F-genotype mumps virus attenuated strain and construction method therefor and application thereof

Abstract

Provided are an F-genotype mumps virus attenuated strain, a construction method therefor and an application thereof. The attenuated strain is a mumps virus with the accession number of CCTCC NO: V201950. Further provided are a vaccine composition containing the F-genotype mumps virus attenuated strain as an active ingredient and a preparation method thereof.

Claims

1. An F genotype mumps virus attenuated strain, which is mumps virus QS-F-SH2 with the accession number of CCTCC NO: V201950.

2. The F genotype mumps virus attenuated strain of claim 1, wherein the genome of the F genotype mumps virus attenuated strain contains the nucleotide sequence shown in SEQ ID NO: 3.

3. A vaccine composition, which comprises: (i) the F genotype mumps virus attenuated strain of claim 1; and (ii) a vaccine acceptable carrier.

4. The vaccine composition of claim 3, wherein the virus in each dose of the vaccine composition is at least 3.7 lgCCID50.

5. The vaccine composition of claim 3, wherein the vaccine composition is in the form of injection.

6. A method for preventing mumps, comprising administrating the F genotype mumps virus attenuated strain of claim 1 to a subject in need thereof.

7. A method for inoculating against mumps, comprising the step of: inoculating the F genotype mumps virus attenuated strain of claim 1, or the vaccine composition comprising the F genotype mumps virus attenuated strain to a subject in need thereof.

8. A method for preparing a F genotype mumps virus attenuated strain, which comprises the steps: (i) constructing a full-length recombinant plasmid of the F genotype mumps virus that lacks and only lacks the SH gene, comprising the nucleotide sequence represented by SEQ ID NO: 3; (ii) obtaining three helper plasmids containing the N gene, P gene and L gene in the mumps virus, respectively; and (iii) co-transfecting host cells with the full-length recombinant plasmid obtained in i) and the three helper plasmids, and after culturing for 3 days, lysing the cells and inoculating into the new cells for culture, and when the cytopathy can be observed, the F genotype mumps virus attenuated strain is obtained.

9. A method for preparing a vaccine composition, which comprises the steps: (i) passaging or culturing the mumps virus QS-F-SH2 with the accession number of CCTCC NO: V201950 to obtain an attenuated vaccine strain; (ii) mixing the attenuated vaccine strain prepared in step (i) with an immunoacceptable carrier to produce the vaccine composition.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows a schematic diagram of the full-length clone of rMuV-SH.

(2) FIG. 2 shows a schematic diagram of the digestion of the full-length clone of rMuV-SH.

(3) FIG. 3 shows a schematic diagram of the construction of helper plasmids.

(4) FIG. 4 shows the sequencing results of each recombinant virus.

(5) Wherein, A shows the sequencing results of rMuV-SHV related sites; B shows the sequencing results of rMuV-SH related sites; C shows the sequencing results of rMuV-V related sites.

(6) FIG. 5 shows the growth curves of three recombinant viruses on Vero cells.

(7) FIG. 6 shows the growth of three strains of virus on chicken embryo fibroblasts.

(8) Wherein, A is rMuV-V; B is rMuV-SH; and C is rMuV-SHV.

(9) FIG. 7 shows the PCR assay results of QS-F-SH2-P15 and P30.

(10) FIG. 8 shows the immunogenicity assay results of the QS-F-SH2 recombinant vaccine and each control.

(11) FIG. 9 shows the results of nerve virulence test in neonatal rats.

(12) Wherein, A shows the statistical results of neurovirulence; B shows the results of neurovirulence.

DETAILED DESCRIPTION

(13) After extensive and in-depth research, through a large number of screening, the inventors have developed for the first time a live attenuated vaccine of F genotype mumps that can be produced on a large scale in the primary chicken embryo fibroblasts. Specifically, the inventors used the reverse genetic operating system to delete the SH gene in the genome and retain other genes in the mumps virus strain of the F genotype, so as to obtain the SH gene-deleted mumps attenuated vaccine strain of F genotype.

(14) Experiments have shown that the obtained SH gene-deleted mumps attenuated vaccine strain of F genotype can better match the predominant mumps virus of F genotype in China, and is comparable to the current vaccine strain in terms of growth characteristics, immunogenicity and neurotoxicity. Moreover, in the preparation process, using the preparation method of the present invention, compared with the traditional mumps virus weakening means, the weakening mechanism is clear and the period is shorter, which is more efficient. In addition, the genetically engineered attenuated strain of mumps virus screened by the present invention can be stably produced in chicken embryo cells with high safety.

