THERMOSTABLE POLYMERASE INHIBITOR COMPOSITIONS AND METHODS
20250369000 ยท 2025-12-04
Inventors
- Sergey G. Lokhov (Seattle, WA, US)
- Alexander A. Gall (Woodinville, WA, US)
- Vera Baraznenok (Sunnyvale, CA, US)
- Ekaterina V. Viazovkina (Sunnyvale, CA, US)
- Irina Shishkina (Sunnyvale, CA, US)
- David H. Persing (San Martin, CA, US)
Cpc classification
C12N2320/52
CHEMISTRY; METALLURGY
International classification
C12N15/115
CHEMISTRY; METALLURGY
Abstract
The present disclosure relates to aptamers for temperature-dependent reversible inhibition of thermostable polymerase activity in order to improve sensitivity and specificity of various reactions and assays involving hot start polynucleotide synthesis. Methods for use of the aptamers and related compositions and kits are also provided.
Claims
1. A hairpin aptamer comprising a single oligonucleotide in a folded configuration comprising a nucleotide stem and a nucleotide loop, wherein the nucleotide stem comprises nucleotides of SEQ ID NO:4, or a variant thereof, hybridized to nucleotides of SEQ ID NO:5, or a variant thereof, wherein: the variant of SEQ ID NO:4 has less than 5 nucleotide substitutions in SEQ ID NO:4; the variant of SEQ ID NO:5 has less than 5 nucleotide substitutions in SEQ ID NO:5; the variants of SEQ ID NO:4 and SEQ ID NO:5 are equal in length to each other, and are 100% complementary to each other along their entire length; the nucleotide loop comprises SEQ ID NO:3, or a variant thereof; and the variant of SEQ ID NO:3 has less than 3 nucleotide substitutions in SEQ ID NO:3.
2. The hairpin aptamer of claim 1, wherein the single oligonucleotide is at least a 56-mer.
3. The hairpin aptamer of claim 1, wherein the single oligonucleotide comprises SEQ ID NO:90.
4. The hairpin aptamer of claim 1, wherein the single oligonucleotide further comprises a first portion of a loop sequence covalently linked to the nucleotides of SEQ ID NO:4 or the variant thereof, and nucleotides of SEQ ID NO:5, or the variant thereof, covalently linked a second portion of the loop sequence; wherein the loop sequence comprises the nucleotides of SEQ ID NO:3, or the variant thereof.
5. The hairpin aptamer of claim 4, wherein the loop sequence is separated from the nucleotide loop by the nucleotide stem.
6. The hairpin aptamer of claim 4, wherein the first portion of the loop sequence is the 3 portion of the nucleotides of SEQ ID NO:3, or the variant thereof, and the second portion of the loop sequence is the 5 portion of the nucleotides of SEQ ID NO:3, or the variant thereof.
7. The hairpin aptamer of claim 4 further comprising a capping moiety selected from the group consisting of a 3 capping moiety linked to the 3 terminus of the first portion of the loop sequence and a 5 capping moiety linked to the 5 terminus of the second portion of the loop sequence.
8. The hairpin aptamer of claim 4, wherein the loop sequence lacks a phosphodiester bond between a 3 most nucleotide of the first portion of the loop sequence and a 5 most nucleotide of the second portion of the loop sequence.
9. The hairpin aptamer of claim 4 further comprising a 3 capping moiety linked to the 3 terminus of the first portion of the loop sequence; and the 3 capping moiety is a propanediol spacer (C3) or a phosphate.
10. The hairpin aptamer of claim 4 further comprising a 5 capping moiety linked to the 5 terminus of the second portion of the loop sequence, and the 5 capping moiety is an ammo group.
11. A composition comprising the hairpin aptamer according to claim 1 and a thermostable polymerase.
12. The composition of claim 11, wherein the molar ratio of the hairpin aptamer to the thermostable polymerase ranges from about 2:1 to about 15:1.
13. The composition of claim 11, wherein the molar ratio of the hairpin aptamer to the thermostable polymerase is about 1:1, 2:1, or 4:1.
14. A hairpin aptamer comprising SEQ ID NO:90 or a variant thereof; the hairpin aptamer comprising a secondary structure comprising a nucleotide loop and a nucleotide stem; wherein the variant of SEQ ID NO:90 comprises fewer than 3 nucleotide substitutions in the nucleotide loop and fewer than 9 nucleotide substitutions in the nucleotide stem.
15. The hairpin aptamer of claim 14 wherein the secondary structure further comprises an overhang separated from the nucleotide loop by the nucleotide stem.
16. The hairpin aptamer of claim 15 wherein the overhang is a 5 overhang or a 3 overhang and the overhang comprises at least three consecutive nucleotides from SEQ ID NO:3.
