Mouse model of myocarditits
11602134 · 2023-03-14
Assignee
Inventors
- Yining WANG (Beijing, CN)
- Chanjuan QU (Beijing, CN)
- Jian Wang (Beijing, CN)
- Yanyu LI (Beijing, CN)
- Kang ZHOU (Beijing, CN)
- Jian CAO (Beijing, CN)
- Lu LIN (Beijing, CN)
- XIAO LI (BEIJING, CN)
- Zhengyu JIN (Beijing, CN)
Cpc classification
A01K67/0275
HUMAN NECESSITIES
A01K2217/206
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
C07K2319/30
CHEMISTRY; METALLURGY
A01K2267/0387
HUMAN NECESSITIES
A01K2207/10
HUMAN NECESSITIES
A01K2217/05
HUMAN NECESSITIES
International classification
Abstract
A preparation method of an anti-PD-1/PD-L1 monoclonal antibody (mAb)-induced autoimmune myocarditis model is provided, including: mediating a model with adeno-associated virus 9 (AAV9) to achieve the high expression of PDL1 in a myocardial tissue, and applying an anti-PD-1/PD-L1 mAb to the model with high PDL1 expression in the myocardial tissue for modeling. The present disclosure also provides use of an animal model prepared by the preparation method. The model prepared by the present disclosure truly simulates the pathogenesis and clinical course of autoimmune myocarditis in a patient administered with an anti-PD1/PD-L1 mAb, is close to a pathophysiological status of a clinical patient, has a high modeling rate, and can be dynamically monitored.
Claims
1. A method of making mouse that displays cardiomyocyte myofilament lysis, the method comprising administering: an adeno-associated virus 9 (AAV9) vector encoding programmed cell death ligand 1 (PDL-1) operably linked to a cTnT promoter to a mouse intravenously; and monoclonal antibody (mAb) that binds to programmed cell death ligand 1 (PDL-1) to the mouse intraperitoneally such that the mouse displays cardiomyocyte myofilament lysis.
2. The method according to claim 1, wherein the mouse displays myocardial T-cell infiltration.
3. The method according to claim 1, wherein the mouse is male.
4. The method according to claim 1, wherein the PDL-1 is encoded by the nucleic acid sequence of SEQ ID NO: 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(6) The following examples are intended to illustrate the present disclosure, rather than to limit the scope of the present disclosure. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents and biological materials are all commercially available.
Example 1 Construction of a PDL1Ig Gene Recombinant Adenovirus Vector
(7) I. The main process of vector construction was as follows:
(8) 1. A corresponding vector was selected, and polymerase chain reaction (PCR) primers were designed for a target fragment.
(9) Specific primer sequences used were as follows in Table 1:
(10) TABLE-US-00001 TABLE 1 AAV-m-CD274-Nhe/Nhe-F ttaatacgactcactataggctagc (SEQ ID NO: 2) GCCACCATGAGGATATTTGC AAV-m-CD274-Nhe/Nhe-R ccttgtagtcaagcttggtgctagc (SEQ ID NO: 3) CGTCTCCTCGAATTGTGTAT
(11) 2. An appropriate restriction endonuclease was selected to digest the vector, and a purified linearized vector was recovered through agarose gel.
(12) Reagents in the table below were added in sequence, and a resulting mixture was gently pipetted up and down for thorough mixing and then placed in a 37° C. water bath to allow a reaction for 1 h to 2 h. After the digestion was completed, agarose gel electrophoresis was conducted to recover the target fragment.
(13) A vector digestion system was as follows Table 2:
(14) TABLE-US-00002 TABLE 2 Reagent Volume (μL) Vector DNA ( 1 ug/uL) 1 10 × buffer 4 DdH.sub.2O 32 NheI 1.5 NheI 1.5 total 40
(15) Notes: An amount of the restriction endonuclease used and a time of the digestion can be adjusted according to the enzyme activity; and if single-enzyme digestion is adopted, a corresponding system is adjusted.
(16) 3. PCR was conducted for the target fragment according to the designed primers, and then the target fragment with a correct size was recovered through agarose gel.
(17) 4. The linearized vector and the target fragment were ligated according to a method of homologous recombination or T4 ligation.
(18) 5. A ligation product was transformed into competent DH5a or stbl3, and a resulting bacterial solution was plated and cultivated for 12 h to 16 h.
(19) 6. Single clones were picked for colony verification.
(20) 7. Verified positive clones were selected for sequencing.
(21) 8. Plasmid extraction was conducted on a cloning sample with a correct sequence.
