Glutamate decarboxylase mutant with improved pH tolerance and use thereof in synthesis of gamma-aminobutyric acid
12480112 ยท 2025-11-25
Assignee
Inventors
- Zhiming Rao (Wuxi, CN)
- Jin Han (Wuxi, CN)
- Taowei Yang (Wuxi, CN)
- Meijuan Xu (Wuxi, CN)
- Xian Zhang (Wuxi, CN)
Cpc classification
C12P13/005
CHEMISTRY; METALLURGY
International classification
Abstract
The invention provides a glutamate decarboxylase mutant with improved pH tolerance and use thereof in synthesis of gamma-aminobutyric acid. The mutant is obtained by mutating glutamate decarboxylase having an amino acid sequence as shown in SEQ ID NO. 3. The enzyme activity of the mutant at pH 6.5 is improved to 178% of the original enzyme (SEQ ID NO. 3). The final yield of 1000 g of substrate fed in batches in a 5 L tank for 12 h is up to 688.13 g/L, which is about 52% higher than the productivity of the original glutamate decarboxylase. The final molar conversion rate can reach 98.2%. The invention not only broadens the enzyme activity of GAD under the optimum pH, but also broadens the enzyme activity of GAD under the neutral pH, and enhances the capability of the GAD to synthesize gamma-aminobutyric acid, and therefore is more suitable for industrial production.
Claims
1. A glutamate decarboxylase mutant with a broadened pH range, the decarboxylase mutant having one of the following mutations relative to the amino acid sequence as shown in SEQ ID NO: 3: (1) serine at position 24 mutated to arginine; (2) serine at position 24 mutated to arginine, and aspartic acid at position 88 mutated to arginine; (3) serine at position 24 mutated to arginine, and tyrosine at position 309 mutated to lysine; and (4) serine at position 24 mutated to arginine, aspartic acid at position 88 mutated to arginine, and tyrosine at position 309 mutated to lysine.
2. A gene encoding the glutamate decarboxylase mutant according to claim 1.
3. The gene according to claim 2, wherein the gene comprises the nucleotide sequence as shown in SEQ ID NO: 2, the nucleotide sequence as shown in SEQ ID NO: 8, the nucleotide sequence as shown in SEQ ID NO: 10, or the nucleotide sequence as shown in SEQ ID NO: 12.
4. A recombinant expression vector carrying the gene according to claim 2.
5. The recombinant expression vector according to claim 4, wherein pET-28a, PMA5, or PXMJ-19 is used as an original expression vector.
6. A recombinant strain comprising the recombinant expression vector according to claim 4.
7. The recombinant strain according to claim 6, wherein the recombinant strain is Escherichia coli, Bacillus subtilis, or Corynebacterium glutamicum.
8. The recombinant strain according to claim 7, wherein the recombinant strain is Bacillus subtilis 168.
9. A method for producing gamma-aminobutyric acid, comprising reacting glutamic acid or L-sodium glutamate to produce gamma-aminobutyric acid in the presence of the glutamate decarboxylase mutant according to claim 1.
10. The method of claim 9, wherein the reacting is at a pH of 6.5.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(5) The invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the invention, but the embodiments described are not intended to limit the invention.
Example 1 Construction of a Recombinant Expression Vector Including a Gene Encoding a Glutamate Decarboxylase Mutant
(6) Mutant genes were constructed based on a fusion PCR method by using a recombinant plasmid pET-28a including a nucleotide sequence as shown in SEQ ID NO. 4 as a template and respectively using primers containing mutation sites to amplify gene fragments upstream and downstream the mutation sites. For genes with combined mutations, by using a single-point mutant plasmid as a template and using primers containing mutation sites, gene fragments upstream and downstream the mutation sites were amplified, and then a series of genes can be obtained by using the fusion PCR method. Details are given as follows.