17. An aptamer comprising an oligonucleotide comprising in a 5 to 3 direction: a first polynucleotide sequence comprising SEQ ID NO:4 or a variant thereof or SEQ ID NO:5 or a variant thereof; a second polynucleotide sequence comprising SEQ ID NO:3 or a variant thereof; a third polynucleotide sequence comprising SEQ ID NO:5 or the variant thereof or SEQ ID NO:4 or the variant thereof; and a fourth polynucleotide sequence comprising SEQ ID NO:3 or the variant thereof; wherein each of the second and fourth sequences are 14 to 20 nucleotides in length, are equal in length, and are complementary to each other along their entire length; wherein the variant of SEQ ID NO:4 has less than 5 nucleotide substitutions in SEQ ID NO:4, the variant of SEQ ID NO:5 has less than 5 nucleotide substitutions in SEQ ID NO:5, the variant of SEQ ID NO:3 has less than 3 nucleotide substitutions in SEQ ID NO:3; and wherein the aptamer comprises a 5 end and a 3 end.
18. The aptamer of claim 17, wherein there is no phosphodiester bond between nucleotides 1 and 2, 2 and 3, 3 and 4, 4 and 5, 5 and 6, 6 and 7, 7and 8, 8 and 9, 9 and 10, 10 and 11, or 11 and 12 of SEQ ID NO:3 in the fourth polynucleotide sequence.
19. The aptamer of claim 17, wherein the oligonucleotide comprises one of SEQ ID NOs:82, 85, or 88 to 105.
20. The aptamer of claim 17, further comprising a capping moiety selected from the group consisting of a 5 capping moiety linked to the 5 end of the aptamer and a 3 capping moiety linked to the 3 end of the aptamer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0077]
[0078]
[0079]
[0080]
[0081]
DETAILED DESCRIPTION
[0082] Various aspects now will be described more fully hereinafter. Such aspects may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey its scope to those skilled in the art.
[0083] The practice of the present disclosure will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, and pharmacology, within the skill of the art. Such techniques are explained fully in the literature. Sec, e.g.; A. L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Morrison and Boyd, Organic Chemistry (Allyn and Bacon, Inc., current addition); J. March, Advanced Organic Chemistry (McGraw Hill, current addition); Remington: The Science and Practice of Pharmacy, A. Gennaro, Ed., 20.sup.th Ed.; Goodman & Gilman The Pharmacological Basis of Therapeutics, J. Griffith Hardman, L. L. Limbird, A. Gilman, 10.sup.th Ed.
[0084] Where a range of values is provided, it is intended that each intervening value between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the disclosure. For example, if a range of 1% to 8% is stated, it is intended that 2%, 3%, 4%, 5%, 6%, and 7% are also explicitly disclosed, as well as the range of values greater than or equal to 1% and the range of values less than or equal to 8%.
I. Definitions
[0085] It must be noted that as used herein and in the appended claims, the singular forms a, an, and the include plural reference unless the context clearly dictates otherwise.
[0086] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the methodologies which are reported in the publications which might be used in connection with the invention.
[0087] The phrase nucleic acid or polynucleotide refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, or non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
[0088] As used herein, the term thermostable polymerase or thermophilic polymerase refers to an enzyme that is relatively stable to heat when compared, for example, to nucleotide polymerases from E. coli, and which catalyzes the template-dependent polymerization of nucleoside triphosphates. A thermostable polymerase, will, e.g., retain enzymatic activity for polymerization and exonuclease activities when subjected to the repeated heating and cooling cycles used in PCR. Preferably, a thermostable nucleic acid polymerase has optimal activity at a temperature above 45 C., or at a temperature ranging from 40 C. to 80 C. and more preferably from 55 C. to 75 C. A representative thermostable polymerase enzyme isolated from Thermus aquaticus (Taq) is described in U.S. Pat. No. 4,889,818 and a method for using it in conventional PCR is described in Saiki et al., 1988, Science 239:487. Other thermostable DNA polymerases include, but are not limited to, DNA polymerases from thermophilic Eubacteria or Archaebacteria, for example, T. thermophilus, T. bockianus, T. flavus, T. rubber, Thermococcus litoralis, Pyroccocus furiousus, P. wosei, Pyrococcus spec. KGD, Thermatoga maritime, Thermoplasma acidophilus, and Sulfolobus spec. Reverse transcriptases functional between 55-60 C. include, but are not limited to, MmLV reverse transcriptase, AMV reverse transcriptase, RSV reverse transcriptase, HIV-1 reverse transcriptase, and HIV-2 reverse transcriptase.
[0089] The term aptamer as used herein refers to a nucleic acid that has a specific binding affinity for a target molecule, such as a protein. Like all nucleic acids, a particular nucleic acid ligand may be described by a linear sequence of nucleotides (A, U, T, C and G), typically 30-75 nucleotides long. Aptamers may also be described in terms of regions of predicted secondary structure wherein a single strand portion of the aptamer is complementary to another single strand portion of the same aptamer and thereby can hybridize (anneal) to each other to form a duplex which is referred to herein as a stem, and portions of the aptamer which are predicted not to hybridize with other portions of the same aptamer are referred to herein as loops. Generally, each end of a loop is linked to an end of a stem thereby providing a loop configuration.
