A Method of Detecting or Differentiating Chikungunya, Dengue, and Zika Viruses
20220334113 · 2022-10-20
Inventors
Cpc classification
C12Q1/6818
CHEMISTRY; METALLURGY
International classification
C12Q1/6818
CHEMISTRY; METALLURGY
Abstract
Disclosed is a method of simultaneously detecting, differentiating, and/or quantifying Chikunguynya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue vims serotype-3 (DENV3), Dengue vims serotype-4 (DENV4) and Zika virus (ZIKV) in a sample. In some examples, the method comprises the step of determining the presence of the target regions or fragments thereof selected from the group consisting of Non Structural protein 5 (NS5) of Zika virus, NS5 of DENV1, NS5 of DENV2, NS5 of DENV3, Capsid of DENV4, and E1 glycoprotein of CHIKV. Also disclosed are isolated oligonucleotides for use in methods thereof, methods for detecting and/or differentiating and/or quantifying vims as described herein, and kits for use thereof.
Claims
1. A method of simultaneously detecting, differentiating, and/or quantifying Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, wherein the method comprising: determining the presence of the target regions or fragments thereof selected from the group consisting of Non Structural protein 5 (NS5) of Zika virus, NS5 of DENV1, NS5 of DENV2, NS5 of DENV3, Capsid of DENV4, and E1 glycoprotein of CHIKV.
2. The method of claim 1, wherein the target regions or fragments thereof are encoded by the sequence SEQ ID NO: 1 (CHIKV E1 consensus sequence); SEQ ID NO: 2 (DENV1 NS5 48+22 seq consensus sequence); SEQ ID NO: 3 (DENV2 NS5 consensus sequence); SEQ ID NO: 4 (DENV3 NS5 consensus sequence); SEQ ID NO: 5 (DENV4 Capsid consensus sequence); and SEQ ID NO: 6 (ZIKV NS5 check_56seq consensus sequence).
3. The method of claim 1, wherein the detecting comprises performing reverse transcription polymerase chain reaction (RT-PCR).
4. The method of claim 1, wherein the primers and probe are selected from the group consisting of: a ZIKV forward primer comprising a sequence at least 90% identical to CCTTGGATTCTTGAACGAGGATCAC (NS5_ZIKV-F/SEQ ID NO: 7); a ZIKV reverse primer comprising a sequence at least 90% identical to GCTTCATTCTCCAGATCAAACCTGC (NS5_ZIKV-R/SEQ ID NO: 9) or GCTTCATTCTCTAGATCAAACCTGC (ZIKV-R1_T/SEQ ID NO: 32); a ZIKV probe comprising a sequence at least 90% identical to TACCAGGAGGAAGGATGTATGCAG (5′-FAM NS5_ZIKV-P/ZEN/3′ IBFQ/SEQ ID NO: 8) or ACCAGGAGGAAAGATGTACGCAG (ZIKV_P1_AF/SEQ ID NO: 33); a DENV1 first forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACAGAAG (NS5_ D1-F_A/SEQID NO: 10); a DENV1 second forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACTGAAG (NS5_ D1-F_T/SEQID NO: 11); a DENV1 reverse primer comprising a sequence at least 90% identical to GAGGACTCACCAATATCACACAA (NS5_D1-R/SEQ ID NO: 13); a DENV1 probe comprising a sequence at least 90% identical to ACCTATGGATGGAACCTAGTAAAGCT (5′-HEX NS5_D1/ZEN/3′ IBFQ/SEQID NO: 12); a DENV3 forward primer comprising a sequence at least 90% identical to GCTCAGCCTCCTCCATGATAAATG (NS5_D3-F/SEQ ID NO: 14); a DENV3 reverse primer comprising a sequence at least 90% identical to GGGTGTCCTGGTGTCCACTTTCTC (NS5_D3-R/SEQ ID NO: 17); a DENV3 first probe comprising a sequence at least 90% identical to CATGGTGACACAGATGGCAATGAC (5′-Texas Red NS5_D3-P_T/3′ IBRQ/SEQID NO: 15); a DENV3 second probe comprising a sequence at least 90% identical to CACGGTGACACAGATGGCAATGAC (5′-Texas Red NS5_D3-P_C/3′ IBRQ/SEQID NO: 16); a CHIKV forward primer comprising a sequence at least 90% identical to GGCGCCTACTGCTTCTGCGAC (E1_CHIKV-F1/SEQ ID NO: 18); a CHIKV reverse primer comprising a sequence at least 90% identical to TTGGTAAAGGACGCGGAGCTTAGC (E1_CHIKV-R1/SEQ ID NO: 21); a CHIKV first probe comprising a sequence at least 90% identical to AGCGAAGCACATGTGGAGAAGTCC (5′-FAM E1_CHIKV-P1_T/ZEN/3′ IBFQ/SEQ ID NO: 19); a CHIKV second probe comprising a sequence at least 90% identical to AGCGAAGCACACGTGGAGAAGTCC (5′-FAM E1_CHIKV-P1_C/ZEN/3′ IBFQ/SEQ ID NO: 20); a DENV2 forward primer comprising a sequence at least 90% identical to ACACAGATGGCAATGACAGACACG (NS5_D2-F2/SEQ ID NO: 22); a DENV2 reverse primer comprising a sequence at least 90% identical to CCAAGGCTGCATTGCTTCTCAC (NS5_D2-R2/SEQ ID NO: 24); a DENV2 probe comprising a sequence at least 90% identical to TGGAAAGAACTAGGAAAGAAAAAGACAC (5′-HEX NS5_D2-P2/ZEN/3′ IBFQ/SEQ ID NO: 23); a DENV4 first forward primer comprising a sequence at least 90% identical to TGGTTAGACCACCTTTCAATATG (C_D4-F1.2_T/SEQID NO: 25); a DENV4 second forward primer comprising a sequence at least 90% identical to TGGCTAGACCACCTTTCAATATG (C_D4-F1.2_C/SEQID NO: 26); a DENV4 reverse primer comprising a sequence at least 90% identical to TGCTAGCACCATCCGTAA (C_D4-R1.2/SEQ ID NO: 28); a DENV4 probe comprising a sequence at least 90% identical to CCTCAAGGGTTGGTGAAGAGATTC (5′-Texas Red C_D4-P1/3′ IBRQ/SEQ ID NO: 27); and a combination thereof.
5. The method of claim 1, wherein the primers and probes are conjugated with a detectable label. In some examples, the detectable label may include, but is not limited to a fluorophore, a quencher, or a combination thereof
6. The method of claim 1, wherein the sample is selected from the group consisting of whole blood, serum, plasma, cerebrospinal fluid, urine, and amniotic fluid.
7. The method of claim 1, wherein the sample is whole blood.
8. The method of of claim 1, wherein the sample is whole blood treated with EDTA.
9-11. (canceled)
12. A method for detecting and/or differentiating and/or quantifying virus selected from the group consisting of Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, the method comprising: subjecting the sample to a reverse transcription polymerase chain reaction (RT-PCR) using primers and a probe specific for CHIKV E1 glycoprotein, primers and a probe specific for DENV1 Non Structural protein 5 (NS5), primers and a probe specific for DENV2 NS5, primers and a probe specific for DENV3 NS5, primers and a probe specific for DENV4 capsid, and primers and a probe specific for ZIKV NS5.
13. The method of claim 12, wherein the primers and probes comprise: a ZIKV forward primer comprising a sequence at least 90% identical to CCTTGGATTCTTGAACGAGGATCAC (SEQ ID NO: 7); a ZIKV reverse primer comprising a sequence at least 90% identical to GCTTCATTCTCCAGATCAAACCTGC (SEQ ID NO: 9) or GCTTCATTCTCTAGATCAAACCTGC (SEQ ID NO: 32); a ZIKV probe comprising a sequence at least 90% identical to TACCAGGAGGAAGGATGTATGCAG (SEQ ID NO: 8) or ACCAGGAGGAAAGATGTACGCAG (SEQ ID NO: 33); a DENV1 first forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACAGAAG (SEQ ID NO: 10); a DENV1 second forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACTGAAG (SEQ ID NO: 11); a DENV1 reverse primer comprising a sequence at least 90% identical to GAGGACTCACCAATATCACACAA (SEQ ID NO: 13); a DENV1 probe comprising a sequence at least 90% identical to ACCTATGGATGGAACCTAGTAAAGCT (SEQ ID NO: 12); a DENV3 forward primer comprising a sequence at least 90% identical to GCTCAGCCTCCTCCATGATAAATG (SEQ ID NO: 14); a DENV3 reverse primer comprising a sequence at least 90% identical to GGGTGTCCTGGTGTCCACTTTCTC (SEQ ID NO: 17); a DENV3 first probe comprising a sequence at least 90% identical to CATGGTGACACAGATGGCAATGAC (SEQ ID NO: 15); a DENV3 second probe comprising a sequence at least 90% identical to CACGGTGACACAGATGGCAATGAC (SEQ ID NO: 16); a CHIKV forward primer comprising a sequence at least 90% identical to GGCGCCTACTGCTTCTGCGAC (SEQ ID NO: 18); a CHIKV reverse primer comprising a sequence at least 90% identical to TTGGTAAAGGACGCGGAGCTTAGC (SEQ ID NO: 21); a CHIKV first probe comprising a sequence at least 90% identical to AGCGAAGCACATGTGGAGAAGTCC (SEQ ID NO: 19); a CHIKV second probe comprising a sequence at least 90% identical to AGCGAAGCACACGTGGAGAAGTCC (SEQ ID NO: 20); a DENV2 forward primer comprising a sequence at least 90% identical to ACACAGATGGCAATGACAGACACG (SEQ ID NO: 22); a DENV2 reverse primer comprising a sequence at least 90% identical to CCAAGGCTGCATTGCTTCTCAC (SEQ ID NO: 24); a DENV2 probe comprising a sequence at least 90% identical to TGGAAAGAACTAGGAAAGAAAAAGACAC (SEQ ID NO: 23); a DENV4 first forward primer comprising a sequence at least 90% identical to TGGTTAGACCACCTTTCAATATG (SEQ ID NO: 25); a DENV4 second forward primer comprising a sequence at least 90% identical to TGGCTAGACCACCTTTCAATATG (SEQ ID NO: 26); a DENV4 reverse primer comprising a sequence at least 90% identical to TGCTAGCACCATCCGTAA (SEQ ID NO: 28); and a DENV4 probe comprising a sequence at least 90% identical to CCTCAAGGGTTGGTGAAGAGATTC (SEQ ID NO: 27).
14. The method of claim 12, wherein: TABLE-US-00040 the ZIKV forward primer comprising (SEQ ID NO: 7) CCTTGGATTCTTGAACGAGGATCAC; the ZIKV reverse primer comprising (SEQ ID NO: 9) GCTTCATTCTCCAGATCAAACCTGC or (SEQ ID NO: 32) GCTTCATTCTCTAGATCAAACCTGC; the ZIKV probe comprising (SEQ ID NO: 8) TACCAGGAGGAAGGATGTATGCAG Or (SEQ ID NO: 33) ACCAGGAGGAAAGATGTACGCAG; the DENV1 first forward primer comprising (SEQ ID NO: 10) GGCTGAAGAAAGTCACAGAAG; the DENV1 second forward primer comprising (SEQ ID NO: 11) GGCTGAAGAAAGTCACTGAAG; the DENV1 reverse primer comprising (SEQ ID NO: 13) GAGGACTCACCAATATCACACAA; the DENVI probe comprising (SEQ ID NO: 12) ACCTATGGATGGAACCTAGTAAAGCT; the DENV3 forward primer comprising (SEQ ID NO: 14) GCTCAGCCTCCTCCATGATAAATG; the DENV3 reverse primer comprising (SEQ ID NO: 17) GGGTGTCCTGGTGTCCACTTTCTC; the DENV3 first probe comprising (SEQ ID NO: 15) CATGGTGACACAGATGGCAATGAC; the DENV3 second probe comprising (SEQ ID NO: 16) CACGGTGACACAGATGGCAATGAC; the CHIKV forward primer comprising (SEQ ID NO: 18) GGCGCCTACTGCTTCTGCGAC; the CHIKV reverse primer comprising (SEQ ID NO: 21) TTGGTAAAGGACGCGGAGCTTAGC; the CHIKV first probe comprising (SEQ ID NO: 19) AGCGAAGCACATGTGGAGAAGTCC; the CHIKV second probe comprising (SEQ ID NO: 20) AGCGAAGCACACGTGGAGAAGTCC; the DENV2 forward primer comprising (SEQ ID NO: 22) ACACAGATGGCAATGACAGACACG; the DENV2 reverse primer comprising (SEQ ID NO: 24) CCAAGGCTGCATTGCTTCTCAC; the DENV2 probe comprising (SEQ ID NO: 23) TGGAAAGAACTAGGAAAGAAAAAGACAC; the DENV4 first forward primer comprising (SEQ ID NO: 25) TGGTTAGACCACCTTTCAATATG; the DENV4 second forward primer comprising (SEQ ID NO: 26) TGGCTAGACCACCTTTCAATATG; the DENV4 reverse primer comprising (SEQ ID NO: 28) TGCTAGCACCATCCGTAA; and the DENV4 probe comprising (SEQ ID NO: 27) CCTCAAGGGTTGGTGAAGAGATTC.
15. The method of claim 1, wherein the primers and probes comprise a detectable label.
16. The method of claim 15, wherein the detectable label comprises a fluorophore, a quencher, or a combination thereof
17. A kit for detecting Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, comprising: an agent specific for detecting CHIKV E1 glycoprotein, an agent specific for detecting DENV1 Non Structural protein 5 (NS5), an agent specific for detecting DENV2 NS5, an agent specific for detecting DENV3 NS5, an agent specific for detecting DENV4 capsid, and an agent specific for detecting ZIKV NS5.
18. The kit of claim 17, comprising an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 1; an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 2; an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 3; an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 4; an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 5; and an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 6.
19. The kit of claim 17, wherein the agent comprises primers and probes comprising: a ZIKV forward primer comprising a sequence at least 90% identical to CCTTGGATTCTTGAACGAGGATCAC (SEQ ID NO: 7); a ZIKV reverse primer comprising a sequence at least 90% identical to GCTTCATTCTCCAGATCAAACCTGC (SEQ ID NO: 9) or GCTTCATTCTCTAGATCAAACCTGC (SEQ ID NO: 32); a ZIKV probe comprising a sequence at least 90% identical to TACCAGGAGGAAGGATGTATGCAG (SEQ ID NO: 8) or ACCAGGAGGAAAGATGTACGCAG (SEQ ID NO: 33); a DENV1 first forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACAGAAG (SEQ ID NO: 10); a DENV1 second forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACTGAAG (SEQ ID NO: 11); a DENV1 reverse primer comprising a sequence at least 90% identical to GAGGACTCACCAATATCACACAA (SEQ ID NO: 13); a DENV1 probe comprising a sequence at least 90% identical to ACCTATGGATGGAACCTAGTAAAGCT (SEQ ID NO: 12); a DENV3 forward primer comprising a sequence at least 90% identical to GCTCAGCCTCCTCCATGATAAATG (SEQ ID NO: 14); a DENV3 reverse primer comprising a sequence at least 90% identical to GGGTGTCCTGGTGTCCACTTTCTC (SEQ ID NO: 17); a DENV3 first probe comprising a sequence at least 90% identical to CATGGTGACACAGATGGCAATGAC (SEQ ID NO: 15); a DENV3 second probe comprising a sequence at least 90% identical to CACGGTGACACAGATGGCAATGAC (SEQ ID NO: 16); a CHIKV forward primer comprising a sequence at least 90% identical to GGCGCCTACTGCTTCTGCGAC (SEQ ID NO: 18); a CHIKV reverse primer comprising a sequence at least 90% identical to TTGGTAAAGGACGCGGAGCTTAGC (SEQ ID NO: 21); a CHIKV first probe comprising a sequence at least 90% identical to AGCGAAGCACATGTGGAGAAGTCC (SEQ ID NO: 19); a CHIKV second probe comprising a sequence at least 90% identical to AGCGAAGCACACGTGGAGAAGTCC (SEQ ID NO: 20); a DENV2 forward primer comprising a sequence at least 90% identical to ACACAGATGGCAATGACAGACACG (SEQ ID NO: 22); a DENV2 reverse primer comprising a sequence at least 90% identical to CCAAGGCTGCATTGCTTCTCAC (SEQ ID NO: 24); a DENV2 probe comprising a sequence at least 90% identical to TGGAAAGAACTAGGAAAGAAAAAGACAC (SEQ ID NO: 23); a DENV4 first forward primer comprising a sequence at least 90% identical to TGGTTAGACCACCTTTCAATATG (SEQ ID NO: 25); a DENV4 second forward primer comprising a sequence at least 90% identical to TGGCTAGACCACCTTTCAATATG (SEQ ID NO: 26); a DENV4 reverse primer comprising a sequence at least 90% identical to TGCTAGCACCATCCGTAA (SEQ ID NO: 28); and a DENV4 probe comprising a sequence at least 90% identical to CCTCAAGGGTTGGTGAAGAGATTC (SEQ ID NO: 27).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0083] Exemplary embodiments of the invention will be better understood and readily apparent to one of ordinary skill in the art from the following written description, by way of example only, and in conjunction with the drawings, in which:
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
DETAILED DESCRIPTION
[0112] Chikungunya, Zika, and Dengue are three prevalent mosquito-borne viruses that cause similar disease symptoms. Distinguishing the causative virus in an infection is essential for appropriate treatment and care. The inventors of the present disclosure have developed a multiplex molecular diagnostic test that can differentially detect Chikungunya, the various serotypes of Dengue and Zika viruses.
[0113] In one aspect, there is provided a method of simultaneously detecting, differentiating, and/or quantifying Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, wherein the method comprising: determining the presence of the target regions or fragments thereof selected from the group consisting of Non Structural protein 5 (NS5) of Zika virus, NS5 of DENV1, NS5 of DENV2, NS5 of DENV3, Capsid of DENV4, and E1 glycoprotein of CHIKV.
[0114] In some examples, the method is to simultaneously detect three or more viruses. That is, in some examples, there is provided a method of simultaneously detecting, differentiating, and/or quantifying three or more virus selected from the group consisting of Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, wherein the method comprising:
[0115] determining the presence of three or more target regions or fragments thereof selected from the group consisting of Non-Structural protein 5 (NS5) of ZIKV, NS5 of DENV1, NS5 of DENV2, NS5 of DENV3, Capsid of DENV4, and E1 glycoprotein of CHIKV.
[0116] In some examples, the method is to detect one or more viruses. That is, in some examples, there is provided a method of detecting, differentiating, and/or quantifying one or more virus selected from the group consisting of Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, wherein the method comprising:
[0117] determining the presence of one or more target regions or fragments thereof selected from the group consisting of Non-Structural protein 5 (NS5) of ZIKV, NS5 of DENV1, NS5 of DENV2, NS5 of DENV3, Capsid of DENV4, and E1 glycoprotein of CHIKV.
[0118] As used herein, the term “simultaneously” refers to concurrent (synchronous or happening at the same time) detection/differentiating and/or quantification of the targets of interest. At the same time, the term “detect”, “detecting”, or “detection” refers to the discovering, distinguishing, or determining the presence of the target of interest or fragment thereof. Thus, the method as described herein allows for one sample to be used concurrently on whether the sample comprises any one of Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV). Thus, in some examples, the method is capable of detecting three or more viruses, or four or more viruses, or five or more viruses, or all six viruses, which includes Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV).
[0119] As used herein, the term “target region” refers to a region or structure of the virus of interest that is to be analysed and/or detected. In some examples, the target region may refer to a target sequence that is a region of a nucleic acid that is to be analysed and comprises the sequence of the virus of interest.
[0120] As used herein, the terms “nucleic acid”, “oligonucleotide” and “polynucleotide” refer to primers, probes, and oligomer fragments. The terms are not limited by length and are generic to polymers (typically linear) of polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and any other N-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine bases. These terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. Oligonucleotides of the present disclosure may be used as primers and/or probes. A nucleic acid or oligonucleotide may comprise the five biologically occurring bases (adenine, guanine, thymine, cystosine, and uracil) and/or bases other than the five biologically occurring bases. These bases may serve a number of purposes, e.g. to stabilize or destabilize hybridization; to promote or inhibit probe degradation; or as attachment points for detectable label (or moieties) or quencher. Included in the terms “nucleic acid”, “oligonucleotide” and “polynucleotide” may include complementary sequences thereof.