(7) TABLE-US-00001 Primer Gene P1/P2, P3/P20 lpgad.sup.S24R P1/P4, P5/P20 lpgad.sup.D88R P1/P6, P7/P20 Lpgad.sup.L135K P1/P8, P9/P20 Lpgad.sup.E170R P1/P10, P11/P20 Lpgad.sup.H196R P1/P12, P13/P20 Lpgad.sup.A225K P1/P14, P15/P20 Lpgad.sup.Y309K P1/P16, P17/P20 Lpgad.sup.A359R P1/P18, P19/P20 Lpgad.sup.E417K P1/P2, P3/P4, P5/P20 lpgad.sup.S24R/D88R P1/P2, P3/P6, P7/P20 lpgad.sup.S24R/L135K P1/P2, P3/P8, P9/P20 lpgad.sup.S24R/E170R P1/P2, P3/P10, P11/P20 lpgad.sup.S24R/H196R P1/P2, P3/P12, P13/P20 lpgad.sup.S24R/A225K P1/P2, P3/P14, P15/P20 lpgad.sup.S24R/Y309K P1/P2, P3/P16, P17/P20 lpgad.sup.S24R/A359R P1/P2, P3/P18, P19/P20 lpgad.sup.S24R/E417K P1/P2, P3/P4, P5/P14, P15/P20 lpgad.sup.S24R/D88R/Y309K
(8) TABLE-US-00002 P1 (SEQIDNO.13): ATGGCAATGTTATACGGTAAACACAAT P2 (SEQIDNO.14): CTTAGGAAGATCATGTTGTTCGCGAGG P3 (SEQIDNO.15): GGTGCGCCTCGCGAACAACATGATCTT P4 (SEQIDNO.16): TCAGATTTCCGGATGGCATTCTTTCGC P5 (SEQIDNO.17): TGCCATCCGGAAATCTGAGTACCCCCG P6 (SEQIDNO.18): CATTGCTTTACCGCCTAACATACAAGC P7 (SEQIDNO.19): AGGCGGTAAAGCAATGAAATTCGCCTG P8 (SEQIDNO.20): AAACTTACGCCAGCAAACTTGATAGCC P9 (SEQIDNO.21): TTGCTGGCGTAAGTTTTGTGTCTACTG P10 (SEQIDNO.22): TAAGACACGGTTAACGTCAAGGACCAT P11 (SEQIDNO.23): GTTAACCGTGTCTTAGACTACGTGGAC P12 (SEQIDNO.24): ATCGAGTTTGGCTAGGTCGTCATATTG P13 (SEQIDNO.25): CTAGCCAAACTCGATAAGGTCGTTACT P14 (SEQIDNO.26): CCCACCTAATTTACTAACTTTGAAGAC P15 (SEQIDNO.27): AAAGTTAGTAAATTAGGTGGGGAGTTG P16 (SEQIDNO.28): CAGAGCGCGTGCCAGGTAGCGGGCAAC P17 (SEQIDNO.29): CTGGCACGCGCTCTGGATAAAGTTGGT P18 (SEQIDNO.30): TTGTTGTTTCAGATTAGCAGGGAAAGG P19 (SEQIDNO.31): AATCTGAAACAACAAGTCATCCAACGA P20 (SEQIDNO.32): TCAGTGTGTGAATAGGTATTTCTTAGG
(9) The expression plasmid pET-28a was enzymatically cleaved by the restriction endonuclease EcoR I/Hind III to obtain a linearized vector. A gene of interest was ligated to the linearized vector to construct a recombinant plasmid. The recombinant plasmid was transformed into Escherichia coli JM109 by chemical transformation, coated on an LB plate containing kanamycin, and incubated overnight at 37 C. Clones were randomly picked up, identified by colony PCR and verified by sequencing. Results show that the recombinant expression vector containing the gene encoding the glutamate decarboxylase mutant was successfully transformed into the cloning vector Escherichia coli JM109, and the recombinant plasmid was extracted from the bacterial solution with successful mutation as verified by sequencing, and stored in a refrigerator at 20 C. The sequencing work was completed by Suzhou Genwiz Biotechnology Co., Ltd.
Example 2 Expression and Purification of GAD Mutant in Escherichia coli BL21
(10) The recombinant plasmid pET-28a containing the mutant gene was transformed into Escherichia coli BL21 by chemical transformation. After the recombinant Escherichia coli was induced at 16 C. for 12 h, homogenized bacterial cells were collected by centrifugation. Protein purification was carried out by nickel column. The purified enzyme was added with 10% glycerol and stored at 4 C. for later use. The purified enzyme was analyzed by SDS-PAGE. The results of E. coli BL21/pET-28a-lpgad.sup.S24R/D88R/Y309K are shown in
Example 3 Enzyme Activity Assay of Glutamate Decarboxylase and HPLC Analysis of Gamma-Aminobutyric Acid
(11) The relative enzyme activities of a series of purified enzymes (glutamate decarboxylase mutants) obtained in Example 2 when reacting with L-glutamic acid at optimum pH 4.5 and pH 6.0 were determined (where the enzyme activity of the enzyme as shown in SEQ ID NO. 3 was 100%), as shown in
(12) The relative enzyme activities of the glutamate decarboxylase lpgad.sup.S24R/D88R/Y309K mutant at pH 4.0, 4.5, 5.0, 5.5, 6.0, 6.5 and 7.0 (as shown in
(13) Definition of enzyme activity unit: One enzyme activity unit (U) is equal to the amount of enzyme needed to catalyze L-glutamic acid to produce 1 nmol gamma-aminobutyric acid at 30 C. in 1 min. The specific enzyme activity is the enzyme activity of 1 mg wet cell, measured in U/mg. The 1 mL reaction system for decarboxylation reaction between enzyme and substrate adopts the following concentrations: 0.01 mM PLP, and 100 mM L-sodium glutamate. Before the reaction, the buffer solution and enzyme solution were preheated at 30 C. for 5 min, then mixed evenly and reacted at 30 C. for 30 min, finally quickly boiled to terminate the reaction, and centrifuged. The resultant was diluted with 5% trichloroacetic acid (TCA) by a factor of 5. The protein was precipitated in a refrigerator at 4 C. for about 3 h, and then detected by HPLC.
