ECHINOCANDIN COMPOUND, AND PREPARATION METHOD THEREFOR AND USE THEREOF
20250360180 ยท 2025-11-27
Assignee
Inventors
- Jinzhong XU (Hangzhou, Zhejiang, CN)
- Xionghui YU (Hangzhou, Zhejiang, CN)
- Pinmei WANG (Hangzhou, Zhejiang, CN)
Cpc classification
A61K45/06
HUMAN NECESSITIES
C07K7/56
CHEMISTRY; METALLURGY
C07K7/50
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
A61K38/12
HUMAN NECESSITIES
International classification
A61K38/12
HUMAN NECESSITIES
C07K7/56
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present invention relates to an echinocandin compound, and a preparation method therefor and the use thereof. Specifically, disclosed in the present invention are an echinocandin B deoxidation analogue and a biosynthesis method therefor. The echinocandin B deoxidation analogue has a good antifungal activity.
Claims
1-30. (canceled)
31. An echinocandin compound represented by the general formula (I), ##STR00023## or an ester, a stereoisomer, a prodrug, a solvate and a pharmaceutically acceptable salt thereof, wherein, R.sub.1 is selected from H; R.sub.2 is selected from H; R.sub.3 is selected from H and alkyl; R.sub.5, and R.sub.6 are identical with or different from each other, and are each independently selected from H or OH; R.sub.4 and R.sub.5 are identical with or different from each other, and are each independently selected from the group consisting of H, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl, said alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl are optionally substituted by halogen, cyano, nitro, thiol, S-alkyl, S(O)-alkyl, SO.sub.2-alkyl, NR.sub.cR.sub.d, COOR.sub.e, and CONR.sub.cR.sub.d, wherein R.sub.c, R.sub.d, R.sub.e, R.sub.c, and R.sub.d are each independently selected from H and alkyl; R.sub.7 is selected from H, OH, halogen, OSO.sub.3H, or -alkylene-N.sub.fR.sub.g, wherein R.sub.f and R.sub.g are each independently selected from H, alkyl; R.sub.9 is H or fatty acyl; provided that: R.sub.c and R.sub.d are not both H; when R.sub.1, R.sub.2, and R.sub.5 are H, and R.sub.6 is OH, R.sub.3 is not methyl.
32. The compound or an ester, a stereoisomer, a prodrug, a solvate and a pharmaceutically acceptable salt thereof according to claim 31, wherein R.sub.4 and R.sub.8 are identical with or different from each other and are each independently selected from H, C.sub.1-6 alkyl, C.sub.1-6 alkenyl, C.sub.1-6 alkynyl, C.sub.6-14 aryl, C.sub.6-14 heteroaryl, C.sub.6-14 cycloalkyl, C.sub.6-14 heterocyclyl, wherein the C.sub.1-6 alkyl, C.sub.1-6 alkenyl, C.sub.1-6 alkynyl, C.sub.6-14 aryl, C.sub.6-14 heteroaryl, C.sub.6-14 cycloalkyl, C.sub.6-14 heterocyclyl are optionally substituted by halogen, cyano, nitro, thiol, SC.sub.1-6alkyl, S(O)C.sub.1-6alkyl, SO.sub.2C.sub.1-6alkyl, NR.sub.cR.sub.d, COOR.sub.e, and CONR.sub.cR.sub.d, wherein R.sub.c, R.sub.d, R.sub.e, R.sub.c, and R.sub.d are each independently selected from H, C.sub.1-6 alkyl.
33. The compound or an ester, a stereoisomer, a prodrug, a solvate and a pharmaceutically acceptable salt thereof according to claim 31, wherein, R.sub.4 and R.sub.8 are identical with or different from each other, and are each independently selected from H, C.sub.1-6 alkyl, said C.sub.1-6 alkyl is optionally substituted by halogen, cyano, nitro, thiol, SC.sub.1-6alkyl, S(O)C.sub.1-6alkyl, SO.sub.2C.sub.1-6alkyl, NR.sub.cR.sub.d, COOR.sub.e, CONR.sub.cR.sub.d, wherein R.sub.c, R.sub.d, R.sub.e, R.sub.c, and R.sub.d are each independently selected from H, C.sub.1-6 alkyl.
34. The compound or an ester, a stereoisomer, a prodrug, a solvate and a pharmaceutically acceptable salt thereof according to claim 31, wherein R.sub.9 is C.sub.6-50 fatty acyl, which optionally contains an unsaturated alkenyl, cycloalkyl, aryl, heteroaryl, or heterocyclic.
35. The compound or an ester, a stereoisomer, a prodrug, a solvate and a pharmaceutically acceptable salt thereof according to claim 31, wherein R.sub.9 is ##STR00024## ##STR00025##
36. The compound or an ester, a stereoisomer, a prodrug, a solvate and a pharmaceutically acceptable salt thereof according to claim 31, wherein provided that: at least one of R.sub.5, and R.sub.6 is H; R.sub.c and R.sub.d are not both H; when R.sub.1, R.sub.2, and R.sub.5 are H, and R.sub.6 is OH, R.sub.3 is not methyl.
37. The compound or an ester, a stereoisomer, a prodrug, a solvate and a pharmaceutically acceptable salt thereof according to claim 31, wherein R.sub.1, R.sub.2, R.sub.5, and R.sub.6 are H.
38. The compound or an ester, a stereoisomer, a prodrug, a solvate and a pharmaceutically acceptable salt thereof according to claim 31, wherein R.sub.1, R.sub.2, R.sub.5, and R.sub.6 are H; R.sub.3, R.sub.4, and R.sub.5 are each independently H or methyl; R.sub.7 is H, OH, or OSO.sub.3H; R.sub.9 is ##STR00026## ##STR00027##
39. The compound according to claim 31, which is ##STR00028## ##STR00029## or an ester, a stereoisomer, a prodrug, a solvate and a pharmaceutically acceptable salt thereof.
40. A pharmaceutical composition comprising the compound, or an ester, stereoisomer, prodrug, solvate and pharmaceutically acceptable salt thereof according to claim 31.
41. The pharmaceutical composition according to claim 40, which further comprises an additional antifungal agent.
42. An echinocandin biosynthetic gene cluster, which consists of genes ecdA, ecdI and htyE, and optional ecdG and/or htyF; or which consists of genes ecdA, ecdI, ecdK and htyE, and optional ecdG and/or htyF.
43. The echinocandin biosynthetic gene cluster according to claim 42, which consists of genes ecdA, ecdI and htyE; or consists of genes ecdA, ecdI, ecdK and htyE; or consists of genes ecdA, ecdI, ecdG and htyE; or consists of genes ecdA, ecdI, ecdG, htyE and htyF.
44. A genetically engineered transformant strain comprising the echinocandin biosynthetic gene cluster according to claim 43.
45. The genetically engineered transformant strain according to claim 44, which is the transformant strain LO8030-5.1 with a deposit accession number of CCTCC M 20211360, or the transformant strain LO8030-4.2.1 with a deposit accession number of CCTCC M 2022168, or the transformant strain LO8030-4.2.1.5 with a deposit accession number of CCTCC M 2023155, or the transformant strain LO8030-4.2.1.9 with a deposit accession number of CCTCC M 2023156.
46. Use of the compound according to claim 31 in the preparation of a medicament for treating or preventing fungal infection-associated diseases.
47. The use according to claim 46, wherein the fungus is selected from any one or more of Aspergillus (such as Aspergillus flavus, Aspergillus fumigatus, Aspergillus glaucus, Aspergillus nidulans, Aspergillus niger and Aspergillus terreus), Blastomyces dermatitidis, Candida (such as Candida albicans, Candida glabrata, Candida tropicalis, Candida parapsilosis, Candida krusei and Candida guilliermondii), Coccidioides immitis, Cryptococcus (such as Cryptococcus neoformans, Cryptococcus albicans and Cryptococcus laurentii), Histoplasma capsulatum var. capsulatum, Histoplasma capsulatum duboisii, Paracoccidioides brasiliensis, Sporothrix schenckii, Absidia corymbifera, Rhizomucor pusillus and Rhizopus arrhizus.
48. The use according to claim 46, the fungal infection-associated disease is selected from one or more of scalp tinea, tinea corporis, tinea pedis, onychomycosis, perionychomycosis, tinea versicolor, thrush, vaginal candidiasis, respiratory tract candidiasis, biliary tract candidiasis, esophageal candidiasis, urethral candidiasis, systemic candidiasis, mucosal and skin candidiasis, aspergillosis, mucormycosis, paracoccidioidomycosis, North American blastomycosis, histoplasmosis, coccidioidomycosis, sporotrichosis, fungal sinusitis and chronic sinusitis.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the office upon request and payment of the necessary fee.
DETAILED DESCRIPTION
Definition
[0155] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms should be clear, however, in the event of any potential ambiguity, the definitions provided hereinafter take precedence over any dictionary or external definition.
[0156] As used herein, the term ester refers to an ester formed by an esterification reaction between OH of the compound represented by formula (I) and an organic acid, an inorganic acid, etc. The ester may undergo hydrolysis under acidic or alkaline conditions to generate the corresponding acid or alcohol.
[0157] As used herein, the term stereoisomer(s) refers to compounds that have identical chemical constitution and connectivity but have different orientations of their atoms in space that are not interchangeable by single bond rotation. Stereoisomer(s) includes diastereomer(s) and enantiomer(s). Diastereomer(s) refers to stereoisomers that have two or more chiral centers and of which molecules are not mirror images of one another. Diastereomers have different physical properties, such as melting points, boiling points, spectral characteristics, and reactivity. Diastereomeric mixtures may be separated under high resolution analytical procedures such as crystallization, electrophoresis and chromatography. Enantiomers refers to two stereoisomers of a compound that are non-superimposable mirror images of one another.
[0158] As used herein, the term pharmaceutically acceptable salt refers to a pharmaceutically acceptable organic or inorganic salt of a compound of the present invention. Exemplary salts include, but are not limited to, sulfates, citrates, acetates, oxalates, chlorides, bromides, iodides, nitrates, bisulfates, phosphates, acidic phosphates, isonicotinates, lactates, salicylates, acidic citrates, tartrates, oleates, tannates, pantothenates, bitartrates, ascorbates, succinates, maleates, gentisinates, fumarates, gluconates, glucuronates, saccharates, formates, benzoates, glutamates, methanesulfonates (mesylate), ethanesulfonates, benzenesulfonates, p-toluenesulfonates, and pamoates; or ammonium salts (e.g., primary, secondary, tertiary, quaternary ammonium salts), metal salts (e.g., sodium, potassium, calcium, magnesium, manganese, iron, zinc, copper, lithium, aluminum salt).
[0159] As used herein, the term pharmaceutically acceptable means that the substance or composition must be chemically and/or toxicologically compatible with the other ingredients comprising the formulation and/or the mammals to be treated therewith.
[0160] As used herein, the term treatment refers to both therapeutic treatment and prophylactic or preventative or preventative measures, wherein the object is to prevent or slow down (lessen) the undesired pathological change or condition. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, reduction in disease severity, delay or slowing of disease progression, improvement or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
[0161] As used herein, the term therapeutically effective amount refers to an amount of a compound of the invention that can: (i) treat or prevent a disease or condition described herein, (ii) ameliorate or eliminate one or more diseases or conditions described herein, or (iii) prevent or delay the onset of one or more symptoms of a disease or condition described herein.
[0162] As used herein, the term alkyl refers to a linear or branched saturated hydrocarbon group having 1 to 20 carbon atoms. Preferably, the alkyl is an alkyl having 1 to 12 carbon atoms. More preferably, the alkyl is an alkyl having 1 to 6 carbon atoms. Most preferably, the alkyl is an alkyl having 1 to 4 carbon atoms. Examples of alkyl include, but are not limited to, methyl, ethyl, 1-propyl (n-propyl), 2-propyl (isopropyl), 1-butyl (n-butyl), 2-methyl-1-propyl (isobutyl), 2-butyl (sec-butyl), 2-methyl-2-propyl (tert-butyl), 1-pentyl (n-pentyl), 2-pentyl, 3-pentyl, 2-methyl-2-butyl, 3-methyl-2-butyl, 3-methyl-1-butyl, 2-methyl-1-butyl, 1-hexyl, 2-hexyl, 3-hexyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 3-methyl-3-pentyl, 2-methyl-3-pentyl, 2,3-dimethyl-2-butyl, 3,3-dimethyl-2-butyl, 1-heptyl, 1-octyl, 1-nonyl, 1-decyl, etc.