[0121] The selection of target regions as described herein surprisingly allows for the detection and differentiation of six viruses simultaneously. In particular, the target regions of the present disclosure allow for the distinction of the four DENV serotypes, ZIKV, and CHIKV to be performed concurrently. As shown in the Experimental section below, the target regions of the present disclosure are highly specific for each of the target of interest such that no cross-reactivity or non-specific result was observed. The selection of target regions could surprisingly allow for the individual detection of each of the four DENV serotypes, which is important as there is an increase risk of severe clinical manifestation in patients/subjects infected with subsequent/other serotypes.
[0122] The E1 glycoprotein of chikungunya virus (CHIKV) as disclosed herein may comprise a sequence or part of a sequence having at least 80% identity to SEQ ID NO: 1 or its fragment thereof. The E1 glycoprotein of chikungunya virus of SEQ ID NO: 1 is a consensus sequence of chikungunya virus that were obtained between 2005 to 2016 from various regions around the world. Detail of virus strains used to build the consensus sequence can be found in Table 5. In some examples, the target regions or fragments thereof may have at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or at least 100% sequence identity to SEQ ID NO: 1 or part of the sequence or its fragment thereof.
[0123] The Non-Structural protein 5 (NS5) of DENV1 (Dengue virus serotype 1) as disclosed herein may comprise a sequence or part of a sequence having at least 80% identity to SEQ ID NO: 2 or its fragment thereof. The NS5 of DENV1 of SEQ ID NO: 2 is a consensus sequence of DENV1 that were obtained from various regions around the world. Detail of virus strains used to build the consensus sequence can be found in Table 6. In some examples, the target regions or fragments thereof may have at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or at least 100% sequence identity to SEQ ID NO: 2 or part of the sequence or its fragment thereof.
[0124] The Non-Structural protein 5 (NS5) of DENV2 (Dengue virus serotype 2) as disclosed herein may comprise a sequence or part of a sequence having at least 80% identity to SEQ ID NO: 3 or its fragment thereof. The NS5 of DENV2 of SEQ ID NO: 3 is a consensus sequence of DENV2 that were obtained from various regions around the world. Detail of virus strains used to build the consensus sequence can be found in Table 7. In some examples, the target regions or fragments thereof may have at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or at least 100% sequence identity to SEQ ID NO: 3 or part of the sequence or its fragment thereof.
[0125] The Non-Structural protein 5 (NS5) of DENV3 (Dengue virus serotype 3) as disclosed herein may comprise a sequence or part of a sequence having at least 80% identity to SEQ ID NO: 4 or its fragment thereof. The NS5 of DENV3 of SEQ ID NO: 4 is a consensus sequence of DENV3 that were obtained from various regions around the world. Detail of virus strains used to build the consensus sequence can be found in Table 8. In some examples, the target regions or fragments thereof may have at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or at least 100% sequence identity to SEQ ID NO: 4 or part of the sequence or its fragment thereof.
[0126] The capsid of DENV4 (Dengue virus serotype 4) as disclosed herein may comprise a sequence or part of a sequence having at least 80% identity to SEQ ID NO: 5 or its fragment thereof. The capsid of DENV4 of SEQ ID NO: 5 is a consensus sequence of DENV4 that were obtained from various regions around the world. Detail of virus strains used to build the consensus sequence can be found in Table 9. In some examples, the target regions or fragments thereof may have at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or at least 100% sequence identity to SEQ ID NO: 5 or part of the sequence or its fragment thereof.
[0127] The NS5 of Zika virus (ZIKV) as disclosed herein may comprise a sequence or part of a sequence having at least 80% identity to SEQ ID NO: 6 or its fragment thereof. The NS5 of ZIKV of SEQ ID NO: 6 is a consensus sequence of ZIKV that were obtained from various regions around the world. Detail of virus strains used to build the consensus sequence can be found in Table 10. In some examples, the target regions or fragments thereof may have at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or at least 100% sequence identity to SEQ ID NO: 6 or part of the sequence or its fragment thereof.
[0128] In some examples, the target regions or fragments thereof are encoded by the sequence SEQ ID NO: 1 (CHIKV E1 consensus sequence); SEQ ID NO: 2 (DENV1 NS5 48+22 seq consensus sequence); SEQ ID NO: 3 (DENV2 NS5 consensus sequence); SEQ ID NO: 4 (DENV3 NS5 consensus sequence); SEQ ID NO: 5 (DENV4 Capsid consensus sequence); and SEQ ID NO: 6 (ZIKV NS5 check_56seq consensus sequence).
TABLE-US-00004 In some examples, the CHIKV E1 consensus sequence is (SEQ ID NO: 1) TACGAACACGTAACAGTGATCCCGAACACGGTGGG AGTACCGTATAAGACTCTAGTCAACAGACCGGGCT ACAGCCCCATGGTATTGGAGATGGAACTACTGTCA GTCACTTTGGAGCCAACACTATCGCTTGATTACAT CACGTGCGAGTACAAAACCGTCATCCCGTCTCCGT ACGTGAAATGCTGCGGTACAGCAGAGTGCAAGGAC AAAAACCTACCTGACTACAGCTGTAAGGTCTTCAC CGGCGTCTACCCATTTATGTGGGGCGGCGCCTACT GCTTCTGCGACGCTGAAAATACGCAATTGAGCGAA GCACATGTGGAGAAGTCCGAATCATGCAAAACAGA ATTTGCATCAGCATACAGGGCTCATACCGCATCCG CATCAGCTAAGCTCCGCGTCCTTTACCAAGGAAAT AACATCACTGTAACTGCCTATGCAAACGGCGACCA TGCCGTCACAGTTAAGGACGCCAAATTCATTGTGG GGCCAATGTCTTCAGCCTGGACACCTTTCGACAAC AAAATTGTGGTGTACAAAGGTGACGTCTATAACAT GGACTACCCGCCCTTTGGCGCAGGAAGACCAGGAC AATTTGGCGATATCCAAAGTCGCACACCTGAGAGT AAAGACGTCTATGCTAATACACAACTGGTACTGCA GAGACCGGCTGCGGGTACGGTACACGTGCCATACT CTCAGGCACCATCTGGCTTTAAGTATTGGCTAAAA GAACGAGGGGCGTCGCTGCAGCACACAGCACCATT TGGCTGCCAAATAGCAACAAACCCGGTAAGAGCGG TGAACTGCGCCGTAGGGAACATGCCCATCTCCATC GACATACCGGAAGCGGCCTTCACTAGGGTCGTCGA CGCGCCCTCTTTAACGGACATGTCGTGCGAGGTAC CAGCCTGCACCCATTCCTCAGACTTTGGGGGCGTC GCCATTATTAAATATGCAGCCAGCAAGAAAGGCAA GTGTGCGGTGCATTCGATGACTAACGCCGTCACTA TTCGGGAAGCTGAGATAGAAGTTGAAGGGAATTCT CAGCTGCAAATCTCTTTCTCGACGGCCTTAGCCAG CGCCGAATTCCGCGTACAAGTCTGTTCTACACAAG TACACTGTGCAGCCGAGTGCCACCCCCCGAAGGAC CACATAGTCAACTACCCGGCGTCACATACCACCCT CGGGGTCCAGGACATTTCCGCTACGGCGATGTCAT GGGTGCAGAAGATCACGGGAGGTGTGGGACTGGTT GTCGCTGTTGCAGCACTGATTCTAATCGTGGTGCT ATGCGTGTCGTTCAGCAGGCAC. In some examples, the DENV1 NS5 consensus sequence is (SEQ ID NO: 2) GGCACGGGAGCCCAAGGGGAAACACTGGGAGAGAA ATGGAAAAGACAGCTGAACCAACTGAGCAAGTCAG AATTCAACACCTACAAAAGGAGTGGGATTATGGAG GTGGACAGATCCGAAGCCAAAGAGGGACTGAAAAG AGGAGAAACAACCAAACATGCAGTGTCGAGAGGAA CCGCCAAACTGAGGTGGTTTGTGGAGAGGAACCTT GTGAAACCAGAAGGGAAAGTCATAGACCTCGGTTG TGGAAGAGGTGGCTGGTCATATTATTGCGCTGGGC TGAAGAAAGTCACAGAAGTGAAGGGATACACAAAA GGAGGACCTGGACATGAGGAACCAATCCCAATGGC GACCTATGGATGGAACCTAGTAAAGCTACACTCCG GGAAAGATGTATTCTTTATACCACCTGAGAAATGT GACACCCTTTTGTGTGATATTGGTGAGTCCTCTCC GAACCCAACTATAGAAGAAGGAAGAACGTTACGTG TTCTAAAGATGGTGGAACCATGGCTCAGAGGAAAC CAATTTTGCATAAAAATTCTAAATCCCTACATGCC AAGTGTGGTAGAAACTCTGGAGCAAATGCAAAGAA AACATGGAGGAATGCTAGTGCGAAATCCACTCTCA AGAAATTCCACTCATGAAATGTACTGGGTTTCATG TGGAACAGGAAACATTGTGTCAGCAGTAAACATGA CATCCAGAATGTTGCTAAATCGATTCACAATGGCT CACAGGAAGCCAACATATGAAAGAGACGTGGACTT AGGCGCTGGAACAAGACATGTGGCAGTGGAACCAG AGGTAGCCAACCTAGATATCATTGGCCAGAGGATA GAGAACATAAAAAATGAACACAAGTCAACATGGCA TTATGATGAGGACAATCCATACAAAACATGGGCCT ATCATGGATCATATGAGGTCAAGCCATCAGGATCA GCCTCATCCATGGTCAATGGTGTGGTGAGACTGCT CACCAAACCATGGGATGTCATCCCCATGGTCACAC AAATAGCCATGACTGACACCACACCCTTTGGACAA CAGAGGGTGTTTAAAGAGAAAGTTGACACGCGCAC ACCAAAAGCAAAACGAGGCACAGCACAAATCATGG AGGTGACAGCCAAGTGGTTATGGGGTTTTCTTTCT AGAAACAAAAAACCCAGAATCTGCACAAGAGAGGA GTTCACAAGAAAAGTTAGGTCAAACGCAGCCATTG GAGCAGTGTTCGTTGATGAAAATCAATGGAACTCA GCAAAAGAAGCAGTGGAAGATGAACGGTTCTGGGA CCTTGTGCACAGAGAGAGGGAGCTTCATAAACAGG GAAAATGTGCCACGTGTGTCTACAACATGATGGGG AAGAGAGAGAAAAAACTAGGAGAGTTTGGAAAGGC AAAAGGAAGTCGTGCAATATGGTACATGTGGTTGG GAGCACGCTTTCTAGAGTTCGAAGCCCTTGGTTTC ATGAATGAAGATCACTGGTTCAGCAGAGAGAATTC ACTCAGTGGAGTGGAAGGAGAAGGACTCCACAAAC TTGGATACATACTCAGAGACATATCAAAGATTCCA GGGGGAAATATGTATGCAGATGACACAGCCGGATG GGACACAAGAATAACAGAGGATGATCTTCAGAATG AGGCCAAAATCACTGACATCATGGAACCTGAACAT GCCCTACTGGCTACGTCAATCTTTAAGCTAACCTA CCAAAATAAGGTGGTAAGGGTGCAGAGACCAGCAA AAAATGGAACCGTGATGGATGTCATATCCAGACGT GACCAGAGAGGAAGTGGACAGGTCGGAACTTATGG CTTAAACACTTTCACCAACATGGAGGCCCAACTAA TAAGACAAATGGAGTCTGAGGGAATCTTTTCACCC AGCGAATTGGAAACCCCAAATTTAGCCGAGAGAGT TCTCGACTGGTTGGAAAAACATGGCGTCGAAAGGC TGAAAAGAATGGCAATCAGCGGAGATGACTGCGTG GTGAAACCAATTGATGACAGGTTCGCAACAGCCTT AACAGCTCTGAATGACATGGGAAAAGTAAGAAAAG ACATACCGCAATGGGAACCTTCAAAAGGATGGAAT GATTGGCAACAAGTGCCTTTCTGTTCACACCATTT CCACCAGCTGATTATGAAGGATGGGAGGGAAATAG TGGTGCCATGCCGCAACCAAGATGAACTTGTGGGT AGGGCTAGAGTATCACAAGGCGCCGGATGGAGCCT GAGAGAAACTGCATGCCTAGGCAAGTCATATGCAC AAATGTGGCAGCTGATGTACTTCCACAGGAGAGAC CTGAGACTAGCGGCTAATGCTATCTGTTCAGCCGT TCCAGTTGATTGGGTCCCAACCAGCCGCACCACCT GGTCGATCCATGCCCACCACCAATGGATGACAACA GAAGACATGTTGTCAGTGTGGAATAGGGTTTGGAT AGAGGAAAACCCATGGATGGAGGACAAAACTCATG TATCCAGTTGGGAAGATGTTCCATACCTAGGGAAA AGGGAAGATCAATGGTGTGGATCCCTGATAGGCTT AACAGCAAGGGCCACCTGGGCCACCAACATACAAG TGGCCATAAACCAAGTGAGAAGGCTCATTGGGAAT GAGAATTATCTAGATTACATGACATCAATGAAGAG ATTCAAGAACGAGAGTGATCCCGAAGGGGCACTCT GG. In some examples, the DENV2 NS5 consensus sequence is (SEQ ID NO: 3) GGAACTGGCAACATAGGAGAGACACTTGGAGAAAA ATGGAAAAGCCGATTAAACGCACTGGGAAAAAGTG AATTTCAGATCTACAAGAAAAGTGGAATCCAGGAA GTGGATAGAACCTTAGCAAAAGAAGGCATCAAAAG AGGAGAAACGGACCACCACGCTGTGTCGCGAGGCT CAGCAAAACTGAGATGGTTCGTCGAGAGAAATATG GTCACACCAGAAGGGAAGGTGGTGGACCTCGGTTG CGGCAGAGGGGGCTGGTCATACTATTGTGGGGGAC TAAAGAATGTAAGAGAAGTCAAAGGCCTAACAAAA GGAGGACCAGGACACGAAGAACCCATCCCCATGTC AACATATGGGTGGAATCTAGTGCGTCTGCAAAGTG GAGTTGACGTTTTCTTCACCCCGCCAGAAAAGTGT GATACATTGTTGTGTGACATAGGGGAGTCGTCACC AAATCCCACGATAGAAGCAGGACGAACACTCAGAG TCCTCAACTTAGTGGAAAATTGGTTGAACAATAAC ACCCAATTTTGCATAAAGGTTCTCAACCCATATAT GCCCTCAGTCATAGAAAAAATGGAAACACTACAAA GGAAATATGGAGGAGCCTTAGTGAGGAATCCACTC TCACGAAACTCCACACATGAGATGTACTGGGTATC CAATGCTACCGGGAACATAGTGTCATCAGTGAACA TGATTTCAAGGATGTTGATTAACAGATTCACAATG AAACACAAGAAAGCCACCTACGAGCCAGATGTTGA CCTAGGAAGTGGAACCCGCAACATTGGAATTGAAA GTGAGATACCAAATCTAGACATAATAGGAAAGAGA ATAGAGAAAATAAAACAAGAGCATGAAACATCATG GCACTATGACCAAGACCACCCATACAAAACGTGGG CTTACCATGGCAGCTATGAAACAAAACAAACTGGA TCAGCATCATCTATGGTGAACGGAGTGGTCAGACT GCTGACAAAACCTTGGGACGTCGTCCCTATGGTGA CACAGATGGCAATGACAGACACGACTCCATTTGGA CAACAGCGCGTTTTCAAAGAGAAAGTGGACACGAG AACCCAAGAACCGAAGGAAGGCACAAAGAAACTGA TGAAAATCACGGCAGAGTGGCTTTGGAAAGAACTA GGAAAGAAAAAGACACCTAGGATGTGTACCAGAGA AGAATTCACAAGAAAGGTGAGAAGCAATGCAGCCT TGGGGGCCATATTCACTGATGAGAACAAATGGAAA TCGGCACGTGAGGCTGTTGAAGATAGTAGGTTTTG GGAGCTGGTTGACAGGGAAAGAAATCTCCATCTTG AAGGAAAGTGTGAAACATGTGTGTACAACATGATG GGAAAAAGAGAGAAGAAACTAGGGGAGTTCGGCAA GGCAAAAGGTAGCAGAGCCATATGGTACATGTGGC TTGGAGCACGCTTCTTAGAGTTTGAAGCCCTAGGA TTCTTGAATGAAGATCACTGGTTCTCCAGAGGGAA CTCCCTGAGTGGAGTGGAAGGAGAAGGGCTGCACA GGCTAGGCTACATTTTAAGAGACGTGAGCAAGAAG GAAGGGGGAGCAATGTACGCCGATGATACAGCAGG ATGGGACACAAGAATCACACTAGAAGACTTAAAAA ATGAAGAAATGGTAACAAACCACATGAAAGGAGAA CACAAGAAACTAGCCGAGGCCATATTCAAATTAAC GTACCAAAACAAGGTGGTGCGTGTGCAAAGACCAA CACCAAGAGGCACAGTAATGGATATCATATCGAGA AGAGACCAAAGAGGCAGTGGGCAAGTCGGCACCTA TGGCCTTAATACTTTCACCAATATGGAAGCCCAAT TAATTAGACAGATGGAGGGAGAAGGAATCTTCAAA AGCATTCAGCAGCATTCAGCACCTGACAGTCACAG AAGAAATCGCTGTACAGAACTGGTTAGCAAGAGTG GGGCGTGAAAGGCTATCAAGAATGGCCATCAGTGG AGATGATTGTGTTGTAAAACCTTTAGATGACAGAT TTGCAAGTGCTTTAACAGCTCTAAATGACATGGGA AAAGTTAGGAAAGATATACAACAATGGGAACCTTC AAGAGGATGGAACGATTGGACACAAGTGCCTTTCT GTTCACACCATTTTCATGAGTTAGTCATGAAAGAT GGTCGCGTGCTCGTAGTCCCATGCAGAAACCAAGA TGAACTGATTGGTAGAGCCCGAATTTCCCAGGGAG CCGGGTGGTCTTTGAAGGAGACGGCCTGTTTGGGG AAGTCTTACGCCCAAATGTGGACCCTGATGTACTT CCACAGACGTGACCTCAGACTGGCGGCAAATGCCA TTTGCTCGGCAGTCCCGTCACATTGGGTTCCAACA AGTCGAACAACCTGGTCCATACACGCTAAGCATGA ATGGATGACGACGGAAGACATGCTGGCAGTCTGGA ACAGGGTGTGGATCCAAGAAAACCCGTGGATGGAA GACAAAACTCCAGTGGAATCATGGGAAGAAGTCCC ATACTTGGGGAAAAGAGAAGACCAATGGTGCGGCT CATTGATTGGGCTAACAAGCAGGGCTACCTGGGCA AAGAACATCCAAACAGCAATAAATCAAGTCAGATC CCTTATAGGCAATGAGGAATACACAGACTACATGC CATCCATGAAGAGATTCAGAAGGGAAGAGGAAGAG GCAGGTGTCCTGTGG. In some examples, the DENV3 NS5 consensus sequence is (SEQ ID NO: 4) GGAACAGGCTCACAAGGTGAAACTTTAGGAGAAAA ATGGAAAAAGAAATTAAATCAATTATCCCGGAAAG AGTTTGACCTTTACAAGAAATCTGGAATCACTGAA GTGGATAGAACAGAAGCCAAAGAAGGGTTGAAAAG AGGAGAAATAACACATCATGCCGTGTCCAGAGGTA GCGCAAAACTTCAATGGTTTGTGGAGAGAAACATG GTCATTCCCGAAGGAAGAGTCATAGACTTGGGCTG TGGAAGAGGAGGCTGGTCATATTACTGTGCAGGAC TGAAAAAAGTCACAGAAGTGCGAGGATACACAAAA GGCGGTCCAGGACACGAAGAACCAGTACCTATGTC CACATATGGATGGAACATAGTTAAGTTAATGAGTG GAAAGGATGTGTTTTATCTTCCACCTGAAAAGTGT GACACCCTGTTGTGTGACATTGGAGAATCTTCACC AAGCCCAACAGTGGAAGAAAGCAGAACTATAAGAG TTTTGAAGATGGTTGAACCATGGCTAAAAAACAAC CAGTTTTGCATTAAAGTATTGAACCCTTACATGCC AACTGTGATTGAGCACCTAGAAAGACTACAAAGGA AACATGGAGGAATGCTTGTGAGAAATCCACTTTCA CGAAACTCCACGCACGAAATGTACTGGATATCTAA TGGCACAGGTAACATTGTCTCTTCAGTCAACATGG TATCTAGACTGCTACTGAACAGGTTCACGATGACA CACAGAAGACCCACCATAGAGAAAGATGTGGATTT AGGAGCAGGAACTCGACATGTTAATGCGGAACCAG AAACACCCAACATGGATGTCATTGGGGAAAGAATA AAAAGGATCAAGGAGGAGCATAATTCAACATGGCA CTATGATGACGAAAACCCCTACAAAACGTGGGCTT ACCATGGATCTTATGAAGTCAAAGCCACAGGCTCA GCCTCCTCCATGATAAATGGAGTCGTGAAACTCCT CACTAAACCATGGGATGTGGTGCCCATGGTGACAC AGATGGCAATGACAGATACAACTCCATTTGGCCAG CAGAGAGTCTTTAAAGAGAAAGTGGACACCAGGAC ACCCAGGCCCATGCCAGGAACAAGAAAGGTTATGG AGATCACAGCGGAGTGGCTCTGGAGAACCCTGGGA AGGAACAAAAAACCCAGGTTATGCACAAGGGAAGA GTTTACAAAAAAGGTCAGAACTAACGCAGCCATGG