(22) II. Information of the constructed vector and target gene
(23) A map of the pHBAAV-TNT-3flag-P2A-EGFP (lsz) vector carrying a target gene constructed in step 1 of this example is shown in
Example 2 Transfection of Mice to Construct Models
(24) 2.1 Experimental Mice
(25) In this example, mice with prominent growth status and healthy physique were selected as experimental objects, which were purchased from Huafukang Biotechnology Co., Ltd. The mice were cheap, easily and widely available, and easy to raise, came from the inbred strain C57/B6J, and had a body weight of 20 g to 30 g and a high degree of standardization, which was convenient for administration and sampling. Male mice were preferred, which were robust and in line with the characteristic that anti-PD1 mAb-induced autoimmune myocarditis is more common among males, such that test errors due to insufficient physical activity could be avoided as much as possible during a test process.
(26) 2.2 Raising Conditions
(27) The experimental mice were raised at a temperature of 22° C. to 34° C. and a humidity of 40% to 70%. The experimental mice had free access to food and drinking water.
(28) 2.3 Modeling Process
(29) 120 SPE C57/BL6 male mice were raised adaptively for 1 week, during which a litter was changed every day, and a basic feed and purified water were provided.
(30) The mice in the previous step were divided into 4 groups:
(31) Group A: 30 mice: The mice were injected with 100 μl of PDL1 (CD274 gene)-overexpressing AAV9 through the tail vein, and 3 weeks later, an anti-PD1 mAb was injected intraperitoneally at 10 mg/kg once a week, 3 times in total.
(32) Group B: 30 mice: The mice were injected with 100 μl of PDL1 (CD274 gene)-overexpressing AAV9 control through the tail vein, and 3 weeks later, an anti-PD1 mAb was injected intraperitoneally at 10 mg/kg once a week, 3 times in total.
(33) Group C: 30 mice: The mice were injected intraperitoneally with an anti-PD1 mAb at 10 mg/kg once a week, 3 times in total.
(34) Group D: 30 mice: The mice were injected intraperitoneally with IgG at 10 mg/kg once a week, 3 times in total. Then the mice were further raised with the basic feed and purified water.
(35) After cardiac magnetic resonance and electrocardiogram acquisition were conducted once a week, 10 mice were sacrificed by cervical dislocation, and hearts were collected for HE staining.
(36) 2.4 Results
(37) The cardiac pathology was used for determination, which was a gold standard for determining whether the model was successfully established.
(38) Group A: After 1 injection, 10 mice were subjected to cardiac pathologic examination, 5 of which showed diffuse myofilament lysis of cardiomyocytes and T cell infiltration, had no T cells in the myocardium under physiological conditions, and did not die, indicating a modeling success rate of 50%. After 2 injections, 10 mice were subjected to cardiac pathologic examination, 8 of which showed diffuse myofilament lysis of cardiomyocytes and T cell infiltration, indicating a modeling success rate of 80%. After 3 injections, 10 mice were subjected to cardiac pathologic examination, all of which showed diffuse myofilament lysis of cardiomyocytes and T cell infiltration, indicating a modeling success rate of 100%.
(39) Group B: After 1 injection, 10 mice were subjected to cardiac pathologic examination, 1 of which showed diffuse myofilament lysis of cardiomyocytes and cell infiltration, had no cells in the myocardium under physiological conditions, and did not die, indicating a modeling success rate of 10%. After 2 injections, 10 mice were subjected to cardiac pathologic examination, 4 of which showed diffuse myofilament lysis of cardiomyocytes and T cell infiltration, indicating a modeling success rate of 40%. After 3 injections, 10 mice were subjected to cardiac pathologic examination, 7 of which showed diffuse myofilament lysis of cardiomyocytes and T cell infiltration, and did not die, indicating a modeling success rate of 70%. The group B was milder than the group A.
(40) Group C: After 1 injection, 10 mice were subjected to cardiac pathologic examination, 2 of which showed diffuse myofilament lysis of cardiomyocytes and T cell infiltration, had no T cells in the myocardium under physiological conditions, and did not die, indicating a modeling success rate of 20% After 2 injections, 10 mice were subjected to cardiac pathologic examination, 5 of which showed diffuse myofilament lysis of cardiomyocytes and T cell infiltration, indicating a modeling success rate of 50%. After 3 injections, 10 mice were subjected to cardiac pathologic examination, 6 of which showed diffuse myofilament lysis of cardiomyocytes and T cell infiltration, and did not die, indicating a modeling success rate of 60%. The group C was milder than the group A.
(41) Group D: After 1 injection, 10 mice were subjected to cardiac pathologic examination, and normal results were obtained; after 2 injections, 10 mice were subjected to cardiac pathologic examination, and normal results were obtained; and after 3 injections, 10 mice were subjected to cardiac pathologic examination, and normal results were obtained.
(42) The present disclosure has been described in detail above with reference to general descriptions and specific examples, but it will be apparent to those skilled in the art that some modifications or improvements can be made based on the present disclosure. Therefore, all these modifications or improvements made without departing from the spirit of the present disclosure fall within the scope of the present disclosure.