[0163] As used herein, the term alkylene refers to a divalent alkyl as defined above. As used herein, the alkylene has 1 to 10 carbon atoms (i.e., C.sub.1-10 alkylene), 1 to 8 carbon atoms (i.e., C.sub.1-8 alkylene), 1 to 6 carbon atoms (i.e., C.sub.1-6 alkylene), or 1 to 4 carbon atoms (i.e., C.sub.1-4 alkylene).
[0164] As used herein, the term alkenyl refers to a hydrocarbon containing at least one carbon-carbon double bond and having 2 to 20 carbon atoms (i.e., C.sub.2-20 alkenyl), 2 to 8 carbon atoms (i.e., C.sub.2-8 alkenyl), 2 to 6 carbon atoms (i.e., C.sub.2-6 alkenyl), or 2 to 4 carbon atoms (i.e., C.sub.2-4 alkenyl). Examples of the alkenyl include, for example, ethenyl, propenyl, butadienyl (including 1,2-butadienyl and 1,3-butadienyl).
[0165] As used herein, the term alkynyl refers to a hydrocarbon group containing at least one carbon-carbon triple bond and having 2 to 20 carbon atoms (i.e., C.sub.2-20 alkynyl), 2 to 8 carbon atoms (i.e., C.sub.2-8 alkynyl), 2 to 6 carbon atoms (i.e., C.sub.2-6 alkynyl), or 2 to 4 carbon atoms (i.e., C.sub.2-4 alkynyl). The term alkynyl also includes those groups having one triple bond and one double bond.
[0166] As used herein, the term halogen refers to fluorine, chlorine, bromine, and iodine.
[0167] As used herein, the term cycloalkyl refers to a monovalent saturated carbocyclic group. Preferably, the cycloalkyl is a 3 to 8 membered monocyclic group. More preferably, the cycloalkyl is a 3 to 6 membered monocyclic group. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.
[0168] The term aryl as used herein refers to a single all-carbon aromatic ring or a multiple condensed all-carbon ring system wherein at least one ring is aromatic, and wherein the aryl has 6 to 20 carbon atoms, 6 to 14 carbon atoms, 6 to 12 carbon atoms, or 6 to 10 carbon atoms. Aryl includes phenyl. Aryl also includes multiple condensed ring systems (e.g., ring systems comprising 2, 3 or 4 rings) having about 9 to 12 carbon atoms in which at least one ring is aromatic and wherein the other ring(s) may be aromatic or not aromatic (i.e., carbocycle). Such multiple condensed ring system is optionally substituted with one or more (e.g., 1, 2 or 3) oxo groups on any carbocycle portion of the multiple condensed ring system. The rings of the multiple condensed ring system can be connected to each other via condensed, spiro and bridged bonds when allowed by valency requirements. It is to be understood that the point of attachment of a multiple condensed ring system, as defined above, can be at any position of the ring system including the aromatic portion or the carbocycle portion of the ring. Exemplary aryl includes, but are not limited to, phenyl, indenyl, naphthyl, 1, 2, 3, 4-tetrahydronaphthyl, anthryl, and the like.
[0169] As used herein, the term heteroaryl refers to a 5- to 6-membered aromatic ring having at least one atom other than carbon in the ring, wherein the atom is selected from oxygen, nitrogen and sulfur; heteroaryl also includes multiple condensed ring systems having 8-16 atoms, which have at least one such aromatic ring, and multiple condensed ring systems are further described below. Thus, heteroaryl includes single aromatic rings having about 1 to 6 carbon atoms and about 1-4 heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur. The sulfur and nitrogen atoms may also be present in an oxidized form if the ring is aromatic. Exemplary heteroaryl ring systems include but are not limited to pyridyl, pyrimidinyl, oxazolyl or furyl. Heteroaryl also includes multiple condensed ring systems (e.g., ring systems comprising 2 or 3 rings) wherein a heteroaryl, as defined above, is condensed with one or more rings selected from heteroaryls (to form for example a naphthyridinyl such as 1,8-naphthyridinyl), heterocycles, (to form for example a 1, 2, 3, 4-tetrahydronaphthyridinyl such as 1,2,3,4-tetrahydro-1,8-naphthyridinyl), carbocycles (to form for example 5,6,7,8-tetrahydroquinolyl) and aryls (to form for example indazolyl) to form the multiple condensed ring system. Thus, a heteroaryl (a single aromatic ring or multiple condensed ring system) has about 1-15 carbon atoms and about 1-6 heteroatoms within the heteroaryl ring. Multiple condensed ring systems may be optionally substituted with one or more (e.g., 1, 2, 3 or 4) oxo groups on the carbocycle or heterocycle portions of the condensed ring. The rings of the multiple condensed ring system can be connected to each other via condensed, spiro and bridged bonds when allowed by valency requirements. It is to be understood that the individual rings of the multiple condensed ring system may be connected in any order relative to one another. It is also to be understood that the point of attachment of a multiple condensed ring system (as defined above for a heteroaryl) can be at any position of the multiple condensed ring system including a heteroaryl, heterocycle, aryl or carbocycle portion of the multiple condensed ring system. It is also to be understood that the point of attachment for a heteroaryl or heteroaryl multiple condensed ring system can be at any suitable atom of the heteroaryl or heteroaryl multiple condensed ring system including a carbon atom and a heteroatom (e.g., a nitrogen). Exemplary heteroaryls include but are not limited to pyridyl, pyrrolyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrazolyl, thienyl, indolyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, furyl, oxadiazolyl, thiadiazolyl, quinolyl, isoquinolyl, benzothiazolyl, benzoxazolyl, indazolyl, quinoxalyl, quinazolyl, 5,6,7,8-tetrahydroisoquinolinyl benzofuranyl, benzimidazolyl, thianaphthenyl, pyrrolo[2,3-b]pyridinyl, quinazolinyl-4 (3H)-one, triazolyl, 4,5,6,7-tetrahydro-1H-indazolyl, and 3b,4,4a,5-tetrahydro-1H-cyclopropa[3,4]cyclopenta[1,2-c]pyrazolyl.
[0170] The term heterocyclyl or heterocycle as used herein refers to a single saturated or partially unsaturated 4 to 8 membered ring that has at least one atom other than carbon in the ring, wherein the atom is selected from oxygen, nitrogen and sulfur; the term also includes multiple condensed ring systems that have at least one such saturated or partially unsaturated ring, which multiple condensed ring systems have 7 to 12 atoms and are further described below. Thus, the term includes single saturated or partially unsaturated rings (e.g., 3, 4, 5, 6, 7 or 8 membered rings) having about 1 to 7 carbon atoms and about 1 to 4 heteroatoms selected from oxygen, nitrogen and sulfur in the ring. The ring may be substituted with one or more (e.g., 1, 2 or 3) oxo groups and the sulfur and nitrogen atoms may also be present in their oxidized forms. The rings of the multiple condensed ring system can be connected to each other via condensed, spiro and bridged bonds when allowed by valency requirements. It should be understood that the individual rings of the multiple condensed ring system may be connected in any order relative to one another. It should also be understood that the point of attachment of the multiple condensed ring system (as defined above for heterocyclyl or heterocycle) may be at any position of the multiple condensed ring system. It should also be understood that the point of attachment of the heterocycle or heterocyclic multiple condensed ring system may be at any suitable atom of the heterocyclyl, including carbon and nitrogen atoms. Exemplary heterocyclyls or heterocycles include, but are not limited to aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, homopiperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydrofuranyl, dihydrooxazolyl, tetrahydropyranyl, tetrahydrothiopyranyl, 1,2,3,4-tetrahydroquinolyl, benzoxazinyl, dihydrooxazolyl, chromanyl, 1,2-dihydropyridinyl, 2,3-dihydrobenzofuranyl, 1,3-benzodioxolyl, 1,4-benzodioxanyl, spiro[cyclopropane-1,1-isoindolinyl]-3-one, isoindolinyl-1-one, 2-oxa-6-azaspiro[3.3]heptanyl, imidazolidin-2-one-N-methylpiperidine, imidazolidine, pyrazolidine, butyrolactam, valerolactam, imidazolidinone, hydantoin, dioxolane, phthalimide, 1,4-dioxane, thiomorpholine, thiomorpholine-S-oxide, thiomorpholine-S,S-oxide, pyranyl, 3-pyrrolinyl, thiopyranyl, pyronyl, tetrahydrothiophenyl, quinuclidinyl, tropanyl, 2-azaspiro[3.3]heptanyl, (1R,5S)-3-azabicyclo[3.2.1]octanyl, (1s,4s)-2-azabicyclo[2.2.2]octanyl, (1R,4R)-2-oxa-5-azabicyclo[2.2.2]octanyl, and pyrrolidin-2-one.
[0171] As used herein, the term optionally substituted means that a given structure or group is not substituted, or that a given structure or group is substituted with one or more specific substituents. Unless otherwise stated, optional substitution may occur at any position of the substituted group.
[0172] As used herein, the term solvate refers to an association complex or complex of one or more solvent molecules and a compound of the present invention. Examples of solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, and ethanolamine. The term hydrate refers to a complex wherein the solvent molecule is water.
[0173] As used herein the term prodrug refers to those compounds that readily undergo chemical changes under physiological conditions to provide the compounds of the present invention. Additionally, prodrugs can be converted to the compounds of the present invention by chemical or biochemical methods in an ex vivo environment. For example, prodrugs can be slowly converted to the compounds of the present invention when placed in a transdermal patch reservoir with a suitable enzyme or chemical reagent.
[0174] Any compound or structure given herein, is also intended to represent unlabeled forms as well as isotopically labeled forms of the compounds. These forms of the compounds may also be referred to as isotopically enriched analogues. Isotopically labeled compounds have structures depicted by the formulas given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Examples of isotopes that can be incorporated into compounds of the disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine chlorine, and iodine, such as, .sup.2H, .sup.3H, .sup.11C, .sup.13C, .sup.14C, .sup.13N, .sup.15N, .sup.15O, .sup.17O, .sup.18O, .sup.31P, .sup.32P, .sup.35S, .sup.18F, .sup.36Cl, .sup.123I, and .sup.125I, respectively. Various isotopically labeled compounds of the present disclosure, for example those into which radioactive isotopes such as .sup.3H, .sup.13C, and .sup.14C are incorporated. Such compounds are synthesized by means well known in the art, for example by employing starting materials in which one or more hydrogens have been replaced with deuterium.
[0175] The term genome or genomic DNA as used herein is referring to the genetic information of a host organism. The genomic DNA comprises the entire genetic material of a cell or an organism, including the DNA of the nucleus (chromosomal DNA), extrachromosomal DNA, and organellar DNA (e.g. of mitochondria). Preferably, the terms genome or genomic DNA is referring to the chromosomal DNA of the nucleus.
[0176] As used herein, in case the term recombination is used to specify an organism or cell, e.g. a microorganism, it is used to express that the organism or cell comprises at least one transgene, transgenic or recombination polynucleotide, which is usually specified later on.
[0177] As used herein, A polynucleotide exogenous to an individual organism is a polynucleotide which is introduced into the organism by any means other than by sexual hybridization.
[0178] As used herein, the term promoter refers to a polynucleotide region that initiates transcription of a coding sequence. Promoters are located near the transcription start sites of genes, on the same strand and upstream on the DNA (towards the 5 region of the sense strand). Some promoters are constitutive as they are active in all circumstances in the cell, while others are regulated becoming active in response to specific stimuli, e.g., an inducible promoter. The term promoter activity and its grammatical equivalents as used herein refer to the extent of expression of nucleotide sequence that is operably linked to the promoter whose activity is being measured. Promoter activity can be measured directly by determining the amount of the produced RNA transcript, for example by Northern blot analysis or be measured indirectly by determining the amount of product coded for by the linked nucleic acid sequence, such as a reporter nucleic acid sequence linked to the promoter.
