprising a polynucleotide sequence and, attached to its 5′ end, a second partner of said pair of azide and alkyne molecules, under conditions to perform a click reaction and to ligate the adapter molecule to the 3′-modified cDNA(s) obtained in step d) under formation of a triazole linkage, g) adding a second primer, the second primer comprising a nucleotide sequence which is complementary to at least 6 of the nucleotides at the 5′-end of the adapter molecule and contains at its 3′-end a nucleotide which is complementary to the dideoxy nucleotide at the 3′-end of the cDNA(s), to effect hybridization and binding of the second primer to the ligated adapter/cDNA molecule obtained in step e) at a position overlapping the triazole linkage, and alternatively h) adding a DNA polymerase to achieve chain extension of the second primer to produce second strand DNA(s) including sequences complementary to the whole cDNA(s) obtained in step b), and either i) sequencing the second strand DNA(s) of step h), or j) adding a third primer which is identical to at least a part of the first primer, and amplifying the full length cDNA(s) to obtain a full length RNA library, or h′) adding a DNA polymerase to achieve chain extension of the second primer and simultaneously determining the sequence of the second strand DNA(s) and the whole cDNA(s).

2. Method for amplifying and or sequencing at least one RNA, preferably mRNA contained in a sample, the method comprising: a) providing at least one first primer, which first primer includes a sequence which is complementary to a sequence which is located at or near the 3′-end of the at least one mRNA to be amplified, and which primer contains a modification by a first partner of a pair of azide and alkyne molecules at its 5′ end, and adding said at least one first primer to the sample under conditions which allow for hybridization of at least one first primer to at least one mRNA, b) reverse transcribing the at least one mRNA under conditions including addition of a reverse transcriptase and nucleotides to the sample to provide full length cDNA(s) of the at least one mRNA, c) purifying the sample at least from excess nucleotides d) adding a dideoxy nucleotide, which dideoxy nucleotide is modified at the 3′-position to include a second partner of a pair of azide and alkyne molecules, and a template-independent polymerase to attach a single 3′-azide- or 3′-alkyne modified dideoxy nucleotide at the 3′-end of the cDNA(s) obtained in step b), e) purifying the sample at least from excess modified dideoxy nucleotide added in step d), f) performing a click ligation reaction to generate circular single stranded cDNA(s) under formation of a triazole linkage, g) adding a second primer, the second primer comprising a nucleotide sequence which is complementary to at least 6 of the nucleotides at the 5′-end of first primer and contains at its 3′-end a nucleotide which is complementary to the dideoxy nucleotide at the 3′-end of the cDNAs, to effect hybridization and binding of the second primer to the ligated circular first primer/cDNA molecule(s) obtained in step f) at a position overlapping the triazole linkage, and either h) adding a DNA polymerase to achieve chain extension of the second primer and subsequently amplify the full length cDNA(s) or h′) adding a DNA polymerase to achieve chain extension of the second primer and simultaneously determining the sequence of the circular single stranded DNA(s) including the whole cDNA(s).

3. Method according to claim 1, wherein in step a) as the at least one first primer a poly(dT) primer, preferably including a 5′-extension of 2 to 50 nucleotides as anchor sequence, is provided and added to the sample under conditions which allow for hybridization to the poly(A) tail(s) of the at least one mRNA present in the sample.

4. Method according to claim 1, wherein in step d) 3′-alkyne- or 3′-azide-modified ddGTP or 3′-alkyne- or 3′-azide-modified ddCTP, preferably 3′-azide-modified ddGTP, most preferably 3′-azido-2′,3′-dideoxy GTP (AzddGTP) is used as the dideoxy nucleotide.

5. Method according to claim 1, wherein in step g) a second primer is added which at the 3′-end contains dC or dG, preferably dC.

6. Method according to claim 1, wherein in step g) a second primer is added which at the second position on the 3′-end of the nucleotide sequence contains dC or dG, preferably dC.

7. Method according to claim 1, wherein in step d) terminal deoxynucleotidyl transferase (TdT) is used as the template-independent polymerase.