(15) On this basis, the present invention has been completed.

(16) Current Status of Mumps Virus and F Genotype Mumps Virus

(17) Mumps virus is a member of the mumps virus genus of the Paramyxoviridae family. Its genome is a single negative-strand RNA without segmentation, with a length of 15384 bp. The entire genome encodes 7 viral proteins in the order of 3-N-P-M-F-SH-HN-L-5. Among them, N protein, P protein and L protein form RNA replicase complex and participate in transcription and replication of virus. F and HN are important transmembrane glycoproteins and immunogens. SH protein contains 57 amino acids and is a non-essential protein for viral replication, which is related to TNF--mediated apoptosis.

(18) Studies have shown that SH protein prevents apoptosis by inhibiting NF-B signaling pathway in L929 cells. Once SH gene is deleted, the virus is easily cleared by host's innate immune response and shows decreased virulence.

(19) It is particularly worth noting that the inventors have done a systematic study on the causes of repeated mumps outbreaks from the serological direction, and the results are as follows:

(20) (1) F genotype virus is the absolute dominant group of mumps virus prevalent in China.

(21) In 2015, the inventors and 6 provincial CDCs collected a large number of patient samples from China, and successfully isolated 29 strains of virus. The bioinformatics analysis shows that these virus strains are all F genotype, and the evolutionary relationship is close.

(22) (2) The cross-protection ability of mumps vaccine of A genotype is limited.

(23) Based on three immune models of human, guinea pig and mouse, the inventors conducted a large number of serological cross-neutralization experiments. The experimental results showed that the neutralizing ability of neutralizing antibodies produced by live attenuated mumps vaccine of A genotype (Jeryl Lynn strain) against the epidemic strain of genotype F was significantly lower than that against A genotype strain. At the same time, in guinea pig and mouse models, the neutralizing ability of antibodies produced by immunization with F genotype mumps virus to F genotype virus was slightly higher than that to A genotype virus.

(24) The F Genotype Mumps Virus Attenuated Strain of the Present Invention

(25) In order to solve the above technical problems, the present invention is realized by the following technical solutions:

(26) In the present invention, the F genotype mumps virus strain QS-F isolated from China is taken as a parent strain. A reverse genetic operating system is constructed and an SH gene deleted mumps attenuated vaccine candidate strain is constructed by using an improved method on this basis. The QS-F strain used in the present invention is derived from the F genotype mumps virus bank isolated by our company and six provincial CDCs (Jiangsu, Zhejiang, Beijing, Guangdong, Hubei and Shaanxi) in China since 2016.

(27) The QS-F strain is finally obtained through stereotyped gene sequencing, bioinformatics analysis, serological comparison, immunogenicity analysis and in vitro phenotype identification. It has the characteristics of strong replication ability, high genetic stability and good immunogenicity, and has a good representation in the current epidemic F genotype mumps virus strains in China.

(28) The deletion of CDS region of SH in the genome of the SH gene deleted mumps attenuated vaccine strain of F genotype constructed by the present invention is changed from 174 bases to 18 bases, resulting in the inability of the SH protein to be effectively expressed. The protein encoded by SH gene is directly related to the nerve virulence caused by mumps virus. SH protein can help mumps virus evade the innate immunity of the host by inhibiting the activation of NF-B and TNF- pathways. Once the SH gene is deleted, the mumps virus is more easily recognized by the host and triggers an immune response; therefore, the biosecurity of the deleted virus is effectively improved.

(29) The full-length recombinant plasmid and helper plasmids of the QS-F were constructed to rescue the QS-F-SH2 virus through the reverse genetics operating system. The rescued virus was passaged, and the supernatant was harvested for PCR identification. The results showed that the recombinant virus strain QS-F-SH2 constructed by the present invention was successfully rescued; the multi-step growth curve showed that the QS-F-SH2 virus had similar growth kinetics to the parent virus. The virus was passaged in the primary chicken embryo fibroblast respectively for a long time and its whole gene sequence was determined. The results showed that the SH gene region of the virus was stable and had good genetic stability.

(30) Specifically, in the present invention, it provides a F genotype mumps virus attenuated strain, and the attenuated strain is mumps virus QS-F-SH2 with a deposit number of CCTCC NO: V201950. Preferably, the genome of the F genotype mumps virus attenuated strain of the present invention contains the nucleotide sequence shown in SEQ ID NO: 3.