[0179] The term expression cassette means those constructs in which the polynucleotide sequence to encode the amino acid sequence to be expressed is effectively linked to at least one genetic control element which enables or regulates the expression (i.e. transcription and/or translation) of the same. The expression may be, for example, stable or transient, constitutive or inducible.
[0180] As used herein, the term plasmid refers to an extrachromosomal element that often carries genes that are not part of the core metabolic mechanism of the cell and is usually in the form of a circular double-stranded DNA molecule. These elements may be autonomously replicating sequence, genome-integrating sequence, phage or nucleotide sequence of any origin, linear, circular or supercoiled single-stranded or double-stranded DNA or RNA. Typically, the plasmid contains an origin of replication functional in host cells (e.g., E. coli) and a selectable marker for detecting host cells containing the plasmid.
[0181] As used herein, gene ecdA includes gene sequences having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91378.1; preferably, gene ecdA is a gene sequence having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91378.1; and more preferably, gene ecdA is a gene sequence having accession number AFT91378.1.
[0182] As used herein, gene ecdI includes gene sequences having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91380.1; preferably, gene ecdI is a gene sequence having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91380.1; and more preferably, gene ecdI is a gene sequence having accession number AFT91380.1.
[0183] As used herein, gene ecdK includes gene sequences having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91382.1; preferably, gene ecdK is a gene sequence having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91382.1; and more preferably, gene ecdK is a gene sequence having accession number AFT91382.1.
[0184] As used herein, gene htyE includes gene sequences having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91391.1; and preferably, gene htyE is a gene sequence having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91391.1. More preferably, gene htyE is the gene sequence having accession number AFT91391.1.
[0185] As used herein, gene htyF includes gene sequences having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91399.1; and preferably, gene htyF is a gene sequence having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91399.1. More preferably, the gene htyF is the gene sequence having accession number AFT91399.1.
[0186] As used herein, gene ecdG includes gene sequences having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91379.1; and preferably, gene ecdG is a gene sequence having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91379.1. More preferably, gene ecdG is the gene sequence having accession number AFT91379.1.
[0187] As used herein, gene ecdH includes gene sequences having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91389.1; and preferably, gene ecdH is a gene sequence having about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the gene sequence having accession number AFT91389.1. More preferably, gene ecdH is the gene sequence having accession number AFT91389.1.
[0188] As used herein, the term transformation refers to the introduction of one or more exogenous polynucleotides into a host cell by using physical or chemical methods.
[0189] As used herein, the term expression is the process by which the information encoded within a gene is revealed. If the gene encodes a protein, then expression involves both transcription of the DNA into mRNA, the processing of mRNA (if necessary) into a mature mRNA product, and translation of the mature mRNA into protein.
[0190] As used herein, the term host cell refers to any cell type that is susceptible to transformation, transfection, transduction, and the like, with a nucleic acid construct or plasmid comprising a polynucleotide of the present invention. The term host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. Preferably, the host cell is a microorganism. More preferably, the microorganism is a bacterium, a yeast, a fungus, such as a cell of the class Ascomycetes. The bacteria that can be used as the host cell of the present invention are preferably selected from Escherichia coli and Bacillus subtilis. Preferably the fungus is selected from the genus Aspergillus (such as Aspergillus japonicus, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Aspergillus fumigatus, Aspergillus aculeatus, Aspergillus caesiellus, Aspergillus candidus, Aspergillus carneus, Aspergillus clavatus, Aspergillus deflectus, Aspergillus fischerianus, Aspergillus flavus, Aspergillus glaucus, Aspergillus ochraceus, Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus restrictus, Aspergillus sojae, Aspergillus tamari, Aspergillus terreus, Aspergillus ustus, Aspergillus versicolor), and the genus Penicillium (such as Penicillium aurantiogriseum, Penicillium bilaiae, Penicillium camemberti, Penicillium candidum, Penicillium chrysogenum, Penicillium claviforme, Penicillium commune, Penicillium crustosum, Penicillium digitatum, Penicillium expansum, Penicillium funiculosum, Penicillium glabrum, Penicillium glaucum, Penicillium italicum, Penicillium lacussarmientei, Penicillium marneffei, Penicillium purpurogenum, Penicillium roqueforti, Penicillium stoloniferum, Penicillium ulaiense, Penicillium verrucosum, Penicillium viridicatum). Preferably the yeast is selected from the genera Saccharomyces, Schizosaccharomyces, Candida and Pichia.
Pharmaceutical Compositions and Administration
[0191] In one embodiment, the present invention provides a pharmaceutical composition having antifungal infection activity, including a compound represented by general formula (I) or an ester, stereoisomer, prodrug, solvate or pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
[0192] Pharmaceutically acceptable carriers can be solid or liquid. Among them, the solid carrier may be one or more materials used as excipients, diluents, sweeteners, solubilizers, lubricants, binders, tablet disintegrants, stabilizers, preservatives, or encapsulating materials. The liquid carrier may be solvents or liquid dispersion media. Suitable solid carriers include, but are not limited to, for example, cellulose, glucose, lactose, mannitol, magnesium stearate, magnesium carbonate, saccharin sodium, sucrose, dextrin, talc, starch, pectin, gelatin, tragacanth, arabic gum, sodium alginate, parabens, methylcellulose, sodium carboxymethyl cellulose, a low-melting point wax, cocoa butter, and the like. Suitable liquid carriers include, but are not limited to, water, ethanol, polylol (such as glycerol, propanediol, liquid polyethylene glycol, etc.), a vegetable oil (such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soy bean oil), glyceride, agar, water free of pyrogen, isotonic saline, Ringer's solution and a mixture thereof.
[0193] The pharmaceutical composition according to the present invention may be prepared by a known method, including conventional blending, granulating, tableting, coating, dissolving, or lyophilization processes.
[0194] In one embodiment, the pharmaceutical composition of the present invention may be administered to a patient or subject in need of treatment by any suitable route of administration, including oral administration, parenteral administration (including subcutaneous, intramuscular, intravenous, and intradermal administration), inhalation spray administration, topical administration, rectal administration, nasal administration, cervicobuccal administration, vaginal administration or administration via an implantable reservoir.
[0195] The orally administered composition in the present invention includes a solid dosage form such as pill, tablet, caplet, capsule (including immediate release, timed release and sustained release formulations), granule, and powder; or a liquid dosage form such as solution, syrup, elixir, emulsion, and suspension. Sterile solutions or ocular drug delivery devices are intended for ocular administration. Sterile solutions, emulsions and suspensions are intended for parenteral administration.
Indications and Treatments
[0196] The compound of the present invention or its ester, stereoisomer or pharmaceutically acceptable salt and the pharmaceutical composition comprising the compound of the present invention or its ester, stereoisomer or pharmaceutically acceptable salt can be used for treating and/or preventing diseases caused by fungal infection. Therefore, the present invention also relates to a method for treating and/or preventing diseases caused by fungal infection, comprising administering a therapeutically effective amount of a compound represented by formula (I) or its ester, stereoisomer, prodrug, solvate or pharmaceutically acceptable salt of the present invention to a patient in need.
[0197] Diseases caused by fungal infections include, but are not limited to, one or more of scalp tinea, tinea corporis, tinea pedis, onychomycosis, perionychomycosis, tinea versicolor, thrush, vaginal candidiasis, respiratory tract candidiasis, biliary tract candidiasis, esophageal candidiasis, urethral candidiasis, systemic candidiasis, mucosal and skin candidiasis, aspergillosis, mucormycosis, paracoccidioidomycosis, North American blastomycosis, histoplasmosis, coccidioidomycosis, sporotrichosis, fungal sinusitis and chronic sinusitis.
[0198] The dosage depends on various factors including the age, weight and condition of a patient and the route of administration. The exact dosage to be administered is left to the discretion of the attending physician. The actual dose levels and time frame of the active ingredient of the pharmaceutical composition of the present invention may be varied to obtain an amount of the active ingredient that, for a particular patient, composition and route of administration, may induce the desired therapeutic response without posing toxicity to the patient. Typically, the pharmaceutical composition of the present invention is administered at a dose sufficient to reduce or eliminate symptoms associated with fungal infection.
[0199] The preferred dose of the agent is the maximum dose that a patient can tolerate and that does not produce serious or unacceptable side effects. Exemplary dose ranges include 0.01 to 250 mg/day, 0.01 to 100 mg/day, 1 to 100 mg/day, 10 to 100 mg/day, 1 to 10 mg/day, and 0.01 to 10 mg/day. The preferred dose of the agent is the maximum dose that a patient can tolerate and that does not produce serious or unacceptable side effects. In examples, the medicament is administered at a dose of about 0.01 to about 100 mg/kg bw/day, about 0.1 to about 10 mg/kg bw/day, or about 1.0 to about 10 mg/kg bw/day.
[0200] In one embodiment, a therapeutically effective dose results in a serum medicament concentration from about 0.1 ng/ml to about 50-100 mg/mL. Typically, these pharmaceutical compositions should be administrated at a dose of about 0.001 to about 2000 mg/kg bw/day. For example, the range of the dose for systemic administration to a human patient may be 1-10 mg/kg. 20-80 mg/kg, 5-50 mg/kg, 75-150 mg/kg, 100-500 mg/kg. 250-750 mg/kg. 500-1000 mg/kg, 1-10 mg/kg, 5-50 mg/kg. 25-75 mg/kg. 50-100 mg/kg. 100-250 mg/kg, 50-100 mg/kg, 250-500 mg/kg, 500-750 mg/kg. 750-1000 mg/kg, 1000-1500 mg/kg, 10 1500-2000 mg/kg. 5 mg/kg. 20 mg/kg, 50 mg/kg, 100 mg/kg, 500 mg/kg, 1000 mg/kg, 1500 mg/kg, or 2000 mg/kg. Pharmaceutical unit dosage forms are prepared to provide about 1 to about 5000 mg (e.g., about 100 to about 2500 mg) of the compound or combination of essential ingredients per unit dosage form. Preferred unit dose formulations are those containing a daily dose or unit, a daily sub-dose, or an appropriate fraction thereof, as discussed herein, of a given ingredient.
[0201] The present invention is further illustrated by the following specific examples, which are not intended to limit the present invention. Many modifications and adjustments may be made by those skilled in the art in light of the above teachings without departing from the spirit and scope of the present invention.
EXAMPLES
Strains:
[0202] The strains used in the present invention are listed in Table 1. Among them, by knocking out eight most highly expressed biosynthetic gene clusters (BGCs) genes, the triple auxotrophic chassis strain Aspergillus nidulans LO8030 (pyrG-, riboB-, pyroA-) has a clean metabolic background and low demand for precursors (see Chiang Y M et al., (2013) An efficient system for heterologous expression of secondary metabolite genes in Aspergillus nidulans, Journal of the American Chemical Society 135, 7720-7731). Considering the large number of genes that need to be transferred and the huge gene fragments encoding core biosynthetic enzymes, one of the challenges of heterologous expression of fungal BGCs is to assemble and transfer the BGC genes into heterologous chassis strains.
Culture Medium:
Solid Glucose Minimum Medium (GMM)
[0203] Formulation: each liter of culture medium contains 10 g glucose, 6 g NaNO.sub.3, 0.52 g KCl, 0.52 g MgSO.sub.4.Math.7H.sub.2O, 1.52 g KH.sub.2PO.sub.4, 0.022 g ZnSO.sub.4.Math.7H.sub.2O, 0.011 g H.sub.3BO.sub.3, 0.005 g MnCl.sub.2.Math.4H.sub.2O, 0.0016 g FeSO.sub.4.Math.7H.sub.2O, 0.0016 g CoCl.sub.2.Math.5H.sub.2O, 0.0016 g CuSO.sub.4.Math.5H.sub.2O, 0.0011 g (NH.sub.4).sub.6M.sub.O7O.sub.24.Math.4H.sub.2O, 0.05 g Na.sub.4EDTA, 16 g agar powder, and NaOH (adjusting pH to 6.5).