8. Method according to claim 1, wherein in step f) an alkyne is preferably attached to the 5′-end of the adapter molecule.

9. Method according to claim 1, wherein in step f) the click reaction comprises a copper catalyzed azide-alkyne cycloaddition (CuAAC) or a strain-promoted copper-free click ligation (SPAAC).

10. Use of a method according to claim 1 for preparing a full length mRNA library from a sample containing a plurality of mRNA molecules.

11. Use according to claim 10, wherein the sample containing a plurality of mRNA molecules comprises the total mRNA of one or more types of cells or the whole exome of an organism.

12. Method for sequencing a plurality of mRNAs contained in a sample, the total mRNA of one or more types of cells or the whole exome of an individual, the method comprising providing a sample containing such plurality of mRNAs, such total cell mRNA or exome of an individual, preparing a library of full-length mRNA by performing a method according to claim 1, and determining the sequence of the amplified mRNA or obtained mRNA library.

13. Method according to claim 12, wherein long-read sequencing technology is applied.

14. Method according to claim 12 for variant mapping in complex disorders, investigation of genetic aberrations.

15. Kit for amplifying at least one RNA, preferably mRNA, contained in a sample, the kit comprising: a) a first primer which primer includes a sequence which is complementary to a sequence which is located at or near the 3′-end of the at least one mRNA to be amplified, b) a reverse transcriptase, c) a dideoxy nucleotide which is modified at the 3′ position to include a first partner of a pair of azide and alkyne molecules, d) a template-independent polymerase, e) an adapter molecule comprising a polynucleotide sequence and attached to its 5′-end a second partner of said pair of azide and alkyne molecules f) a second primer comprising a nucleotide sequence which is complementary to at least 6 of the nucleotides at the 5′-part of the adapter molecule and which contains at its 3′-end a nucleotide which is complementary to the dideoxy nucleotide of c), g) a third primer which is identical to at least a part of the first primer.

16. Kit for amplifying and/or sequencing at least one RNA, preferably mRNA, contained in a sample, the kit comprising: a) a first primer which primer includes a sequence which is complementary to a sequence which is located at or near the 3′-end of the at least one mRNA to be amplified and which primer contains a modification by a first partner of a pair of azide and alkyne molecules at its 5′ end, b) a reverse transcriptase, c) a dideoxy nucleotide which is modified at the 3′ position to include a second partner of a pair of azide and alkyne molecules, d) a template-independent polymerase, e) a second primer comprising a nucleotide sequence which is complementary to at least 6 of the nucleotides at the 5′-part of the first primer and which contains at its 3′-end a nucleotide which is complementary to the dideoxy nucleotide of c),

17. Kit according to claim 15, which further comprises at least one of: h) an RNase, i) all four kinds of naturally occurring nucleotides, j) reagents for performing a click reaction, k) buffers and solvents, l) reagents for performing cDNA amplification m) reagents for purification.

18. Method according to claim 2, wherein in step d) 3′-alkyne- or 3′-azide-modified ddGTP or 3′-alkyne- or 3′-azide-modified ddCTP, preferably 3′-azide-modified ddGTP, most preferably 3′-azido-2′,3′-dideoxy GTP (AzddGTP) is used as the dideoxy nucleotide.

19. Method according to claim 2, wherein in step g) a second primer is added which at the 3′-end contains dC or dG, preferably dC.

20. Method according to claim 2, wherein in step g) a second primer is added which at the second position on the 3′-end of the nucleotide sequence contains dC or dG, preferably dC.

21. Method according to claim 2, wherein in step d) terminal deoxynucleotidyl transferase (TdT) is used as the template-independent polymerase.

22. Method according to claim 2, wherein in step f) an alkyne is preferably attached to the 5′-end of the adapter molecule.

23. Method according to claim 2, wherein in step f) the click reaction comprises a copper catalyzed azide-alkyne cycloaddition (CuAAC) or a strain-promoted copper-free click ligation (SPAAC).

24. Use of a method according to claim 2 for preparing a full length mRNA library from a sample containing a plurality of mRNA molecules.