(31) In addition, the present invention also provides a derived virus strain derived from the F genotype mumps attenuated vaccine strain described in claim 1, with one or more of the following characteristics:

(32) (a) it is suitable for passage in primary cultured cells of chicken embryos, with a stable passage number 10, preferably, a stable passage number 15, and more preferably, a stable passage number 30;

(33) (b) low virulence: the virulence index is equivalent to the virulence index of the mumps virus QS-F-SH2 whose deposit number is CCTCC NO: V201950; wherein, the virulence index is equivalent means that its virulence index is 150%, preferably 120%, more preferably 100% of the virulence index of F genotype mumps virus attenuated strain whose deposit number is CCTCC NO: V201950; wherein, the virulence index is the degree of ventricular edema;

(34) (c) compared with wild-type F genotype mumps virus, the genome does not contain SH gene.

(35) In the present invention, the genome of the derived virus strain contains the following nucleotide sequences:

(36) (i) the nucleotide sequence shown in SEQ ID NO: 1 corresponding to the SH gene in the genome of the wild-type F genotype mumps virus is replaced by the nucleotide sequence shown in SEQ ID NO: 2; and

(37) (ii) the sequence identity to the nucleotide sequence shown in SEQ ID NO: 3 is 85%, preferably 90%, more preferably 95%.

(38) In another embodiment, the genome of the derived virus strain contains the following nucleotide sequence:

(39) (i) the nucleotide sequence shown in SEQ ID NO: 1 corresponding to the SH gene in the genome of the wild-type F genotype mumps virus is replaced by the nucleotide sequence shown in SEQ ID NO: 2; and

(40) (ii) the sequence identity to the nucleotide sequence shown in SEQ ID NO: 3 is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

(41) TABLE-US-00001 CompletesequenceofSHgene: (SEQIDNO:1) ATGCCGGCAATCCACCCTCCCTTATACCTAACATTT CTATTGCTAATTCTTCTTCATCTGATCTTAAATTT ATATGTCTGAATTATGCTAACCATTACTCACAAGA CTGCGGTGCAACATGCAGCACTGTACCAGAGATCC CTCTTTCGTTGGAGTTTCGATCACTCACTCTAGGe nesequenceafterdeletionofSH: (SEQIDNO:2) ATGCCGGCAGCTAGCTAG

(42) In a preferred embodiment, the present invention adopts intramuscular injection into 6-week-old BALB/c female mice, and the mice do not show any abnormality. Immunization by intramuscular injection of hind limbs was performed twice, with an interval of 21 days, and the immunization dose was 410.sup.5 CCID.sub.50/100 L. Fourteen days after the second immunization, the produced neutralizing antibody was measured. The results show that compared with JL vaccine strain, the QS-F-SH2 vaccine strain can effectively resist the attack of F genotype mumps virus, which is widely prevalent in China, and has good immunogenicity.

(43) In a preferred embodiment of the present invention, the SH gene deleted mumps attenuated vaccine strain QS-F-SH2 constructed by the present invention, parental virus QS-F, JL vaccine (100 CCID.sub.50/10 L) and negative control DMEM 10 L were used to infect 1-day-old suckling rats by intracranial injection, respectively. The suckling rats of each experimental group did not show any abnormal reaction during the observation period. After 25 days of intracranial injection, the left cerebral hemisphere of the experimental rat was subjected to vibratome section (2 mm from the sagittal suture), and the neurovirulence value was quantitatively calculated according to the size of the cavity of the third ventricle.

(44) The results shows that the neurovirulence values of parental virus QS-F, QS-F-SH2 and JL strain are 5.66, 0.53 and 0.31 respectively. The parental virus has obvious neurovirulence, but the neurovirulence of QS-F-SH2 is not significantly different from that of the JL vaccine strain. Combined immunogenicity and neurovirulence, QS-F-SH2 has the potential to be a candidate vaccine strain for mumps.

(45) The Mumps Virus Weakening Strategy of the Present Invention.

(46) The traditional strategy of mumps virus attenuation is to screen out candidate strains with reduced virulence through in vitro culture under non-optimal conditions for a long time. However, since the weakening principle cannot be explained so far, a long time and a large number of evaluation tests are needed to determine the safety and genetic stability of the new vaccine strain. Therefore, the development period of vaccines is very long.