Preparation Process:
[0204] 1 L 20Nitrate Salts was prepared, containing 120 g NaNO.sub.3, 10.4 g KCl, 10.4 g MgSO.sub.4.Math.7H.sub.2O, and 30.4 g KH.sub.2PO.sub.4; [0205] 100 mL of Trace Elements was prepared, containing 2.2 g ZnSO.sub.4.Math.7H.sub.2O, 1.1 g H.sub.3BO.sub.3, 0.5 g MnCl.sub.2.Math.4H.sub.2O, 0.16 g FeSO.sub.4.Math.7H.sub.2O, 0.16 g CoCl.sub.2.Math.5H.sub.2O, 0.16 g CuSO.sub.4.Math.5H.sub.2O, 0.11 g (NH.sub.4).sub.6M.sub.O7O.sub.24.Math.4H.sub.2O, and 5 g Na.sub.4EDTA; [0206] Then, for each liter of GMM liquid medium, a solid glucose minimum medium was obtained by taking 50 mL of 20 Nitrate Salts, 1 mL of Trace Elements, 10.0 g of glucose, and 16.0 g of agar powder, and by adding 800 mL of ddH.sub.2O, adjusting the pH to 6.5 with NaOH, making up to 1 liter, with autoclave at 121 C. for 20 minutes, further cooling to 60 C., dispensing into plates, and cooling and solidify at room temperature.
Liquid Glucose Minimum Medium:
[0207] Formulation: each liter of culture medium contains 10 g glucose, 6 g NaNO.sub.3, 0.52 g KCl, 0.52 g MgSO.sub.4.Math.7H.sub.2O, 1.52 g KH.sub.2PO.sub.4, 0.022 g ZnSO.sub.4.Math.7H.sub.2O, 0.011 g H.sub.3BO.sub.3, 0.005 g MnCl.sub.2.Math.4H.sub.2O, 0.0016 g FeSO.sub.4.Math.7H.sub.2O, 0.0016 g CoCl.sub.2.Math.5H.sub.2O, 0.0016 g CuSO.sub.4.Math.5H.sub.2O, 0.0011 g (NH.sub.4).sub.6M.sub.O7O.sub.24.Math.4H.sub.2O, 0.05 g Na.sub.4EDTA, and NaOH (adjusting pH to 6.5).
Preparation Process:
[0208] 1 L 20 Nitrate Salts was prepared, containing 120 g NaNO.sub.3, 10.4 g KCl, 10.4 g MgSO.sub.4.Math.7H.sub.2O, and 30.4 g KH.sub.2PO.sub.4; [0209] 100 mL of Trace Elements was prepared, containing 2.2 g ZnSO.sub.4.Math.7H.sub.2O, 1.1 g H.sub.3BO.sub.3, 0.5 g MnCl.sub.2.Math.4H.sub.2O, 0.16 g FeSO.sub.4.Math.7H.sub.2O, 0.16 g CoCl.sub.2.Math.5H.sub.2O, 0.16 g CuSO.sub.4.Math.5H.sub.2O, 0.11 g (NH.sub.4).sub.6M.sub.O7O.sub.24.Math.4H.sub.2O, and 5 g Na.sub.4EDTA; [0210] Then, for each liter of GMM liquid medium, a liquid glucose minimum medium was obtained by taking 50 mL of 20 Nitrate Salts, 1 mL of Trace Elements, 10.0 g of glucose, and by adding 800 mL of ddH.sub.2O, adjusting the pH to 6.5 with NaOH, making up to 1 liter, with autoclave at 121 C. for 20 minutes, further cooling to room temperature.
Culture Conditions:
[0211] Emericella rugulosa NRRL 11440 and Aspergillus nidulans LO8030 strains were stored as glycerol stocks at 80 C. and activated in solid glucose minimum medium (GMM) at 37 C. (see Shimizu et al. (2001) Genetic involvement of a cAMP-dependent protein kinase in a G protein signaling pathway regulating morphological and chemical transitions in Aspergillus nidulans, Genetics 157, 591-600), supplementing for nutritional deficiencies when necessary. For the pyr G auxotrophic type, 0.56 g/L uracil and 1.26 g/L uridine were supplemented in the GMM; for the pyro A auxotrophic type, 1 mg/L pyridoxine hydrochloride was supplemented; for the ribo B auxotrophic type, 2.5 mg/L riboflavin was supplemented. Saccharomyces cerevisiae BJ5464 was used for yeast homologous recombination plasmid construction (see Yin W B, et al., (2013). Discovery of cryptic polyketide metabolites from dermatophytes using heterologous expression in Aspergillus nidulans, ACS Synth Biol 2, 629-634.), and Escherichia coli DH5 was used for plasmid amplification.
TABLE-US-00001 TABLE 1 Strains used in the present invention Strains Notes Purpose Source Emericella rugulosa Wild type obtain ATCC, NRRL 11440 Ecd/Hty USA BGC gene Escherichia coli Plasmid laboratory DH5 cloning and storage Saccharomyces MATalpha, ura 3-52, trp 1, leu2-1, his 3- Plasmid Wen-Bing cerevisiae BJ5464 200, pep4::HIS 3, prb 1-1.6R, can 1, GAL construction Yin et al..sup.1 Aspergillus nidulans pyr G89, pyro A4, ribo B2, nkuA::argB, Chassis strain Yi-Ming LO8030 .sup.a sterigmatocystin cluster (AN7804-AN7825), Chiang emericellamide cluster (AN2545-AN2549), et al..sup.2 asperfuranone cluster (AN1039-AN1029), monodictyphenone cluster (AN10023- AN10021), terrequinone cluster (AN8512- AN8520) , austinol cluster (AN8379- AN8384, AN9246-AN9259) , F9775 cluster (AN7906-AN7915), asperthecin cluster (AN6000-AN6002) . LO8030-1.1/1.3/1.6 .sup.b pyr G89, pyro A4, yA:: (xylp-ecdA 1 - 2 - transformant This study AfriboB) strains of the first round LO8030-2.2 /2.4/2.5 .sup.b pyro A4, ribo B2, yA:: (xylp-ecdA 1 - 2 -ecdA transformant This study 3 -AppyrG -gpdAp-ecdI) strains of the second round LO8030-4.1/4.2/4.3 .sup.b pyr G89, pyro A4, yA:: (xylp-ecdA-gpdAp- transformant This study ecdI-AfriboB) strains of the third round LO8030- pyro A4, yA:: (xylp-ecdA-gpdAp-ecdI- transformant This study 5.1/5.2/5.3/5.4/5.5/ AfriboB), pYX10 strains of the 5.6 .sup.b fourth round LO8030-4.2.1 .sup.b pyro A4, yA:: (xylp-ecdA-gpdAp-ecdI- transformant This study strains of the AfriboB), pJQ10 fourth round LO8030-4C.1 pyr G89, pyro A4, yA:: (xylp-gpdAp-AfriboB) Control of This study transformant strains of the third round, without biosynthetic genes LO8030-5C.1 pyro A4, yA:: (xylp-gpdAp-AfriboB), pYX12 Control of This study transformant strains of the fourth round, without biosynthetic genes LO8030-4.2.1.5 pyro A4, yA::(xylp-ecdA-gpdAp-ecdI- transformant This study AfriboB), pJQ10, pJQ5 strains of the fifth round LO8030-4.2.1.9 pyro A4, yA: :(xylp-ecdA-gpdAp-ecdI- transformant This study AfriboB), pJQ10, pJQ9 strains of the fifth round .sup.a Description of the Aspergillus nidulans LO8030 transformant strains, with omitting the genotype portion identical to LO8030. .sup.b 1.1/1.3/1.6 represent three parallel transformant strains generated in the first round of Aspergillus transformation, and the three transformants have the same genotype; 2.2/2.4/2.5, 4.1/4.2/4.3 and 5.1/5.2/5.3/5.4/5.5/5.6 represent different parallel transformant strains generated in the second, third and fourth rounds of transformation, respectively. .sup.1Yin, W B, Chooi, Y H, Smith, A R, Cacho, R A, Hu, Y., White, T C, and Tang, Y. (2013) Discovery of cryptic polyketide metabolites from dermatophytes using heterologous expression in Aspergillus nidulans, ACS Synth Biol 2, 629-634. .sup.2Chiang, Y M, Ahuja, M., Oakley, C E, Entwistle, R., Asokan, A., Zutz, C., Wang, C C, and Oakley, B R (2016) Development of Genetic Dereplication Strains in Aspergillus nidulans Results in the Discovery of Aspercryptin, Angewandte Chemie (International ed. in English) 55, 1662-1665.
Example 1. Plasmid Construction
[0212] To extract genomic DNA (gDNA), Emericella rugulosa NRRL 11440 and Aspergillus nidulans LO8030 were cultivated in liquid GMM at 37 C. for 24 h and supplemented for auxotrophs as necessary. gDNA was extracted from Emericella rugulosa NRRL 11440 according to the standard protocol (see Sambrook, J., and Russell, DW (2001) Molecular cloning: a laboratory manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). Then, the gDNA of Emericella rugulosa NRRL 11440 was used as a template and high-fidelity DNA polymerase Primestar HS/MAX (Takara, Japan) was used to clone the echinocandin biosynthetic gene cluster (BGC) genes (as shown in Table 3) by PCR (PCR operation program is shown in Table 2). The nonribosomal polypeptide synthetase (NRPS) gene ecdA of the echinocandin biosynthetic gene cluster (BGC) was divided into four fragments ecdA 1-4, each of which was approximately 6-7 kb, for PCR cloning, wherein the ecdA 1 fragment contained base pairs 1 to 5831, the ecdA 2 fragment contained base pairs 5648 to 11563, the ecdA 3 fragment contained base pairs 10591 to 16084, and the ecdA 4 fragment contained base pairs 14938 to 21910. All PCR primers used in the present invention are shown in Table 4.
TABLE-US-00002 TABLE 2 PCR operation program: Pre-denaturation 98 C. 1 min 30 Cycle Denaturation 98 C. 10 s annealing 60 C. 30 s extension 72 C. 5 s/kb Thermal insulation 4 C.
TABLE-US-00003 TABLE 3 Genes of the echinocandin biosynthetic gene cluster Length Accession Gene (bp) Function Number ecdA 21910 NRPS (TCATCATCATCATCATCATC)* AFT91378.1 ecdI 1924 Fatty acyl AMP ligase AFT91380.1 ecdK 1119 Dioxygenase, involved in the AFT91382.1 cyclization of L-leucine to 4R-Me-L-proline htyE 1104 Oxygenase, involved in the AFT91391.1 hydroxylation of L-proline C.sub.4 and 4R-Me-L-proline C.sub.3 ecdG Monooxygenase, responsible for the AFT91379.1 hydroxylation of L-homotyrosine at the C-3 position HtyF Monooxygenase, responsible for the AFT91399.1 hydroxylation of L-homotyrosine at the C-4 position EcdH Dioxygenase, responsible for the AFT91389.1 hydroxylation of L-ornithine at C-4 and C-5 positions *NRPS domains: T represents thiolation, C represents condensation, and A represents adenylylation.