25. Use according to claim 24, wherein the sample containing a plurality of mRNA molecules comprises the total mRNA of one or more types of cells or the whole exome of an organism.

26. Method for sequencing a plurality of mRNAs contained in a sample, the total mRNA of one or more types of cells or the whole exome of an individual, the method comprising providing a sample containing such plurality of mRNAs, such total cell mRNA or exome of an individual, preparing a library of full-length mRNA by performing a method according to claim 2, and determining the sequence of the amplified mRNA or obtained mRNA library.

27. Method for sequencing a plurality of mRNAs contained in a sample, the total mRNA of one or more types of cells or the whole exome of an individual, the method comprising providing a sample containing such plurality of mRNAs, such total cell mRNA or exome of an individual, preparing a library of full-length mRNA by performing a method in accordance with the use of claim 10, and determining the sequence of the amplified mRNA or obtained mRNA library.

28. Method for sequencing a plurality of mRNAs contained in a sample, the total mRNA of one or more types of cells or the whole exome of an individual, the method comprising providing a sample containing such plurality of mRNAs, such total cell mRNA or exome of an individual, preparing a library of full-length mRNA by performing a method in accordance with the use of claim 24, and determining the sequence of the amplified mRNA or obtained mRNA library.

29. Kit according to claim 16, which further comprises at least one of: h) an RNase, i) all four kinds of naturally occurring nucleotides, j) reagents for performing a click reaction, k) buffers and solvents, l) reagents for performing cDNA amplification m) reagents for purification.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0111] FIG. 1 shows a schematic representation of a common prior art PCR amplification of RNA for library preparation. The RNA sample is fragmented using an ultrasonic device, the fragments are (randomly) primed and a first strand synthesis (cDNA synthesis) is performed using a reverse transcriptase. A second strand is generated incorporating uracil instead of dTTP and the double-stranded DNA fragments are purified and blunted. dA tailing is performed to increase the efficiency of the subsequent enzymatic adapter ligation step. Another clean-up step involving size selection is done and the U-containing strand is removed before PCR enrichment.

[0112] FIG. 2 shows a schematic representation of the inventive method including poly(dT) priming to amplify mRNAs and provide full-length mRNA libraries.

[0113] FIG. 3A shows full-length PCR fragments that were generated from a click ligated cDNA pool generated by the inventive method. One primer binds to the click ligated adapter (Adapter Primer1), the second primer is part of the Poly(dT) (Poly(dT) Primer Reverse) used for priming of the reverse transcription. Depending on the extension time (1 to 10 min) the distribution of the PCR fragments shifts towards longer amplificates.

[0114] FIGS. 3B, C show analyses of full-length PCR fragments using a Bioanalyzer device (Agilent). The distribution of dsDNA size for samples with three minutes extension time (C) during PCR clearly shifts to larger size compared to one minute extension time (B).

[0115] FIG. 4 shows PCR fragments that were generated from a click ligated cDNA pool generated by the inventive method. The primers cover the very 5′-end of the transcript. Next to house-keeping genes like GAPDH and β-Gal, mRNAs for eGFP, Cas9 and Fluc were spiked into a Jurkat cell total mRNA pool for internal control.

[0116] FIG. 5 shows PCR fragments that were generated from a click ligated cDNA pool generated by the inventive method. One primer binds to the click ligated adapter, the second primer binds to a gene specific reverse complement (like Int rev in FIG. 4). Except for the artificially produced β-Gal gene fragment, all PCR products are larger as expected compared to FIG. 4.

[0117] FIG. 6 displays exemplary click-ready nucleotides for terminal deoxynucleotidyl transferase mediated 3′-end labeling of single stranded cDNA for the inventive method.

[0118] FIG. 7 displays exemplary click-ready 5′-ends of adapter oligonucleotides for the inventive method.

[0119] FIG. 8 displays exemplary triazole backbone versions for the inventive method compared to the natural phosphodiester (left).