(47) In the present invention, the cutting-edge technology of virology research, the reverse genetic operating technology, is used to directly construct the recombinant mumps virus with the deletion of virulence gene, and a live vaccine with a clear attenuation principle can be obtained.

(48) In addition, the virulence evaluation model used in the present invention is a new generation of mumps virus neurovirulence evaluation system recommended by the International Association for Biological Standardization (IABS), the World Health Organization (WHO), the European Directorate for the Quality of Medicines & HealthCare (EDQM), the Center for Biologics Evaluation and Research of Food and Drug Administration (FDA CBER) and the European Union (EU), and relevant optimization has been conducted. Compared with the rhesus monkey neurovirulence assay, the evaluation method can more truly reflect the neurovirulence situation between attenuated strain and wild strain, with lower cost and shorter period.

(49) The Method of the Present Invention

(50) In the present invention, it provides a method for preparing an F genotype mumps virus attenuated strain, which comprises the steps:

(51) (i) constructing a full-length recombinant plasmid of the F genotype mumps virus that lacks and only lacks the SH gene;

(52) (ii) obtaining three helper plasmids containing the N gene, P gene and L gene in the mumps virus, respectively; and

(53) (iii) co-transfecting host cells with the full-length recombinant plasmid obtained in (i) and the three helper plasmids, and after culturing for 3 days, lysing the cells and inoculating into the new cells for culture, and when the cytopathy can be observed, the F genotype mumps virus attenuated strain is obtained.

(54) In a preferred embodiment, the host cell is selected from the group consisting of BSR-T7 cells, 293T cells, Vero cells, Slam/Vero cells, and a combination thereof.

(55) Vaccine Composition

(56) In the present invention, it provides a method for preparing a vaccine composition, which comprises the steps:

(57) (i) passaging or culturing the mumps virus QS-F-SH2 with a deposit number of CCTCC NO: V201950 to obtain an attenuated vaccine strain;

(58) (ii) mixing the attenuated vaccine strain prepared in step (i) with an immunoacceptable carrier to produce the vaccine composition.

(59) In the vaccine composition provided by the present invention, including:

(60) (i) the F genotype mumps virus attenuated strain according to the first aspect of the present invention or the derived virus strain according to the second aspect of the present invention; and

(61) (ii) a vaccine acceptable carrier.

(62) Preferably, the carrier is a pharmaceutically acceptable carrier. In a preferred embodiment, the pharmaceutically acceptable carrier comprises liquid, preferably water, saline or buffer.

(63) The carrier may further contain an auxiliary substance, preferably a filler, a lubricant, a glidant, a wetting agent or an emulsifier, a pH buffer substance, etc.

(64) In another preferred embodiment, the carrier further contains a cell transfection agent.

(65) In the present invention, the vaccine composition is a dual vaccine or a multiple vaccine. Preferably, the vaccine composition further contains one or more vaccine components derived from pathogens selected from the group consisting of: measles, rubella, Japanese encephalitis, hepatitis A, chickenpox, polio, and a combination thereof.

(66) In one embodiment, the vaccine component comprises an inactivated strain, an attenuated strain, or a protein, a nucleic acid, etc.

(67) In the present invention, the vaccine composition further comprises an adjuvant. Preferably, the adjuvant comprises a granular and a non-granular adjuvant. In a preferred example, the granular adjuvant is selected from the group consisting of: aluminum salts, water-in-oil emulsions, oil-in-water emulsions, nanoparticles, micro-particles, liposomes, immunostimulatory complexes, and a combination thereof. In another preferred embodiment, the non-granular adjuvant is selected from the group consisting of muramyl dipeptide and its derivatives, saponins, lipid A, cytokines, derived polysaccharides, bacterial toxins, microorganisms and their products such as mycobacteria (Mycobacterium tuberculosis, BCG), Bacillus pumilus, Bacillus pertussis, propolis, and a combination thereof.

(68) In the present invention, preferably, the virus in each dose of the vaccine composition is at least 3.7 lgCCID.sub.50. In a more preferred embodiment, the vaccine composition is in the form of injection.

(69) Deposit of Virus Strains

(70) As used herein, the F genotype mumps virus attenuated strain and mumps virus QS-F-SH2 of the present invention can be used interchangeably and have been deposited in China Center for Type Culture Collection (CCTCC, Wuhan University, Wuhan, China) on Jul. 25, 2019, with the accession number of CCTCC No: V201950.