GCGCCGTTTTCACAGAGGAGAACCAATGGGACAGC GCGAAAGCTGCTGTTGAGGATGAGGATTTTTGGAA ACTTGTGGACAGAGAACGTGAACTCCACAAATTGG GCAAGTGTGGAAGCTGTGTTTACAACATGATGGGC AAGAGAGAGAAGAAACTTGGAGAGTTTGGCAAAGC AAAAGGCAGTAGAGCTATATGGTACATGTGGTTGG GAGCCAGGTACCTTGAGTTCGAAGCCCTTGGATTC TTAAATGAAGACCACTGGTTCTCGCGTGAGAACTC TTACAGTGGAGTAGAAGGAGAAGGACTGCACAAGC TAGGCTATATATTAAGGGACATTTCCAAGATACCC GGAGGAGCTATGTATGCTGATGACACAGCTGGTTG GGACACAAGAATAACAGAAGATGACCTGCACAATG AGGAAAAGATCACACAGCAAATGGACCCTGAACAC AGGCAGTTAGCGAACGCTATATTTAAGCTCACATA CCAAAACAAAGTGGTCAAAGTTCAACGACCGACTC CAACAGGCACGGTAATGGACATCATATCTAGGAAA GACCAAAGAGGCAGTGGACAGGTGGGAACTTATGG TCTGAATACATTCACCAACATGGAAGCCCAGTTAA TCAGACAAATGGAAGGAGAAGGTGTGCTGTCAAAG GCAGACCTCGGCAGACCTCGAGAACCCTCATCTGC CAGAGAAGAAAATTACACAATGGTTGGAAACCAAA GGAGTGGAGAGGTTAAAAAGAATGGCCATTAGCGG GGATGATTGCGTAGTGAAACCAATCGATGACAGGT TCGCTAATGCCCTGCTTGCTCTGAACGATATGGGA AAGGTTCGGAAAGACATACCTCAATGGCAGCCATC AAAGGGATGGCATGATTGGCAACAGGTTCCTTTCT GCTCCCACCACTTTCATGAATTGATCATGAAAGAT GGAAGAAAGTTGGTGGTTCCCTGCAGACCCCAGGA CGAACTAATAGGAAGAGCAAGAATCTCTCAAGGAG CGGGATGGAGCCTTAGAGAAACCGCATGTCTGGGG AAAGCCTACGCTCAAATGTGGAGTCTCATGTATTT TCACAGAAGAGATCTCAGACTAGCATCCAACGCCA TATGTTCAGCAGTACCAGTCCACTGGGTCCCCACA AGTAGAACGACATGGTCTATTCATGCTCACCATCA GTGGATGACCACAGAAGACATGCTTACTGTCTGGA ACAGGGTGTGGATCGAGGACAATCCATGGATGGAA GACAAAACTCCAGTCACAACCTGGGAAAATGTTCC ATATCTAGGGAAGAGAGAAGACCAATGGTGCGGAT CACTTATTGGTCTCACTTCCAGAGCAACCTGGGCC CAGAACATACCCACAGCAATTCAACAGGTGAGAAG CCTTATAGGCAATGAAGAGTTTCTGGACTACATGC CTTCAATGAAGAGATTCAGGAAGGAGGAGGAGTCG GAGGGAGCCATTTGG. In some examples, the DENV4 caspid consensus sequence is (SEQ ID NO: 5) ATGAACCAACGAAAAAAGGTGGTTAGACCACCTTT CAATATGCTGAAACGCGAGAGAAACCGCGTATCAA CCCCTCAAGGGTTGGTGAAGAGATTCTCAACCGGA CTTTTTTCTGGGAAAGGACCCTTACGGATGGTGCT AGCATTCATCACGTTTTTGCGAGTCCTTTCCATCC CACCAACAGCAGGGATTCTGAAGAGATGGGGACAG TTGAAGAAAAATAAGGCCATCAAGATACTGATTGG ATTCAGGAAGGAGATAGGCCGCATGCTGAACATCT TGAACGGGAGAAAAAGGTCAACGATAACATTGCTG TGCTTGATTCCCACCGTAATGGCG. In some examples, the ZIKV NS5 consensues sequence is (SEQ ID NO: 6) GGGGGTGGAACAGGAGAGACCCTGGGAGAGAAATG GAAGGCCCGCTTGAACCAGATGTCGGCCCTGGAGT TCTACTCCTACAAAAAGTCAGGCATCACCGAGGTG TGCAGAGAAGAGGCCCGCCGCGCCCTCAAGGACGG TGTGGCAACGGGAGGCCATGCTGTGTCCCGAGGAA GTGCAAAGCTGAGATGGTTGGTGGAGCGGGGATAC CTGCAGCCCTATGGAAAGGTCATTGATCTTGGATG TGGCAGAGGGGGCTGGAGTTACTACGCCGCCACCA TCCGCAAAGTTCAAGAAGTGAAAGGATACACAAAA GGAGGCCCTGGTCATGAAGAACCCGTGTTGGTGCA AAGCTATGGGTGGAACATAGTCCGTCTTAAGAGTG GGGTGGACGTCTTTCATATGGCGGCTGAGCCGTGT GACACGTTGCTGTGTGACATAGGTGAGTCATCATC TAGTCCTGAAGTGGAAGAAGCACGGACGCTCAGAG TCCTCTCCATGGTGGGGGATTGGCTTGAAAAAAGA CCAGGAGCCTTTTGTATAAAAGTGTTGTGCCCATA CACCAGCACTATGATGGAAACCCTGGAGCGACTGC AGCGTAGGTATGGGGGAGGACTGGTCAGAGTGCCA CTCTCCCGCAACTCTACACATGAGATGTACTGGGT CTCTGGAGCGAAAAGCAACACCATAAAAAGTGTGT CCACCACGAGCCAGCTCCTCTTGGGGCGCATGGAC GGGCCTAGGAGGCCAGTGAAATATGAGGAGGATGT GAATCTCGGCTCTGGCACGCGGGCTGTGGTAAGCT GCGCTGAAGCTCCCAACATGAAGATCATTGGTAAC CGCATTGAAAGGATCCGCAGTGAGCACGCGGAAAC GTGGTTCTTTGACGAGAACCACCCATATAGGACAT GGGCTTACCATGGAAGCTATGAGGCCCCCACACAA GGGTCAGCGTCCTCTCTAATAAACGGGGTTGTCAG GCTCCTGTCAAAACCCTGGGATGTGGTGACTGGAG TCACAGGAATAGCCATGACCGACACCACACCGTAT GGTCAGCAAAGAGTTTTCAAGGAAAAAGTGGACAC TAGGGTGCCAGACCCCCAAGAAGGCACTCGTCAGG TTATGAGCATGGTCTCTTCCTGGTTGTGGAAAGAG CTAGGCAAACACAAACGGCCACGAGTCTGTACCAA AGAAGAGTTCATCAACAAGGTTCGTAGCAATGCAG CATTAGGGGCAATATTTGAAGAGGAAAAAGAGTGG AAGACTGCAGTGGAAGCTGTGAACGATCCAAGGTT CTGGGCTCTAGTGGACAAGGAAAGAGAGCACCACC TGAGAGGAGAGTGCCAGAGTTGTGTGTACAACATG ATGGGAAAAAGAGAAAAGAAACAAGGGGAATTTGG AAAGGCCAAGGGCAGCCGCGCCATCTGGTATATGT GGCTAGGGGCTAGATTTCTAGAGTTCGAAGCCCTT GGATTCTTGAACGAGGATCACTGGATGGGGAGAGA GAACTCAGGAGGTGGTGTTGAAGGGCTGGGATTAC AAAGACTCGGATATGTCCTAGAAGAGATGAGTCGC ATACCAGGAGGAAGGATGTATGCAGATGACACTGC TGGCTGGGACACCCGCATCAGCAGGTTTGATCTGG AGAATGAAGCTCTAATCACCAACCAAATGGAGAAA GGGCACAGGGCCTTGGCATTGGCCATAATCAAGTA CACATACCAAAACAAAGTGGTAAAGGTCCTTAGAC CAGCTGAAAAAGGGAAAACAGTTATGGACATTATT TCGAGACAAGACCAAAGGGGGAGCGGACAAGTTGT CACTTACGCTCTTAACACATTTACCAACCTAGTGG TGCAACTCATTCGGAATATGGAGGCTGAGGAAGTT CTAGAGATGCCTAGAGATGCAAGACTTGTGGCTGC TGCGGAGGTCAGAGAAAGTGACCAACTGGTTGCAG AGCAACGGATGGGATAGGCTCAAACGAATGGCAGT CAGTGGAGATGATTGCGTTGTGAAGCCAATTGATG ATAGGTTTGCACATGCCCTCAGGTTCTTGAATGAT ATGGGAAAAGTTAGGAAGGACACACAAGAGTGGAA ACCCTCAACTGGATGGGACAACTGGGAAGAAGTTC CGTTTTGCTCCCACCACTTCAACAAGCTCCATCTC AAGGACGGGAGGTCCATTGTGGTTCCCTGCCGCCA CCAAGATGAACTGATTGGCCGGGCCCGCGTCTCTC CAGGGGCGGGATGGAGCATCCGGGAGACTGCTTGC CTAGCAAAATCATATGCGCAAATGTGGCAGCTCCT TTATTTCCACAGAAGGGACCTCCGACTGATGGCCA ATGCCATTTGTTCATCTGTGCCAGTTGACTGGGTT CCAACTGGGAGAACTACCTGGTCAATCCATGGAAA GGGAGAATGGATGACCACTGAAGACATGCTTGTGG TGTGGAACAGAGTGTGGATTGAGGAGAACGACCAC ATGGAAGACAAGACCCCAGTTACGAAATGGACAGA CATTCCCTATTTGGGAAAAAGGGAAGACTTGTGGT GTGGATCTCTCATAGGGCACAGACCGCGCACCACC TGGGCTGAGAACATTAAAAACACAGTCAACATGGT GCGCAGGATCATAGGTGATGAAGAAAAGTACATGG ACTACCTATCCACCCAAGTTCGCTACTTGGGTGAA GAAGGGTCTACACCTGGAGTGCTG.
[0129] As would be understood by the person skilled in the art, the target of the methods of the present disclosure is an RNA. In some examples, the target is a viral RNA. Thus, in some examples, the method may comprise the steps of purifying RNA from the sample. In some examples, the method may comprise the steps of cDNA synthesis. In some examples, the purified (viral) RNA is prepared into cDNA.
[0130] In some examples, the detecting and/or differentiating and/or quantifying comprises performing reverse transcription polymerase chain reaction (RT-PCR). In some examples, it would be well understood that the consensus sequences as described herein may be translated into amino acid sequences that could be used to generate peptides for use in serological assays.
[0131] In some examples, the detection and/or differentiation and/or quantification of the virus is performed by subjecting the sample to a reverse transcription polymerase chain reaction (RT-PCR) using primers and probe specific to the target regions or fragments thereof. In some examples, the sequences as described herein (such as the consensus sequences of each of the viruses) were sequences of clinically important isolates/strains worldwide that are retrieved from the art.
[0132] As used herein, the term “primer” refers to an oligonucleotide that acts as a point of initiation of DNA (or cDNA) synthesis under conditions in which synthesis of a primer extension product complementary to a nucleic acid strand is induced, i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. In some examples, a primer may be a single-stranded oligodeoxyribonucleotide. The primer may include a “hybridizing region” exactly or substantially complementary to the target sequence, for example about 15 to about 35 nucleotides in length, or 20, or 21, or 22, or 23, or 24, or 25, or 26, or 27, or 28, or 29, or 30, or 31, or 32, or 33, or 34, or 35 nucleotides in length. A primer oligonucleotide may either consist entirely of the hybridizing region or may contain additional features which allow for the detection, differentiation, quantification, immobilization, or manipulation of the amplified product, but which do not alter the ability of the primer to serve as a starting reagent for DNA (or cDNA) synthesis. For example, a nucleic acid sequence tail can be included at the 5′ end of the primer that hybridizes to a capture oligonucleotide.
[0133] As used herein, the term “probe” refers to an oligonucleotide that selectively hybridizes to a target nucleic acid under suitable conditions. A probe for detection of the target region as described herein may be of any length for example about 15 to 35 nucleotides length, or 20, or 21, or 22, or 23, or 24, or 25, or 26, or 27, or 28, or 29, or 30, or 31, or 32, or 33, or 34, or 35 nucleotides in length.
[0134] In some examples, the primers and probe may include, but is not limited to the following exemplary primers and probe:
[0135] a ZIKV forward primer comprising a sequence at least 90% identical to CCTTGGATTCTTGAACGAGGATCAC (NS5 ZIKV-F/SEQ ID NO: 7);
[0136] a ZIKV reverse primer comprising a sequence at least 90% identical to GCTTCATTCTCCAGATCAAACCTGC (NS5_ZIKV-R/SEQ ID NO: 9) or GCTTCATTCTCTAGATCAAACCTGC (ZIKV-R1_T/SEQ ID NO: 32);
[0137] a ZIKV probe comprising a sequence at least 90% identical to TACCAGGAGGAAGGATGTATGCAG (5′-FAM NS5_ZIKV-P/ZEN/3′ IBFQ/SEQ ID NO: 8) or ACCAGGAGGAAAGATGTACGCAG (ZIKV_P1_AF/SEQ ID NO: 33);
[0138] a DENV1 first forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACAGAAG (NS5_D1-F_A/SEQID NO: 10);
[0139] a DENV1 second forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACTGAAG (NS5_D1-F_T/SEQID NO: 11);
[0140] a DENV1 reverse primer comprising a sequence at least 90% identical to GAGGACTCACCAATATCACACAA (NS5_D1-R/SEQ ID NO: 13); a DENV1 probe comprising a sequence at least 90% identical to
[0141] ACCTATGGATGGAACCTAGTAAAGCT (5′-HEX NS5_D1/ZEN/3′ IBFQ/SEQ ID NO: 12);
[0142] a DENV3 forward primer comprising a sequence at least 90% identical to GCTCAGCCTCCTCCATGATAAATG (NS5_D3-F/SEQ ID NO: 14);
[0143] a DENV3 reverse primer comprising a sequence at least 90% identical to GGGTGTCCTGGTGTCCACTTTCTC (NS5_D3-R/SEQ ID NO: 17);
[0144] a DENV3 first probe comprising a sequence at least 90% identical to CATGGTGACACAGATGGCAATGAC (5′-Texas Red NS5_D3-P_T/3′ IBRQ/SEQ ID NO: 15);
[0145] a DENV3 second probe comprising a sequence at least 90% identical to CACGGTGACACAGATGGCAATGAC (5′-Texas Red NS5_D3-P_C/3′ IBRQ/SEQID NO: 16);
[0146] a CHIKV forward primer comprising a sequence at least 90% identical to GGCGCCTACTGCTTCTGCGAC (E1_CHIKV-F1/SEQID NO: 18);
[0147] a CHIKV reverse primer comprising a sequence at least 90% identical to TTGGTAAAGGACGCGGAGCTTAGC (E1_CHIKV-R1/SEQ ID NO: 21);
[0148] a CHIKV first probe comprising a sequence at least 90% identical to AGCGAAGCACATGTGGAGAAGTCC (5′-FAM E1_CHIKV-P1_T/ZEN/3′ IBFQ/SEQID NO:
[0149] 19);
[0150] a CHIKV second probe comprising a sequence at least 90% identical to AGCGAAGCACACGTGGAGAAGTCC (5′-FAM E1_CHIKV-P1_C/ZEN/3′ IBFQ/SEQID NO: 20);
[0151] a DENV2 forward primer comprising a sequence at least 90% identical to ACACAGATGGCAATGACAGACACG (NS5_D2-F2/SEQ ID NO: 22);
[0152] a DENV2 reverse primer comprising a sequence at least 90% identical to CCAAGGCTGCATTGCTTCTCAC (NS5_D2-R2/SEQ ID NO: 24);
[0153] a DENV2 probe comprising a sequence at least 90% identical to TGGAAAGAACTAGGAAAGAAAAAGACAC (5′-HEX NS5_D2-P2/ZEN/3′ IBFQ/SEQ ID NO: 23);
[0154] a DENV4 first forward primer comprising a sequence at least 90% identical to TGGTTAGACCACCTTTCAATATG (C_D4-F1.2_T/SEQID NO: 25);
[0155] a DENV4 second forward primer comprising a sequence at least 90% identical to TGGCTAGACCACCTTTCAATATG (C_D4-F1.2_C/SEQID NO: 26);
[0156] a DENV4 reverse primer comprising a sequence at least 90% identical to TGCTAGCACCATCCGTAA (C_D4-R1.2/SEQ ID NO: 28);
[0157] a DENV4 probe comprising a sequence at least 90% identical to CCTCAAGGGTTGGTGAAGAGATTC (5′-Texas Red C_D4-P1/3′ IBRQ/SEQID NO: 27); and a combination thereof.
[0158] In some examples, the primers and/or probe may comprise a sequence at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or are identical to SEQ ID NO: 7 to SEQ ID NO: 28. In some examples, the primers and/or probe may comprise a sequence having 10 or less nucleic acid difference, or 9 or less nucleic acid difference, or 8 or less nucleic acid difference, or 7 or less nucleic acid difference, or 6 or less nucleic acid difference, or 5 or less nucleic acid difference, or 4 or less nucleic acid difference, or 3 or less nucleic acid difference, or 2 or less nucleic acid difference or one or two nucleic acid difference from SEQ ID NO: 7 to SEQ ID NO: 28.
[0159] In some examples, the primers and/or probes may be conjugated with a detectable label. In some examples, the detectable label may provide signals detectable by fluorescence, radioactivity, colorimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. In some examples, the detectable label may include but is not limited to a fluorophore, a radioactive agent, a colorimetric agent, a gravimetric agent, a detectable enzyme, a quencher, and their combination thereof. In some examples, the primer and/or probes may comprise one or more quencher, or two quenchers, or three quenchers, or more. For example, the fluorophore may include, but is not limited to, 5′-FAM (also called 5′-carboxyfluorescein; also called Spiro(isobenzofuran-1(3H), 9′-(9H)xanthene)-5-carboxylic acid,3′,6′-dihydroxy-3-oxo-6-carboxyfluorescein); 5′-HEX (also called 5-Hexachloro-Fluorescein([4,7,2′,4′,5′,7′-hexachloro-(3′,6′-dipivaloyl-fluoresceinyl)-6-carboxylic acid])); 6-Hexachloro-Fluorescein([4,7,2′,4′,5′,7′-hexachloro-(3′,6′-dipivaloylfluoresceinyI)-5-carboxylic acid]); 5,-Tetrachloro-Fluorescein ([4,7,2′,7′-tetra-chloro-(3′,6′-dipivaloylfluoresceinyl)-5-carboxylic acid]); 6-Tetrachloro-Fluorescein([4,7,2′,7′-tetrachloro-(3′,6′-dipivaloylfluoresceinyl)-6-carboxylic acid]); 5-TAMRA (5-carboxytetramethylrhodamine; Xanthylium, 9-(2,4-dicarboxyphenyl)-3,6-bis(dimethyl- amino); 6-TAMRA (6-carboxytetramethylrhodamine; Xanthylium, 9-(2,5-dicarboxyphenyl)-3, 6-bis(dimethylamino); EDANS (5-((2-aminoethyl) amino)naphthalene-1-sulfonic acid); 1,5-IAEDANS (5-((((2-iodoacetyl)amino)ethyl) amino)naphthalene-1-sulfonic acid); DABCYL (4-((4-(dimethylamino)phenyl)azo)benzoic acid)Cy5, (Indodicarbocyanine-5)Cy3 (Indo- dicarbocyanine-3); and BODIPY FL (2,6-dibromo-4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-proprionic acid), Quasar-670 (Biosearch Technologies), CalOrange (Biosearch Technologies), Rox, FAM, HEX, Cy5™, Texas Red®, and suitable derivatives thereof.