TABLE-US-00004 TABLE4 PCRprimers Name Sequence(5-3).sup.a Purpose ecdA1-F ATGCACAGAACCAACGAGATGG(SEQIDNO:1) ecdA1 ecdA1-R TCGCTGCAGGTGGAGTGAATG(SEQIDNO:2) amplification ecdA2-F CGTTTGCGACCCTTACCTCTAC(SEQIDNO:3) ecdA2 ecdA2-R TGGCCTGCTCCTCAACCATTTC(SEQIDNO:4) amplification pYX1-Ribo-yAdn-F AACAATGTGTGCATGAAATGGTTGAGGAGCAGGCCAGCGGACT Amplificationof GAGTTATGGATGAC(SEQIDNO:5) theRiboandyA pYX1-Ribo-yAdn-R AGGAACCGAAATACATACATTGTCTTCCGTAAAGCCCCAGTCAC downstream GACGTTGTAAAAC(SEQIDNO:6) fragmentsof PYX1 pYX1-AscI-F GCTTTACGGAAGACAATG(SEQIDNO:7) Amplificationof pYX1-AscI-R CAATTCCACACAACATACGAGCCGGAAGCATAAAGAATTCGGG pYX1plasmid TGCCTAATGAGTGAG(SEQIDNO:8) backbone pYX1-YAup-F TTTATGCTTCCGGCTCG(SEQIDNO:9) Amplificationof pYX1-YAup-R ATAAGTATACTCTATTGACCTATAGGACCTGAGTGATGCTCGGCT theyAupstream TGATGTTGTTCG(SEQIDNO:10) fragmentyA-up ofpYX1 pYX1-xylp-F GCATCACTCAGGTCCTATAGG(SEQIDNO:11) Amplificationof pYX1-xylp-R CAGTTGGTTCTTCGAGTCGATG(SEQIDNO:12) xylpofpYX1 ecdA3-F ACTCATTAGGCACCCAAATATGCGGCCGCTATAAAGAACAGTTC ecdA3 TTCGTATGGACG(SEQIDNO:13) amplification ecdA3-R CTTTCGTTGGATCTGGTATTC(SEQIDNO:14) pYX5-pyrG-F CGAGGTCGGTGAGGTTGAATACCAGATCCAACGAAAGAGCTTA Amplificationof TACGAACAGATGG(SEQIDNO:15) AppyrGof pYX5-pyrG-R CAAATAGAATTAAATGGTACTCGAGTCCACTGAAGGTGCCCAAC PYX5 GCATTCTTCATG(SEQIDNO:16) pYX5-gpdA-F CACCTTCAGTGGACTCGAGTAC(SEQIDNO:17) Amplificationof pYX5-gpdA-R CCAGTTGGCTGCACCATGCTGGGGAAGTGAAGACCATTGTGAT gpdApofpYX5 GTCTGCTCAAGCG(SEQIDNO:18) ecdI-F ATGGTCTTCACTTCCCCAGCATG(SEQIDNO:19) ecdI ecdI-R CCAAGGCGCATGTACTAGTCAAG(SEQIDNO:20) amplification pYX5-yA-down-F GTATCATAACAATCTTGACTAGTACATGCGCCTTGGGGGGTTGA Amplificationof TGTTTGGGATTC(SEQIDNO:21) theyA pYX5-yA-down-R ACATTGTCTTCCGTAAAGCTTTATAGCGGCCGCATATTTCCTCGG downstream TTCAGTCTTACTAG(SEQIDNO:22) fragmentyA- downofpYX5 pYX5-AscI-F AAATATGCGGCCGCTATAAAGCTTTACGGAAGACAATG(SEQ Amplificationof IDNO:23) pYX5plasmid pYX5-AscI-R TTTATAGCGGCCGCATATTTGGGTGCCTAATGAGTGAG(SEQ backbone IDNO:24) ecdA4-F GACCTTGCTGCCTCATTTGC(SEQIDNO:25) ecdA4 ecdA4-R GGCTCCCTTTATGCTCTTCG(SEQIDNO:26) amplification pYX9-riboB-F AGTCAGACAATGTTCCGAAGAGCATAAAGGGAGCCGCGGACT Amplificationof GAGTTATGGATGAC(SEQIDNO:27) AffiboB pYX9-riboB-R CAACAAGTGCCACTCAACGC(SEQIDNO:28) pYX9-gpdA-F TCACTGAGTCAATGGCGTTGAGTGGCACTTGTTGCACCTTCAG gpdAp TGGACTCGAGTAC(SEQIDNO:29) amplification pYX9-gpdA-R ATTGTCTTCCGTAAAGCTTTATAGCGGCCGCATATTTTGTGATGT CTGCTCAAGCG(SEQIDNO:30) pYX9-AscI-F AAATATGCGGCCGCTATAAAGCTTTACGGAAGACAATG(SEQ Amplificationof IDNO:31) pYX9plasmid pYX9-AscI-R AGCAAATGAGGCAGCAAGGTCTTTATAGCGGCCGCATATTTGGG backbone TGCCTAATGAGTGAG(SEQIDNO:32) pYX14-yA-up-F ACTCATTAGGCACCCAAATATGCGGCCGCTATAAATTTATGCTT Amplificationof CCGGCTCGTAT(SEQIDNO:33) theyAupstream pYX14-yA-up-R ATAAGTATACTCTATTGACCTATAGGACCTCGGCTTGATGTTGTT fragmentyA-up CG(SEQIDNO:34) ofpYX14 pYX14-xyl-F ACGGAAGCGCGCAGTCGGCG(SEQIDNO:35) Amplificationof pYX14-xyl-R GAAAGGGAGTCATCCATAACTCAGTCCGCAGTTGGTTCTTCGA xylpofpYX14 GTCGATG(SEQIDNO:36) pYX14-riboB-F GCGGACTGAGTTATGGATGAC(SEQIDNO:37) Amplificationof pYX14-riboB-R CAACAAGTGCCACTCAACGC(SEQIDNO:38) AfriboBof PYX14 pYX14-gpdA-F GAGTCAATGGCGTTGAGTGGCACTTGTTGCACCTTCAGTGGA Amplificationof CTCGAGTAC(SEQIDNO:39) gpdApofpYX14 pYX14-gpdA-R TGTGATGTCTGCTCAAGCG(SEQIDNO:40) pYX14-yA-down-F ACAGCTACCCCGCTTGAGCAGACATCACAGGGGTTGATGTTTG Amplificationof GGATTC(SEQIDNO:41) theyAupstream pYX14-yA-down-R TGTCTTCCGTAAAGCTTTATAGCGGCCGCATATTTCCTCGGTTC fragmentyA- AGTCTTACTAG(SEQIDNO:42) downofpYX14 pYX14-AscI-F AAATATGCGGCCGCTATAAAGCTTTACGGAAGACAATGTA Amplificationof (SEQIDNO:43) pYX14plasmid pYX14-AscI-R TTTATAGCGGCCGCATATTTGGGTGCCTAATGAGTGAGCT backbone (SEQIDNO:44) pYX10-amyB-F CCATCATGGTGTTTTGATC(SEQIDNO:45) Amplificationof pYX10-amyB-R AATTCGGAGCTTGCTGTGG(SEQIDNO:46) amyBpof pYX10 pYX10-htyE-F TTCTCTGAACAATAAACCCCACAGCAAGCTCCGAATTATGGCTA Amplificationof TCACTACGCTAG(SEQIDNO:47) htyE pYX10-htyE-R TGTCAACTACGACTGTCATG(SEQIDNO:48) pYX10-gpdA-F CTCATATTCATATTCATGACAGTCGTAGTTGACACACCTTCAGT Amplificationof GGACTCGAGTAC(SEQIDNO:49) gpdApofpYX10 pYX10-gpdA-R TGTGATGTCTGCTCAAGCG(SEQIDNO:50) pYX10-ecdK-F CTTGACTAACAGCTACCCCGCTTGAGCAGACATCACAATGTCT Amplificationof GTTCTAACTCTCG(SEQIDNO:51) ecdK pYX10-ecdK-R GGAATAGTCCTCTCGGGCCATCTGTTCGTATAAGCTGATAAACA GCAGGTGACATG(SEQIDNO:52) pYX10-pyrG-F AGCTTATACGAACAGATGG(SEQIDNO:53) Amplificationof pYX10-pyrG-R ATACAAAAAATAAGCTGGCTTTCCCCGTCAAGCTCTAACCCAAC AppyrGof GCATTCTTCATG(SEQIDNO:54) pYX10 pYX10-AMA1-F TTAGAGCTTGACGGGGAAAGC(SEQIDNO:55) Amplificationof pYX10-AMA1-R CCAGGAACCGAAATACATACATTGTCTTCCGTAAAGCACTCTAG AMA1of AGGATCCTGCAG(SEQIDNO:56) PYX10 pYX10-AscI-F GCTTTACGGAAGACAATG(SEQIDNO:57) Amplificationof pYX10-AscI-R CCATATAAAAATTTAAAATGATCAAAACACCATGATGGGGGTGCC pYX10plasmid TAATGAGTGAG(SEQIDNO:58) backbone pYX12-gpdA-F TCTGAACAATAAACCCCACAGCAAGCTCCGAATTCACCTTCAG Amplificationof TGGACTCGAGTAC(SEQIDNO:59) gpdApofpYX12 pYX12-gpdA-R CGGAATAGTCCTCTCGGGCCATCTGTTCGTATAAGCTTGTGATG TCTGCTCAAGCG(SEQIDNO:60) pJQ10-pyrG/AMA1-F AGCTTATACGAACAGATGG(SEQIDNO:61) Amplificationof pJQ10-pyrG/AMA1-R CCAGGAACCGAAATACATACATTGTCTTCCGTAAAGCACTCTAG thepyrG-AMA1 AGGATCCTGCAG(SEQIDNO:62) fragmentof pJQ10 pJQ10-AscI-F GCTTTACGGAAGACAATG(SEQIDNO:63) Amplificationof pJQ10-AscI-R GGGTGCCTAATGAGTGAG(SEQIDNO:64) pJQ10plasmid backbone pJQ10-amyBp/htyE-F CGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCCATCAT Amplificationof GGTGTTTTGATC(SEQIDNO:65) theamyBp-htyE pJQ10-amyBp/htyE-R CGGAATAGTCCTCTCGGGCCATCTGTTCGTATAAGCTTGTCAAC fragmentof TACGACTGTCATG(SEQIDNO:66) pJQ10 pJQ5-pyroA4/AMA1-F GCATCCACATGATCGACAGC(SEQIDNO:67) Amplificationof pJQ5-pyroA4/AMAI-R CCAGGAACCGAAATACATACATTGTCTTCCGTAAAGCACTCTAG fragments AGGATCCTGCAG(SEQIDNO:68) pyroA4and AMA1ofpJQ5 pJQ5-AscI-F GCTTTACGGAAGACAATG(SEQIDNO:69) Amplificationof pJQ5-AscI-R GGGTGCCTAATGAGTGAG(SEQIDNO:70) pJQ5plasmid backbone pJQ5-amyBp/ecdG-F CGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCCATCAT Amplificationof GGTGTTTTGATC(SEQIDNO:71) fragmentsamyBp pJQ5-amyBp/ecdG-R CACTAACACTTGTTTTGGCTGTCGATCATGTGGATGCGGATTTA andecdGof CTGGATCTGTCA(SEQIDNO:72) pJQ5 pJQ9-pyroA4/AMA1-F GCATCCACATGATCGACAGC(SEQIDNO:73) Amplificationof pJQ9-pyroA4/AMAI-R CCAGGAACCGAAATACATACATTGTCTTCCGTAAAGCACTCTAG fragments AGGATCCTGCAG(SEQIDNO:74) pyroA4and AMA1ofpJQ9 pJQ9-AscI-F GCTTTACGGAAGACAATG(SEQIDNO:75) Amplificationof pJQ9-AscI-R GGGTGCCTAATGAGTGAG(SEQIDNO:76) pJQ9plasmid backbone pJQ9-amyBp/ecdG-F CGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCCATCAT Amplificationof GGTGTTTTGATC(SEQIDNO:77) fragmentsamyBp pJQ9-amyBp/ecdG-R GGATTTACTGGATCTGTCA(SEQIDNO:78) andecdGof pJQ9 pJQ9-gpdAp/htyF-F TTCTTGCCTGAGATGAGCTGACAGATCCAGTAAATCCCACCTTC Amplificationof AGTGGACTCGAGTAC(SEQIDNO:79) fragmentsgpdAp pJQ9-gpdAp/htyF-R CACTAACACTTGTTTTGGCTGTCGATCATGTGGATGCACGACC andhtyFofpJQ9 AAATAGCACACAGC(SEQIDNO:80) Semi- RT-ecdA-F TTCTCCGGGTCTTCTTGTC(SEQIDNO:81) quantitative RT-ecdA-R TTCTTCCCATTCTGGTGTC(SEQIDNO:82) RT-PCR RT-ecdI-F TCTTTGGCATTAACGACG(SEQIDNO:83) detection RT-ecdI-R CTGTGACCCTTGGGAATAC(SEQIDNO:84) RT-ecdK-F ATCTGCCTGTGCGGTTTG(SEQIDNO:85) RT-ecdK-R ATCCTGGAACGATGGACG(SEQIDNO:86) RT-htyE-F TTTGTTCGGCGAATCATCG(SEQIDNO:87) RT-htyE-R GCAACGCAGTCAAATGGTC(SEQIDNO:88) RT-H2B-F CTGCCGAGAAGAAGCCTAGCAC(SEQIDNO:89) RT-H2B-R GAAGAGTAGGTCTCCTTCCTGGTC(SEQIDNO:90) .sup.aThe bases in italics are the homologous region sequences used for yeast homologous recombination.