[0090] The term capping moiety refers to a moiety attached to the 3 or 5 end of an aptamer or other nucleic acid that changes the stability of the nucleic acid, prevents polymerase elongation of the nucleic acid, and/or increases the efficiency of nucleic acid dimer formation. By cap structure is meant chemical modifications, which have been incorporated into the ends of oligonucleotide (see, for example, Matulic-Adamic et al., U.S. Pat. No. 5,998,203). In non-limiting examples: a suitable 5-cap can be one selected from the group comprising inverted abasic residue; 4,5-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide, 4-thio nucleotide; carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3,4-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3-3-inverted nucleotide moiety; 3-3-inverted abasic moiety; 3-2-inverted nucleotide moiety; 3-2-inverted abasic moiety; 1,4-butanediol phosphate; 3-phosphoramidate; hexylphosphate; aminohexyl phosphate; 3-phosphate; 3-phosphorothioate; phosphorodithioate; or bridging or non-bridging methylphosphonate moiety.
[0091] In another non-limiting example, a suitable 3-cap can be selected from a group comprising, 4,5-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide; 4-thio nucleotide, carbocyclic nucleotide; 5-amino-alkyl phosphate; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate;
[0092] hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3,4-seco nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5-5-inverted nucleotide moiety; 5-5-inverted abasic moiety; 5-phosphoramidate; 5-phosphorothioate; 1,4-butanediol phosphate; 5-amino; bridging and/or non-bridging 5-phosphoramidate, phosphorothioate and/or phosphorodithioate, bridging or non bridging methylphosphonate and 5-mercapto moieties. For more details, see Beaucage and lyer, 1993, Tetrahedron 49:1925, which is incorporated by reference herein.
[0093] A variant of a first nucleic acid sequence refers to a second nucleic acid sequence that has one or more nucleotide substitutions relative to the first nucleic acid sequence.
[0094] Primers refer to single-stranded oligonucleotides which are complementary to sequence portions on a template nucleic acid molecule separated by a variable number of nucleotides. Primers annealed to the template nucleic acid can be extended by covalent bonding of nucleotide monomers during amplification or polymerization of a nucleic acid molecule catalyzed by the thermostable polymerases. Typically, primers are from 12 to 35 nucleotides in length and are preferably from 15 to 20 nucleotides in length. Primers are designed from known parts of the template, one complementary to each strand of the double strand of the template nucleic acid molecule, lying on opposite sides of the region to be synthesized. Primers can be designed and synthetically prepared as is well known in the art.
[0095] The term used herein forward primer means a primer complementary to a strand of a nucleic acid sequence aligned in a 3 to 5 direction. The reverse primer has a complementary sequence to the other strand of the nucleic acid sequence.
[0096] Template as used herein refers to a double-stranded or single-stranded nucleic acid molecule, which serves a substrate for nucleic acid synthesis. In the case of a double-stranded DNA molecule, denaturation of its strands to form a first and a second strand is performed before these molecules may be used as substrates for nucleic acid synthesis. A primer, complementary to a portion of a single-stranded nucleic acid molecule serving as the temple template is hybridized under appropriate conditions and an appropriate polymerase may then synthesize a molecule complementary to the template or a portion thereof. The newly synthesized molecule may be equal or shorter in length than the original template.
[0097] A target or target nucleic acid refers to a single or double stranded polynucleotide sequence sought to be copied or amplified in a reaction which includes a polymerase and an oligonucleotide primer.
[0098] The term hybridize as used herein refers to the binding, duplexing, or hybridizing of a nucleic acid molecule preferentially to a particular nucleotide sequence. Hybridization generally involves the formation of hydrogen bonds between two single strands of a polynucleotide.
[0099] The term complementary as used herein refers to the capacity for precise pairing between two nucleotides; i.e., if a nucleotide at a given position of a nucleic acid is capable of hydrogen bonding (e.g., via standard Watson-Crick base pairing and Hoogsteen-type hydrogen bonding) with a nucleotide of another nucleic acid to form a canonical base pair, then the two nucleic acids are considered to be complementary to one another at that position. Complementarity between two single-stranded nucleic acid molecules may be partial. Complementarity is complete, fully, or 100% when there are no mismatches between the two single-stranded nucleotide sequences. 100% complementarity along the full length of the sequences indicates that there are no mismatches between two nucleic acid strands which can hybridize and which are of identical length.
[0100] The term oligonucleotide as used herein refers to a sequence of nucleotide monomers, each bound to an adjacent nucleotide monomer by a covalent bond. An oligonucleotide may also include a non-nucleotide subunit or a nucleotide analog within the sequence of nucleotide monomers wherein the non-nucleotide subunit or nucleotide analog is bound to an adjacent subunit, analog or nucleotide by a covalent bond. bound by means of a covalent bond. The covalent bond between two adjacent nucleotide monomers in an oligonucleotide is a phosphodiester bond.
[0101] The term dried herein refers to a composition which has a water content of less than about 10%, 8%, 5%, 4%, 3%, 2%, 1% or 0.5%.