[0160] In some examples, the fluorophore may include FAM (carboxyfluorescein), HEX (Hexachlorofluorescein), Texas Red®, Cy5™ and the like.
[0161] As used herein, the term “quencher” refers to a chromophoric molecule or part of a compound, which is capable of reducing the emission from a fluorescent donor when attached to or in proximity to the donor. Quenching may occur by any of several mechanisms including fluorescence resonance energy transfer, photo-induced electron transfer, paramagnetic enhancement of intersystem crossing, Dexter exchange coupling, and exciton coupling such as the formation of dark complexes. Fluorescence is “quenched” when the fluorescence emitted by the fluorophore is reduced as compared with the fluorescence in the absence of the quencher by at least 10%, for example,15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99.9% or more.
[0162] The quencher can be any material that can quench at least one fluorescence emission from an excited fluorophore being used in the assay.
[0163] A number of commercially available quenchers are known in the art, and include but are not limited to ZEN™, TAO™, and the like, developed by Integrated DNA Technologies (IDT). In some examples, the quenchers ZEN ™ and/or TAOTM may be used in addition to 3′quencher Iowa Black FQ (IBFQ) or 3′ IBRQ quencher, resulting in double-quenched probes, for example, e.g. 5′-FAM/ZEN/3′IBFQ or 5′-CY5/TAO/3′IBRQ. The inventors found that these double quenched probes generate less background and have increased signal compared to probes containing single quencher. Each probe's fluorophore is selected with the least amount of spectral overlap.
[0164] The methods of the present disclosure have been found to be useful in determining the specific virus that is causing various symptoms in a subject. Thus, in some embodiments, the sample is obtained from a subject suspected to have one (or more) of CHIKV, DENV1, DENV2, DENV3, DENV4, or ZIKV.
[0165] As shown in the Experimental section below, the methods of the present disclosure may be used on various samples. As used herein, the term “sample” may refer to a specimen that may contain the target of interest (i.e. virus of interest), which includes the nucleic acid sequences in or derived from the target of interest. Samples may be from any source such as biological specimens or environmental sources. Biological specimens include any tissue or material derived from a living or dead organism that may contain a target of interest or nucleic acid in or derived from the target of interest. Examples of biological samples include respiratory tissue, exudates (e.g., bronchoalveolar lavage), biopsy, sputum, whole blood (such as peripheral blood), plasma, serum, lymph node, gastrointestinal tissue, feces, urine, or other fluids, tissues or materials. Examples of environmental samples include water, ice, soil, slurries, debris, biofilms, airborne particles, and aerosols. Samples may be processed specimens or materials, such as obtained from treating a sample by using filtration, centrifugation, sedimentation, or adherence to a medium, such as matrix or support. Other processing of samples may include treatments to physically or mechanically disrupt tissue, cellular aggregates, or cells to release intracellular components that include nucleic acids into a solution which may contain other components, such as enzymes, buffers, salts, detergents and the like. In some examples, the sample may include, but is not limited to, whole blood, serum, plasma, cerebrospinal fluid, urine, and amniotic fluid. In some example, the sample may be whole blood.
[0166] In some examples, the sample may be whole blood treated with Ethylenediaminetetraacetic acid (EDTA). In some examples, the sample may be whole blood treated with EDTA and at least one other biological sample obtained from the same patient (i.e. patient-matched whole blood specimen) including serum, cerebrospinal fluid (CSF), urine, amniotic fluid, and the like.
[0167] In the process of developing the methods of the present disclosure, the inventors of the present disclosure found that ZIKV RNA is generally detectable in serum, whole blood and/or urine during the acute phase of infection and up to 14 days following onset of symptoms. Thus, in some examples, the sample for detecting or differentiating Zika virus may be serum, whole blood, and/or urine.
[0168] In some examples, the sample may be obtained from various phase of infection. For example, for detection of Zika virus, the sample may be obtained during acute phase of infection. In some examples, the sample may be obtained up to 14 days following onset of symptoms (if present). For detection of CHIKV and/or either one of the four serotypes of DENV, the sample may be obtained during the acute phase of the disease. In some examples, the sample may be obtained less than 14 to 1, or 14, or 13, or 12, or 11, or 10, or 9, or 8, or 7, or 6, or 5, or 4, or 3, or 2 days post-illness onset. In some examples, the sample may be obtained less than 7 days post-illness onset.
[0169] As would be apparent to the person skilled in the art, a positive result would be indicative of a current infection. On the other hand, negative result (such as negative RT-PCR result) may not rule out infections by one or more of CHIKV, DENV1, DENV2, DENV3, and/or ZIKV infections and should not be used as the sole basis for patient management decisions. It would be apparent to the skilled artisan that a negative result may be combined with clinical observations, patient history, and epidemiological information. An exemplary decision algorithm for positive and negative results observed can be seen in Table 4 (see Experimental section).
[0170] In some examples, the methods as disclosed herein may further include the inclusion or addition of an internal control. As used herein, the term “internal control” refers to any substance or mixture of known composition that is added to or is part of the sample that is used to establish a baseline for comparison with the target of interest. For example, the internal control may be added to the sample or may be a region of a molecule known to be present in the sample. Under the simultaneous presence of the target region and the internal control, the target region and internal control are subjected to identical conditions within the method or assay, providing an explicit measure of the effectiveness of the entire method or assay or test system. In some examples, the internal control may be any endogenous target that are detactable in blood. In some examples, the internal control may include, but is not limited to, GAPDH, beta-globin, beta-actin, and the like.
[0171] In some example, the internal control may be detected by the oligonucleotide comprising or consisting of:
[0172] a beta-actin forward primer comprising a sequence at least 90% identical to GGCACCCAGCACAATGAAG (B-actin-F; SEQ ID NO: 29);
[0173] a beta-actin reverse primer comprising a sequence at least 90% identical to GCCGATCCACACGGAGTACT (B-actin-R; SEQ ID NO: 31);
[0174] a beta-actin probe comprising a sequence at least 90% identical to TCAAGATCATTGCTCCTCCTGAGAGCGC (5′-Cy5 B-actin-P/TAO/3′ IBRQ; SEQ ID NO: 30).
[0175] In some examples, the primers and/or probe may comprise a sequence at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or are identical to SEQ ID NO: 29 to SEQ ID NO: 31. In some examples, the primers and/or probe may comprise a sequence having 10 or less nucleic acid difference, or 9 or less nucleic acid difference, or 8 or less nucleic acid difference, or 7 or less nucleic acid difference, or 6 or less nucleic acid difference, or 5 or less nucleic acid difference, or 4 or less nucleic acid difference, or 3 or less nucleic acid difference, or 2 or less nucleic acid difference or one or two nucleic acid difference from SEQ ID NO: 29 to SEQ ID NO: 31.
[0176] In another aspect, there is provided an isolated oligonucleotide for a simultaneous detection and/or differentiate and/or quantify virus selected from the group consisting of Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, wherein the oligonucleotide detects a nucleic acid sequence that is at least 80% identical to the sequences selected from the group consisting of:
[0177] a nucleic acid molecule that encodes a nucleotide sequence of Non Structural protein 5 (NS5) of Zika virus,
[0178] a nucleic acid molecule that encodes a nucleotide sequence of NS5 of DENV1,
[0179] a nucleic acid molecule that encodes a nucleotide sequence of NS5 of DENV2,
[0180] a nucleic acid molecule that encodes a nucleotide sequence of NS5 of DENV3,
[0181] a nucleic acid molecule that encodes a nucleotide sequence of Capsid of DENV4, and
[0182] a nucleic acid molecule that encodes a nucleotide sequence of E1 glycoprotein of CHIKV.
[0183] In some examples, there is provided an isolated oligonucleotide for a simultaneous detection and/or differentiate and/or quantify three or more virus selected from the group consisting of Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, wherein the oligonucleotide detects a nucleic acid sequence that is at least 80% identical to the sequences selected from the group consisting of:
[0184] a nucleic acid molecule that encodes a nucleotide sequence of Non Structural protein 5 (NS5) of Zika virus,
[0185] a nucleic acid molecule that encodes a nucleotide sequence of NS5 of DENV1,
[0186] a nucleic acid molecule that encodes a nucleotide sequence of NS5 of DENV2,
[0187] a nucleic acid molecule that encodes a nucleotide sequence of NS5 of DENV3,
[0188] a nucleic acid molecule that encodes a nucleotide sequence of Capsid of DENV4, and
[0189] a nucleic acid molecule that encodes a nucleotide sequence of E1 glycoprotein of CHIKV.
[0190] Thus, in some examples, the isolated oligonucleotide is capable of detecting three or more viruses, or four or more viruses, or five or more viruses, or all six viruses, which includes Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV).
[0191] In some examples, the nucleotide sequence of E1 glycoprotein of CHIKV comprises SEQ ID NO: 1 or its fragment or parts thereof, the nucleotide sequence of NS5 of DENV1 comprises SEQ ID NO: 2 or its fragment or parts thereof, the nucleotide sequence of NS5 of DENV2 comprises SEQ ID NO: 3 or its fragment or parts thereof, the nucleotide sequence of NS5 of DENV3 comprises SEQ ID NO: 4 or its fragment or parts thereof, the nucleotide sequence of Capsid of DENV4 comprises SEQ ID NO: 5 or its fragment or parts thereof, and the nucleotide sequence of Non Structural protein 5 (NS5) of Zika virus comprises SEQ ID NO: 6 or its fragment or parts thereof.
[0192] In some examples, the oligonucleotide may include, but is not limited to (or comprise or consist of):
[0193] a ZIKV forward primer comprising a sequence at least 90% identical to CCTTGGATTCTTGAACGAGGATCAC (SEQ ID NO: 7);
[0194] a ZIKV reverse primer comprising a sequence at least 90% identical to GCTTCATTCTCCAGATCAAACCTGC (SEQ ID NO: 9) or GCTTCATTCTCTAGATCAAACCTGC (SEQ ID NO: 32);
[0195] a ZIKV probe comprising a sequence at least 90% identical to TACCAGGAGGAAGGATGTATGCAG (SEQ ID NO: 8) or ACCAGGAGGAAAGATGTACGCAG (SEQ ID NO: 33);
[0196] a DENV1 first forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACAGAAG (SEQ ID NO: 10);
[0197] a DENV1 second forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACTGAAG (SEQ ID NO: 11);
[0198] a DENV1 reverse primer comprising a sequence at least 90% identical to GAGGACTCACCAATATCACACAA (SEQ ID NO: 13);
[0199] a DENV1 probe comprising a sequence at least 90% identical to ACCTATGGATGGAACCTAGTAAAGCT (SEQ ID NO: 12);
[0200] a DENV3 forward primer comprising a sequence at least 90% identical to GCTCAGCCTCCTCCATGATAAATG (SEQ ID NO: 14);
[0201] a DENV3 reverse primer comprising a sequence at least 90% identical to GGGTGTCCTGGTGTCCACTTTCTC (SEQ ID NO: 17);
[0202] a DENV3 first probe comprising a sequence at least 90% identical to CATGGTGACACAGATGGCAATGAC (SEQ ID NO: 15);
[0203] a DENV3 second probe comprising a sequence at least 90% identical to CACGGTGACACAGATGGCAATGAC (SEQ ID NO: 16);
[0204] a CHIKV forward primer comprising a sequence at least 90% identical to GGCGCCTACTGCTTCTGCGAC (SEQ ID NO: 18);
[0205] a CHIKV reverse primer comprising a sequence at least 90% identical to TTGGTAAAGGACGCGGAGCTTAGC (SEQ ID NO: 21);
[0206] a CHIKV first probe comprising a sequence at least 90% identical to AGCGAAGCACATGTGGAGAAGTCC (SEQ ID NO: 19);
[0207] a CHIKV second probe comprising a sequence at least 90% identical to AGCGAAGCACACGTGGAGAAGTCC (SEQ ID NO: 20);
[0208] a DENV2 forward primer comprising a sequence at least 90% identical to ACACAGATGGCAATGACAGACACG (SEQ ID NO: 22);
[0209] a DENV2 reverse primer comprising a sequence at least 90% identical to CCAAGGCTGCATTGCTTCTCAC (SEQ ID NO: 24);
[0210] a DENV2 probe comprising a sequence at least 90% identical to TGGAAAGAACTAGGAAAGAAAAAGACAC (SEQ ID NO: 23);
[0211] a DENV4 first forward primer comprising a sequence at least 90% identical to TGGTTAGACCACCTTTCAATATG (SEQ ID NO: 25);
[0212] a DENV4 second forward primer comprising a sequence at least 90% identical to TGGCTAGACCACCTTTCAATATG (SEQ ID NO: 26);
[0213] a DENV4 reverse primer comprising a sequence at least 90% identical to TGCTAGCACCATCCGTAA (SEQ ID NO: 28); and
[0214] a DENV4 probe comprising a sequence at least 90% identical to CCTCAAGGGTTGGTGAAGAGATTC (SEQ ID NO: 27).
[0215] In some examples, the oligonucleotides as disclosed herein may further include oligonucleotides for detecting an internal control. In some example, the oligonucleotide for detecting internal control may include, but is not limited to:
[0216] a beta-actin forward primer comprising a sequence at least 90% identical to GGCACCCAGCACAATGAAG (B-actin-F; SEQ ID NO: 29);
[0217] a beta-actin reverse primer comprising a sequence at least 90% identical to GCCGATCCACACGGAGTACT (B-actin-R; SEQ ID NO: 31);
[0218] a beta-actin probe comprising a sequence at least 90% identical to TCAAGATCATTGCTCCTCCTGAGAGCGC (5′-Cy5 B-actin-P/TAO/3′ IBRQ; SEQ ID NO: 30).
[0219] In some examples, the oligonucleotide is at least 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 7 to SEQ ID NO: 31. In some examples, the oligonucleotide may comprise a sequence at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or are identical to SEQ ID NO: 7 to SEQ ID NO: 31. In some examples, the oligonucleotide may comprise a sequence having 10 or less nucleic acid difference, or 9 or less nucleic acid difference, or 8 or less nucleic acid difference, or 7 or less nucleic acid difference, or 6 or less nucleic acid difference, or 5 or less nucleic acid difference, or 4 or less nucleic acid difference, or 3 or less nucleic acid difference, or 2 or less nucleic acid difference or one or two nucleic acid difference from SEQ ID NO: 7 to SEQ ID NO: 31.
[0220] In another aspect, there is provided a method for detecting and/or differentiating and/or quantifying virus selected from the group consisting of Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, the method comprising:
[0221] subjecting the sample to a reverse transcription polymerase chain reaction (RT-PCR) using primers and a probe specific for CHIKV E1 glycoprotein, primers and a probe specific for DENV1 Non Structural protein 5 (NS5), primers and a probe specific for DENV2 NS5, primers and a probe specific for DENV3 NS5, primers and a probe specific for DENV4 capsid, and primers and a probe specific for ZIKV NS5.
[0222] In some examples, there is provided a method for detecting and/or differentiating and/or quantifying three or more virus selected from the group consisting of Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, the method comprising:
[0223] subjecting the sample to a reverse transcription polymerase chain reaction (RT-PCR) using primers and a probe specific for CHIKV E1 glycoprotein, primers and a probe specific for DENV1 Non Structural protein 5 (NS5), primers and a probe specific for DENV2 NS5, primers and a probe specific for DENV3 NS5, primers and a probe specific for DENV4 capsid, and primers and a probe specific for ZIKV NS5. In some examples, the method is capable of detecting three or more viruses, or four or more viruses, or five or more viruses, or all six viruses, which includes Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV).
[0224] In some example, the primers and probes may comprise:
[0225] a ZIKV forward primer comprising a sequence at least 90% identical to CCTTGGATTCTTGAACGAGGATCAC (SEQ ID NO: 7);
[0226] a ZIKV reverse primer comprising a sequence at least 90% identical to GCTTCATTCTCCAGATCAAACCTGC (SEQ ID NO: 9) or GCTTCATTCTCTAGATCAAACCTGC (SEQ ID NO: 32);
[0227] a ZIKV probe comprising a sequence at least 90% identical to TACCAGGAGGAAGGATGTATGCAG (SEQ ID NO: 8) or ACCAGGAGGAAAGATGTACGCAG (SEQ ID NO: 33);
[0228] a DENV1 first forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACAGAAG (SEQ ID NO: 10);
[0229] a DENV1 second forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACTGAAG (SEQ ID NO: 11);
[0230] a DENV1 reverse primer comprising a sequence at least 90% identical to GAGGACTCACCAATATCACACAA (SEQ ID NO: 13);
[0231] a DENV1 probe comprising a sequence at least 90% identical to ACCTATGGATGGAACCTAGTAAAGCT (SEQ ID NO: 12);
[0232] a DENV3 forward primer comprising a sequence at least 90% identical to GCTCAGCCTCCTCCATGATAAATG (SEQ ID NO: 14);
[0233] a DENV3 reverse primer comprising a sequence at least 90% identical to GGGTGTCCTGGTGTCCACTTTCTC (SEQ ID NO: 17);
[0234] a DENV3 first probe comprising a sequence at least 90% identical to CATGGTGACACAGATGGCAATGAC (SEQ ID NO: 15);
[0235] a DENV3 second probe comprising a sequence at least 90% identical to CACGGTGACACAGATGGCAATGAC (SEQ ID NO: 16);
[0236] a CHIKV forward primer comprising a sequence at least 90% identical to GGCGCCTACTGCTTCTGCGAC (SEQ ID NO: 18);
[0237] a CHIKV reverse primer comprising a sequence at least 90% identical to TTGGTAAAGGACGCGGAGCTTAGC (SEQ ID NO: 21);
[0238] a CHIKV first probe comprising a sequence at least 90% identical to AGCGAAGCACATGTGGAGAAGTCC (SEQ ID NO: 19);
[0239] a CHIKV second probe comprising a sequence at least 90% identical to AGCGAAGCACACGTGGAGAAGTCC (SEQ ID NO: 20);
[0240] a DENV2 forward primer comprising a sequence at least 90% identical to ACACAGATGGCAATGACAGACACG (SEQ ID NO: 22);
[0241] a DENV2 reverse primer comprising a sequence at least 90% identical to CCAAGGCTGCATTGCTTCTCAC (SEQ ID NO: 24);
[0242] a DENV2 probe comprising a sequence at least 90% identical to TGGAAAGAACTAGGAAAGAAAAAGACAC (SEQ ID NO: 23);
[0243] a DENV4 first forward primer comprising a sequence at least 90% identical to TGGTTAGACCACCTTTCAATATG (SEQ ID NO: 25);
[0244] a DENV4 second forward primer comprising a sequence at least 90% identical to TGGCTAGACCACCTTTCAATATG (SEQ ID NO: 26);
[0245] a DENV4 reverse primer comprising a sequence at least 90% identical to TGCTAGCACCATCCGTAA (SEQ ID NO: 28); and
[0246] a DENV4 probe comprising a sequence at least 90% identical to CCTCAAGGGTTGGTGAAGAGATTC (SEQ ID NO: 27).
[0247] In some examples, the primers and/or probe may comprise a sequence at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or are identical to SEQ ID NO: 7 to SEQ ID NO: 28. In some examples, the primers and/or probe may comprise a sequence having 10 or less nucleic acid difference, or 9 or less nucleic acid difference, or 8 or less nucleic acid difference, or 7 or less nucleic acid difference, or 6 or less nucleic acid difference, or 5 or less nucleic acid difference, or 4 or less nucleic acid difference, or 3 or less nucleic acid difference, or 2 or less nucleic acid difference or one or two nucleic acid difference from SEQ ID NO: 7 to SEQ ID NO: 28.
