Microorganism of <i>Corynebacterium </i>genus having enhanced L-arginine or L-citrulline productivity and a method for producing L-arginine or L-citrulline using the same

12486490 ยท 2025-12-02

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure relates to a Corynebacterium sp. mutant strain having increased L-arginine or L-citrulline productivity and a method of producing L-arginine or L-citrulline using the same. The Corynebacterium sp. mutant strain has enhanced activity of acetylornithine aminotransferase involved in the L-arginine biosynthesis pathway, and thus is capable of producing L-arginine or L-citrulline productivity in an increased yield compared to a parent strain.

Claims

1. A Corynebacterium sp. mutant strain having increased L-arginine or L-citrulline productivity by having enhanced activity of acetylornithine aminotransferase, wherein said acetylornithine aminotransferase has a substitution of threonine for alanine at amino acid position 131 in the amino acid sequence of SEQ ID NO: 2.

2. The Corynebacterium sp. mutant strain of claim 1, which is Corynebacterium glutamicum.

3. A method for producing L-arginine or L-citrulline comprising steps of: culturing the Corynebacterium sp. mutant strain of claim 1 in a medium; and recovering L-arginine or L-citrulline from the cultured mutant strain or the medium in which the mutant strain has been cultured.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The FIGURE shows the structure of a pk19msb+argD(A131T) vector containing a gene encoding an acetylornithine aminotransferase having a substitution of threonine for alanine at amino acid position 131 according to one embodiment of the present disclosure.

DETAILED DESCRIPTION

(2) Hereinafter, the present disclosure will be described in more detail. However, these descriptions are provided for illustrative purposes only to aid in the understanding of the present disclosure, and the scope of the present disclosure is not limited by these illustrative descriptions.

Example 1. Construction of Corynebacterium glutamicum Mutant Strain

(3) To construct a Corynebacterium glutamicum mutant strain having enhanced activity of acetylornithine aminotransferase, Corynebacterium glutamicum 14GR (KCCM13219P) strain, which is an L-arginine-producing strain, and E. coli DH5a (HIT Competent Cells, Cat No. RH618) were used.

(4) The Corynebacterium glutamicum 14GR strain was cultured in an ARG-broth medium (pH 7.2) containing 10.5 g of 98% glucose, 1 g of beef extract, 4 g of yeast extract, 2 g of polypeptone, 2 g of NaCl and 40 g of (NH.sub.4).sub.2SO.sub.4 in 1 L of distilled water at a temperature of 30 C.

(5) The E. coli DH5a was cultured on an LB medium containing 10.0 g of tryptone, 10.0 g of NaCl and 5.0 g of yeast extract in 1 L of distilled water at a temperature of 37 C.

(6) The antibiotic kanamycin used was the product of Sigma.

(7) DNA sequencing was performed by Macrogen, Inc.

(8) 1-1. Recombinant Vector

(9) Mutation was induced in acetylornithine aminotransferase to enhance the biosynthesis pathway in the strain. In the method used in this Example, the argD gene encoding acetylornithine aminotransferase was subjected to site-directed mutagenesis in order to increase expression of the gene. Alanine at amino acid position 131 of the acetylornithine aminotransferase encoded by the argD gene was substituted with threonine, and the left arm portion (529 bp) and the right arm portion (525 bp) with respect to the center of the argD gene on the Corynebacterium glutamicum genome were amplified by PCR and ligated together by overlap PCR, followed by cloning into a pk19msb vector. The resulting plasmid was named pk19msb+argD(A131T) (see the FIGURE). To construct the plasmid, the primers shown in Table 1 below were used for amplification of each gene fragment.

(10) TABLE-US-00001 TABLE1 Primer(5.fwdarw.3) SEQIDNO Amplification A131T-LF1 tgattacgcccatcgcgcactcggtgttgc 5 primersforleft A131T-LF2 catcgcgcactcggtgttgc 6 homologousarmof A131T-LR1 cgggaacgaccagtcaagcg 7 argD A131T-LR2 agtcagaatccgggaacgac 8 Amplification A131T-RF1 gattctgactgcagttcatggtttccacgg 9 primersforright A131T-RF2 gcagttcatggtttccacgg 10 homologousarmof A131T-RR1 gcgtcatcgacaacagacag 11 argD A131T-RR2 tgcgcagaaagcgtcatcga 12

(11) Using the above-described primers, PCR was performed under the following conditions. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc., Japan) in a reaction solution containing 100 M of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 1 pM oligonucleotide, ng of the chromosomal DNA of Corynebacterium glutamicum ATCC 13032 as a template, and 1 unit of pfu-X DNA polymerase mixture (Solgent). PCR was performed for 25 to 30 cycles, each consisting of (i) denaturation at 94 C. for 30 sec, (ii) annealing at 58 C. for 30 sec, and (iii) extension at 72 C. for 1 to 2 min (a polymerization time of 2 min per kb).