(71) In addition, the mumps virus QS-F isolated in the present invention has also been deposited in China Center for Type Culture Collection (CCTCC, Wuhan University, Wuhan, China) on Jul. 25, 2019, with the accession number of CCTCC No: V201948.

(72) The Main Advantages of the Present Invention Include:

(73) 1) F genotype mumps virus strain is selected to match the genotype of the dominant epidemic strain in China.

(74) 2) The present invention utilizes a novel mumps virus weakening strategy and adopts reverse genetic operation to carry out the directed transformation of the virus. Compared with the traditional mumps virus weakening method, the weakening mechanism is clear and the weakening period is short; therefore, it is more efficient.

(75) 3) At present, foreign teams have only studied the growth characteristics of similar genetically engineered attenuated strains on Vero cells. The present invention has screened out a genetically engineered attenuated strain of mumps virus that can adapt to the production of chicken embryo cells, and has the conditions for production based on the requirements of the current pharmacopoeia, so it has an excellent application prospect.

(76) 4) It is consistent with the current vaccine strain in terms of growth characteristics, immunogenicity and neurovirulence.

(77) The present invention is further explained below in conjunction with specific example. It should be understood that these examples are only for illustrating the present invention and not intend to limit the scope of the present invention. The conditions of the experimental methods not specifically indicated in the following examples are usually in accordance with conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are percentages by weight and parts by weight.

(78) Experimental Materials

(79) The QS-F virus from throat swab samples was provided by Jiangsu Provincial Center for Disease Control and Prevention, which is isolated, identified and preserved by Shanghai Qingsai Biotechnology Co., Ltd. Vero Cells were provided by the Research and Development Center of the company. The pAC vector and pcDNA3.1 were used for the construction of the full-length plasmids and helper plasmids.

Example 1: Construction of a rMuV-SH Deletion Virus

(80) 1.1 Construction of Full-Length Plasmid of QS-F Virus

(81) According to the sequence information of mumps F genotype provided on NCBI, universal primers were designed to sequence the whole genome of QS-F virus. The sequencing primer information is as follows:

(82) TABLE-US-00002 TABLE1 SequenceInformationofSequencingPrimers SEQID Primername Primersequence(5'-3') NO: MUV-N1-F ACCAAGGGGAAAATGAAGATGG 4 MUV-N1400-F GGGCCTGTGAATCCATTTGTTC 5 MUV-N1500-R TGGAATCCTGCACCTCCATCTT 6 MUV-N2800-F GGAATGATGGCGACCGTAAAGA 7 MUV-N2900-R GAATGACACATCTCCTGGTCCA 8 MUV-N4200-F CATCCACCAATCATCACCATCG 9 MUV-N4300-R GTCATCAGTTTTTGCGAGTGAT 10 MUV-N5600-F AGTCAAAACTATGCCTTGCAGG 11 MUV-N5700-R CGTTAGACTTCGACAGTTTGCA 12 MUV-N7000-F CTTGCCACAATCTGTACAAGC 13 MUV-N7100-R GTGGATGGCCGATAGAGAAATC 14 MUV-N8400-F TGAATGCAGCGGTAGGCCCTAT 15 MUV-N8500-R ATATCTAACGATGGGTGAGTTC 16 MUV-N9800-F GTATGAATATGTCCTCAAGAAT 17 TGG MUV-N9900-R CAGTCTTGCTTTGGACAGCTTA 18 MUV-N11200-F CCAAACTAAATCCCTTAGTCAG 19 G MUV-N11300-R CAGGCGACTACACGAGAGAAAG 20 MUV-N12600-F GCTGTATAAGACCTGTTGAGTC 21 MUV-N12700-R TCCATCTCTAGCAAACTGAGTG 22 MUV-N14000-F AGAATCCTCCCCAACGCAATTT 23 MUV-N14100-R CTGTTACCGTTCCAGAGTGGAT 24 MUV-N15384-R ACCAAGGGGAGAAAGTAAAATC 25

(83) Primers were designed according to sequencing results, and F genotype QS-F was divided into 5 segments for cloning. The specific strategy is shown in FIG. 1.