[0213] According to Yin et al. (Discovery of cryptic polyketide metabolites from dermatophytes using heterologous expression in Aspergillus nidulans, ACS Synth Biol (2013) 2, 629-634.), a plasmid was constructed in Saccharomyces cerevisiae BJ5464 by yeast homologous recombination (
TABLE-US-00005 TABLE 5 Constructed plasmids Name Notes Purpose pYX1 xylp-ecdA1-2-AfriboB Contains the expression cassette for the first round of transformation pYX5 ecdA3-AppyrG- Contains the expression cassette for gpdAp-ecdI the second round of transformation pYX9 ecdA4-AfriboB-gpdAp Contains the expression cassette for the third round of transformation pYX10 amyBp-htyE-gpdAp- Heterologous expression of ecdK-AppyrG, AMA1 oxygenase genes htyE and ecdK pYX14 xylp-AfriboB-gpdAp, Contains expression cassette for control transformant strains pYX12 amyBp-gpdAp- pYX10 control AppyrG, AMA1 pJQ10 amyBp-htyE- Heterologous expression of AppyrG, AMA1 oxygenase gene htyE pJQ5 amyBp-ecdG- Heterologous expression of pyroA4, AMA1 oxygenase gene ecdG pJQ9 amyBp-ecdG-gpdAp- Heterologous expression of htyF-pyroA4, AMA1 oxygenase genes ecdG and htyF
Example 2: Preparation of Aspergillus nidulans Gene Transformant Strain LO8030-5.1
[0214] Some fragments of the plasmid were initially connected by double-joint PCR (DJ-PCR) (Yu et al. (2004) Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi, Fungal genetics and biology: FG & B 41, 973-981.), and then the plasmid was constructed by yeast homologous recombination to obtain the gene expression cassette. Through three rounds of transformation, the heterologous gene expression cassettes of ecdA and ecdI were integrated into the yA gene site of Aspergillus nidulans LO8030, as shown in
[0215] Specifically, the gene expression cassette used for the first round of transformation was from plasmid pYX1 (
TABLE-US-00006 TABLE 6 Templates and primers for constructing PCR clones of each fragment of pYX1 plasmid Fragment Length No. Fragment Template Primer pair (kb) {circle around (1)} ecdA1 E. plicatilis ecdA1-F and 5.8 NRRL 11440 ecdA1-R genomic DNA {circle around (2)} ecdA2 E. plicatilis ecdA2-F and 5.9 NRRL 11440 ecdA2-R genomic DNA {circle around (3)} AfriboB- pYH-yA-riboA pYX1-Ribo- 3.4 yA-down plasmid.sup.a yAdn-F and pYX1- Ribo-yAdn-R {circle around (4)} Plasmid pYH-yA-riboA pYX1-AscI-F 4.8 backbone plasmid.sup.a and pYX1- fragment AscI-R {circle around (5)} yA-up pYH-yA-riboA pYX1-YAup-F and 1.1 plasmid.sup.a pYX1-YAup-R {circle around (6)} xylp pSK485 pYX1-xylp-F and 1.8 plasmid.sup.b pYX1-xylp-R .sup.aWang, P M et al. (2016). TrpE feedback mutants reveal roadblocks and conduits toward increasing secondary metabolism in Aspergillus fumigatus. Fungal genetics and biology 89: 102-113.) .sup.bHartmann, T. et al. (2010). Validation of a self-excising marker in the human pathogen Aspergillus fumigatus by employing the beta-rec/six site-specific recombination system. Appl Environ Microbiol 76(18): 6313-6317.
[0216] The gene expression cassette for the second round of transformation was from plasmid pYX5 (FIG. 4). The gene expression cassette contains the third fragment of ecdA, ecdA3, the nutritional deficiency marker gene pyrG (AppyrG) from Aspergillus parasiticus (GenBank: EU817656), the promoter of the glyceraldehyde-3-phosphate dehydrogenase encoding gene gpdAp from Aspergillus nidulans (Lim, F Y et al. (2012). Genome-based cluster deletion reveals an endocrocin biosynthetic pathway in Aspergillus fumigatus. Appl Environ Microbiol 78 (12): 4117-4125.), ecdI and a DNA fragment yA-down of about 1 kb downstream of the gene yA, wherein, ecdA3 and ecdA2 have a homologous sequence of about 1 kb, which is a homologous region fragment used for homologous recombination in Aspergillus transformation. After PCR amplification of each fragment (Table 7), after gel tapping, purification, and mixing, transformation of yeast BJ5464 was performed. After obtaining yeast transformants, yeast plasmids were extracted using a yeast plasmid extraction kit (OMEGA Bio-tek), and the plasmids were transformed into competent Escherichia coli for plasmid amplification and PCR detection. By detecting the interface of each fragment with primer pairs, the target fragment of the expected size was obtained, and the plasmid pYX5 was successfully constructed (
TABLE-US-00007 TABLE 7 Templates and primers for constructing PCR clones of each fragment of pYX5 plasmid Fragment Length No. Fragment Template Primer pair (kb) {circle around (1)} ecdA3 E. plicatilis ecdA3-F and 5.5 NRRL 11440 ecdA3-R genomic DNA {circle around (2)} AppyrG pJMP9.1 pYX5-pyrG-F and 2 plasmid.sup.a pYX5-pyrG-R {circle around (3)} gpdAp pJMP9.1 pYX5-gpdA-F and 1.2 plasmid.sup.a pYX5-gpdA-R {circle around (4)} ecdI E. plicatilis ecdI-F and 2 NRRL 11440 ecdI-R genomic DNA {circle around (5)} yA-down pYH-yA-riboA pYX5-yA-down-F 1 plasmid and pYX5-yA- down-R {circle around (6)} Plasmid pYH-yA-riboA pYX5-AscI-F2 4.8 backbone plasmid.sup.b and pYX5-AscI- fragment R2 .sup.aLim, F Y et al. (2012). Genome-based cluster deletion reveals an endocrocin biosynthetic pathway in Aspergillus fumigatus. Appl Environ Microbiol 78(12): 4117-4125. .sup.bWang, P M et al. (2016). TrpE feedback mutants reveal roadblocks and conduits toward increasing secondary metabolism in Aspergillus fumigatus. Fungal genetics and biology 89: 102-113.)
[0217] The gene expression cassette for the third round of transformation were from plasmid pYX9 (
TABLE-US-00008 TABLE 8 Templates and primers for constructing PCR clones of each fragment of pYX9 plasmid Fragment Length No. Fragment Template Primer pair (kb) {circle around (1)} ecdA4 E. plicatilis ecdA4-F and 7.1 NRRL 11440 ecdA4-R genomic DNA {circle around (2)} AfriboB pYH-yA-riboA pYX9-riboB-F and 2.3 plasmid.sup.a pYX9-riboB-R {circle around (3)} gpdAp pJMP9.1 pYX9-gpdA-F and 1.2 plasmid.sup.b pYX9-gpdA-R {circle around (4)} Plasmid pYH-yA-riboA pYX9-AscI-F and 4.8 backbone plasmid.sup.a pYX9-AscI-R fragment .sup.aWang, P M et al. (2016). TrpE feedback mutants reveal roadblocks and conduits toward increasing secondary metabolism in Aspergillus fumigatus. Fungal genetics and biology 89: 102-113.) .sup.bLim, F Y et al. (2012). Genome-based cluster deletion reveals an endocrocin biosynthetic pathway in Aspergillus fumigatus. Appl Environ Microbiol 78(12): 4117-4125.
[0218] The control plasmid pYX14 was constructed to obtain the expression cassettes containing xylp, AfriboB and gpdAp (
TABLE-US-00009 TABLE 9 Templates and primers of PCR clones of each fragment for constructing a control plasmid pYX14 Fragment Length No. Fragment Template Primer pair (kb) {circle around (1)} yA-up pYX1 pYX14-yA-up-F and 1.1 pYX14-yA-up-R {circle around (2)} xylp pYX1 pYX14-xyl-F and 1.8 pYX14-xyl-R {circle around (3)} AfriboB pYX9 pYX14-riboB-F and 2.3 pYX14-riboB-R {circle around (4)} gpdAp pYX9 pYX14-gpdA-F and 1.2 pYX14-gpdA-R {circle around (5)} yA-down pYX1 pYX14-yA-down-F and 1 pYX14-yA-down-R {circle around (6)} Plasmid pYX1 pYX14-AscI-F and 4.8 backbone pYX14-AscI-R fragment .sup.aWang, P M et al. (2016). TrpE feedback mutants reveal roadblocks and conduits toward increasing secondary metabolism in Aspergillus fumigatus. Fungal genetics and biology 89: 102-113.) .sup.bLim, F Y et al. (2012). Genome-based cluster deletion reveals an endocrocin biosynthetic pathway in Aspergillus fumigatus. Appl Environ Microbiol 78(12): 4117-4125.
[0219] The E. coli-yeast-Aspergillus shuttle plasmid pYX10 (
TABLE-US-00010 TABLE 10 Templates and primers of PCR clones of each fragment for constructing plasmid Fragment Length No. Fragment Template Primer pair (kb) {circle around (1)} amyBp pTAex3 pYX10-amyB-F and 0.6 plasmid.sup.a pYX10-amyB-R {circle around (2)} htyE E. plicatilis pYX10-htyE-F and 1.2 NRRL 11440 pYX14-xyl-R genomic DNA {circle around (3)} gpdAp pYX5 plasmid pYX10-gpdA-F and 1.2 pYX10-gpdA-R {circle around (4)} ecdK E. plicatilis pYX10-ecdK-F and 1.2 NRRL 11440 pYX10-ecdK-R genomic DNA {circle around (5)} AppyrG pYX5 plasmid pYX10-pyrG-F and 2.0 pYX10-pyrG-R {circle around (6)} AMA1 ANEp2.sup.b pYX10-AMA1-F and 2.6 pYX10-AMA1-R {circle around (7)} Plasmid pYX5 pYX10-AscI-F and 4.8 backbone pYX10-AscI-R fragment .sup.aAwakawa, T. et al. (2012). A heptaketide naphthaldehyde produced by a polyketide synthase from Nectria haematococca. Bioorg Med Chem Lett 22(13): 4338-4340.) .sup.bStorms, R. et al. (2005). Plasmid vectors for protein production, gene expression and molecular manipulations in Aspergillus niger. Plasmid 53(3): 191-204.
TABLE-US-00011 TABLE 11 Templates and primers of PCR clones of each fragment for constructing control plasmid pYX12 Fragment Length No. Fragment Template Primer pair (kb) {circle around (1)} AppyrG-AMA1- pYX10 pYX10-pyrG-F and 10 backbone plasmid pYX10-amyB-R fragment-amyBp {circle around (2)} gpdAp pYX10 pYX12-gpdA-F and 1.2 plasmid pYX12-gpdA-R
[0220] Whole genome sequencing of the gene transformant strain LO8030-5.1 was performed by Illumina HiSeq 2000, and the results showed that no mutations occurred in the four gene cluster genes (ecdA, ecdI, ecdK, and htyE) expressed in the transformant strain LO8030-5.1 (as shown in
Example 3. RNA Preparation and Semi-Quantitative RT-PCR
[0221] The Aspergillus nidulans gene transformant strain LO8030-5.1 and its control strain LO8030-5C.1 were cultured in XSMM medium under the same conditions as those for the fermentation production of echinocandin, and the strains were collected in duplicate. XSMM medium is derived from liquid GMM medium, except that the carbon source glucose (10 g/L) in GMM is replaced by xylose (20 g/L) and starch (20 g/L). Total RNA was extracted using Trizol reagent (Ambion) and DNase I (Promaga). cDNA was synthesized using the PrimeScript RT reagent kit (TaKaRa) and 100 ng of DNase I-treated RNA. Semi-quantitative RT-PCR was performed in a 25 L reaction mixture containing 1 L of diluted cDNA (diluted 10-fold) as a template and 12.5 L of 2Es Taq MasterMix (Cwbio, China). The internal control was the histone 2B gene (H2B), and the primers used for each indicated gene are shown in Table 4.