[0102] The polymerase chain reaction (PCR) is a reaction in which replicate copies are made of a target polynucleotide using one or more primers, and a catalyst of polymerization, such as a DNA polymerase, and particularly a thermally stable polymerase enzyme. Generally, PCR involves repeatedly performing a cycle of three steps: melting, in which the temperature is adjusted such that the DNA dissociates to single strands, annealing, in which the temperature is adjusted such that oligonucleotide primers are permitted to match their complementary base sequence using base pair recognition to form a duplex at one end of the span of polynucleotide to be amplified; and extension or synthesis, which may occur at the same temperature as annealing, or in which the temperature is adjusted to a slightly higher and more optimum temperature, such that oligonucleotides that have formed a duplex are elongated with a DNA polymerase. This cycle is then repeated until the desired amount of amplified polynucleotide is obtained. Methods for PCR amplification are taught, for example, in U.S. Pat. Nos. 4,683,195 and 4,683,202.
[0103] Specificity in primer extension or PCR amplification refers to the generation of a single, specific PCR product with the size and sequence predicted from the sequences of the primers and the genomic or transcribed region of nucleic acid to which the primers were designed to anneal in a base-complementary manner. Nonspecific PCR product has a size or sequence different from such prediction.
[0104] A target nucleic acid is that genomic or transcribed region of nucleic acid, the ends of which are base-complementary (with proper orientation) to primers included in a complete set of PCR reagents. A primer refers to a nucleic acid sequence, which is complementary to a known portion of a target nucleic acid sequence and which is necessary to initiate synthesis by DNA polymerase. Proper orientation is for the two primers to anneal to opposite strands of double-stranded target nucleic acid with their 3 ends pointing toward one another. Such primers are said to target the genomic or transcribed sequence to the ends of which they are base-complementary. An appropriate temperature, as referred to in the claims in regard to the PCR amplifications, indicates the temperature at which specific annealing between primers and a target nucleic acid sequence occurs.
[0105] Oligonucleotide refers to a synthetic or natural molecule comprising a covalently linked sequence of nucleotides which are joined by a phosphodiester bond between the 3 position of the pentose of one nucleotide and the 5 position of the pentose of the adjacent nucleotide.
[0106] Primer extension assay refers to an in vitro method wherein a primer hybridized to a complementary sequence part of a single-stranded nucleic acid template molecule is extended by sequential covalent bonding of nucleotides to the 3 end of the primer forming a new DNA molecule complementary to the DNA template molecule. The primer extension method transforms a single-stranded nucleic acid template into a partially or completely double-stranded nucleic acid molecule. The primer extension method as used herein is a single step nucleic synthesis process without amplification of the copy number of the template nucleic acid molecule.
[0107] The term modulate or regulate, as used herein, refers to a change in the activity of pyruvate dehydrogenase kinase (PDK). For example, modulation or regulation may cause an increase or a decrease in protein activity, binding characteristics, or any other biological, functional or immunological properties of the PDK.
[0108] The procedures disclosed herein which involve the molecular manipulation of nucleic acids are known to those skilled in the art. See generally Fredrick M. Ausubel et al. (1995), Short Protocols in Molecular Biology, John Wiley and Sons, and Joseph Sambrook et al. (1989), Molecular Cloning, A Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, which are both incorporated by reference.
II. Aptamer Inhibitors of Polymerase Activity
[0109] The present disclosure provides reversible inhibitors of thermostable polymerases for use in reactions which require primer extension by the polymerase. These reversible inhibitors are aptamers, nucleic acids which are designed to adopt a secondary structure comprising a stem and a loop. The aptamers are useful in reactions and assays that benefit from incorporating hot start and can improve the sensitivity and specificity of nucleic acid synthesis.
[0110] In some embodiments, the aptamer has a dumbbell structure (see, e.g.,
[0111] An example of a linear oligonucleotide which is predicted to fold into an aptamer with a stem and two loops is provided in
[0112] Accordingly, and with reference to
[0113]
[0114] The two loops (second and fourth polynucleotide sequences as described above and illustrated in
[0115] The stem which is positioned between the two loops of the aptamer is a double-stranded structure (formed by hybridization or annealing of the first and third polynucleotide sequences as described above and illustrated in
[0116] The aptamers comprising two loops as presently described can be in a closed or open form. In other words, in the closed form, there are no free ends of the aptamer polynucleotide. So, while the sequence maintains a 5 to 3 orientation as is well known in the art, the aptamer does not comprise a 5 end (e.g., 5 phosphate) or a 3 end (e.g., 3 hydroxyl). Instead, every nucleotide in the aptamer is bound to the adjacent neighbor by a covalent bond. In some embodiments, the covalent bond is a phosphodiester bond. In other embodiments, every covalent bond linking the nucleotide monomers in the aptamer is a phosphodiester bond. In an alternative embodiment, one strand of the aptamer stem comprises a non-nucleotide linking moiety such as a linker comprising DMT-ethane diol phosphoroamidite (C-2 spacer).