(84) Using pAc as a vector, F1 and F5 were doubly digested with Not I, BstE II and Not I and Rsr II respectively, to obtain plasmid pAC-F1, pAC-F5. Then F2 was doubly digested with BstE II, Rsr II, and F4 was doubly digested with Not I, Hind III, to obtain pAC-F1-F2, and pAC-F4-F5. The pAC-F4-F5 and pAC-F1-F2 were doubly digested by Pac I and Rsr II again to obtain the plasmid pAC-F1-F2-F4-F5. Fragment F3 was cloned by transitioning to T vector to obtain pMD18T-F3-1 and pMD18T-F3-2, and pMD18T-F3 was obtained by double enzyme digestion. The plasmids pAC-F1-F2-F4-F5 and pMD18T-F3 were singly digested with Pac I to finally obtain pAC-F1-F2-F3-F4-F5, namely pAC-MuV, and after the digestion of Hind III, the plasmid pAC-MuV was cut into three segments by 8969 bp, 5207 bp, and 3803 bp respectively. According to FIG. 2, it can be seen that the full-length plasmid of the QS-F virus was successfully constructed.

(85) TABLE-US-00003 TABLE2 PrimerSequencesandAmplifiedFragments SEQ Amplified ID Frag- fragment NO: ment Primersequence length Fl Muv-B-MP-1-F: 2776bp 26 TGCAGGCGGCCGCGTAATACGACTCACTATAG GGACCAAGGGGAAAATGAAGATGGGATATTGG Muv-B-MP-1-R: 27 ATAAGAATGCGGCCGCGGTCACCATGCTGCCCT GTGCAAGCA F2 Muv-B-MP-2-F: 2500bp 28 TTGGCGCGCCAGCATGGTGACCCAAATAAAGA A Muv-B-MP-2-R: 29 CTCGCGGACCGCCGGATTAATTAATTGGGGCTG AAAC F3 Muv-B-MP-3-F: 6224bp 30 TTGGCGCGCCCAATTAATTAATCCGGCACTGTC Muv-B-MP-3-R: 31 ATAAGAATGCGGCCGCCAGCCAGCTTTAATTA ATCGTTTCAC F4 Muv-B-MP-4-F: 2981bp 32 TTGGCGCGCCGATTAATTAAAGCTGGCTGTTTA G Muv-B-MP-4-R: 33 ATAAGAATGCGGCCGCCCCATGAAGCTTTCAA GATTAGC F5 Muv-B-MP-5-F: 1142bp 34 TTGGCGCGCCTTGAAAGCTTCATGGGAACCTT Muv-B-MP-5-R: 35 GGTCGGACCGCGAGGAGGTGGAGATGCCATGC CGACCCACCAAGGGGAGAAAGTAAAATC pAC PAC-B-F: 2631bp 36 ATAAGAATGCGGCCGCCTAGCATAACCCCTTG GGGCCTC PAC-B-R: 37 TTGGCGCGCCTGCAGCTGGCGCCATCGATACGC GTA
1.2 Construction and Identification of Infectious Clone of rMuV-SH Deletion Virus

(86) The primer sequences were designed according to the obtained pAC-MuV, and the SH gene was deleted from the original 174bp to 18bp: TTTCTAGCTAGCTGCCGGCATAGTGCAACGGCAGGGT (SEQ ID NO: 39). The vector was doubly digested with Pml I and Apa I, then the homology arms L and R were amplified by PCR using the following primers. Then the fusion PCR was performed, and the target fragment was subjected to homologous recombination with the digested vector to obtain the SH gene deleted full-length recombinant plasmid. The primer information is shown in the following table:

(87) TABLE-US-00004 TABLE3 PrimerSequencesandAmplifiedFragments Amplified SEQ fragment ID Fragment Primersequence length NO: SH-L-F ACAGACAAATGCACGTGCGATAGCGG 1354bp 38 SH-L-R TTTCTAGCTAGCTGCCGGCATAGTGC 39 AACGGCAGGGT SH-R-F CCGGCAGCTAGCTAGAAAGATCTCCA 2149bp 40 ACCCGGACA SH-R-R ATTTGCTAGTGGGCCCAAGTCATCTG 41 GCTCC
1.3 Construction of Helper Plasmids

(88) According to the full-length gene information of QS-F virus obtained from sequencing results, primers were designed to amplify N, P and L and they were connected to pcDNA3.1 to obtain plasmids pcDNA3.1-N, pcDNA3.1-P and pcDNA3.1-L.