[0248] In some example, the oligonucleotide as disclosed herein and/or the primers and/or probe may be:
TABLE-US-00005 the ZIKV forward primer comprising (SEQ ID NO: 7) CCTTGGATTCTTGAACGAGGATCAC; the ZIKV reverse primer comprising (SEQ ID NO: 9) GCTTCATTCTCCAGATCAAACCTGC or (SEQ ID NO: 32) GCTTCATTCTCTAGATCAAACCTGC; the ZIKV probe comprising (SEQ ID NO: 8) TACCAGGAGGAAGGATGTATGCAG or (SEQ ID NO: 33) ACCAGGAGGAAAGATGTACGCAG; the DENV1 first forward primer comprising (SEQ ID NO: 10) GGCTGAAGAAAGTCACAGAAG; the DENV1 second forward primer comprising (SEQ ID NO: 11) GGCTGAAGAAAGTCACTGAAG; the DENV1 reverse primer comprising (SEQ ID NO: 13) GAGGACTCACCAATATCACACAA; the DENV1 probe comprising (SEQ ID NO: 12) ACCTATGGATGGAACCTAGTAAAGCT; the DENV3 forward primer comprising (SEQ ID NO: 14) GCTCAGCCTCCTCCATGATAAATG; the DENV3 reverse primer comprising (SEQ ID NO: 17) GGGTGTCCTGGTGTCCACTTTCTC; the DENV3 first probe comprising (SEQ ID NO: 15) CATGGTGACACAGATGGCAATGAC; the DENV3 second probe comprising (SEQ ID NO: 16) CACGGTGACACAGATGGCAATGAC; the CHIKV forward primer comprising (SEQ ID NO: 18) GGCGCCTACTGCTTCTGCGAC; the CHIKV reverse primer comprising (SEQ ID NO: 21) TTGGTAAAGGACGCGGAGCTTAGC; the CHIKV first probe comprising (SEQ ID NO: 19) AGCGAAGCACATGTGGAGAAGTCC; the CHIKV second probe comprising (SEQ ID NO: 20) AGCGAAGCACACGTGGAGAAGTCC; the DENV2 forward primer comprising (SEQ ID NO: 22) ACACAGATGGCAATGACAGACACG; the DENV2 reverse primer comprising (SEQ ID NO: 24) CCAAGGCTGCATTGCTTCTCAC; the DENV2 probe comprising (SEQ ID NO: 23) TGGAAAGAACTAGGAAAGAAAAAGACAC; the DENV4 first forward primer comprising (SEQ ID NO: 25) TGGTTAGACCACCTTTCAATATG; the DENV4 second forward primer comprising (SEQ ID NO: 26) TGGCTAGACCACCTTTCAATATG; the DENV4 reverse primer comprising (SEQ ID NO: 28) TGCTAGCACCATCCGTAA; and the DENV4 probe comprising (SEQ ID NO: 27) CCTCAAGGGTTGGTGAAGAGATTC.
[0249] In some examples, the primers and/or probe may comprise a sequence at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or are identical to SEQ ID NO: 7 to SEQ ID NO: 28. In some examples, the primers and/or probe may comprise a sequence having 10 or less nucleic acid difference, or 9 or less nucleic acid difference, or 8 or less nucleic acid difference, or 7 or less nucleic acid difference, or 6 or less nucleic acid difference, or 5 or less nucleic acid difference, or 4 or less nucleic acid difference, or 3 or less nucleic acid difference, or 2 or less nucleic acid difference or one or two nucleic acid difference from SEQ ID NO: 7 to SEQ ID NO: 28.
[0250] In some examples, the primers and/or probes may be conjugated with a detectable label. In some examples, the detectable label may provide signals detectable by fluorescence, radioactivity, colorimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. In some examples, the detectable label may include but is not limited to a fluorophore, a radioactive agent, a colorimetric agent, a gravimetric agent, a detectable enzyme, a quencher, and their combination thereof. In some examples, the primer and/or probes may comprise one or more quencher, or two quenchers, or three quenchers, or more. For example, the fluorophore may include, but is not limited to, 5′-FAM (also called 5′-carboxyfluorescein; also called Spiro(isobenzofuran-1(3H), 9′-(9H)xanthene)-5-carboxylic acid,3′,6′-dihydroxy-3-oxo-6-carboxyfluorescein); 5′-HEX (also called 5-Hexachloro-Fluorescein([4,7,2′,4′,5′,7′-hexachloro-(3′,6′-dipivaloyl-fluoresceinyl)-6-carboxylic acid])); 6-Hexachloro-Fluorescein ([4,7,2′,4′,5′,7′-hexachloro-(3′,6′-dipivaloylfluoresceinyI)-5-carboxylic acid]); 5,-Tetrachloro-Fluorescein ([4,7,2′,7′-tetra-chloro-(3′,6′-dipivaloylfluoresceinyl)-5-carboxylic acid]); 6-Tetrachloro-Fluorescein([4,7,2′,7′-tetrachloro-(3′,6′-dipivaloylfluoresceinyl)-6-carboxylic acid]); 5-TAMRA (5-carboxytetramethylrhodamine; Xanthylium, 9-(2,4-dicarboxyphenyl)-3,6-bis(dimethyl- amino); 6-TAMRA (6-carboxytetramethylrhodamine; Xanthylium, 9-(2,5-dicarboxyphenyl)-3, 6-bis(dimethylamino); EDANS (5-((2-aminoethyl) amino)naphthalene-1-sulfonic acid); 1,5-IAEDANS (5-((((2-iodoacetyl)amino)ethyl) amino)naphthalene-1- sulfonic acid); DABCYL (4-((4-(dimethylamino)phenyl)azo)benzoic acid)Cy5, (Indodicarbocyanine-5)Cy3 (Indo- dicarbocyanine-3); and BODIPY FL (2,6-dibromo-4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-proprionic acid), Quasar-670 (Biosearch Technologies), CalOrange (Biosearch Technologies), Rox, and suitable derivatives thereof. In some examples, the fluorophore may include FAM (carboxyfluorescein), HEX (Hexachlorofluorescein), Texas Red®, Cy5™ and the like.
[0251] In some examples, the methods as disclosed herein may further include the inclusion or addition of an internal control.
[0252] In some example, the internal control may be detected by the oligonucleotide including, but is not limited to:
[0253] a beta-actin forward primer comprising a sequence at least 90% identical to GGCACCCAGCACAATGAAG (B-actin-F; SEQ ID NO: 29);
[0254] a beta-actin reverse primer comprising a sequence at least 90% identical to GCCGATCCACACGGAGTACT (B-actin-R; SEQ ID NO: 31);
[0255] a beta-actin probe comprising a sequence at least 90% identical to TCAAGATCATTGCTCCTCCTGAGAGCGC (5′-Cy5 B-actin-P/TAO/3′ IBRQ; SEQ ID NO: 30).
[0256] In some examples, the primers and/or probe may comprise a sequence at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or are identical to SEQ ID NO: 29 to SEQ ID NO: 31. In some examples, the primers and/or probe may comprise a sequence having 10 or less nucleic acid difference, or 9 or less nucleic acid difference, or 8 or less nucleic acid difference, or 7 or less nucleic acid difference, or 6 or less nucleic acid difference, or 5 or less nucleic acid difference, or 4 or less nucleic acid difference, or 3 or less nucleic acid difference, or 2 or less nucleic acid difference or one or two nucleic acid difference from SEQ ID NO: 29 to SEQ ID NO: 31.
[0257] In another aspect, there is provided a kit for detecting Chikungunya virus (CHIKV), Dengue virus serotype-1 (DENV1), Dengue virus serotype-2 (DENV2), Dengue virus serotype-3 (DENV3), Dengue virus serotype-4 (DENV4) and Zika virus (ZIKV) in a sample, comprising: an agent specific for detecting CHIKV E1 glycoprotein, an agent specific for detecting DENV1 Non Structural protein 5 (NS5), an agent specific for detecting DENV2 NS5, an agent specific for detecting DENV3 NS5, an agent specific for detecting DENV4 capsid, and an agent specific for detecting ZIKV NS5.
[0258] In some examples, the kit comprises an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 1; an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 2; an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 3; an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 4; an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 5; and an agent for detecting a region or fragment thereof having 80% sequence identity to SEQ ID NO: 6.
[0259] In some examples, the agent may comprise primers and probes comprising:
[0260] a ZIKV forward primer comprising a sequence at least 90% identical to CCTTGGATTCTTGAACGAGGATCAC (SEQ ID NO: 7);
[0261] a ZIKV reverse primer comprising a sequence at least 90% identical to GCTTCATTCTCCAGATCAAACCTGC (SEQ ID NO: 9) or GCTTCATTCTCTAGATCAAACCTGC (SEQ ID NO: 32);
[0262] a ZIKV probe comprising a sequence at least 90% identical to TACCAGGAGGAAGGATGTATGCAG (SEQ ID NO: 8) or ACCAGGAGGAAAGATGTACGCAG (SEQ ID NO: 33);
[0263] a DENV1 first forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACAGAAG (SEQ ID NO: 10);
[0264] a DENV1 second forward primer comprising a sequence at least 90% identical to GGCTGAAGAAAGTCACTGAAG (SEQ ID NO: 11);
[0265] a DENV1 reverse primer comprising a sequence at least 90% identical to GAGGACTCACCAATATCACACAA (SEQ ID NO: 13);
[0266] a DENV1 probe comprising a sequence at least 90% identical to ACCTATGGATGGAACCTAGTAAAGCT (SEQ ID NO: 12);
[0267] a DENV3 forward primer comprising a sequence at least 90% identical to GCTCAGCCTCCTCCATGATAAATG (SEQ ID NO: 14);
[0268] a DENV3 reverse primer comprising a sequence at least 90% identical to GGGTGTCCTGGTGTCCACTTTCTC (SEQ ID NO: 17);
[0269] a DENV3 first probe comprising a sequence at least 90% identical to CATGGTGACACAGATGGCAATGAC (SEQ ID NO: 15);
[0270] a DENV3 second probe comprising a sequence at least 90% identical to CACGGTGACACAGATGGCAATGAC (SEQ ID NO: 16);
[0271] a CHIKV forward primer comprising a sequence at least 90% identical to GGCGCCTACTGCTTCTGCGAC (SEQ ID NO: 18);
[0272] a CHIKV reverse primer comprising a sequence at least 90% identical to TTGGTAAAGGACGCGGAGCTTAGC (SEQ ID NO: 21);
[0273] a CHIKV first probe comprising a sequence at least 90% identical to AGCGAAGCACATGTGGAGAAGTCC (SEQ ID NO: 19);
[0274] a CHIKV second probe comprising a sequence at least 90% identical to AGCGAAGCACACGTGGAGAAGTCC (SEQ ID NO: 20);
[0275] a DENV2 forward primer comprising a sequence at least 90% identical to ACACAGATGGCAATGACAGACACG (SEQ ID NO: 22);
[0276] a DENV2 reverse primer comprising a sequence at least 90% identical to CCAAGGCTGCATTGCTTCTCAC (SEQ ID NO: 24);
[0277] a DENV2 probe comprising a sequence at least 90% identical to TGGAAAGAACTAGGAAAGAAAAAGACAC (SEQ ID NO: 23);
[0278] a DENV4 first forward primer comprising a sequence at least 90% identical to TGGTTAGACCACCTTTCAATATG (SEQ ID NO: 25);
[0279] a DENV4 second forward primer comprising a sequence at least 90% identical to TGGCTAGACCACCTTTCAATATG (SEQ ID NO: 26);
[0280] a DENV4 reverse primer comprising a sequence at least 90% identical to TGCTAGCACCATCCGTAA (SEQ ID NO: 28); and
[0281] a DENV4 probe comprising a sequence at least 90% identical to CCTCAAGGGTTGGTGAAGAGATTC (SEQ ID NO: 27).
[0282] In some examples, the primers and/or probe may comprise a sequence at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or are identical to SEQ ID NO:
[0283] 7 to SEQ ID NO: 28. In some examples, the primers and/or probe may comprise a sequence having 10 or less nucleic acid difference, or 9 or less nucleic acid difference, or 8 or less nucleic acid difference, or 7 or less nucleic acid difference, or 6 or less nucleic acid difference, or 5 or less nucleic acid difference, or 4 or less nucleic acid difference, or 3 or less nucleic acid difference, or 2 or less nucleic acid difference or one or two nucleic acid difference from SEQ ID NO: 7 to SEQ ID NO: 28.
[0284] In some examples, the methods or kits as disclosed herein may be provided such that the reagents, primers and/or probes, or oligonucleotides are provided in two or more set. For example, as exemplified in the Experimental section, the method as disclosed herein may be performed as two-tube reactions (that could be run concurrently in the same RT-PCR run) where a first tube determines the presence of ZIKV, DENV1, DENV3 and a second tube determines the presence of CH IKV, DENV2 and DENV4. It would be understood that other permutations of the two-tube reactions would also be within the scope of the present disclosure.
[0285] Further, in the description herein, the word “substantially” whenever used is understood to include, but not restricted to, “entirely” or “completely” and the like. In addition, terms such as “comprising”, “comprise”, and the like whenever used, are intended to be non-restricting descriptive language in that they broadly include elements/components recited after such terms, in addition to other components not explicitly recited. For an example, when “comprising” is used, reference to a “one” feature is also intended to be a reference to “at least one” of that feature. Terms such as “consisting”, “consist”, and the like, may, in the appropriate context, be considered as a subset of terms such as “comprising”, “comprise”, and the like. Therefore, in embodiments disclosed herein using the terms such as “comprising”, “comprise”, and the like, it will be appreciated that these embodiments provide teaching for corresponding embodiments using terms such as “consisting”, “consist”, and the like. Further, terms such as “about”, “approximately” and the like whenever used, typically means a reasonable variation, for example a variation of +/−5% of the disclosed value, or a variance of 4% of the disclosed value, or a variance of 3% of the disclosed value, a variance of 2% of the disclosed value or a variance of 1% of the disclosed value.
[0286] Furthermore, in the description herein, certain values may be disclosed in a range. The values showing the end points of a range are intended to illustrate a preferred range. Whenever a range has been described, it is intended that the range covers and teaches all possible sub-ranges as well as individual numerical values within that range. That is, the end points of a range should not be interpreted as inflexible limitations. For example, a description of a range of 1% to 5% is intended to have specifically disclosed sub-ranges 1% to 2%, 1% to 3%, 1% to 4%, 2% to 3% etc., as well as individually, values within that range such as 1%, 2%, 3%, 4% and 5%. The intention of the above specific disclosure is applicable to any depth/breadth of a range.
[0287] The example embodiments may also be practiced with other computer system configurations, including handheld devices, multiprocessor systems/servers, microprocessor-based or programmable consumer electronics, network PCs, minicomputers, mainframe computers, personal digital assistants, mobile telephones and the like. Furthermore, the example embodiments may also be practiced in distributed computing environments where tasks are performed by remote processing devices that are linked through a wireless or wired communications network. In a distributed computing environment, program modules may be located in both local and remote memory storage devices.
[0288] It will be appreciated by a person skilled in the art that other variations and/or modifications may be made to the specific embodiments without departing from the scope of the invention as broadly described. For example, in the description herein, features of different exemplary embodiments may be mixed, combined, interchanged, incorporated, adopted, modified, included etc. or the like across different exemplary embodiments. The present embodiments are, therefore, to be considered in all respects to be illustrative and not restrictive.
Experimental Section
Assay Design
[0289] Six sets of primers and probes to target unique regions of the 6 viruses were designed. The 6 primers and probe sets are constituted into 2 multiplex mixes, each with the ability to detect 3 viruses with the inclusion of an internal control (IC). The assay consists of a 2-tube reaction with specific oligonucleotide primers and dual labeled 5′-fluorescent (Taqman) probes for in-vitro, multiplex detection of ZIKV, DENV1, DENV3 and IC or/and CHIKV, DENV2, DENV4 and IC respectively. The IC used in the assay targets β-actin, a constitutively present protein. Multiplexing is facilitated by the targeting of each virus/IC with a different probe, i.e. each Taqman probe targets a single virus/IC and is conjugated to a fluorophore that emits fluorescence at different excitation wavelengths. The following is information on each of the targets in the multiplex assay:
1. Chikungunya Virus (CHIKV);
[0290] Family: Togaviridae
[0291] Genus: Alphavirus
[0292] Target region: E1 glycoprotein
[0293] ssRNA-positive strand, causal agent of Chikungunya Fever
2-5. Dengue Virus Serotype 1 to 4 (DENV1-4);
[0294] Family: Flaviviridae
[0295] Genus: Flavivirus
[0296] Target region: Non Structural protein 5 (NS5) (DENV1-3), Capsid (C) (DENV4)
[0297] ssRNA-positive strand, causal agent of Dengue Fever
6. Zika Virus (ZIKV); and
[0298] Family: Flaviviridae
[0299] Genus: Flavivirus
[0300] Target region: Non Structural protein 5 (NS5)
[0301] ssRNA-positive strand, causal agent of Zika Fever
7. Internal Control (IC).
[0302] Target region: β-actin
[0303] Internal control target region adapted from Mocellin et al., IL-10 stimulatory effects on human NK cells explored by gene profile analysis, Genes & Immunity 5, 621-630 (2004)
Specimens Used
For CHIKV, DENV, and ZIKV Testing:
[0304] Whole blood (treated with Ethylenediaminetetraacetic acid/EDTA); [0305] Serum (collected in a serum separator tube, tube centrifuged prior to shipping to avoid hemolysis (where applicable)); and [0306] Cerebrospinal fluid.
For ZIKV Testing:
[0307] Urine; and [0308] Amniotic fluid.
Materials and Methods
Reagents
[0309] For purification of viral RNA from plasma, serum or whole blood samples: [0310] Qiagen QlAamp Viral RNA Kit (50 or 250) (Cat. No. 52904 or 52906) or equivalent;
For RT-PCR Reaction:
[0311] ThermoFisher SuperScript® Ill Platinum 6 One-Step Quantitative RT-PCR System (Cat. No. 11732088) or equivalent
Multiplex Assay Workflow
[0312] The six primers and probe sets are constituted into two multiplex mixes, each with the ability to detect three targets with the inclusion of an internal control (IC). The assay consists of a two-tube reaction with specific oligonucleotide primers and dual labelled 5′-fluorescent (Taqman®) probes for in vitro, multiplex detection of ZIKV, DENV1, DENV3 and IC or/and CHIKV, DENV2, DENV4 and IC, respectively. The internal control (IC) used in the assay targets β-actin, a constitutively present protein.
[0313] Multiplexing is facilitated by the targeting of each virus/IC with a different colored probe, i.e. each Taqman® probe targets a single virus/IC and is conjugated to a fluorophore that emits fluorescence at different excitation wavelengths. Integrated DNA Technology (IDT) has developed internal Zen™ and TAO™ quenchers. They are used in addition to the 3′quencher Iowa Black FQ (IBFQ) or 3′ IBRQ quencher, resulting in double-quenched probes, e.g. 5′-FAM/ZEN/3′IBFQ or 5′-Cy5/TAO/3′IBRQ, in the assay. These double-quenched probes generate less background and have an increased signal compared to probes containing a single quencher. Each probe's fluorophore is selected with the least amount of spectral overlap.