[0120] FIG. 9 shows a schematic representation of an alternative workflow for full-length mRNA sequencing. A 5′-alkyne/azide modified primer is used for reverse transcription and the resulting cDNA is purified. An azide/alkyne nucleotide is incorporated to the 3′-end by the terminal deoxynucleotidyl transferase (TdT) and after removal of excess nucleotide click ligation is performed to generate circular ssDNA. By applying an at least partly complementary primer to the initial primer, amplification or even sequencing of the circular ssDNA would be possible.

[0121] FIG. 10 PCR products (B) of a triazole readover which was performed on the primed model RNA (A). The model RNA was reverse transcribed with a nucleotide mix containing 3′-Azido ddATP, nucleotides were removed and the cDNA was click ligated to a 5′-alkyne adapter (Alkyne-Oligo1). The crude click reaction mix was used as a template for PCRs involving different template amounts, polymerases and cycling conditions.

[0122] FIG. 11 shows the results for TdT mediated AzddNTP incorporation to an unmodified oligonucleotide (Oligo2) and subsequent click with a short model alkyne oligonucleotide (Alkyne-Oligo3) compared to a click between two synthetically prepared oligonucleotides (3′-N.sub.3-Reference, Alkyne Oligo3 and Azide-Oligo2).

[0123] FIG. 12 shows the capillary electrophoresis trace of a Sanger sequencing, which was generated from a PCR fragment (FIG. 5, Lane 4) treated according to the inventive method. The sequencing demonstrates that after the protocol the 5′-end of the mRNA remains intact. Here it was done for Fluc mRNA (firefly luciferase), which was spiked into the RNA pool before reverse transcription. The average quality value score (QV) is 54.34, i.e. >99.999% certainty for the specific sequence.

[0124] The following Examples further illustrate the invention:

EXAMPLES

Example 1 (Relating to FIG. 3)

[0125] For internal control, next to house-keeping genes like GAPDH, mRNAs (0.1 μg) of eGFP (Baseclick), CleanCap®Cas9 (Trilink), CleanCap®β-Gal (Trilink) and CleanCap®Fluc (Trilink) were spiked into 2 μg of Jurkat cell total RNA pool. To this RNA pool, 1 μL dNTP mix (10 mM) and 2 μL of the Poly(dT) Primer (100 μM) were combined to a total volume of 13 μL with RNase free H.sub.2O. The mixture was incubated at 65° C. for 5 min and cooled down to 0° C. for 3 min to allow hybridization. For cDNA synthesis 4 μL 5×SuperScriptIV Buffer, 1 μL dithiothreitol (100 mM), 200 units of Superscript IV reverse transciptase were added and filled up with RNase free water to a total volume of 20 μL. The mixture was incubated at 50° C. for 20 min, at 80° C. for 10 min and cooled down to 4° C. for 3 min. After cDNA synthesis 3 μL 10×RNase H Buffer, 1 μL RNase A (10 mg/mL), 1.4 μL RNase H (5 U/μL) and 4 μL shrimp alkaline phosphatase (1 U/μL) and 0.6 μL dH.sub.2O were added to remove RNA and excess of nucleotides. The mixture was incubated at 37 C for 25 min, at 65 C for 15 min and cooled down to 0 C for 3 min and then cleaned by a spin column method (BaseClean Kit) according to manufacturers' instruction for PCR products and eluted with 17 μL dH.sub.2O.

[0126] The purified mixture was directly used for azide elongation with 3′-N.sub.3-ddGTP. To 17 μL purified cDNA mixture 5 μL 5×TdT Buffer, 1 μL 3′-N.sub.3-ddGTP (10 mM) and 2 μL of terminal deoxynucleotidyl transferase (20 U/μL) was added. The solution was incubated at 37° C. for 1 h and cooled down to 0 C for 3 min. Modified cDNA was purified by a spin column method (BaseClean Kit) according to manufacturers' instruction for PCR products and eluted with 9 μL.