(89) 1.4 Rescue and Identification of Virus

(90) The full-length plasmid of SH gene deleted QS-F virus and helper plasmids were extracted in large quantities with the Sigma Endotoxin Removal Kit; and then they were co-transfected into cells. The cells were inoculated in a six-well plate for overnight culture, and cell wells with a cell confluence of 80-90% were selected for virus rescue. The specific process is as follows: the full-length plasmid pAC-MuV (7 g), helper plasmids pcDNA3.1-N(1.5 g), pcDNA3.1-P (0.2 g), pcDNA3.1-L(1.0 g) and Lipofectamine 2000 transfection reagent (12 L) were mixed in 500 L DMEM medium and incubated at 37 C. for 20 min; cells were washed 3 times with PBS, then the plasmid transfection reagent mixture was added into the cell wells and incubated at 37 C. for 6 h. Washed the cells 3 times with PBS, replaced with DMEM medium containing 2% serum and 1% antibiotic, and continued to culture cells at 37 C. for 3-4 days. Transfected cells were lysed and inoculated into Vero cells for culture. After the cells have obvious fusion lesions, the cell supernatant was collected and identified.

(91) The following viruses were rescued: recombinant mumps virus with SH gene deletion (rMuV-SH) (SH gene deletion changed from 174 bp to 18 bp), recombinant mumps virus with V gene deletion (rMuV-V) (insert A at positions 2439-2430 and 2432-2433, and insert TAGC at position 3199), recombinant mumps virus with SH gene deletion and V gene deletion (rMuV-SHV) (combined with the above two mutation methods).

(92) Among them, the construction method of infectious cloning of rMuV-V deletion virus and rMuV-SHV deletion virus is similar to the construction method in Example 1.2.

(93) 1.5 PCR Detection

(94) The cell supernatants of the above virus rescue experiments were collected respectively. The collected cell supernatant was used to infect Vero cells. When lesions occurred in more than 50% of the cells, the cells were collected and lysed with TRIZOL. Total RNA was extracted, and reverse transcription was carried out. The specific primer SH-F/SH-R were used for PCR detection, and the amplified fragments were subjected to gene sequencing. The results are shown in FIG. 4.

(95) 1.6 Experimental Conclusion

(96) According to the typical pathological characteristics caused by the virus in Vero cells and the sequencing results of the rescued virus genome, the recombinant mumps virus with SH gene deletion, V gene deletion, and SH gene and V gene deletion was successfully constructed.

Example 2: Growth Characteristics and Genetic Stability of Recombinant Viruses

(97) 2.1 Growth Characteristics of Recombinant Virus

(98) The three recombinant viruses were inoculated into Vero cells grown into monolayers in a 24-well plate at MOI=0.01 (volume of 300 L), respectively. After 1 h of infection, the cells were washed three times with PBS and continued to be cultured in DMEM medium containing 2% fetal bovine serum. Cell supernatant was collected at 1 d, 2 d, 3 d, 4 d and 5 d after virus inoculation respectively, and viral titer was determined. A multi-step growth curve was drawn to analyze the in vitro replication characteristics of the three strains of mumps virus.

(99) The results are shown in FIG. 5. The growth kinetics curves of the three recombinant viruses in Vero cells have certain coincidence, and there is no significant difference in growth kinetics.

(100) 2.2 Passaging Adaptability of Recombinant Viruses in Chicken Embryos Cells

(101) Three recombinant viruses were mixed with chicken embryo fibroblasts made from 9-11 days old chicken embryos at MOI=0.01 to inoculation. After 24h of inoculation, the cells were washed 3 times with PBS and continued to be cultured in DMEM medium containing 2% fetal bovine serum.

(102) The three viruses were continuously passaged in chicken embryo fibroblasts to compare the in vitro replication characteristics of P0 and P10 generations.

(103) The cells were inoculated at MOI=0.01. The cell supernatant was collected at 2 d, 3 d, 4 d and 5 d after virus inoculation, and the viral titer was measured. The multi-step growth curve was drawn to analyze the in vitro replication characteristics of the three mumps viruses.

(104) The results are shown in FIG. 6. Comparing the growth characteristics of the three recombinant viruses on chicken embryo cells, the results showed that rMuV-SHV and rMuV-V did not significantly increase the viral titer on chicken embryo cells before and after the passage on chicken embryo cells, while rMuV-SH P10 could better adapt to chicken embryo cells, and the viral titer thereof was significantly increased to meet the needs of vaccine production, which was named QS-F-SH2.

(105) 2.3 Genetic Stability of QS-F-SH2

(106) The obtained QS-F-SH2 were continuously passaged in chicken embryo cells, and the SH gene was sequenced in the 15th and 30th generations. The results of agarose gel electrophoresis are shown in FIG. 7.