[0117] In some embodiments, the stem structure in the aptamer lacks a covalent bond between two of the nucleotides in only one of the strands of the stem. In these embodiments, the aptamer has a 5 end and a 3 end. As all nucleotides in the stem can remain hybridized to the opposite, fully complementary strand, the 5 and 3 ends remain adjacent to one-another when the aptamer is folded into its predicted secondary structure (see, e.g.,
[0118] To synthesize a aptamer having two loops and a stem according to the present disclosure, a linear oligonucleotide is synthesized in a 3 to 5 direction using routine chemical synthesis methods. To generate a closed aptamer as described above (having no 5 or 3 free ends), the desired aptamer sequence is first synthesized then denatured by heating and slowly cooled to room temperature to allow the oligonucleotide to anneal to form an aptamer having the desired predicted dumbbell structure. For example, the synthesized oligonucleotide can be denatured in a 5 mM HEPES-KOH buffer at pH 7.5 with 50 mL of a salt such as KCl at a temperature of about 95 C. then slowly cooled (about 45 minutes to 1 hour) to room temperature.
[0119] Ligation of the 5 and 3 ends can be achieved by chemical or enzymatic means (sec, e.g., Example 1) after synthesis, denaturation and annealing of the oligonucleotide as described above. Enzymatic ligation can be achieved through the use of T4 ligase wherein the 5 end of the synthesized oligonucleotide is phosphorylated and incubated with T4 ligase under appropriate conditions. Chemical ligation can be performed using, e.g. cyanogen bromide, or other methods routine in the art. In some embodiments, an oligonucleotide synthesized then first modified to place an amino group at the 5 end of the oligonucleotide. The 5-modified oligonucleotide is then incubated with imidazole-HCl (pH 6.0) and 16.7 mg EDC (1-Ethyl-e-(3-dimethylaminopropyl)carbodiimide) to ligate the 5 and 3 ends together, forming an aptamer with the predicted structure of 2 loops and a stem wherein every nucleotide within the aptamer is covalently bonded to 2 adjacent nucleotides.
[0120] To generate an aptamer having free 5 and 3 ends, the desired aptamer sequence can be chemically synthesized above wherein the first and last nucleotides in the synthetic oligonucleotide are the nucleotides which will be adjacent to one-another within a single strand of the stem structure (as described above and shown in
[0121] Aptamers which can bind to a polymerase and inhibit the polymerase activity as described above were designed to have 2 loops comprising the sequence TTCTTAGCGTTT (SEQ ID NO:3) as was determined by Yakimovich et al. (2003, Biochem (Moscow), 68:228-235) as being responsible for binding to the polymerase and effecting inhibition of polymerase activity when bound. In some embodiments, the loop sequence of SEQ ID NO:3 has 1 or 2 nucleotide substitutions. The two loops are separated by a stem comprising two complementary sequences of equal length. Accordingly, the aptamer structure, an example of which is shown in
[0122] The stem sequence, such as that comprised of SEQ ID NO:1 paired with SEQ ID NO:2, is AT-rich. For example, the stem sequence is 12-18 base pairs in length wherein at least 14, 15, or 16 of those base pairs are A-T base pairs. In some embodiments, the stem positioned between the two loops is 16 base pairs in length and comprises 14 A-T base pairs and two G-C base pairs. The two G-C base pairs can be adjacent to one another.
[0123] As described above, the aptamer can lack a covalent bond between two nucleotides present in one of the strands within the stem portion. For example, the stem strand comprising SEQ ID NO:1 and SEQ ID NO:2 or variants thereof can lack a covalent bond between nucleotides 1 and 2, 2 and 3, 3 and 4, 4 and 5, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15 or 15 and 16 of SEQ ID NO:1 or SEQ ID NO:2. Accordingly, the aptamer which lacks a covalent bond between the 2 nucleotides comprises a single 5 terminus and a single 3 terminus. As noted above, an aptamer comprising a single 5 terminus and a single 3 terminus can be chemically synthesized as a single-stranded oligonucleotide comprising the entire sequence of the aptamer. In other words, the synthesized single strand oligonucleotide comprises a 5 portion of a first stem sequence comprising SEQ ID NO:1 or a variant thereof, a first loop sequence comprising SEQ ID NO:3 or a variant thereof, a second stem sequence comprising SEQ ID NO:2 or a variant thereof, a second loop sequence or a variant thereof and the remaining 3 portion of the first stem sequence comprising SEQ ID NO:1 or a variant thereof. Once synthesized as a single strand nucleotide it can fold under appropriate conditions to have two loops separated by a single stem, wherein one strand of the stem does not have a covalent bond between 2 adjacent nucleotides. Not to be bound by theory, the lack of a covalent bond between 2 adjacent nucleotides in one strand of a predicted stem structure may allow flexibility, such as a bend, thereby facilitating interaction of each of the two predicted loop structures with the active site of the polymerase. The presence of two loops connected via a stem in the predicted dumbbell structure may increase the local concentration of the aptamer loops, leading to more efficient binding of the aptamer to the polymerase at lower temperatures such as about 25 C. to 30 C. Accordingly, less aptamer may be needed in a reaction mixture to provide the desired hot start functionality.