[0127] Click ligation was performed using 9 μL of the purified and azide-modified cDNA, 0.5 μL of Alkyne Adapter (100 μM), 2.5 μL Activator.sup.2.sub.40 (baseclick GmbH), 0.5 μL dH.sub.2O and two reactor pellets. The reaction mixture was incubated at 45 C, 600 rpm, for 40 min. After the reaction, the supernatant was transferred to a new vial. The pellets were washed with 12.5 μL water and the supernatant was transferred to the supernatant before. The click ligated cDNA was cleaned using a spin column method (BaseClean Kit) according to manufacturers' instruction for PCR products and eluted with 10 μL.

[0128] After click ligation, the cDNA pool was amplified using untargeted primer (Adapter Primer1 and Poly(dT) Primer Reverse) to obtain a full-length mRNA library. In a 200 μL reaction vial 11.5 μL dH.sub.2O, 4 μL 5×OneTaq Buffer, 1 μL Adapter Primer1 (10 μM), 1 μL Poly(dT) Primer Reverse (10 μM), 0.4 μL dNTP Mix (10 mM), 2 μL of the purified click ligation mixture and 0.13 μL OneTaq DNA Polymerase (5000 U/μL) (New England Biolabs) were combined. The sample was subjected to a thermal cycling program in a thermocycler (BIORAD).

[0129] As a standard cycling following conditions were used with different extension times (step 4):

TABLE-US-00001 step temperature duration 1 94 C. 2 min 20× 2 94 C. 20 s 3 54 C. 20 s 4 68 C. 1 min/3 min/5 min/7 min/10 min 5 68 C. 5 min

[0130] The PCR mixture was cleaned using a spin column method (BaseClean Kit) according to manufacturers' instruction for PCR products and eluted with 10 μL dH.sub.2O. In FIG. 3A 3 μL aliquots of each PCR reaction were analyzed on 1.5% agarose gels (10×15 cm) prepared in TAE buffer (20 mM TRIS, 10 mM acetic acid, 0.5 mM EDTA).

[0131] For bioanalyzer measurements as shown in FIGS. 3B and C, 1 μL purified aliquots of generated full-length PCR fragments from an mRNA pool (FIG. 3A Lane 1 extension time 1 minute and lane 2 extension time 3 minutes) were measured using the DNA 1000 Kit (Agilent) and a bioanalyzer device (Agilent 2100).

[0132] Oligonucleotides:

TABLE-US-00002 Modifi- Name Sequence cation Poly(dT) Primer GTG ACT GGA GTT CAG ACG V = dA, dC, (SEQ ID NO. 1) TGT TTT TTT TTT TTT TTT dG; N = dA, TTT TVN dC, dG, dT Alkyne Adapter XTAGATCGGAAGAGCGTCGTGT X = (SEQ ID NO. 2) AGGGAAAGAGTGTAGATCTCGG 5′-Hexynyl TGGTCGCCGTATCATT linker Adapter Primer1 CGA CGC TCT TCC GAT CTA No (SEQ ID NO. 3) C Poly(dT) Primer GTG ACT GGA GTT CAG ACG No Reverse TGT (SEQ ID NO. 4)

[0133] Modifications:

##STR00001##

Example 2 (Relating to FIG. 4)

[0134] After click ligation (procedure described in example 3), specific genes were amplified from the cDNA pool using targeted primer (various Intern Primer Reverse and Forward, see table below), which result in specific PCR fragments. In a 200 μL reaction vial 11.5 μL dH.sub.2O, 4 μL 5×OneTaq standard reaction buffer, 1 μL Intern Reverse Primer (10 μM), 1 μL Intern Forward Primer (10 μM), 0.4 μL dNTP mix (10 mM), 2 μL of the purified and click ligated cDNA mixture and 0.13 μL OneTaq DNA Polymerase (5000 U/μL) (New England Biolabs) were combined. The sample was subjected to a thermal cycling program in a thermocycler (BIORAD).

TABLE-US-00003 step temperature duration 1 94 C. 2 min 20× 2 94 C. 20 s 3 54 C. 20 s 4 68 C. 1 min 5 68 C. 5 min

[0135] 5 μL unpurified aliquots of each PCR amplification were analyzed on 1.5% agarose gels (10×15 cm) prepared in TAE buffer (20 mM TRIS, 10 mM acetic acid, 0.5 mM EDTA).