The 2-tube reaction consist of the following reagents:
Tube 1:
[0314] 1. ZIKV primers+5′-FAM ZIKV/ZEN/3′IBFQ
[0315] 2. DENV1 primers+5′-HEX DENV1/ZEN/3′IBFQ
[0316] 3. DENV3 primers+5′Texas Red DENV3/3′ IBRQ
[0317] 4. IC primers+5′-Cy5 IC/TAO/3′IBRQ
Tube 2:
[0318] 1. CHIKV primers+5′-FAM CHIKV/ZEN/3′IBFQ
[0319] 2. DENV2 primers+5′-HEX DENV2/ZEN/3′IBFQ
[0320] 3. DENV4 primers+5′-Texas Red DENV4/3′ IBRQ
[0321] 4. IC primers+5′-Cy5 IC/TAO/3′IBRQ
TABLE-US-00006 Probe Mix 1 Mix 2 fluorophore ZIKV CHIKV FAM DENV1 DENV2 Hex DENV3 DENV4 TxR IC IC Cy5
The 2-tube reaction consists of the following primers and probes:
TABLE-US-00007 SIgN Mix 1 Reaction No. Components. Name. 1 ZIKV Primers (F + R) Mix 1 F + R* DENV-1 Primers (F + R) DENV-3 Primers (F + R) 2 IC Primers (F + R) IC F + R 3 ZIKV Probe ZIKV FAM 4 DENV-1 Probe DENV-1 Hex 5 DENV-3 Probe DENV-3 TxR 6 IC Probe IC Cy5 *F: forward primer; R: reverse primer
TABLE-US-00008 Mix 1 F + R* Primer Stock Concentration Components (μM) in Mix (μM) 100 μL mix ZIKV-F 100 10 10.0 ZIKV-P 100 10 10.0 DENV1-F_A 100 10 10.0 DENV1-F_T 100 10 10.0 DENV1-R 100 10 10.0 DENV3-F 100 4 4.00 DENV3-R 100 4 4.00 Water — — 42.0
TABLE-US-00009 No. SIgN Mix 2 Reaction Components. Name. 1 CHIKV Primers (F + R) Mix 2 F + R.sup.# DENV-2 Primers (F + R) DENV-4 Primers (F + R) 2 IC Primers (F + R) IC F + R 3 CHIKV Probe CHIKV FAM 4 DENV-2 Probe DENV-2 Hex 5 DENV-4 Probe DENV-4 TxR 6 IC Probe IC Cy5
TABLE-US-00010 Mix 2 F + R.sup.# Primer Stock Concentration Components (μM) in Mix (μM) 100 μL mix CHIKV-F 100 10 10 CHIKV-R 100 10 10 DENV2-F 100 10 10 DENV2-R 100 10 10 DENV4-F_T 100 10 4 DENV4-F_C 100 4 4 DENV4-R 100 4 4 Water 48 Prepare the qRT-PCR reaction mix.sup.+ as follows:
Mix 1 Reaction Set-Up
[0322]
TABLE-US-00011 Components Volume (μL) SSIII 12.5 mastermix Mix1 F + R 1.25 IC F + R 0.50 ZIKV Probe 0.50 DENV-1 Probe 0.50 DENV-3 Probe 0.25 IC Probe 0.375 MgSO4 0.50 RT enzyme mix 0.50 RNA template 5.00 Nuclease free 3.125 H.sub.2O
Mix 2 Reaction Set-Up
[0323]
TABLE-US-00012 Components Volume (μL) SSIII 12.5 mastermix Mix 2 F + R 1.25 IC F + R 0.50 CHIKV Probe 0.50 DENV-2 Probe 0.50 DENV-4 Probe 0.25 IC Probe 0.375 MgSO4 0.50 RT enzyme mix 0.50 RNA template 5.00 Nuclease free 3.125 H.sub.2O .sup.+Note: 1 μL of vircell RNA and 5 μL of elute from the extraction of HC (healthy donor whole blood) were used for LoD runs. Nuclease free H.sub.2O was adjusted to 2.125 μL.
Sequences of primers and probes used are as follows:
TABLE-US-00013 the ZIKV forward primer comprising (SEQ ID NO: 7) CCTTGGATTCTTGAACGAGGATCAC; the ZIKV reverse primer comprising (SEQ ID NO: 9) GCTTCATTCTCCAGATCAAACCTGC or (SEQ ID NO: 32) GCTTCATTCTCTAGATCAAACCTGC; the ZIKV probe comprising (SEQ ID NO: 8) TACCAGGAGGAAGGATGTATGCAG or (SEQ ID NO: 33) ACCAGGAGGAAAGATGTACGCAG; the DENV1 first forward primer comprising (SEQ ID NO: 10) GGCTGAAGAAAGTCACAGAAG; the DENV1 second forward primer comprising (SEQ ID NO: 11) GGCTGAAGAAAGTCACTGAAG; the DENV1 reverse primer comprising (SEQ ID NO: 13) GAGGACTCACCAATATCACACAA; the DENV1 probe comprising (SEQ ID NO: 12) ACCTATGGATGGAACCTAGTAAAGCT; the DENV3 forward primer comprising (SEQ ID NO: 14) GCTCAGCCTCCTCCATGATAAATG; the DENV3 reverse primer comprising (SEQ ID NO: 17) GGGTGTCCTGGTGTCCACTTTCTC; the DENV3 first probe comprising (SEQ ID NO: 15) CATGGTGACACAGATGGCAATGAC; the DENV3 second probe comprising (SEQ ID NO: 16) CACGGTGACACAGATGGCAATGAC; the CHIKV forward primer comprising (SEQ ID NO: 18) GGCGCCTACTGCTTCTGCGAC; the CHIKV reverse primer comprising (SEQ ID NO: 21) TTGGTAAAGGACGCGGAGCTTAGC; the CHIKV first probe comprising (SEQ ID NO: 19) AGCGAAGCACATGTGGAGAAGTCC; the CHIKV second probe comprising (SEQ ID NO: 20) AGCGAAGCACACGTGGAGAAGTCC; the DENV2 forward primer comprising (SEQ ID NO: 22) ACACAGATGGCAATGACAGACACG; the DENV2 reverse primer comprising (SEQ ID NO: 24) CCAAGGCTGCATTGCTTCTCAC; the DENV2 probe comprising (SEQ ID NO: 23) TGGAAAGAACTAGGAAAGAAAAAGACAC; the DENV4 first forward primer comprising (SEQ ID NO: 25) TGGTTAGACCACCTTTCAATATG; the DENV4 second forward primer comprising (SEQ ID NO: 26) TGGCTAGACCACCTTTCAATATG; the DENV4 reverse primer comprising (SEQ ID NO: 28) TGCTAGCACCATCCGTAA; and the DENV4 probe comprising (SEQ ID NO: 27) CCTCAAGGGTTGGTGAAGAGATTC.
[0324] The targeted region of the viruses' or IC's RNA are transcribed into complimentary DNA (cDNA) and amplified by their respective primers in the polymerase chain reaction (PCR) respectively. The fluorophore-labelled probes then anneal to amplified DNA fragments and the fluorescent signal intensity is monitored by the amplification instrument during each PCR cycle. Target amplification is recorded as an increase and accumulation of fluorescence over time in contrast to background signal.
Thermal cycler conditions for SIgN assay are as follows:
Stage 1: 50° C. for 20 minutes
Stage 2: 95° C. for 2 minutes
Stage 3: 95° C. for 45 seconds [0325] 60° C. for 1 minute 15 seconds (acquire)
Stage 3 performed for 45 cycles.
Assay Controls
[0326] Virus stocks are eluted from the extraction of respective virus stocks as follows:
TABLE-US-00014 Viruses Strain/Isolate Details Chikungunya virus IMT 2006 https://doi.org/10.3201/ eid1210.060596 Dengue 1 virus DEN1-16-2582 MF314188 Dengue 2 virus DEN2-16-2447 MF314189 Dengue 3 virus 05K4648DK1 EU081225 Dengue 4 virus 8976/95 AY762085 Zika virus H/PF/2013 https://doi.org/10-1128/ genomeA.00500-14 Note: Quantified virus stocks were serial diluted. 1E5 to 1E1 copies (1 μL) were used.
Commercially available RNA controls were purchased. Traceable and standardised positive material (respective) for all six pathogen and other 3 flaviviruses are as follows:
TABLE-US-00015 Vircell RNA Stock controls Cat # (copies/mL) NCBI Strain/Isolate Year Dengue 1 MBC055 16.5 KM204119 Hawaii 1944 virus Dengue 2 MBC056 15.5 KM204118 New Guinea 1944 virus DEN2-16- C 2447 From NPHL Dengue 3 MBC057 17.5 KU050695 Philippines 1956 virus H87 Dengue 4 MBC058 12.5 KR011349 Philippines 1956 virus H241 Chikungunya MBC099 15.5 NC_004162.2 S27-African 1953 virus Zika virus MBC072 13.0 KX377335.1 MR-766 1947 Zika virus MBC103 16.0 KU501215 PRVABC59 2015 (Asian) St. Louis MBC101 15.0 NA NA NA Encephalitis Virus West Nile MBC069 13.0 HQ596519.1 New York 99 1999 Virus Yellow Fever MBC100 17.0 FJ654700.1 17D-Tiantan NA Virus [0327] Healthy control (HC): whole blood from healthy donor as an extraction control and positive control for the IC Primer and probe set (IC). [0328] HC should generate negative results with DENV, CHIKV, and ZIKV primer and probe sets, but positive results for IC; [0329] In LoD tests, HC was added in addition to respective vircell RNA controls (Refer to LoD in results). [0330] No Template Control (NTC) [0331] NTC reactions include PCR-grade water in place of specimen; [0332] The NTC is a control for contamination or improper function of assay reagents resulting in false positive results.
Human Specimens
[0333]
TABLE-US-00016 Human specimens Cohort/Year Published study (if applicable) CHIKV, SG 2008 cohort https://doi.org/10.1093/infdis/jiq042 n = 10 ZIKV, SG 2016 cohort https://doi.org/10.1093/infdis/jix276 n = 10 DENV1 Compiled from https://doi.org/10.1093/infdis/jix276 to 4, different sources https://doi.org/10.1093/infdis/jiw494 n = 4 each https://doi.org/10.1371/journal.pntd.000 3043 Unpublished data HC, n = 26 extracted 2017 https://doi.org/10.1093/infdis/jix276 HC, n = 5 extracted 2012 https://doi.org/10.1371/journal.pntd.000 304
[0334] Comparator tests for these samples have been described in the respective publications. Additional tests that were conducted on these samples during time of collection were also described. (Please refer to respective publications for more details).
CDC Single-Plex Assays Workflow
[0335] The performance of SIgN-DxD primers and probes under single-plex conditions were compared to the following CDC assays (reference tests) to access their performances.
[0336] Protocols were adapted from the following publications:
CHIKV: Pastorino, B. et al., Development of a TaqMan® RT-PCR assay without RNA extraction step for the detection and quantification of African Chikungunya viruses; J. Virological Methods; Vol. 124, issues 1-2, March 2006, pages 65-71;
DENV: Pastorino, B. et al., Development of a TaqMan® RT-PCR assay without RNA extraction step for the detection and quantification of African Chikungunya viruses; J. Virological Methods; Vol. 124, issues 1-2, March 2006, pages 65-71; and
ZIKV: Lanciotti et al., Genetic and Serologic Properties of Zika Virus Associated with an Epidemic, Yap State, Micronesia, 2007; EID Journal, Vol, 14, No. 8, August, 2008.
CDC Single-Plex Reaction Set Up
[0337]
TABLE-US-00017 Reaction Volume for 1x components Stock (μl) SSH1 mastermix 2x 12.5 Forward + 10 μM 1.00 Reverse primers Probe 10 μM 0.50 RT enzyme mix 0.50 RNA template 5.00 Nuclease free 5.50 H.sub.2O
Thermal cycler conditions for single-plex assay are as follows:
Stage 1: 50° C. for 20 minutes
Stage 2: 95° C. for 2 minutes
Stage 3: 95° C. for 15 seconds [0338] 60° C. for 1 minute (acquire)
Stage 3 performed for 45 cycles.
Data Interpretation
[0339] The threshold is normally set by the software manager using auto settings. Each amplification curve (if any) and corresponding threshold in every channel was inspected manually for confirmation. In some instances, the threshold for each channel was set at a specific value. Values shown below were set based on the background signals observed from the LoD and cross reactivity runs: [0340] FAM channel: 90 [0341] Hex channel: 36 [0342] TxR channel: 25 [0343] Cy5 channel: 50
[0344] The IC for each specimen should always be positive. If both the IC for a specimen sample the other samples in the 2-tube assay are negative, the following steps were taken: [0345] Repeat RT-PCR test of specimen. [0346] Repeat extraction from new specimen aliquot.
[0347] If the IC for a specimen sample is negative, but DENV, CHIKV, and/or ZIKV is positive for specimen samples:
[0348] RT-PCR test was not repeated and consider the results of the multiplex assay valid.
[0349]
[0350] True positives should produce exponential curves with logarithmic, linear, and plateau phases. (Note: Weak positives will produce high CT values that are sometimes devoid of a plateau phase; however, the exponential plot will be seen.)
[0351] For a sample to be a true positive, the curve must cross the threshold in a similar fashion as shown in
[0352] Examples of false positive curves can be found in
[0353] In certain situations, a low ct value (eg. ct of 29.2 in
[0354] A note on weak positive samples: Weak positives were interpreted with caution. If curves are true exponential curves, the reaction should be interpreted as positive.
[0355] If repeat testing of a weak specimen was necessary, repeat the sample in replicates as a single repeat test run has a high likelihood of generating a discrepant result. The repeat testing should be conducted in single-plex using only primer/probe set(s) giving the weak positive signal. If it is possible to repeat the extraction of RNA from the biological specimen, eluting in a lower volume to concentrate the sample is recommended.
Results and Discussion
Performance of SIgN-DxD Primers and Probes Under Single-Plex Conditions
[0356] The sensitivity and specificity of SIgN-DxD primers and probes under single-plex conditions were determined in comparison to the CDC reference-PCR. For CHIKV and all four serotypes of DENV, the PCR efficiencies of the SIgN-DXD PCR (see
TABLE-US-00018 TABLE 1.1 Summary of PCR efficiency in single-plex conditions Target SIgN CDC CHIKV 100% 67.13% DENV 1 92.35% 89.81% DENV 2 98.44 83.95% DENV 3 100% 99.5% DENV 4 100% 62.63% ZIKV 86.86% 93.99%
TABLE-US-00019 TABLE 1.2 Comparison of SIgN-DxD CHIKV PCR with CDC CHIKV PCR SIgN-DxD CHIKV Single-plex Set (1) CDC CHIKV Single-plex Copy No Ct Copy No Ct 1E5 24.83 1E5 24.90 1E4 27.96 1E4 28.52 1E3 30.97 1E3 32.45 1E2 34.02 1E2 39.56 1E1 35.69 1E1 ND PCR Efficiency 100% PCR Efficiency 67.13%
TABLE-US-00020 TABLE 1.3 Comparison of SIgN-DxD DENV1 PCR with CDC DENV1 PCR SIgN-DxD DENV1 Single-plex (Set 1) CDC DENV1 Single-plex 1E5 22.29 1E5 20.83 1E3 29.53 1E3 27.68 1E1 36.37 1E1 35.20 PCR Efficiency 92.35% PCR Efficiency 89.81%
TABLE-US-00021 TABLE 1.4 Comparison of SIgN-DxD DENV2 PCR with CDC DENV2 PCR SlgN-DxD DENV2 Single-plex Set (2) CDC DENV2 Single-plex Copy No Ct Copy No Ct 1E5 15.7 1E5 16.64 1E4 19.17 1E4 20.38 1E3 22.57 1E3 24.26 1E2 25.85 1E2 27.78 1E1 29.15 1E1 31.83 PCR Efficiency 98.44% PCR Efficiency 83.95%
TABLE-US-00022 TABLE 1.5 Comparison of SlgN-DxD DENV3 PCR with CDC DENV3 PCR SlgN-DxD DENV3 Single-plex Set (2) CDC DENV3 Single-plex Copy No Ct Copy No Ct 1E5 23.84 1E5 22.81 1E4 28.25 1E4 27.29 1E3 31.72 1E3 30.85 1E2 34.41 1E2 33.16 1E1 37.25 1E1 36.55 PCR Efficiency 100% PCR Efficiency 99.5%
TABLE-US-00023 TABLE 1.6 Comparison of SlgN-DxD DENV4 PCR with CDC DENV4 PCR SlgN-DxD DENV4 Single-plex Set (3) CDC DENV4 Single-plex Copy No Ct Copy No Ct 1E5 24.95 1E5 — 1E4 28.27 1E4 26.54 1E3 31.45 1E3 — 1E2 34.45 1E2 33.81 1E1 37.12 1E1 43.02 PCR Efficiency 100% PCR Efficiency 62.23%
TABLE-US-00024 TABLE 1.7 Comparison of SIgN-DxD ZIKV PCR with CDC ZIKV PCR SIgN-DxD ZIKV Single-plex (Set 1) CDC ZIKV Single-plex Copy No Ct1 Ct2 Copy No Ct1 Ct2 1.00E+05 24.52 25.06 1.00E+05 23.92 24.33 1.00E+04 28.3 29.27 1.00E+04 27.74 27.02 1.00E+03 32.05 32.82 1.00E+03 30.93 31.26 1.00E+02 35.21 36.34 1.00E+02 34.23 34.54 1.00E+01 39.62 39.8 1.00E+01 38.97 37.03 PCR Efficiency 88.86% PCR Efficiency 93.99%
Limit of Detection (LoD)
[0357] The LoD of each target in the multiplex PCR is an important measure for the lowest detectable RNA copy number for each pathogen. By definition, the LoD of the multiplex PCR is determined as the lowest copy number which, in terms of RNA copy, when added to the assay, leads to a positive pathogen identification outcome more than 95% of the time. In the analysis below, the lower limit of 95% detection (95% LLOD) was calculated using probit analysis by extrapolating the probit graph at the 0.95 (y-axis) as represented by the blue arrow in the graphs below. The two red dotted lines that flank the probit graph represent the 95% confidence interval at 95% LLOD.
SIgN-DxD Multiplex Mix1 ZIKV
[0358]
TABLE-US-00025 TABLE 2.1 ZIKV copies and corresponding detectable Ct Copies Replicates No. with detectable Ct 1 10 0 7 10 3 20 10 9 50 10 10 100 10 10 250 10 10 500 10 10 1000 10 10
SIgN-DxD Multiplex Mix1 DENV1
[0359]
TABLE-US-00026 TABLE 2.2 DENV1 copies and corresponding detectable Ct Copies Replicates No. with detectable Ct 1 10 0 7 10 3 20 10 10 50 10 10 100 10 10 250 10 10 500 10 10 1000 10 10
SIgN-DxD Multiplex Mix1 DENV3
[0360]
TABLE-US-00027 TABLE 2.3 DENV2 copies and corresponding detectable Ct Copies Replicates No. with detectable Ct 1 10 1 7 10 2 20 10 6 50 10 10 100 10 10 250 10 10 500 10 10 1000 10 10
SIgN-DxD Multiplex Mix2 CHIKV
[0361]
TABLE-US-00028 TABLE 2.4 CHIKV copies and corresponding detectable Ct Copies Replicates No. with detectable Ct 1 10 8 7 10 9 20 10 10 50 10 10 100 10 10 250 10 10 500 10 10 1000 10 10
SIgN-DxD Multiplex Mix2 DENV2
[0362]
TABLE-US-00029 TABLE 2.5 DENV2 copies and corresponding detectable Ct Copies Replicates No. with detectable Ct 1 10 0 7 10 3 20 10 8 50 10 10 100 10 10 250 10 10 500 10 10 1000 10 10
SIgN-DxD Multiplex Mix2 DENV4
[0363]
TABLE-US-00030 TABLE 2.6 DENV4 copies and corresponding detectable Ct Copies Replicates No. with detectable Ct 1 10 1 7 10 7 20 10 9 50 10 10 100 10 10 250 10 10 500 10 10 1000 10 10
TABLE-US-00031 TABLE 2.7 Summary of LoDs for each of the virus targets Virus 95% LLOD 95% Confidence Interval Dengue 1 virus 9.87 NA NA Dengue 2 virus 31.8 19.5 156.7 Dengue 3 virus 71.5 37.2 285.6 Dengue 4 virus 24.4 12.4 108.1 Chikungunya 6.83 1.4 9.18E+09 virus Zika virus (Asian 24.1 15.5 139.4 Lineage)
Cross-Reactivity
[0364] Evaluation of the cross-reactivity of each component of the multiplex assay with the viruses targeted by the other components was performed. Three additional flaviviruses (WNV, YFV and SLEV) were selected to evaluate the specificity of the DENV, ZIKV and CHIKV primer and probe sets. The graphs below show the amplification curve (if any) in all channels for each virus tested.
[0365] As seen in
TABLE-US-00032 TABLE 3 Near-neighbour Cross Reactivity Summary Mix 1 Mix2 RNA ZIKV DENV1 DENV3 CHIKV DENV2 DENV4 DENV1 X ✓ X X X X DENV2 X X X X ✓ X DENV3 X X ✓ X X X DENV4 X X X X X ✓ ZIKV ✓ X X X X X CHIKV X X X ✓ X X SLEV X X X X X X WNV X X X X X X YFV X X X X X X No cross-reactivity was observed. All controls performed as expected.