[0124] It was also determined that by designing a dumbbell aptamer which comprises free 5 and 3 ends (lacks a covalent bond between two nucleotides of one strand of the stem), the aptamer is still able to inhibit polymerase activity of a thermostable polymerase at temperatures at or below about 30 C. Variations in the open dumbbell aptamer sequence can affect the temperature below which polymerase activity is inhibited. In some embodiments, an open dumbbell aptamer inhibits polymerase activity at or below about 32 C., 35 C., 38 C., or 40 C. Particularly advantageous is the complete loss of polymerase activity inhibition by these open aptamer compositions at temperatures above 40 C., 45 C., 50 C. or 55 C.
[0125] Table 1 below provides exemplary first and third sequences as described above with respect to aptamers which anneal to form a predicted dumbbell structure, wherein the first and third polynucleotide sequences of an aptamer are complementary to each other and can anneal to form the predicted stem structure. It is understood that each 5 and 3 end of the first and third sequences below is ligated to one end of a loop structure. It is also understood that in some embodiments, one of the first and third polynucleotide sequences may lack a phosphodiester bond between two of the nucleotides within the first or third sequence. Additionally, any of these sequences predicted to form on strand of the predicted stem may have a nucleotide substitution at 1, 2 3 or 4 positions in the sequence. Accordingly, the opposite strand which is predicted to anneal to this strand has a fully complementary sequence.
TABLE-US-00001 TABLE1 DumbbellAptamerStemSequences SEQIDNO Sequence5.fwdarw.3 11 ATATTAAAAAATTATA 12 TATAATTTTTTAATAT 13 ATATTAAAATTATA 14 TATAATTTTAATAT 15 ATATTAAAAAATTATA 16 TATAATTTTTTAATAT 17 TTATTTTAAAATTATA 18 TATAATTTTAAAATAA 19 TTATTTTAAAATTATA 20 TATAATTCCAAAATAA 21 TTATTTTGGAATTATA 22 TATAATTGCAAAATAA 23 TTATTTTGCAATTATA 24 TATAATTCGAAAATAA 25 TTATTTTCGAATTATA 26 TTATTTTAAAATTATA 27 TATAATTTTAAAATAA 28 TTATTTTCCAATTATA 29 TATAATTGGAAAATAA 30 TTATTTTGCAATTATA 31 TATAATTGCAAAATAA 32 TTATTTTCGAATTATA 33 TATAATTCGAAAATAA 34 TATTTTAAAAATAT 35 ATATTTTTAAAATA 36 TATTTTTAAAATAT 37 ATATTTTAAAAATA 38 TATTTTAAAAATAT 39 ATATTTT-C2-spacer-TAAAATA 40 TATTTTTAAAATAT 41 ATATTTT-C2-spacer-AAAAATA
[0126] Table 2 below provides exemplary oligonucleotide sequences which can be synthesized and which are predicted to fold into an aptamer having two loops and a stem. The bolded nucleotides represent portions of a stem sequence which, when the oligonucleotide is folded as predicted, hybridizes to a second stem sequence indicated by the underlined portion.
TABLE-US-00002 TABLE2 DumbbellAptamersSynthesizedas LinearOligonucleotides SEQ IDNO Sequence5.fwdarw.3 42 CAAAATAATTCTTAGCGTTTTTATTTTGCAATTATA TTCTTAGCGTTTTATAATTG 43 CAATTATATTCTTAGCGTTTTATAATTGCAAAATAA TTCTTAGCGTTTTTATTTTG 44 TAAAATAATTCTTAGCGTTTTTATTTTAAAATTAT ATTCTTAGCGTTTTATAATTT 45 CAAAATAATTCTTAGCGTTTTTATTTTGGAATTA TATTCTTAGCGTTTTATAATTC 46 GAAAATAATTCTTAGCGTTTTTATTTTCGAATTA TATTCTTAGCGTTTTATAATTC 47 AAATTATATTCTTAGCGTTTTATAATTTTAAAATA ATTCTTAGCGTTTTTATTTTA 48 CAATTATATTCTTAGCGTTTTATAATTGGAAAATA ATTCTTAGCGTTTTTATTTTC 49 GAATTATATTCTTAGCGTTTTATAATTCGAAAATA ATTCTTAGCGTTTTTATTTTC 50 AAAATATTTCTTAGCGTTTATATTTTTAAAATATT CTTAGCGTTTTATTTTA 51 AAAATATTTCTTAGCGTTTATATTTTAAAAATATT CTTAGCGTTTTATTTTT 52 AAAATATTTCTTAGCGTTTATATTTT-C2-spacer- TAAAATATTCTTAGCGTTTTATTTTA 53 AAAATATTTCTTAGCGTTTATATTTT-C2-spacer- AAAAATATTCTTAGCGTTTTATTTTT 54 AAATTATATCTTAGCGTTTTATAATTTTTTAATA TTCTTAGCGTTTATATTAAA 55 AATTATATCTTAGCGTTTTATAATTTTAATA TTCTTAGCGTTTATATTAA 56 AAATTATATTCTTAGCGTTTTATAATTTTTTA ATATTTCTTAGCGTTTATATTAAA 57 AAATTATATTCTTAGCGTTTTATAATTTTAAAA TAATTCTTAGCGTTTTTATTTTA
[0127] In other embodiments described herein, the aptamer is designed to form a hairpin structure wherein the aptamer is predicted to comprise a single stem having two single strands which are complementary and terminating in a single loop. The single stem in the predicted hairpin structure as described herein comprises a first polynucleotide sequence which is annealed to a third polynucleotide sequence wherein the first and third polynucleotide sequences are complementary and are equal in length. The 3 end of the first polynucleotide sequence is covalently bound to the 5 end of a second polynucleotide sequence which is predicted to form a single stranded loop in the predicted hairpin aptamer, and the 3 end of the second polynucleotide sequence is covalently bound to the 5 end of the third polynucleotide sequence. Table 3 below provides some exemplary oligonucleotide sequences for the first and/or third polynucleotide sequences in the hairpin aptamer. It is understood that any of these sequences may have a nucleotide substitution at 1, 2 3 or 4 positions in the sequence. In preferred embodiments, the second polynucleotide sequence which is predicted to form a loop comprises TTCTTAGCGTTT (SEQ ID NO:3).