[0136] Oligonucleotides:

TABLE-US-00004 Modifi- Name Sequence cation GAPDH Intern Reverse GGA GGG ATC TCG No Primer (SEQ ID NO. 5) CTC CTG GAPDH Intern Forward ATG GGG AAG GTG No Primer (SEQ ID NO. 6) AAG GTC GG eGFP Intern Reverse GCCGTAGGTCAGGGT No Primer (SEQ ID NO. 7 GGTC eGFP Intern Forward GCGAACTAGTAAGCA No Primer (SEQ ID NO. 8) AGGAGG Cas9 Intern Reverse CCA CCA GGA AGC No Primer (SEQ ID NO. 9) TCT CCT CC Cas9 Intern Forward ATGGCCCCCAAGAAG No Primer (SEQ ID NO. 10) AAGCG β-Gal Intern Reverse GCA CTC CAG CCA No Primer (SEQ ID NO. 11) GCT CTC β-Gal Intern Forward ATGAGCTTCACCCTG No Primer (SEQ ID NO. 12) ACCAACA FLUC Intern Reverse GTT GTA GAT GTC No Primer (SEQ ID NO. 13) GTT GGC GGG FLUC Intern Forward ATG GAG GAC GCC No Primer (SEQ ID NO. 14 AAG AAC ATC A

Example 3 (Relating to FIG. 5 and FIG. 12)

[0137] After click ligation (procedure described in example in FIG. 3), specific genes were amplified from the cDNA pool using a gene specific primer and a common adapter primer targeted primer (various Intern Primer Reverse and Adapter Primer 1, see table below), which result in specific PCR fragments. In a 200 μL reaction vial 11.5 μL dH.sub.2O, 4 μL 5×OneTaq standard reaction buffer, 1 μL Intern Reverse Primer (10 μM), 1 μL Adapter Primer1 (10 μM), 0.4 μL dNTP mix (10 mM), 2 μL of the purified and click ligated cDNA mixture and 0.13 μL OneTaq DNA Polymerase (5000 U/μL) (New England Biolabs) were combined. The sample was subjected to a thermal cycling program in a thermocycler (BIORAD).

TABLE-US-00005 step temperature duration 1 94 C. 2 min 20× 2 94 C. 20 s 3 54 C. 20 s 4 68 C. 1 min 5 68° C..sup.  5 min

[0138] 5 μL unpurified aliquots of each PCR amplification were analyzed on 1.5% agarose gels (10×15 cm) prepared in TAE buffer (20 mM TRIS, 10 mM acetic acid, 0.5 mM EDTA).

[0139] For Sanger sequencing as shown in FIG. 12, the generated PCR fragment of Fluc (firefly luciferase) was cleaned using a spin column method (BaseClean Kit) according to manufacturers' instruction for PCR products and eluted with 20 μL dH.sub.2O. This template and the specific primer (FLUC Intern Reverse Primer) were prepared according to and send to Eurofins Genomics (Ebersberg, Germany) for Sanger sequencing.

[0140] Oligonucleotides:

TABLE-US-00006 Modifi- Name Sequence cation Adapter Primer1 CGA CGC TCT TCC No (SEQ ID NO. 2) GAT CTA C GAPDH Intern Reverse GGA GGG ATC TCG No Primer (SEQ ID NO. 5) CTC CTG eGFP Intern Reverse GCCGTAGGTCAGGGT No Primer (SEQ ID NO. 7) GGTC Cas9 Intern Reverse CCA CCA GGA AGC No Primer (SEQ ID NO. 9) TCT CCT CC β-Gal Intern Reverse GCA CTC CAG CCA No Primer (SEQ ID NO. 11) GCT CTC FLUC Intern Reverse GTT GTA GAT GTC No Primer (SEQ ID NO. 13) GTT GGC GGG

Example 4 (Relating to FIG. 10)

[0141] The feasibility of the triazole readover was exemplified for reverse transcription of a Model RNA sequence. The RNA was hybridized to Primer1 and then reverse transcribed in the presence of 200 μM dTTP, dGTP, dCTP and 3′-azido-ddATP using MuLV reverse transcriptase. Nucleotides and enzyme were removed by purification of the cDNA using the nucleotide removal kit (QIAGEN) according to manufacturers' instructions.