Assay Validation on Human Specimens
[0366] In order to assess the clinical performance of the assay, the multiplex PCR was evaluated on clinical specimens to compare its diagnostic capability with reference methods. In the last set of experiments, the multiplex PCR assay was performed with RNA extracted from a few cohorts of patient samples as listed below:
Plates Ran:
Plate 1 (Date: 27-12-04 10-35-18) Human 1:
[0367] CHIKV, n=10
ZIKV, n=10
Healthy controls, n=6 (RNA extracted in 2017), n=5 (RNA extracted in 2012)
Plate 2 (Date: 2017-11-21 11-36-37) Cross2:
[0368] Healthy controls, n=20 (RNA extracted in 2017)
(Rows A, C, E 1 to 12): HC1-14 ran in replicate of 3 in Mix1
(Rows B, D, F 1 to 12): HC1-14 ran in replicate of 3 in Mix2
(Rows G7-12): HC15-20 Mix1
(Rows H7-12): HC15-20 Mix2
Plate 3 (Date: 2017-12-04 10-35-18) Human2:
[0369] DENV1 to 4, n=4 (each)
ZIKV Samples
[0370] 9 out of 10 ZIKV samples tested positive for ZIKV. The one sample that did not come up positive for ZIV in assay was also negative in a comparator's test. The assay is able to detect samples with low ZIKV viral load (
DENV1 Samples
[0371] All 4 samples tested positive for DENV1 (
DENV3 Samples
[0372] All 4 samples tested positive for DENV3 (
CHIKV Samples
[0373] All 10 samples tested positive for CHIKV. As seen from
DENV2 Samples
[0374] All 4 samples tested positive for DENV2 (
DENV4 Samples
[0375] All 4 samples tested positive for DENV4 (
[0376] In the present disclosure, one example of an optimised multiplex real-time TaqMan-based RT-PCR assay capable of differentially detect six different targets (CHIKV, 4 serotypes of DENV (i.e. DENV1, DENV2, DENV3 and DENV4), and ZIKV) in the whole blood of patients was developed.
[0377] Based on the LoD values and the validation experiments with patient samples, the multiplex assay described herein has been shown to be a sensitive and specific assay that is able to successfully differentiate the detection of the six viral targets.
[0378] Table 4 below shows the optimised multiplex real-time TaqMan-based RT-PCR for six different targets—CHIKV, 4 serotypes of DENV (DENV1, DENV2, DENV3 and DENV4) and ZIKV, with a clear result interpretation and reporting algorithm.
TABLE-US-00033 TABLE 4 Multiplex Assay Interpretation and Reporting Algorithm Mix 1 Mix 2 IC Data Analysis and conclusion ZIKV DENV1 DENV3 CHIKV DENV2 DENV4 β-actin Interpretation Reporting Actions — — — — — — — Inconclusive Specimen Repeat inconclusive extraction for presence and of Zika, RT-PCR dengue, and chikungunya — — — — — — + Negative No Zika, No dengue, or further chikungunya testing RNA detected required by RT-PCR + — — — — — +/− Positive for Zika RNA ZIKV ZIKV, but detected single-plex negative for by RT-PCR. can be run CHIKV and for DENV. confirmation (2.sub.nd tier testing) — + — — — — +/− Positive for Dengue 1 DENV1 DENV1, but RNA detected single-plex negative by RT-PCR. can be run for ZIKV, for DENV2, confirmation DENV3, (2.sub.nd tier DENV4 testing) and CHIKV. — — + — — — +/− Positive for Dengue 3 DENV3 DENV3, but RNA single-plex negative detected can be run for ZIKV, by RT-PCR. for DENV1, confirmation DENV2, (2nd tier DENV4 testing) and CHIKV. — — — + — — +/− Positive for Chikungunya CHIKV CHIKV, but RNA single-plex negative detected can be run for ZIKV by RT-PCR. for and DENV. confirmation (2nd tier testing) — — — — + — +/− Positive for Dengue 2 DENV2 DENV2, but RNA single-plex negative detected can be run for ZIKV, by RT-PCR. for DENV1, confirmation DENV3, (2nd tier DENV4 and testing) CHIKV. — — — — — + +/− Positive for Dengue 4 DENV4 DENV4, but RNA single-plex negative detected can be run for ZIKV, by RT-PCR. for DENV1, confirmation DENV2, (2nd tier DENV3 testing) and CHIKV.
TABLE-US-00034 TABLE 5 Chikungunya strains used for E1 glycoprotein consensus sequence Collection Accession Name Size Year Date Country EF027136 IND-06-MH2 11,800 2006 2005-2006 India EF452493 AF15561 12,036 2007 2007 Thailand EF452494 TSI-GSD-218-VR1 12,036 2007 2007 USA EU244823 ITA07-RA1 11,788 2007 2007 Italy EU703759 MY002IMR/06/BP 12,028 2006 2006 Malaysia FJ445426 isolate LKEHCH13908 11,717 2008 Apr. 2008 Sri Lanka FJ445430 isolate SGEHICHD93508 11,722 2008 Jul. 2008 Singapore FJ445433 isolate SGEHICHS422808 11,729 2008 Aug. 2008 Singapore FJ513629 isolate LK(PB)CH1608 11,716 2008 Mar. 2008 Sri Lanka FJ807896 0611aTw 11,811 2006 2006 Singapore FJ807898 0810aTw 11811 2008 2008 Bangladesh FJ807899 0810bTw 11811 2008 2008 Malaysia FJ959103 BNI-CHIKV 899 11,832 2006 2006 Mauritius FR717336 complete genome, isolate 11,559 2005 Dec. 26, 2005 France IMTSSA6424S GU301779 isolate CU-Chik009 11,811 2009 Sep. 04, 2009 Thailand HM045804 IPD/A SH 2807 11,847 2010 2010 Senegal HM045817 HD 180760 11,832 2005 Nov. 2005 Senegal HQ456251 Com25 11,836 2004- 2004-2005 Indian ocean 2005 HQ456252 strain COMJ 11,836 2004- 2004-2005 Indian ocean 2005 HQ456255 Lamu33 11,836 2004- 2004-2005 Indian ocean 2005 JX088705 GD05/2010 11,811 2010 2010 China KC614648 isolate Yem-11, complete 11,778 2011 Jan. 25, 2011 Yemen sequence KC862329 isolate NL10/152 11,836 2010 2010 Indonesia KF318729 isolate chik-sy 12,017 2012 Jul. 06, 2012 China KF590564 10Mdy7 11,695 2010 2010 Myanmar KJ679577 isolate CHIKV STMWG01 11,567 2011 Sep. 12, 2011 India KJ689452 Yap 13-2039 12,042 2013 Nov. 2013 Micronesia KJ796844 RGCB730/09 11,764 2009 Aug. 04, 2009 India KM673291 isolate DH130003 11,979 2013 Jan. 2013 Indonesia KM923917 M125 11,837 2007 Mar. 09, 2007 Malaysia KP003808 MADOPY1 11,562 2006 2006 Madagascar KP003809 OPY4 11,791 2006 2006 Mayotte KP003812 GABOPY1 11,561 2007 2007 Gabon KP003813 BRAZZA_MRS1 11,726 2011 2011 Republic of the Congo KP164567 isolate AMA2798/H804298 11,715 2014 Aug. 28, 2014 Brazil KP164568 isolate BHI3734/H804698 11,812 2014 Aug. 26, 2014 Brazil KP164571 isolate PER160/H803609 12,189 2014 Jul. 03, 2014 Brazil KP164572 isolate TR206/H804187 12,053 2014 Aug. 21, 2014 Brazil KP851709 isolate InDRE 51CHIK 11,989 2014 Oct. 15, 2014 Mexico KR046227 isolate VE53_20 12,003 2014 Aug. 30, 2014 Trinidad and Tobago KR264949 isolate PR-S4 12,014 2014 Jul. 15, 2014 Puerto Rico KR559470 WHCHK1 12,004 2014 Nov. 2014 Puerto Rico KT192707 11540 11,889 2014 Oct. 31, 2014 Nicaragua KT308159 isolate CPCC007800Y01 11,631 2012 2012 Philippines KT327163 isolate CH0008 12,193 2014 2014 Mexico KT449801 LR2006_OPY1 11,796 2006 2006 Reunion KX009167 isolate Chik435 11,765 2013 2013 Thailand KX168429 isolate MUM001-2009-Selangor 11,900 2008 2009 Malaysia KX262987 CHIKV/Homo sapiens/THA/SVO- 11,671 1996 1996 Thailand 451-96/1996 KX262991 CHIKV/Homo sapiens/SXM/H- 11,950 2003 2003 Saint Martin 20235-STMARTIN-2013/2003 KX262992 CHIKV/Homo sapiens/GLP/YO- 11,294 2014 Jan. 05, 2014 Guadeloupe 111213/2014 KX262994 CHIKV/Homo sapiens/GUF/YO- 11,702 2014 Jan. 21, 2014 French 123223/2014 Guiana KX262996 CHIKV/Homo 11,570 2006 2006 Cameroon sapiens/CMR/667/2006 KX262997 CHIKV/Homo sapiens/MYS/BS- 11,669 2009 2009 Malaysia 285-C2/2009 KX496989 Homo sapiens/COL/UF-1/2016 12,037 2016 Feb. 09, 2016 Colombia KY575565 CHIKV/Homo 11,643 2014 2014 USA sapiens/USA/IDR1400024561/2014 KY575567 CHIKV/Homo 11,758 2006 2006 USA sapiens/USA/91077/2006 KY703888 CHIKV/Homo 11,456 2015 2015 Aug. 15 Nicaragua: sapiens/NIC/1885.1D/2015 Managua KY751908 isolate IN16C1 11,796 2016 2016 Australia: imported from India LN898093 Caribbean strain, isolate M100 12,230 2013 Dec. 2013 Martinique IND91 11737 India SGP11 11708 Singapore SGP7 11738 Singapore CNR20235 11917 Caribbean islands
TABLE-US-00035 TABLE 6 DENV1 strains used for NS5 consensus sequence Subtype/ Accession Strain Genotype Year Country AY620951 My00D136393 I 2000 Myanmar AY732464 ThD1_K0407 01 I 2001 Thailand AM746216 6633 I 2004 Saudi Arabia AY835999 ZJ01/2004 I 2004 China FR666922 D1/Malaysia/33087/04 I 2004 Malaysia EU081226 D1/SG/05K814DK1/2005 I 2005 Singapore FJ196844 GD02/06 I 2006 China JN415533 Vietnam 2006 I 2006 Vietnam AB608787 SDDF1543 I 2008 Taiwan GU131792 DENV-1/VN/BID-V4034/2008 I 2008 Vietnam South JN415521 Singapore 2008 I 2008 Singapore JN415534 Vietnam 2008a I 2008 Vietnam KC172829 XB998_Laos_2008 I 2008 Laos KR919821 TSV08 I 2008 Australia GU131895 DENV-1/IPC/BID- I 2009 Cambodia V3787/2009 HQ891316 DV1_SL_2009d I 2009 Sri Lanka KC182084 LNT1975_Laos_2010 I 2010 Laos KC848576 SO/DB118/2011 I 2011 Somalia KJ649286 DENV-1-Jeddah I 2011 Saudi Arabia KR919805 Bali 2011 I 2011 Indonesia KJ726662 SL_2012_GS0319 I 2012 Sri Lanka KR919808 Cairns 2012 I 2012 Australia KF184975 Angola_2013 I 2013 Angola KR919817 Van 2013 I 2013 Vanuatu KR919816 ET2014 I 2014 East Timor LC002828 D1/Hu/Saitama/NIID100/2014 I 2014 Japan FN825674 D1/Malaysia/36046/05 III 2005 Malaysia U88535 Nauru Island, Western Pacific IV 1974 Nauru FJ196846 GD95/95 IV 1995 China JN415499 ET00 243 IV 2000 East Timor JN415515 Palau 2000 IV 2000 Palau AY630407 FP/01/192206 IV 2001 French Polynesia DQ672564 HawO3663 IV 2001 Hawaii EU863650 CHI3336-02 IV 2002 Chile: Easter Island JN415503 Fiji 2002 IV 2002 Fiji KF559254 M49440 IV 2002 Myanmar AB195673 NIID03-41 IV 2003 Seychelles FJ196842 GD66/03 IV 2003 China AB204803 NIID04-27 IV 2004 Federated States of Micronesia (Yap) JN415513 Malaysia 2010 IV 2010 Malaysia JQ915080 NC10/080810-1138 IV 2010 New Caledonia JX298570 Fiji 2011b IV 2011 Fiji KR919815 PNG 2011 IV 2011 Papua New Guinea KR919818 PNG 2014b IV 2014 Papua New Guinea KR919810 Tully 2015 IV 2015 Australia JQ922544 IND/631288/1963 V 1963 India AF425625 IBH 28328 V 1968 Nigeria GU131962 DENV-1/MX/BID-V3669/2007 V 2007 Mexico GQ357692 SG(EHI)DED65008 V 2008 Singapore GU131863 DENV-1/BR/BID-V3490/2008 V 2008 Brazil JN415506 Guyana 2008 V 2008 Guyana JN903579 D1/IN/RGCB419/2008 V 2008 India KC692512 HNRG25001 V 2010 Argentina KJ189367 DENV-1/PR/BID-V8188/2010 V 2010 Puerto Rico KF864667 Zj/yw01 V 2013 China KM458188 US/DB167/2014 V 2014 USA AF309641 D1/H/IMTSSA/98/658 I 1998 Cambodia AY732483 ThD1_0008_81 I 1981 Thailand EU081262 D1/SG/05K4173DK1/2005 I 2005 Singapore KU365900 D1/Taiwan/806KH1405a I 2014 Taiwan KX225493 GZ-12/M/GZ/2014/DEV1 I 2015 China KP406802 DenKor-02 I 2005 South Korea/travelled to Indonesia KF955444 KH/BID-V3784/2007 I 2007 Cambodia DQ672556 FP0203 IV 2001 French Polynesia DQ672560 HawM2516 IV 2001 Hawaii/French Polynesia EU179861 DS212-110306 IV 2006 Brunei KP406803 DenKor-07 IV 2007 South Korea/travelled to Philippines JQ675358 DENV-1/BOL-KW010 V 2010 USA HQ332182 VE_61006_2006 V 2006 Venezuela AY762084 Singapore 8114/93 V 1993 Singapore AF311957 BR/97-409 V 1997 Brazil AF513110 BR/01-MR V 2001 Brazil GU131949 CO/BID-V3383/2006 V 2006 Colombia: Norte de Santander KJ189368 MX/BID-V8195/2012 V 2012 Mexico KJ189366 PR/BID-V8187/2010 V 2012 Puerto Rico
TABLE-US-00036 TABLE 7 DENV2 strains used for NS5 consensus sequence Subtype/ Accession Strain name Genotype Lineage Year Country EU482449 DENV-2/VN/BID- AA AA1 2006 Vietnam V1004/2006 FM210213 MD1504 AA AA1 2005 Vietnam FM210202 DF768 AA AA1 2004 Vietnam FJ639702 DENV-2/KH/BID- AA AA1 2003 Cambodia V2030/2003 EU482780 DENV-2/VN/BID- AA AA1 2003 Vietnam V758/2003 FJ639697 DENV-2/KH/BID- AA AA1 2001 Cambodia V2020/2001 EU596489 DENV-2/US/BID- AA AA2 2007 USA V1411/2007 EU482544 DENV-2/US/BID- AA AA2 2006 USA V1031/2006 EU482556 DENV-2/US/BID- AA AA2 2005 USA V1045/2005 EU687214 DENV-2/US/BID- AA AA2 2004 USA V1435/2004 EU687240 DENV-2/US/BID- AA AA2 2003 USA V1492/2003 EU482722 DENV-2/US/BID- AA AA2 2002 USA V591/2002 EU482593 DENV-2/US/BID- AA AA2 2001 USA V854/2001 GQ398270 DENV-2/PR/2DN/1994 AA AA2 1994 Puerto Rico FJ898450 DENV-2/VI/BID- AA AA2 1990 Virgin Islands V2948/1990 FJ850072 DENV-2/BR/BID- AA AA3 2000 Brazil V2376/2000 GQ868552 DENV-2/CO/BID- AA AA3 1998 Colombia V3368/1998 FJ898465 DENV-2/VE/BID- AA AA3 1998 Venezuela V2941/1998 FJ850106 DENV-2/VE/BID- AA AA4 2008 Venezuela V2476/2008 GQ868558 DENV-2/CO/BID- AA AA4 2007 Colombia V3375/2007 EU482604 DENV-2/VE/BID- AA AA4 2007 Venezuela V1095/2007 FJ850088 DENV-2/BR/BID- AA AA4 2006 Brazil V2396/2006 HQ332184 VE_61069_2006 AA AA4 2006 Venezuela FJ850085 DENV-2/BR/BID- AA AA4 2005 Brazil V2393/2005 FJ024473 DENV-2/CO/BID- AA AA4 2005 Colombia V1594/2005 FJ850082 DENV-2/BR/BID- AA AA4 2004 Brazil V2390/2004 FJ639734 DENV-2/VE/BID- AA AA4 2003 Venezuela V2160/2003 FJ850076 DENV-2/BR/BID- AA AA4 2002 Brazil V2382/2002 JN819408 DENV-2/VE/BID- AA AA4 2001 Venezuela V2161/2001 GQ199892 DENV-2/JM/BID- AA AA5 2007 Jamaica V2963/2007 EU596491 DENV-2/US/BID- AA AA5 2007 USA V1413/2007 FJ898453 DENV-2/VI/BID- AA AA5 2005 Virgin Islands V2960/2005 FJ898451 DENV-2/DO/BID- AA AA5 2003 Dominican V2955/2003 Republic FJ898460 DENV-2/KN/BID- AA AA5 2001 Saint Kitts and V2951/2001 Nevis AF208496 DEN2/H/IMTSSA- AA AA5 1998 Martinique MART/98-703 AY702037 Cuba89/97 AA AA5 1997 Cuba HQ705624 DENV-2/NI/BID- AA AA6 2009 Nicaragua V4914/2009 FJ898439 DENV-2/MX/BID- AA AA6 2008 Mexico V2964/2008 GQ868515 DENV-2/MX/BID- AA AA6 2007 Mexico V3713/2007 GQ868497 DENV-2/MX/BID- AA AA6 2006 Mexico V3654/2006 FJ850067 DENV-2/NI/BID- AA AA6 2006 Nicaragua V2331/2006 GQ199894 DENV-2/MX/BID- AA AA6 2005 Mexico V2959/2005 FJ898461 DENV-2/BZ/BID- AA AA6 2002 Belize V2952/2002 GU369819 CAM7786 AA AA6 2002 Mexico JF730051 DENV-2/NI/BID- AA AA7 2009 Nicaragua V5072/2009 FJ639829 DENV-2/TH/BID- Al AI-1 2001 Thailand V2154/2001 FJ639718 DENV-2/KH/BID- Al AI-2 2008 Cambodia V2068/2008 HQ541799 DENV-2/US/BID- All All 2010 USA V4825/2010 FJ906959 DENV-2/PG/BID- All All 2008 Papua New V2618/2008 Guinea HQ891023 DENV-2/TW/BID- All All 2008 Taiwan V5054/2008 EU056811 IQT-1950 AM AM 1995 Peru GQ868590 DENV-2/MX/BID- AM AM 1992 Mexico V3356/1992 JQ922551 DENV- C C1 2005 India 2/IND/053598/2005 GQ252676 DENV-2/LK/BID- C C1 2003 Sri Lanka V2421/2003 DQ448231 GWL18 INDI-01 C C1 2001 India GQ398265 DENV- C C2 2008 Singapore 2/SG/07K3608DK1/2008 EU179859 DS09-280106 C C2 2006 Brunei EU482672 DENV-2/VN/BID- C C2 2006 Viet Nam V735/2006 FJ196853 GD01/03 C C2 2003 China DQ645545 1183-DF-06/17/2002 C C2 2002 Taiwan AB189122 strain 98900663 DHF DV- C C2 1998 Indonesia 2