[0222] The results showed that the four transformed genes (ecdA, ecdI, htyE, and ecdK) could be transcribed to varying degrees. Furthermore, the expression of ecdG, ecdH and htyF was not detected, indicating that the above genes were not transformed into LO8030-5.1. The results of RT-PCR are shown in
Example 4. Fermentation and HPLC/MS Analysis
[0223] The Aspergillus nidulans gene transformant strains LO8030-4.1 and LO8030-5.1 and their controls LO8030-4C.1 and LO8030-5C.1 were cultured in XSMM fermentation medium. XSMM medium is derived from liquid GMM medium, except that the carbon source glucose (10 g/L) in GMM is replaced by xylose (20 g/L) and starch (20 g/L). 1 mg/L pyridoxine hydrochloride was added to the culture medium of LO8030-5.1 and LO8030-5C.1, and 1.26 g/L uracil, 1.26 g/L uridine and 100 mg/L 4R-Me-L-proline were added to the culture medium of LO8030-4.1 and LO8030-4C.1. Since the BGC biosynthetic gene cluster transformed in the present invention does not contain htyA-D genes, L-homotyrosine (100 mg/L) is added to the culture medium of the present invention for the synthesis of deoxyechinocandins. In addition, linoleic acid (300 mg/L) was added to the XSMM fermentation medium to promote the production of echinocandins.
[0224] The above 100 mL XSMM medium was added to a 500 mL flask and fermented at 25 C. and 180 rpm for 12 days in triplicate.
[0225] Then, the fungal cells were separated from the culture solution by filtration. The cells were soaked in methanol and the metabolites were extracted by ultrasound for 3 times, 30 min each time, and the culture medium was extracted for 3 times with an equal amount of ethyl acetate. The organic phases were combined, and the solvent was removed by evaporation in vacuo. The extract was dissolved in 1 mL of methanol, filtered through a 0.22 m filter membrane, and used for HPLC and LC-MS analysis.
[0226] 20 L of the filtrate was subjected to reverse phase high performance liquid chromatography (RP-HPLC) (Agilent 1260). A COSMOCIL C.sub.18-MS-II column (4.6250 mm, 5 m) was used with a flow rate of 1 mL/min, a column temperature of 35 C., an eluent of 10-100% MeOHH.sub.2O (v/v) (linear gradient), and a time of 60 min. The chromatographic peaks were detected at a wavelength of 222 nm.
[0227] LC-MS analysis was performed with an Agilent UPLC-Triple-TOF 5600.sup.+ LC/MS system using positive mode electrospray ionization. A Waters ACQUITY UPLC HSS SB-C.sub.18 column (1002.1 mm, 1.7 m) was used, the eluent was 5-100% methanol in water+0.1% formic acid (linear gradient), and the flow rate was 0.4 mL/min.
[0228] HPLC analysis showed that compared with the control strain LO8030-4C.1, LO8030-4.1 did not have any new obvious peaks (as shown in
Example 5. Nuclear Magnetic Resonance Analysis of Compound 2 (Echinocandin E) and Compound 1 (Echinocandin F)
[0229] After the fermentation of the transformant strain LO8030-5.1 in 10 L XSMM medium was completed, the fermentation liquid and the thallus were extracted three times with equal volumes of ethyl acetate and methanol, respectively. The organic phases were combined and evaporated under reduced pressure to obtain a crude extract (2.20 g). The extract was separated using a silica gel column with a mobile phase of CH.sub.2Cl.sub.2/MeOH (50:1, 20:1, 10:1, 5:1, 2:1, 1:1). The echinocandins were preliminarily identified by thin layer chromatography (TLC) and high performance liquid chromatography (HPLC). Then, it was further purified by semi-preparative HPLC with a COSMOCIL C18-MS-II column (10250 mm, 5 m) and a mobile phase of MeOH/H.sub.2O (85:15) at a flow rate of 3.0 mL/min.
[0230] The separated compounds 1 and 2 were dissolved in CD.sub.3OD for NMR analysis. .sup.1H, .sup.13C and 2D (.sup.1H-.sup.13C HSQC, .sup.1H-.sup.13C HMBC and .sup.1H-.sup.1HCOSY) NMR spectra were recorded on a JNM-ECZ600R/S1 spectrometer. Table 12 shows the .sup.1H NMR and .sup.13C NMR data.
TABLE-US-00012 TABLE 12 .sup.13C NMR and .sup.1H NMR of Echinocandin E and Echinocandin F 1 2 1 2 (Echinocandin F) (Echinocandin E) (Echinocandin F) (Echinocandin E) Position .sup.13C NMR Position .sup.1H NMR 1.sup.st L-Ornithine C-1 175.1 175.0 C-2 53.5 53.4 2-H 4.39 4.38 C-3 28.4 28.4 .sup.3-H.sub.2 1.54, 2.10 1.54, 2.06 C-4 25.1 25.1 .sup.4-H.sub.2 1.69 1.69 C-5 38.5 38.5 .sup.5-H.sub.2 2.98, 3.47 3.02, 3.41 2.sup.st L-Threonine C-1 172.9 172.8 C-2 58.9 58.9 2-H 4.83 4.81 C-3 68.7 68.5 3-H 4.42 4.41 C-4 19.9 19.9 .sup.4-H.sub.3 1.26 1.26 5.sup.st L-Threonine C-1 170.6 170.8 C-2 56.6 56.7 2-H 4.89 4.90 C-3 69.5 69.4 3-H 4.23 4.27 C-4 20.6 20.6 .sup.4-H.sub.3 1.18 1.18 3.sup.rd 4R-OH-L-proline C-1 173.8 173.7 C-2 62.3 62.2 2-H 4.54 4.55 C-3 38.7 38.7 .sup.3-H.sub.2 1.81, 2.32 1.82, 2.32 C-4 71.4 71.4 4-H 4.48 4.49 C-5 57.2 57.2 .sup.5-H.sub.2 3.75 3.76 4.sup.th L-Homotyrosine C-1 174.0 174.0 C-2 55.4 55.4 2-H 4.26 4.23 C-3 34.5 34.4 .sup.3-H.sub.2 2.11, 2.24 2.14, 2.24 C-4 33.0 33.0 .sup.4-H.sub.2 2.58 2.58 C-1 133.2 133.2 C-2/C-6 130.6 130.6 2/6-H.sup. 7.01 7.01 C-3/C-5 116.4 116.4 3/5-H.sup. 6.70 6.70 C-4 156.9 156.9 6.sup.th 3S-OH-L-proline/3S-OH-4S-Me-L-proline C-1 172.6 172.5 C-2 69.9 70.1 2-H 4.22 4.34 C-3 74.3 76.0 3-H 4.35 4.18 C-4 34.5 39.1 .sup.4-H.sub.2/H 1.97, 2.24 2.45 C-5 46.8 52.9 .sup.5-H.sub.2 3.81 3.39, 3.88 4-CH.sub.3 11.5 4-CH.sub.3 1.06 Fatty acid side chain C-1 176.7 176.7 C-2 37.0 36.9 2-H 2.24 (m, 2H) 2.23(m, 2H) C-3 27.2 27.2 3-H 1.61(m, 2H) 1.60(m, 2H) C-8/C-14 28.3, 28.3 28.3, 28.3 8-H/14-H 2.06 (m, 4H) 2.06 (m, 4H) C-9/C-10/ 131.1, 131.1, 131.1, 131.1, 9-H/10-H/ 5.29-5.39 5.29-5.39 C-12/C-13 129.2, 129.2 129.2, 129.2 12-H/13-H (m, 4H) (m, 4H) C-11 26.7 26.7 11-H 2.78 (t, J = 2.77 (t, J = 6.8 Hz, 2H) 6.8 Hz, 2H) C-4/C-5/ 32.8, 30.9, 32.8, 30.9, 4-H/5-H/ 1.28-1.39 1.28-1.39 C-6/C-7/ 30.6, 30.5, 30.6, 30.5, 6-H/7-H/ (m, 14H) (m, 14H) C-15/C-16/ 30.4, 30.4, 30.4, 30.4, 15-H/16-H/ C-17 23.8 23.8 17-H C-18 14.6 14.6 18-H 0.91 (t, J = 0.91 (t, J = 7.2 Hz, 3H) 7.3 Hz, 3H)
[0231] Compound 1 (echinocandin F) has the same structural features as compound 2 (echinocandin E), except for the loss of the methyl on the 3SOH-4S-Me-L-proline residue, including the loss of the hydroxyl at C.sub.3/C.sub.4 of L-homotyrosine and the loss of the hydroxyl at C.sub.4/C.sub.5 of L-ornithine (as shown in
Example 6: Construction of Plasmid and Preparation of Aspergillus nidulans Gene Transformant Strain LO8030-4.2.1
[0232] The E. coli-yeast-Aspergillus shuttle plasmid pJQ10 (
TABLE-US-00013 TABLE 13 Templates and primers for constructing PCR clones of each fragment of pJQ10 plasmid Fragment Length No. Fragment Template Primer pair (kb) {circle around (1)} pyrG- pYX10 pJQ10-pyrG/AMA1-F 4.7 AMA1 plasmid and pJQ10-pyrG/AMA1-R {circle around (2)} Plasmid pYX10 pJQ10-AscI-F and 4.8 backbone plasmid pJQ10-AscI-R fragment {circle around (3)} amyBp- pYX10 pJQ10-PamyB/htyE-F 1.9 htyE plasmid and pJQ10-PamyB/htyE-R
Example 7. Fermentation and Analysis
[0233] The Aspergillus nidulans gene transformant strain LO8030-4.2.1 was cultured in XSMM medium, and 1 mg/L pyridoxine hydrochloride was added to the medium. In addition, L-homotyrosine (100 mg/L) and linoleic acid (300 mg/L) were added to the XSMM fermentation medium. After the transformant strain LO8030-4.2.1 was fermented in 10 L XSMM medium for 12 days, the fermentation liquid and the fungal cells were extracted three times with equal volumes of ethyl acetate and methanol, respectively. The organic phases were combined and evaporated under reduced pressure to obtain a crude extract. According to the analysis method in Example 4, it was confirmed that the transformant strain LO8030-4.2.1 was able to produce echinocandin F.
Example 8. Quantitative Analysis of Echinocandin E and Echinocandin F in Fermentation Products
[0234] The transformant strains LO8030-5.1 and LO8030-4.2.1 were fermented in parallel in three bottles (200 mL in each bottle) according to the preceding fermentation method. Ten volumes of methanol were added to each bottle of fermentation product (including fungal cells and fermentation liquid). After precipitation, the samples were centrifuged and filtered through a membrane and used as samples for HPLC quantitative analysis. The ODS-HPLC analysis conditions were: isocratic elution with 80% methanol/water, a flow rate of 1 mL/min, and a detection wavelength of 220 nm. The quantitative control substances are the echinocandin E and echinocandin F separated above. The control substances were prepared into solutions with different concentrations, and the HPLC peak areas of the solutions at each concentration under the condition of constant injection volume were measured to draw a standard curve (
Example 9: Construction of Plasmid and Preparation of Aspergillus nidulans Gene Transformant Strain LO8030-4.2.1.5
[0235] The E. coli-yeast-Aspergillus shuttle plasmid pJQ5 (
TABLE-US-00014 TABLE 14 Templates and primers for constructing PCR clones of each fragment of pJQ5 plasmid Fragment Length No. Fragment Template Primer pair (kb) {circle around (1)} pyro- pYH11 pJQ5-pyro/AMA1-F 4.5 AMA1 plasmid and pJQ5-pyro/AMA1-R {circle around (2)} Plasmid pYH11 pJQ5-AscI-F and 4.8 backbone plasmid pJQ5-AscI-R fragment {circle around (3)} amyBp- pYH11 pJQ5-PamyB/ecdG-F 1.8 ecdG plasmid and pJQ5-PamyB/ecdG-R
Example 10. Fermentation and Analysis
[0236] The Aspergillus nidulans gene transformant strain LO8030-4.2.1.5 was cultured in XSMM medium, and L-homotyrosine (100 mg/L) and linoleic acid (300 mg/L) were added to the medium. After the transformant strain LO8030-4.2.1 was fermented in 10 L XSMM medium for 12 days, the fermentation liquid and the fungal cells were extracted for three times with equal volumes of ethyl acetate and methanol, respectively. The organic phases were combined and evaporated under reduced pressure to obtain a crude extract. The extract was separated using a silica gel column with a mobile phase of CH.sub.2Cl.sub.2/MeOH (50:1, 20:1, 10:1, 5:1, 2:1, 1:1). The echinocandins were preliminarily identified by thin layer chromatography (TLC) and high-performance liquid chromatography (HPLC). Then, it was further purified by semi-preparative HPLC with a COSMOCIL C18-MS-II column (10250 mm, 5 m) and a mobile phase of MeOH/H.sub.2O (85:15) at a flow rate of 3.0 mL/min. Compound 3 was isolated, which is a novel tetradeoxyechinocandin and named as echinocandin G (ECG). TOF-ESIMS m/z 998.5800 [M+H].sup.+, m/z 1020.5626 [M+Na].sup.+ (
[0237] The isolated compound 3 was dissolved in CD.sub.3OD for NMR analysis. .sup.1H, .sup.13C and 2D (.sup.1H-.sup.13C HSQC, .sup.1H-.sup.13C HMBC and .sup.1H-.sup.1HCOSY) NMR spectra were recorded on a JNM-ECZ600R/S1 spectrometer. Table 15 shows the .sup.1H NMR and .sup.13C NMR data.