[0142] Alkyne Oligo1 was clicked to the purified cDNA in a 200 μL reaction vial with a single reactor pellet (600-800 μm, containing elemental copper) in a total 12.5 μL reaction mix and incubated at 45 C for 60 min. The reaction mix consisted of 800 μM THPTA, 20 mM MgCl.sub.2, 5% DMSO, 7 μM of Alkyne Oligo1 and about 4 μM purified cDNA. dH.sub.2O was used to adjust the volume to a final 12.5 μL if necessary.

[0143] After the incubation the sample was briefly spinned down and the supernatant was transferred to a new vial to stop the reaction. The crude click reaction was diluted 1:1000, 1:5000 and 1:10000 (max. 4 nM, 0.8 nM and 0.4 nM) for PCR amplification without further purification.

[0144] In a 200 μL reaction vial, PCR amplifications were prepared in a total volume of 20 μL. Click reaction dilutions were combined with 200 μM dNTPs, 10 pmol of Primer2 and Primer3 and 1 U polymerase. For the various polymerases, Pfu, Phusion, Q5, One Taq and Dream Taq buffers were used according to manufacturers' recommendations. The samples were subjected to a thermal cycling program in a thermocycler (BIORAD).

[0145] As a standard cycling condition following conditions were used:

TABLE-US-00007 step temperature duration 1 95 C. 2 min 25× 2 95 C. 15 s 3 51 C. 20 s 4 72 C. 30 s 5 72 C. 2 min

[0146] For the Pfu polymerase different template dilutions and an alternative cycling condition were studied:

TABLE-US-00008 step temperature duration 1 95 C. 2 min 25× 2 95 C. 15 s 3 52 C.  5 s 4 72 C. 20 s 5 72 C. 2 min

[0147] After the incubation the sample was briefly spinned down and an aliquot was analyzed on 3% agarose gels (10×15 cm) prepared in TAE buffer (20 mM TRIS, 10 mM acetic acid, 0.5 mM EDTA).

[0148] Samples were prepared with 20% purple loading dye (NEB), and low molecular weight DNA ladder (25-766 bp, NEB, N3233) was prepared accordingly; usually 0.5 μL marker were used in 5 μL loading volume. Gels were run in TAE buffer applying constant power (10 W, max. 500 V, max. 100 mA) for 60 min. Then, gels were incubated in a freshly prepared 1:10000 ethidium bromide dilution for 15 min and then destained in dH.sub.2O for 15 min. For visualization a Gel Doc EZ Imager (BIO RAD) was used.

[0149] Oligonucleotides:

TABLE-US-00009 Modifi- Name Sequence cation Alkyne XAA TGA TAC GGC GAC CAC X = 5′- Oligo1 CGA GAT CTA CAC TCT TTC CCT alkyne dT SEQ ID ACA CGA CGC TCT TCC GAT CT NO. 15) Model RNA UUC GAC AAA CGA AAA CAC n.r. SEQ ID AAA CAC AAA CCA AAC AGA AAA NO. 16) CAG UAC AUG UAA UCG ACC A Primer1 FAM-TGG TCG ATT ACA TGT AC FAM =  SEQ ID fluorescein NO. 17) Primer2 TGG TCG ATT ACA TGT ACT GTT n.r. SEQ ID TT NO. 18) Primer3 AGA TCG GAA GAG CGT CG n.r. SEQ ID NO. 19)

[0150] Resulting cDNA after reverse transcription:

TABLE-US-00010 (SEQ ID NO. 20) 5′-FAM-TGG TCG ATT ACA TGT ACT GTT TTC TGT TTG GTT TGT GTT TGT GTT TTC GTT TGT CGA-N.sub.3

[0151] Resulting click product:

TABLE-US-00011 (SEQ ID NO. 21) 5′-FAM-TGG TCG ATT ACA TGT ACT GTT TTC TGT TTG GTT TGT GTT TGT GTT TTC GTT TGT CGA TAA TGA TAC GGC GAC CAC CGA GAT CTA CAC TCT TTC CCT ACA CGA CGC TCT TCC GAT CT-3′ AT = A and T joined via backbone mimic

[0152] Resulting PCR product:

TABLE-US-00012 (SEQ ID NO. 22) 5′-TGG TCG ATT ACA TGT ACT GTT TTC TGT TTG GTT TGT GTT TGT GTT TTC GTT TGT CGA TAA TGA TAC GGC GAC CAC CGA GAT CTA CAC TCT TTC CCT ACA CGA CGC TCT TCC GAT CT-3′

[0153] Modifications:

##STR00002##

Example 5 (Relating to FIG. 11)

[0154] In a final volume of 25 μL the samples contained 1 μM Oligo2, 1 mM 3′-Azido-2′,3′-dideoxyguanosine-5′-triphosphate or 3′-Azido-2′,3′-dideoxyuridine and TdT-enzyme (2 U/μl) in 1×terminal nucleotidyl transferase buffer (25 mM Tris-HCl (pH 7.2), 200 mM potassium cacodylate, 0.01% (v/v) Triton X-100, 1 mM CoCl.sub.2) for TdT-reactions. The reactions were incubated overnight (12-15 h) at 37 C and stopped by heating to 70 C for 10 min. The mixture was purified using the QIAquick Nucleotide Removal Kit and eluted in 30 μL water.

[0155] In a 200 μL reaction vial two reactor pellets (600-800 μm, containing elemental copper) were combined with 12.5 μL reaction mix and incubated at 45 C for 60 min. The click reaction mixture consisted of 800 μM THPTA, 40 mM MgCl.sub.2, 5% (v/v) DMSO in H.sub.2O, 1 μM of Alkyne-Oligo3 and about 0.3 μM purified azide oligonucleotide from TdT reaction. As a reference a reaction mixture consisted of 800 μM THPTA, 40 mM MgCl.sub.2, 5% (v/v) DMSO in H.sub.2O, 1 μM of Alkyne-Oligo3 and about 1 μM of Azide-Oligo2 was mixed.

[0156] After the incubation the sample was briefly spinned down and the supernatant was transferred to a new vial to stop the reaction. Samples were analyzed on a 20% polyacrylamide gel. As a reference low molecular weight DNA ladder (25-766 bp, NEB, N3233) was used.

[0157] For denaturing PAGE of oligonucleotides, samples were mixed with urea (50 v/v) and loaded on 20% denaturing polyacrylamide gels (7.5 mL Rotiphorese® Sequencing gel concentrate 750 μL Rotiphorese® Sequencing buffer concentrate, 2.09 mL bidistilled water, 3 mL 6 M urea solution, 1.5 mL 10×Tris-borate-EDTA (TBE) buffer (1 M tris, 1 M H.sub.3BO.sub.3, 25 mM EDTA), 150 μL ammonium persulfate (10% (w/v), 10 μL tetramethyl ethylene diamine (W×D×H=7.5×0.1×8.3 cm). Gel electrophoreses were performed in 0.5×TBE buffer at 150 V for 2 h. The gel was stained in ethidium bromide solution and washed with water. Afterwards the bands were visualized using Gel Doc™ EZ System by BioRad and analyzed using Image Lab™ software.

[0158] Oligonucleotides:

TABLE-US-00013 Name Sequence Modification Oligo TTG GTA TCG CTA TCG CTA n.r. (SEQ ID TGG NO. 23) Alkyne- XAA AAA AAC CAT GAA CAA X = 5′- Oligo3 AAT GTG ACT CAT ATC Hexynyl linker (SEQ ID NO. 24) Azide- TTG GTA TCG CTA TCG CTA Z = 3′-Azide,  Oligo2 TGG Z 5- (SEQ ID methylcytosine NO. 25)

[0159] Modifications:

##STR00003##