TABLE-US-00003 TABLE3 HairpinAptamerStemSequences SEQIDNO Sequence5.fwdarw.3 58 TTATTTTAAAATTATA 59 TATAATTTTAAAATAA 60 TATTTTTAAAAATATA 61 TATATTTTTAAAAATA 62 TTAATTTAAATTTATA 63 TATAAATTTAAATTAA 64 TTAATTTTAAAATATA 65 TATATTTTAAAATTAA 66 TTATTTTTAAAAAATA 67 TATTTTTTAAAAATAA 68 TTATATTTAAATTATA 69 TATAATTTAAATATAA 70 TATATTTTTAAAAA 71 TAATTTTTAAAAATAT 72 TAATTTTAAAAAATA 73 TATTTTTTAAAATTA 74 TTATTTTTAAAAAAT 75 ATTTTTTAAAAATAA 76 TAATTTTAAAAAAT 77 ATTTTTTAAAATTA 78 TAATTTTAAAAAT 79 ATTTTTAAAATTA 80 CAATTTTAAAAAT 81 ATTTTTAAAATTG
[0128] In some embodiments, the hairpin aptamers have 5 and/or 3 overhangs which represent a full or partial sequence of SEQ ID NO:3 or a variant thereof. An example of a hairpin aptamer according to the present disclosure is provided in
[0129] To synthesize the hairpin aptamer, oligonucleotides can be chemically synthesized based on the sequences shown in Table 4 below. The underlined bases indicate the 3 and 5 portions of SEQ ID NO:3 (cut loop). The bolded bases indicate stem sequences which are fully complementary to one another and which are predicted to hybridize when the aptamer is folded into a hairpin structure. SEQ ID NO:79 illustrates a hairpin structure in which the 3 overhang represents the full loop sequence of SEQ ID NO:3 while SEQ ID NO:80 illustrates a hairpin structure in which the 5 overhang represents the full loop sequence of SEQ ID NO:3. SEQ ID NO:84 is an example of a hairpin aptamer with a 3 overhang in which a 5 portion of a sequence consisting of SEQ ID NO:3 is covalently linked to the 3 end of one stem sequence, the remaining 3 portion of the sequence consisting of SEQ ID NO:3 is covalently linked to the 5 end of the complementary stem sequence, and there is no covalent (e.g., phosphodiester) bond between nucleotides 7 and 8 of the sequence consisting of SEQ ID NO:3.
TABLE-US-00004 TABLE4 HairpinAptamerSynthesizedas LinearOligonucleotides SEQID NO Sequence5.fwdarw.3 82 GCGTTTTTATTTTAAAATTATATTCTTAGCGTTTTATAATTTTAAAATAATTCTTA 83 TTATTTTAAAATTATATTCTTAGCGTTTTATAATTTTAAAATAATTCTTAGCGTTT 84 TTCTTAGCGTTTTTATTTTAAAATTATATTCTTAGCGTTTTATAATTTTAAAATAA 85 GCGTTTTATAATTTTAAAATAATTCTTAGCGTTTTTATTTTAAAATTATATTCTTA 86 TTCTTAGCGTTTTATAATTTTAAAATAATTCTTAGCGTTTTTATTTTAAAATTATA 87 TATAATTTTAAAATAATTCTTAGCGTTTTTATTTTAAAATTATATTCTTAGCGTTT 88 CGTTTTTATTTTAAAATTATATTCTTAGCGTTTTATAATTTTAAAATAATTCTTAG 89 AGCGTTTTTATTTTAAAATTATATTCTTAGCGTTTTATAATTTTAAAATAATTCTT 90 GTTTTTTATTTTAAAATTATATTCTTAGCGTTTTATAATTTTAAAATAATTCTTAGC 91 TAGCGTTTTTATTTTAAAATTATATTCTTAGCGTTTTATAATTTTAAAATAATTCT 92 GCGTTTTATTTTTAAAAATATATTCTTAGCGTTTTATATTTTTAAAAATATTCTTA 93 GCGTTTTTAATTTAAATTTATATTCTTAGCGTTTTATAAATTTAAATTAATTCTTA 94 GCGTTTTTAATTTTAAAATATATTCTTAGCGTTTTATATTTTAAAATTAATTCTTA 95 GCGTTTTTATTTTTAAAAAATATTCTTAGCGTTTTATTTTTTAAAAATAATTCTTA 96 GCGTTTTTATATTTAAATTATATTCTTAGCGTTTTATAATTTAAATATAATTCTTA 97 CGTTTTTATTTTTAAAAAATATTCTTAGCGTTTTATTTTTTAAAAATAATTCTTAG 98 GTTTTTATTTTTAAAAAATATTCTTAGCGTTTTATTTTTTAAAAATAATTCTTAGC 99 CGTTTATATTTTTAAAAATTATTCTTAGCGTTTTAATTTTTAAAAATATTTCTTAG 100 GTTTATATTTTTAAAAATTATTCTTAGCGTTTTAATTTTTAAAAATATTTCTTAGC 101 GTTTTAATTTTAAAAAATATTCTTAGCGTTTTATTTTTTAAAATTATTCTTAGC 102 GTTTTTATTTTTAAAAAATTTCTTAGCGTTTATTTTTTAAAAATAATTCTTAGC 103 GTTTTAATTTTAAAAAATTTCTTAGCGTTTATTTTTTAAAATTATTCTTAGC 104 GTTTTAATTTTAAAAATTTCTTAGCGTTTATTTTTAAAATTATTCTTAGC 105 GTTTCAATTTTAAAAATTTCTTAGCGTTTATTTTTAAAATTGTTCTTAGC
Aptamer Inhibition Activity