TABLE-US-00015 TABLE 15 .sup.1H and .sup.13C NMR data of compound Echinocandin G (.sup.1H 600 MHz, .sup.13C 150 MHz, CD.sub.3OD) Position .sup.13C NMR Position .sup.1H NMR 1.sup.st L-Ornithine C-1 175.2 C-2 53.3 2-H 4.40 C-3 28.1 .sup.3-H.sub.2 1.56, 2.16 C-4 24.9 .sup.4-H.sub.2 1.73, 1.73 C-5 38.2 .sup.5-H.sub.2 2.94, 3.53 2.sup.st L-Threonine C-1 173.1 C-2 58.9 2-H 4.93 C-3 68.4 3-H 4.49 C-4 20.4 4-H 1.23 5.sup.st L-Threonine C-1 170.5 C-2 57.0 2-H 4.91 C-3 69.5 3-H 4.22 C-4 19.8 4-H 1.19 3.sup.rd 4R-methyl-L-proline C-1 174.4 C-2 62.6 2-H 4.64 C-3 39.1 .sup.3-H.sub.2 2.47, 2.07 C-4 71.4 4-H 4.58 C-5 57.4 .sup.5-H.sub.2 4.02, 3.82 4.sup.th L-Homotyrosine C-1 172.8 C-2 57.9 2-H 4.45 C-3 74.4 3-H 4.39 C-4 41.1 .sup.4-H.sub.2 2.57, 2.66 C-1 129.9 C-2/C-6 131.6 2/6-H.sup. 7.02 C-3/C-5 116.4 3/5-H.sup. 6.71 C-4 157.3 6.sup.rd 3S-Hydroxy-L-proline C-1 172.8 C-2 69.9 2-H 4.19 C-3 74.4 3-H 4.33 C-4 34.6 .sup.4-H.sub.2 1.96, 2.25 C-5 46.9 .sup.5-H.sub.2 3.79, 3.79 Fatty acid side chains C-1 176.6 C-2 37.0 2-H 2.25 (m, 2H) C-3 27.2 3-H 1.61(m, 2H) C-8/C-14 28.3, 28.3 8-H/14-H 2.07 (m, 3H) C-11 26.7 11-H 2.78 (t, J = 6.7 Hz, 1H) C-9/C-10/ 131.1, 131.1, 9-H/10-H/ 5.30-5.40 C-12/C-13 129.2, 129.2 12-H/13-H (m, 2H) C-4/C-5/ 32.8, 30.9, 4-H/5-H/ 1.28-1.40 C-6/C-7/ 30.6, 30.5, 6-H/7-H/ (m, 14H) C-15/C-16/ 30.4, 30.4, 15-H/16-H/ C-17 23.8 17-H C-18 14.6 18-H 0.91 (t, J = 7.3 Hz, 3H)
Example 11: Construction of Plasmid and Preparation of Aspergillus nidulans Gene Transformant Strain LO8030-4.2.1.9
[0238] The E. coli-yeast-Aspergillus shuttle plasmid pJQ9 (
TABLE-US-00016 TABLE 16 Templates and primers for constructing PCR clones of each fragment of pJQ9 plasmid Fragment Length No. Fragment Template Primer pair (kb) {circle around (1)} pyro- pYH11 pJQ9-pyro/ 4.5 AMA1 plasmid AMA1-F and pJQ9- pyro/AMA1-R {circle around (2)} Plasmid pYH11 pJQ9-AscI-F and 4.8 backbone plasmid pJQ9-AscI-R fragment {circle around (3)} amyBp- pYH11 pJQ9-PamyB/ 1.8 ecdG plasmid ecdG-F and pJQ9- PamyB/ecdG-R {circle around (4)} gpdAp- pYH11 pJQ9-PgpdA/ 4.0 htyF plasmid htyF-F and pJQ9- PgpdA/htyF-R
Example 12. Fermentation and Analysis
[0239] The Aspergillus nidulans gene transformant strain LO8030-4.2.1.9 was cultured in XSMM medium, and L-homotyrosine (100 mg/L) and linoleic acid (300 mg/L) were added to the medium. After the transformant strain LO8030-4.2.1.9 was fermented in 10 L XSMM medium for 12 days, the fermentation liquid and the fungal cells were extracted for three times with equal volumes of ethyl acetate and methanol, respectively. The organic phases were combined and evaporated under reduced pressure to obtain a crude extract. The extract was separated using a silica gel column with a mobile phase of CH.sub.2Cl.sub.2/MeOH (50:1, 20:1, 10:1, 5:1, 2:1, 1:1). The echinocandins were preliminarily identified by thin layer chromatography (TLC) and high performance liquid chromatography (HPLC). Then, it was further purified by semi-preparative HPLC with a COSMOCIL C18-MS-II column (10 250 mm, 5 m) and a mobile phase of MeOH/H.sub.2O (85:15) at a flow rate of 3.0 mL/min. Compound 4 was isolated, which is a novel tetradeoxyechinocandin and named as echinocandin H (ECH). TOF-ESIMS C.sub.51H.sub.79N.sub.7O.sub.14 m/z 1014.5770 [M+H].sup.+, m/z 1036.5590 [M+Na].sup.+ (
[0240] The isolated compound 4 was dissolved in CD.sub.3OD for NMR analysis. .sup.1H, .sup.13C and 2D (.sup.1H-.sup.13C HSQC, .sup.1H-.sup.13C HMBC and .sup.1H-.sup.1HCOSY) NMR spectra were recorded on a JNM-ECZ600R/S1 spectrometer. Table 17 shows the .sup.1H NMR and .sup.13C NMR data.
TABLE-US-00017 TABLE 17 .sup.1H and .sup.13C NMR data of compound ECH (.sup.1H 600 MHz, .sup.13C 150 MHz, CD.sub.3OD) Position .sup.13C NMR Position .sup.1H NMR 1.sup.st L-Ornithine C-1 175.2 C-2 53.5 2-H 4.39 C-3 28.2 .sup.3-H.sub.2 1.55, 2.15 C-4 25.0 .sup.4-H.sub.2 1.71, 1.71 C-5 38.5 .sup.5-H.sub.2 2.94, 3.50 2.sup.st L-Threonine C-1 172.6 C-2 58.7 2-H 4.90 C-3 68.4 3-H 4.49 C-4 19.9 4-H 1.23 5.sup.st L-Threonine C-1 170.4 C-2 57.2 2-H 4.88 C-3 69.7 3-H 4.22 C-4 20.3 4-H 1.21 3.sup.rd 4R-methyl-L-proline C-1 173.9 C-2 62.7 2-H 4.58 C-3 38.8 .sup.3-H.sub.2 2.42, 2.07 C-4 71.4 4-H 4.55 C-5 57.4 .sup.5-H.sub.2 3.97, 3.80 4.sup.th L-Homotyrosine C-1 173.1 C-2 56.8 2-H 4.26 C-3 77.0 3-H 4.26 C-4 76.0 4-H 4.31 C-1 133.2 C-2/C-6 129.7 2/6-H.sup. 7.14 C-3/C-5 116.4 3/5-H.sup. 6.76 C-4 158.7 6.sup.rd 3S-Hydroxy-L-proline C-1 172.8 C-2 69.9 2-H 4.16 C-3 74.3 3-H 4.32 C-4 34.6 .sup.4-H.sub.2 1.94, 2.24 C-5 46.9 .sup.5-H.sub.2 3.79, 3.79 Fatty acid side chains C-1 176.6 C-2 37.0 2-H 2.24 (m, 2H) C-3 27.2 3-H 1.61(m, 2H) C-8/C-14 28.3, 28.3 8-H/14-H 2.07 (m, 2H) C-11 26.7 11-H 2.78 (t, J = 7.3 Hz, 1H) 1.36 (m, 1H) C-9/C-10/ 131.1, 131.1, 9-H/10-H/ 5.30-5.39 C-12/C-13 129.2, 129.2 12-H/13-H (m, 2H) C-4/C-5/ 32.8, 30.9, 4-H/5-H/ 1.28-1.39 C-6/C-7/ 30.6, 30.5, 6-H/7-H/ (m, 14H) C-15/C-16/ 30.4, 30.4, 15-H/16-H/ C-17 23.8 17-H C-18 14.6 18-H 0.91 (t, J = 7.3 Hz, 3H)
Example 13. Biological Activity Test
[0241] The minimum inhibitory concentration (MIC) values of echinocandin E and echinocandin F were determined by broth microdilution method, and the test strain was Candida albicans ATCC 10231. The MIC value was defined as the lowest antibiotic concentration that inhibited the growth of more than 90% of the strains. Amphotericin B was used as a positive control and echinocandin B as a reference, and each sample was subjected to three parallel experiments.
[0242] Candida albicans was cultured in Mueller-Hinton (MH) broth (50 mL 20 Nitrate Salts, 1 mL Trace Elements, and 10.0 g glucose, dissolved in 800 mL ddH.sub.2O, adjusted to pH 6.5, fixed to 1 L, added with 16.0 g agar powder, and sterilized at 121 C. for 20 min) (purchased from Hangzhou Basebio Biotechnology Co., Ltd. (Basebio)) and cultured at 37 C. and 180 rpm for 12-16 hours. The fungal solution concentration was controlled to 106 CFU/mL by gradient dilution with MH broth.
[0243] The sample solution was prepared by dissolving the test samples (amphotericin B, echinocandin B, echinocandin E, echinocandin F) in DMSO to prepare a stock solution with a concentration of 40 g/ml. An appropriate amount of sterile MH broth medium and the test compounds were added to a 96-well plate, and Candida albicans was quantitatively inoculated so that the total liquid volume in each well was 100 L. The final concentrations of the compounds were 2, 1.5, 1, 0.8, 0.6, 0.4, 0.2, 0.1, 0.05 and 0 g/ml, respectively, and DMSO (volume concentration of 5%) was used as a negative control.
[0244] After the 96-well plate was placed in a 37 C. constant temperature incubator for 12 hours, the growth of pathogens in the wells was observed, and the concentration at which the pathogens did not grow in the wells was used as the judgment standard. The fungal concentration was measured at OD.sub.600 using an ELISA reader to determine the MIC value of each sample. The results are shown in Table 18 below.
TABLE-US-00018 TABLE 18 MIC values of the compounds of the present invention Compound MIC value g/mL Amphotericin B 0.2 Echinocandin B 0.4 Echinocandin F 1.0 Echinocandin E 0.6 Echinocandin G 0.8 Echinocandin H 0.8
[0245] Experiments have shown that echinocandins E, F, G and H exhibit good activity against Candida albicans. It can also be further known that compounds of the present invention which are appropriately modified on this basis will also have good anti-Candida albicans activity.
[0246] Although the foregoing invention has been described in some detail by way of illustration and examples for the purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teaching of this invention that certain changes and modification may be made thereto without departing from the spirit or scope of the invention as defined in the claims.