TABLE-US-00037 TABLE 8 DENV3 strains used for NS5 consensus sequence Subtype/ Sequence Collection Accession Strain Name Genotype Length Year Date Country AB189127 98901517 DHF DV-3 3-I 10707 -N/A- -N/A- Indonesia AB189126 98901437 DSS DV-3 3-I 10707 -N/A- -N/A- Indonesia KC762685 MKS-0388 3-I 10707 2008 Feb. 15, 2008 Indonesia KC762681 MKS-0057 3-I 10707 2007 Jun. 22, 2007 Indonesia JQ920479 PF96/150296-46183 3-I 10671 1996 Feb. 15, 1996 French Polynesia JQ920485 NC96/211096-4631 3-I 10663 1996 Oct. 21, 1996 New Caledonia FJ898456 DENV-3/WS/BID-V2973/1995 3-I 10663 1995 1995 Samoa JQ920488 WF95/050495-1650 3-I 10671 1995 Apr. 05, 1995 Wallis and Futuna AY744685 PF94/136116 3-I 10707 1994 1994 French Polynesia FJ898455 DENV-3/CK/BID-V2972/1991 3-I 10663 1991 1991 Cook Islands KJ622199 HN/2013/110 3-II 10710 2013 2013 China KF824903 YN02 3-II 10707 2013 2013 China GU189648 DTID-ZJU04 3-II 10173 2009 2009 China GU131946 DENV-3/IPC/BID-V4314/2008 3-II 10631 2008 2008 Cambodia FJ461337 DENV-3/VN/BID-V1946/2008 3-II 10623 2008 2008 Viet Nam FJ432741 DENV-3/VN/BID-V1810/2007 3-II 10638 2007 2007 Viet Nam GU131908 DENV-3/IPC/BID-V3820/2006 3-II 10511 2006 2006 Cambodia EU482457 DENV-3/VN/BID-V1013/2006 3-II 10663 2006 2006 Viet Nam GQ868629 DENV-3/KH/BID-V2087/2005 3-II 10660 2005 2005 Cambodia FJ639726 DENV-3/KH/BID-V2083/2004 3-II 10648 2004 2004 Cambodia FJ639725 DENV-3/KH/BID-V2082/2003 3-II 10648 2003 2003 Cambodia FJ639721 DENV-3/KH/BID-V2078/2002 3-II 10648 2002 2002 Cambodia GQ868626 DENV-3/KH/BID-V2075/2001 3-II 10663 2001 2001 Cambodia FJ744728 DENV-3/TH/BID-V2314/2001 3-II 10664 2001 2001 Thailand KJ737429 C0360/94 3-II 10707 1994 1994 Thailand KF955449 DENV-3/VE/BID-V1121/36892.5 3-III 10421 -N/A- -N/A- Venezuela KF973478 DENV-3/NI/BID-V7646/2012 3-III 10584 2012 2012 Nicaragua KF973483 DENV-3/NI/BID-V7665/2011 3-III 10509 2011 2011 Nicaragua JF937638 DENV-3/NI/BID-V5517/2010 3-III 10681 2010 2010 Nicaragua JF808120 D3BR/AL95/2009 3-III 10707 2009 2009 Brazil KF971709 DENV-3/NI/BID-V5453/2009 3-III 10678 2009 2009 Nicaragua KJ189292 DENV-3/PE/BID-V7081/2009 3-III 10696 2009 2009 Peru FJ850094 DENV-3/BR/BID-V2403/2008 3-III 10662 2008 2008 Brazil KJ189298 DENV-3/PE/BID-V7087/2008 3-III 10692 2008 2008 Peru FJ639826 DENV-3/VE/BID-V2267/2008 3-III 10654 2008 2008 Venezuela KU509278 DENV3-254 3-III 10270 2007 2007 Barbados FJ850092 DENV-3/BR/BID-V2400/2007 3-III 10648 2007 2007 Brazil EU596492 DENV-3/US/BID-V1415/2007 3-III 10648 2007 2007 USA EU529683 DENV-3/VE/BID-V1102/2007 3-III 10649 2007 2007 Venezuela GU131849 DENV-3/BR/BID-V3430/2006 3-III 10525 2006 2006 Brazil JX669496 603/BR-PE/06 3-III 10709 2006 2006 Brazil GU131954 DENV-3/CO/BID-V3404/2006 3-III 10525 2006 2006 Colombia FJ898441 DENV-3/MX/BID-V2987/2006 3-III 10663 2006 2006 Mexico KJ189295 DENV-3/PE/BID-V7084/2006 3-III 10694 2006 2006 Peru KF955456 DENV-3/PR/BID-V1728/2006 3-III 10645 2006 2006 Puerto Rico EU482555 DENV-3/US/BID-V1043/2006 3-III 10648 2006 2006 USA HQ332171 VE_61035_2006 3-III 10707 2006 2006 Venezuela JX669500 249/BR-PE/05 3-III 10707 2005 2005 Brazil FJ898444 DENV-3/CO/BID-V2986/2005 3-III 10663 2005 2005 Colombia KJ189299 DENV-3/PE/BID-V7088/2005 3-III 10692 2005 2005 Peru FJ182008 DENV-3/US/BID-V1618/2005 3-III 10648 2005 2005 USA JX669495 145/BR-PE/04 3-III 10707 2004 2004 Brazil GQ868575 DENV-3/CO/BID-V3400/2004 3-III 10663 2004 2004 Colombia FJ182006 DENV-3/US/BID-V1616/2004 3-III 10648 2004 2004 USA FJ639791 DENV-3/VE/BID-V2224/2004 3-III 10647 2004 2004 Venezuela EF643017 D3BR/RP1/2003 3-III 10707 2003 2003 Brazil FJ898440 DENV-3/MX/BID-V2985/2003 3-III 10663 2003 2003 Mexico JF808129 D3PY/AS10/03 3-III 10707 2003 2003 Paraguay KT726348 Cuba_21_2002 3-III 10663 2002 2002 Cuba KF955505 DENV-3/GD/BID-V3930/2002 3-III 10653 2002 2002 Grenada JF808123 D3PY/AS12/02 3-III 10707 2002 2002 Paraguay FJ898459 DENV-3/TT/BID-V2982/2002 3-III 10663 2002 2002 Trinidad and Tobago FJ547083 DENV-3/US/BID-V2119/2002 3-III 10649 2002 2002 USA FJ898462 DENV-3/AI/BID-V2976/2001 3-III 10663 2001 2001 Anguilla KT726342 Cuba_553_2001 3-III 10663 2001 2001 Cuba KF955468 DENV-3/PR/BID-V2116/2001 3-III 10640 2001 2001 Puerto Rico GQ868616 DENV-3/LC/BID-V3929/2001 3-III 10663 2001 2001 Saint Lucia FJ898457 DENV-3/EC/BID-V2975/2000 3-III 10663 2000 2000 Ecuador KF955466 DENV-3/PR/BID-V2102/2000 3-III 10596 2000 2000 Puerto Rico KF955465 DENV-3/PR/BID-V2101/2000 3-III 10614 2000 2000 Puerto Rico GQ199886 DENV-3/NI/BID-V2419/1998 3-III 10646 1998 1998 Nicaragua FJ882575 DENV-3/MZ/BID-V2418/1985 3-III 10663 1985 1985 Mozambique EU367962 07CHLS001 -N/A- 10707 -N/A- -N/A- China AY858046 PI64 -N/A- 10707 -N/A- -N/A- Indonesia KJ830751 Jeddah-2014 -N/A- 10635 2014 Jan. 26, 2014 Saudi Arabia KF954946 13GDZDVS30B -N/A- 10686 2013 Aug. 08, 2013 China KU216208 Rajasthan.India/DMRC/ -N/A- 10672 2013 Nov. 11, 2013 India Balotra87/2013 KX380842 D3/SG/CT37/2013 -N/A- 10676 2013 2013 Singapore KC261634 GZ/10476/2012 -N/A- 10630 2012 2012 China KX380839 D3/SG/CT7/2012 -N/A- 10674 2012 2012 Singapore KU509286 DENV3-9468 -N/A- 10493 2011 2011 India KU509280 DENV3-1631 -N/A- 10261 2011 2011 Thailand KC762692 MKS-WS78 -N/A- 10707 2010 Mar. 22, 2010 Indonesia JF504679 ZJYW2009 -N/A- 10685 2009 September 2009 China KU509281 DENV3-2994 -N/A- 10259 2009 2009 India KF041258 D3/Pakistan/45251/2009 -N/A- 10675 2009 2009 Pakistan KU509282 DENV3-3140 -N/A- 10568 2009 2009 Senegal GU370052 SGEHI(D3)0040Y09 -N/A- 10250 2009 January 2009 Singapore FJ639716 DENV-3/KH/BID-V2054/2008 -N/A- 10648 2008 2008 Cambodia GQ466079 DEL-72 -N/A- 10680 2008 2008 India KF041254 D3/Pakistan/56/2008 -N/A- 10675 2008 2008 Pakistan FJ644564 ND143 -N/A- 10707 2007 2007 India KF041255 D3/Pakistan/55505/2007 -N/A- 10675 2007 2007 Pakistan KF041259 D3/Pakistan/43298/2006 -N/A- 10675 2006 2006 Pakistan KU509283 DENV3-3404 -N/A- 10336 2006 2006 Sri Lanka AB214880 D3/Hu/TL029NIID/2005 -N/A- 10707 2005 2005 East Timor
TABLE-US-00038 TABLE 9 DENV4 strains used for capsid consensus sequence Subtype/ Sequence Collection Accession Strain Name Genotype* Length Year Date Country JQ513345 H781363 4-I 10604 2011 Mar. 18, 2011 Brazil KR922405 11/1666 4-I 10164 2011 2011 Thailand JN638570 DF patient 4-I 10650 2008 2008 Cambodia JN638572 DSS patient 4-I 10656 2008 2008 Cambodia JN638571 DHF patient 4-I 10656 2007 2007 Cambodia KF955510 DENV-4/KH/BID-V2055/2002 4-I 10586 2002 2002 Cambodia KJ160504 rDENV4 4-II 10650 NA -N/A- Sri Lanka KU523872 ID-CN27-15 4-II 10653 2015 Apr. 08, 2015 Indonesia LC069810 D4/Hu/India/NIID48/2009 4-II 10623 2015 2015 Japan KP140942 MRS 6169642904/2014 4-II 10565 2014 Sep. 11, 2014 Haiti KT276273 Haiti/0324/2014 4-II 10649 2014 Sep. 08, 2014 Haiti KU523871 PH-CN08-14 4-II 10589 2014 Feb. 13, 2014 Philippines KP188565 BR/SJRP/733/2013 4-II 10355 2013 Jan. 30, 2013 Brazil KP188566 BR/SJRP/850/2013 4-II 10426 2013 Feb. 08, 2013 Brazil KU513441 LRV13/422 4-II 10650 2013 2013 Brazil KJ579243 DENV-4/MT/BR12_TVP17898/2012 4-II 10649 2012 Mar. 28, 2012 Brazil KJ596666 DENV-4/MT/BR53_TVP17939/2012 4-II 10649 2012 Mar. 14, 2012 Brazil KP188558 BR/SJRP/505/2012 4-II 10572 2012 Mar. 14, 2012 Brazil KJ596664 DENV-4/MT/BR50_TVP18148/2012 4-II 10649 2012 Mar. 12, 2012 Brazil KP188557 BR/SJRP/500/2012 4-II 10425 2012 Mar. 09, 2012 Brazil KJ596672 DENV-4/MT/BR91_TVP17968/2012 4-II 10649 2012 Feb. 03, 2012 Brazil KP188560 BR/SJRP/514/2012 4-II 10576 2012 Apr. 02, 2012 Brazil KC333651 GZ/9809/2012 4-II 10574 2012 2012 China JQ513344 H780571 4-II 10604 2011 Jan. 13, 2011 Brazil KT794007 BR005AM_2011 4-II 10649 2011 Mar. 07, 2011 Brazil JQ513341 H780120 4-II 10604 2010 Nov. 21, 2010 Brazil JQ513331 H772852 4-II 10604 2010 Jul. 18, 2010 Brazil JQ513334 H775222 4-II 10604 2010 Nov. 10, 2010 Brazil JN983813 Br246RR/10 4-II 10649 2010 Sep. 08, 2010 Brazil JF741967 GZ1D4 4-II 10631 2010 Sep. 26, 2010 China JQ915084 PF10/150610-28 4-II 10573 2010 Jun. 15, 2010 French Polynesia KU509288 DENV4-61120 4-II 10500 2010 2010 Indonesia JX024757 EHI310A129CY10 4-II 10653 2010 December 2010 Singapore JQ915081 PF09/290109-69 4-II 10572 2009 Jan. 29, 2009 French Polynesia JQ915083 PF09/080409-93 4-II 10572 2009 Apr. 08, 2009 French Polynesia JQ915089 NC09/230909-14518 4-II 10572 2009 Sep. 23, 2009 New Caledonia JQ915088 NC09/020409-9266 4-II 10572 2009 Apr. 02, 2009 New Caledonia JQ915090 WF09/010409-0001 4-II 10246 2009 Apr. 01, 2009 Wallis and Futuna KC762698 MKS-2007 4-II 10653 2008 Apr. 30, 2008 Indonesia JQ915085 NC08/200208-409 4-II 10572 2008 Feb. 20, 2008 New Caledonia KC762696 MKS-0252 4-II 10653 2007 Aug. 13, 2007 Indonesia FJ182016 DENV-4/VE/BID-V1158/2007 4-II 10606 2007 2007 Venezuela HQ332176 VE_61054_2007 4-II 10649 2007 2007 Venezuela FJ882583 DENV-4/VE/BID-V2492/2007 4-II 10592 2007 2007 Venezuela KM190936 VIROAF8 4-II 10592 2006 May 26, 2006 Thailand GQ398256 DENV-4/SG/06K2270DK1/2005 4-II 10653 2005 2005 Singapore FJ639764 DENV-4/VE/BID-V2194/2001 4-II 10566 2001 2001 Venezuela FJ850095 DENV-4/VE/BID-V2176/2000 4-II 10558 2000 2000 Venezuela EU854297 DENV-4/US/BID-V1094/1998 4-II 10606 1998 1998 USA FJ024476 DENV-4/CO/BID-V1600/1997 4-II 10606 1997 1997 Colombia GQ199881 DENV-4/US/BID-V2435/1996 4-II 10590 1996 1996 USA FJ810417 DENV-4/US/BID-V2433/1995 4-II 10606 1995 1995 USA JF262781 INH6412 4-II 10649 1995 1995 Venezuela JF262782 Haiti73 4-II 10649 1994 1994 Haiti GQ199878 DENV-4/US/BID-V2429/1994 4-II 10592 1994 1994 USA KR011349 H241 -N/A- 10664 1956 Aug. 28, 1956 Philippines *I: Philippines, Thailand and Sri-Lanka II: Indonesia, Tahiti, Caribbean Islands (Puerto Rico, Dominica) and Central and South America III: sylvatic
TABLE-US-00039 TABLE 10 ZIKV strains used for NS5 consensus sequence Subtype/ Sequence Collection Accession Strain Name Genotype Length Year Date Country EU545988 EU545988 FSM Asian 10272 2007 2007 Micronesia JN860885 FSS13025 Asian 2010 2010 Cambodia KU955593 KHM/2010/FSS13025 Asian 10807 2010 2010 Cambodia KU681082 PHL/2012/CPC-0740 Asian 10807 2012 May 09, 2012 Philippines KF993678 PLCal_ZV Asian 2013 2013 Canada KJ776791 H/PF/2013 Asian 10807 2013 Nov. 28, 2013 French Polynesia KX051560 SK364/13AS Asian 10795 2013 Jul. 09, 2013 Thailand KJ634273 CK-ISL 2014 Asian 2014 2014 Cook Islands KX447511 1_0015_PF Asian 10585 2014 January 2014 French Polynesia KU509998 Haiti/1225/2014 Asian 10807 2014 Dec. 12, 2014 Haiti KU681081 THA/2014/SV0127-14 Asian 10807 2014 Jul. 19, 2014 Thailand KU729217 BeH823339 Asian 10645 2015 2015 Brazil KX197192 ZIKV/H.sapiens/Brazil/PE243/2015 Asian 10807 2015 2015 Brazil KX280026 Paraiba_01 Asian 10807 2015 2015 Brazil KU820897 FLR Asian 10807 2015 December 2015 Colombia KU758877 17271 Asian 10364 2015 December 2015 French Guiana KX694534 HND/R103451/2015 Asian 10772 2015 Jan. 06, 2015 Honduras KU647676 MRS_OPY_Martinique_PaRi_2015 Asian 10617 2015 December 2015 Martinique KX247632 MEX_I_7 Asian 10777 2015 November 2015 Mexico KX156774 PAN/CDC-259359_V1-V3/2015 Asian 10771 2015 Dec. 18, 2015 Panama KX087101 PRI/PRVABC59/2015 Asian 10778 2015 December 2015 Puerto Rico KU312313 Z1106032 Asian 2015 2015 Suriname KX051562 SV0010/15 Asian 10800 2015 Jan. 16, 2015 Thailand KX806557 TS17-2016 Asian 10807 2016 February 2016 Australia KU926309 Rio-U1 Asian 10807 2016 Jan. 14, 2016 Brazil KY014301 BRA/2016/FC-DQ107D1-URI Asian 10361 2016 Apr. 13, 2016 Brazil KY014307 BRA/2016/FC-DQ49D1-PLA Asian 10455 2016 Mar. 28, 2016 Brazil KU740184 GD01 Asian 10574 2016 February 2016 China KU820899 ZJ03 Asian 10805 2016 Feb. 17, 2016 China KY927808 ZZ-1 Asian 10633 2016 September 2016 China KY967711 SY01_2016 Asian 10632 2016 Nov. 01, 2016 China KX247646 COL/UF-1/2016 Asian 10808 2016 Feb. 09, 2016 Colombia KX766028 R114916 Asian 10680 2016 Jun. 06, 2016 Dominican Republic KY014305 DOM/2016/BB-0076-SER Asian 10366 2016 Apr. 05, 2016 Dominican Republic KX879604 EcEs089_16 Asian 10810 2016 April 2016 Ecuador KX262887 103451 Asian 10806 2016 Jan. 06, 2016 Honduras KU853012 Dominican Republic/2016/PD1 Asian 10636 2016 Feb. 01, 2016 Italy KY785419 JAM/2016/WI-JM6-SER Asian 10599 2016 Jun. 13, 2016 Jamaica LC190723 ZIKV/Hu/Yokohama/1/2016 Asian 10786 2016 May 20, 2016 Japan LC191864 ZIKV/Hu/Chiba/S36/2016 Asian 10807 2016 Apr. 21, 2016 Japan KY785451 MTQ/2016/FL-001-SAL Asian 10345 2016 Mar. 22, 2016 Martinique KU922923 MEX/InDRE/Lm/2016 Asian 10617 2016 Feb. 25, 2016 Mexico KX421194 Nica2-16 Asian 10580 2016 Jan. 13, 2016 Nicaragua KX198135 PAN/BEI-259634_V4/2016 Asian 10778 2016 2016 Panama KY693678 FPI15198/PERU/Loreto/2016 Asian 10666 2016 Jun. 28, 2016 Peru KY785464 PRI/2016/MA-WGS16-004-SER Asian 10453 2016 Apr. 13, 2016 Puerto Rico KX813683 ZKA-16-097 Asian 10484 2016 Aug. 27, 2016 Singapore KX827309 ZKA-16-291 Asian 10526 2016 Aug. 28, 2016 Singapore KY348640 SL1602 Asian 10807 2016 Jan. 22, 2016 Suriname KY272987 SI-BKK01 Asian 10807 2016 Aug. 30, 2016 Thailand KU870645 FB-GWUH-2016 Asian 10798 2016 Feb. 02, 2016 USA KX702400 VEN/UF-1/2016 Asian 10808 2016 Mar. 25, 2016 Venezuela KX520666 HS-2015-BA-01 Asian 10538 August 2015 August 2015 Brazil EU545988 FSM -N/A- 10272 2007 June 2007 Micronesia KU365777 BeH818995 -N/A- 10662 2015 2015 Brazil KU501216 103344 -N/A- 10272 2015 Dec. 01, 2015 Guatemala KU501215 PRVABC59 -N/A- 10675 2015 Dec. 01, 2015 Puerto Rico KU312312 Z1106033 -N/A- 10374 2015 Oct. 02, 2015 Suriname