(12) The gene fragments prepared as described above were cloned into a pk19msb vector by self-assembly cloning. The vector was transformed into E. coli DH5a which was then plated on an LB-agar plate containing 50 g/ml of kanamycin, and cultured at 37 C. for 24 hours. The finally formed colony was isolated and whether the insert was exactly present in the vector was checked. Next, the vector was isolated and used for recombination of the Corynebacterium glutamicum strain.

(13) As a process commonly performed in the above method, the corresponding genes were amplified by PCR from the genomic DNA of Corynebacterium glutamicum ATCC 13032 and inserted into the pk19msb vector by the self-assembled cloning method according to the strategy, and the resulting plasmid was selected in E. coli DH5a. For chromosomal base substitution, the gene fragments were amplified individually and ligated together by overlap PCR, thereby preparing the desired DNA fragment. For genetic manipulation, Ex Taq polymerase (Takara) and Pfu polymerase (Solgent) were used as PCR polymerases, and various restriction enzymes and DNA modifying enzymes purchased from NEB were used, and they were used according to manufacturer's provided buffers and protocols.

(14) 1-2. Corynebacterium glutamicum Mutant Strain AD1

(15) Mutant strain AD1 was constructed using a cloning vector. The cloning vector was prepared at a final concentration of 1 g/l or more and electroporated into a Corynebacterium glutamicum 14GR strain (see Tauch et al., FEMS Microbiology letters 123 (1994) 343-347) to induce first recombination. In this case, the electroporated strain was plated on an agar medium containing 50 g/l of kanamycin, colonies were isolated, and whether the vector was properly inserted at the desired position on the genome was checked by PCR and sequencing. Each of the isolated strains was inoculated again in a liquid medium to induce second recombination, cultured overnight or more, and then plated on an agar medium containing 10% sucrose, and colonies were isolated. Whether the finally isolated colonies were resistant to kanamycin was checked, and then whether mutation was introduced into the acetylornithine aminotransferase in the strains having no antibiotic resistance was checked by sequencing (see Schafer et al., Gene 145 (1994) 69-73). As a result, Corynebacterium glutamicum mutant strain AD1 capable of producing L-arginine was constructed, which has a substitution of threonine for alanine at position 131 in the amino acid sequence of acetylornithine aminotransferase (SEQ ID NO: 2).

Experimental Example 1. Evaluation of L-Arginine Productivity of Corynebacterium glutamicum Mutant Strain

(16) The L-arginine productivity of the Corynebacterium glutamicum mutant strain AD1 constructed in Example 1 was evaluated in comparison with that of the parent strain.

(17) Each strain was patched on a flask solid seed medium and cultured at 30 C. for 24 hours. Each cultured colony was inoculated into a 10-ml flask titer medium and cultured at 200 rpm at 32 C. for 30 hours. The compositions of the media used here are shown in Table 2 below. After completion of the culturing, each culture was diluted 100-fold with distilled water and filtered through a 0.45-m filter, and then the amount of L-arginine produced was analyzed using high-performance liquid chromatography (HPLC) (Agilent Technologies 1260 Infinity, Agilent Technologies) equipped with a column (DionexIonPac CS12A) and a UV detector (195 mm), and the results are shown in Table 3 below. In Table 3, L-arginine (%) denotes the amount (percentage) of arginine produced by each strain, and fermentation yield (Yp/s) (%) denotes the amount of L-arginine produced per glucose consumed.