(107) The results showed that the SH gene of QS-F-SH2 did not mutate during the passage, and the deletion of the SH gene was inherited stably.

(108) 2.4 Experimental Conclusion

(109) From the above results, it can be seen that there is no significant difference in the growth kinetics of the three recombinant viruses, and all of them can reach higher titers.

(110) However, only QS-F-SH2 recombinant virus has good passaging adaptability on chicken embryo cells. Moreover, QS-F-SH2 recombinant virus has good genetic stability and has no mutation in the process of virus passage and proliferation, which has the potential to be a candidate strain of novel mumps vaccine.

Example 3: Immunogenicity Assay in Mice

(111) Sixty SPF mice aged 6-8 weeks were selected and randomly divided into 4 groups, namely A, B, C and D. Group A was inoculated with commercial attenuated mumps vaccine JL at a dose of 410.sup.5 CCID.sub.50/mouse, group B was inoculated with F genotype wild virus at a dose of 410.sup.5 CCID.sub.50/mouse, group C was inoculated with recombinant vaccine QS-F-SH2 at a dose of 410.sup.5 CCID.sub.50/mouse, and group D was inoculated with blank diluent. The inoculation site of each group was intramuscular injection in the hindlimb, 50 L on each side. After 21 days of immunization, the same dose was used to boost the immunization once. After 14 days of the secondary immunization, blood was collected from the mice and serum was separated. The neutralization titer of the virus (attack virus: F genotype WT) was determined, and clinical observation of mice was carried out daily before and after immunization.

(112) TABLE-US-00005 TABLE 4 Immunization program Dosage Numbers Sample Grouping Vaccines (CCID.sub.50) (mice) collection A JL 4 10.sup.5 15 14 days after the secondary immunization B WT 4 10.sup.5 15 14 days after the secondary immunization C QS-F-SH2 4 10.sup.5 15 14 days after the secondary immunization D Diluent 100 L
3.1 Virus Neutralization Assay

(113) First, the serum to be tested was inactivated at 56 C. for 30 min, and then diluted by 2 times. 50 L of each serum dilution was added to 50 L of F genotype virus (containing 100 CCID.sub.50) was added, and treated at 37 C. for 1 h. 100 L DMEM cell culture medium containing 10% fetal bovine serum was added and the cells were cultured at 37 C. for 7 days with 5% CO.sub.2. The lesions of the cells were observed under a microscope. The neutralization titer of serum antibody was calculated according to the formula. The results were statistically analyzed.

(114) The results of the immunogenicity assay are shown in FIG. 8. Among them, the neutralization titer of JL (A genotype vaccine) to F genotype wild virus (epidemic strain) is significantly lower than that of F genotype wild virus. At the same time, it is equivalent to immune effect of genotype wild virus QS-F, that is, QS-F-SH2 maintains good immunogenicity.

Example 4: Viral Neurotoxicity Assay

(115) Four SPF WISTAR pregnant rats were selected and randomly divided into four groups, namely A, B, C and D. After giving birth, intracranial injection experiments were performed on the suckling rats. Suckling rats of group A were inoculated with commercial mumps attenuated vaccine at a dose of 100 CCID.sub.50/rat; suckling rats of group B were inoculated with F genotype wild virus at a dose of 100 CCID.sub.50/rat; suckling rats of group C were inoculated with recombinant vaccine with gene deletion at a dose of 100 CCID.sub.50/rat; suckling rats of group D were inoculated with blank diluent. The inoculation site of each group was 2 mm on the left side of the sagittal suture of the brain, between the bregma and the herringbone point, and the inoculation volume was 10 L/rat. After 25 days of inoculation, the suckling mice were sacrificed, and the brains were taken for vibrating slices to analyze the degree of hydrocephalus, hydrocephalus=cross-sectional area of lateral ventricle/cross-sectional area of brain100.

(116) The experimental results are shown in FIG. 9. Pathological sections of brain tissue of suckling rats showed that the degree of hydrocephalus caused by gene deletion virus strain QS-F-SH2 was not significantly different from that of JL. Combined with the results of neutralizing antibodies, QS-F-SH2 shows highly attenuating characteristics, and is safe for suckling rat, and can resist the infection of mumps.

(117) All literatures mentioned in the present application are incorporated by reference herein, as though individually incorporated by reference. In addition, it should be understood that after reading the above teaching content of the present invention, various changes or modifications may be made by those skilled in the art, and these equivalents also fall within the scope as defined by the appended claims of the present application.