(14) HPLC: The reaction solution was diluted with 5% trichloroacetic acid (TCA) by a factor of 5. The protein was precipitated in a refrigerator at 4 C. for about 3 h, and centrifuged. The supernatant was filtered with a 0.22 m membrane, and then injected. Chromatographic column: DinoSoil C18 (5 L, 250 mm4.6 mm), mobile phase: A: 0.1% aqueous formic acid solution; B: 100% acetonitrile; detector: UV Detector; detection wavelength: 360 nm; column temperature: 25 C.; sample size: 10 L; flow rate: 1.0 mL/min. Process: 0-22 min: 15% B.fwdarw.50% B; 22-22.1 min: 50% B.fwdarw.15% B; 22.1-26 min: 15% B.
Example 4 Construction of Lpgad.SUP.S24R/D88R/Y309K .in Bacillus subtilis
(15) The pET-28a-lpgad.sup.S24R/D88R/Y309K plasmid constructed in Example 1 was used as a template, and was amplified using the primer P1/P20 to obtain a gene of interest. The expression plasmid PMA5 was enzymatically cleaved by the restriction endonuclease BamH I/Mlu I to obtain a linearized vector. A gene of interest was ligated to the linearized vector to construct a recombinant plasmid PMA5-lpgad.sup.S24R/D88R/Y309K. The recombinant plasmid was transformed into Escherichia coli JM109 by chemical transformation, coated on an LB plate containing ampicillin, and incubated overnight at 37 C. Clones were randomly picked up, and identified by colony PCR. Results show that the recombinant plasmid containing the gene encoding the glutamate decarboxylase mutant was successfully transformed into the cloning vector Escherichia coli JM109. Colonies determined to be positive were inoculated in a 5 mL LB liquid medium and cultured overnight at 37 C. The recombinant plasmid was extracted from the bacterial solution, and stored in a refrigerator at 20 C.
(16) TABLE-US-00003 P1 (SEQIDNO.13): ATGGCAATGTTATACGGTAAACACAAT P20 (SEQIDNO.32): TCAGTGTGTGAATAGGTATTTCTTAGG
(17) The successfully constructed recombinant plasmid PMA5-lpgad.sup.S24R/D88R/Y309K was transformed into Bacillus subtilis BS168 by chemical transformation to construct a BS168/PMA5-lpgad.sup.S24R/D88R/Y309K recombinant strain, which was coated on an LB plate containing kanamycin and cultured overnight at 37 C. Clones were randomly picked up, and identified by colony PCR. The successfully transformed bacterial solution was added with glycerol and stored in a refrigerator at 80 C.
Example 5 Preparation of Gamma-Aminobutyric Acid from BS168/PMA5-lpgad.SUP.S24R/D88R/Y309K .Engineered Bacterium
(18) The BS168/PMA5-lpgad.sup.S24R/D88R/Y309K mutant engineered strain in Example 4 was used for transformation of L-glutamic acid substrate. In a 5 L tank with 1 L 0.9% NaCl solution as the buffer system, the bacterial count OD.sub.600 nm was controlled to 16. 100 g/L L-glutamic acid was added in batches, and the reaction was carried out at 30 C. for 12 h. The final yield of 1000 g of substrate fed in batches using the lpgad.sup.S24R/D88R/Y309K engineered strain was up to 688.13 g/L, which was about 52% higher than that of the original enzyme, and the molar conversion rate was up to 98.2%. The results show that the catalytic efficiency of the mutant enzyme was significantly improved, providing broad industrial application prospects.
(19) Apparently, the above-described embodiments are merely examples provided for clarity of description, and are not intended to limit the implementations of the invention. Other variations or changes can be made by those skilled in the art based on the above description. The embodiments are not exhaustive herein. Obvious variations or changes derived therefrom also fall within the protection scope of the invention.