(18) TABLE-US-00002 TABLE 2 Flask solid seed 10.5 g of 98% glucose, 1 g of beef extract, 4 g of medium (per L) yeast extract, 2 g of polypeptone, 2 g of NaCl, 40 g of (NH.sub.4) .sub.2SO.sub.4 and 20 g of agar Flask titer 120 g of 98% glucose, 1 g of MgSO.sub.4, 2 g of KH.sub.2PO.sub.4, medium (per L) 45 g of (NH.sub.4) .sub.2SO.sub.4, 20 mg of FeSO.sub.4, 20 mg of MnSO.sub.4, 100 g of biotin, 100 g of thiamine, 4 g of YSP and 2 g of urea

(19) TABLE-US-00003 TABLE 3 Fermentation Strain OD.sub.610 L-arginine (%) yield (%) Parent strain 18.0 1.63 16.31 AD1 29.0 2.42 24.25

(20) As shown in Table 3 above, it was confirmed that the Corynebacterium glutamicum mutant strain AD1 had significantly increased L-arginine productivity compared to the parent strain due to a substitution of threonine for alanine at amino acid position 131 in the amino acid sequence of acetylornithine aminotransferase.

Example 2. Construction of Corynebacterium glutamicum Mutant Strain

(21) Corynebacterium glutamicum mutant strain CD1 having a substitution of threonine for alanine at position 131 in the amino acid sequence of acetylornithine aminotransferase (SEQ ID NO: 2) and capable of producing L-citrulline was constructed in the same manner as in Example 1, except that the pk19msb+argD(A131T) cloning vector of Example 1-1 was introduced into Corynebacterium glutamicum 15GD (KCCM13220P) in place of Corynebacterium glutamicum 14GR.

Experimental Example 2. Evaluation of L-Citrulline Productivity of Corynebacterium glutamicum Mutant Strain

(22) The L-citrulline productivity of the Corynebacterium glutamicum mutant strain CD1 constructed in Example 2 was evaluated in comparison with that of the parent strain.

(23) Each strain was patched on a flask solid seed medium and cultured at 30 C. for 24 hours. Each cultured colony was inoculated into a 10-ml flask titer medium and cultured at 200 rpm at 32 C. for 30 hours. The compositions of the media used here are shown in Table 4 below. After completion of the culturing, each culture was diluted 100-fold with distilled water and filtered through a 0.45-m filter, and then the amount of L-citrulline produced was analyzed using high-performance liquid chromatography (HPLC) (Agilent Technologies 1260 Infinity, Agilent Technologies) equipped with a column (DionexIonPac CS12A) and a UV detector (195 mm), and the results are shown in Table 5 below. In Table 5, L-citrulline (%) denotes the amount (percentage) of citrulline produced by each strain, and fermentation yield (Yp/s) (%) denotes the amount of L-citrulline produced per glucose consumed.

(24) TABLE-US-00004 TABLE 4 Flask solid seed 10.5 g of 95% glucose, 10 g of beef extract, 10 g of medium (per L) yeast extract, 10 g of polypeptone, 2.5 g of NaCl and 100 mg of arginine Flask titer medium 105.3 g of 95% glucose, 1 g of MgSO.sub.4, 4 g of YPA, (per L) 0.8 g of KH.sub.2PO.sub.4, 1.2 g of Na.sub.2HPO.sub.4, 30 g of (NH.sub.4) .sub.2SO.sub.4, 20 mg of FeSO.sub.4, 20 mg of MnSO.sub.4, 10 mg of ZnSO.sub.4, 100 mg of arginine, 100 g of biotin and 200 g of thiamine

(25) TABLE-US-00005 TABLE 5 Fermentation Strain OD.sub.610 L-citrulline (%) yield (%) Parent strain 9.0 1.08 10.84 CD1 14.0 1.53 15.33

(26) As shown in Table 5 above, it was confirmed that the Corynebacterium glutamicum mutant strain CD1 had significantly increased L-citrulline productivity compared to the parent strain due to a substitution of threonine for alanine at amino acid position 131 in the amino acid sequence of acetylornithine aminotransferase.

(27) These results suggest that L-arginine and L-citrulline productivities were increased by enhancing enzymatic activity through site-directed mutation in the nucleic acid sequence or amino acid sequence of acetylornithine aminotransferase involved in the L-arginine biosynthesis pathway.

(28) So far, the present disclosure has been described with reference to the embodiments. Those of ordinary skill in the art to which the present disclosure pertains will appreciate that the present disclosure may be embodied in modified forms without departing from the essential characteristics of the present disclosure. Therefore, the disclosed embodiments should be considered from an illustrative point of view, not from a restrictive point of view. The scope of the present disclosure is defined by the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present disclosure.

(29) [Accession Number]

(30) Depository authority: Korean Culture Center of Microorganisms (KCCM) Accession number: KCCM13219P Deposit date: Jun. 29, 2022 Depository authority: Korean Culture Center of Microorganisms (KCCM) Accession number: KCCM13220P Deposit date: Jun. 29, 2022