[0130] Also contemplated is a method for reversibly inhibiting polymerase activity comprising incubating an aptamer as described herein with a thermostable polymerase. The aptamers of the present disclosure were designed to bind to a thermostable polymerase and inhibit the polymerase activity of that polymerase at lower temperatures, then dissociate from the polymerase as the reaction temperature is raised. In some embodiments, the thermostable polymerase is selected from but not limited to DNA polymerases from thermophilic Eubacteria or Archaebacteria, including but not limited to, Thermus aquaticus, T. thermophilus, T. bockianus, T. flavus, T. rubber, Thermococcus litoralis, Pyroccocus furiousus, P. wosei, Pyrococcus spec. KGD, Thermatoga maritime, Thermoplasma acidophilus, and Sulfolobus spec. In some embodiments the polymerase may be a reverse transcriptase functional between 55-60 C., including but not limited to, MmLV reverse transcriptase, AMV reverse transcriptase, RSV reverse transcriptase, HIV-1 reverse transcriptase, and HIV-2 reverse transcriptase.
[0131] The ability of the aptamer to bind to and inhibit, then dissociate from the polymerase depends in part upon its secondary structure in the reaction mixture. Aptamers of the present disclosure have melting temperatures ranging from about 45 C. to 70 C. In some embodiments, the closed (ligated) dumbbell aptamers have higher melting temperatures, ranging from about 60 C. to 70 C., 60 C. to 65 C. or 65 C. to 70 C., while the open dumbbell aptamers lacking a phosphodiester bond in one strand of the stem have a melting temperature ranging from about 45 C. to 55 C., 45 C. to 50 C., 50 C. to 55 C., or 48 C. to 53 C. Melting temperatures are determined in some embodiments at an aptamer concentration of about 8 M in a buffered solution having a pH of about 8. The buffered solution in some embodiments comprises 3 mM MgCl.sub.2, 15 KCl, 25 mM HEPES, pH 8.0. Melting temperatures for each aptamer can be measured using a UV-Vis-NIR spectrophotometer (see, e.g., Example 2).
[0132] While the loss of secondary structure of an inhibitory aptamer can result in a decrease in the aptamer's ability to remain bound to and inhibit a polymerase, dissociation from the polymerase with increasing temperatures can depend on other factors such as the primary sequence of the aptamer and the interface between the aptamer and the polymerase. Accordingly, contemplated and described are aptamers that inhibit, reduce or eliminate thermostable polymerase activity at temperatures below about 50 C., 45 C., 44 C., 43 C., 42 C., 41 C., 40 C., 39 C. or 38 C. In some embodiments, the aptamer and polymerase are in a solution having a pH of about 6-8, 6-9, 7-8, 7-9, or 8-9.
[0133] The ability of an aptamer to inhibit, reduce or eliminate the polymerase activity of a thermostable polymerase can be measured and quantified using an assay which measures the polymerase activity in the presence or absence of the aptamer at varying temperatures. It is understood that several alternative methods may be used to measure the ability of an aptamer to inhibit polymerase activity in a temperature-dependent way, only some of which are briefly described here.
[0134] One method for measuring the inhibitory effects of an aptamer on the activity of a thermostable polymerase is exemplified in Example 3 below and further described in Nikiforov et al., 2011, Analytical Biochemistry, 412:229-236. Specifically, a hairpin template is provided in which a fluorescent label (e.g., fluorescein (FAM; 5-Dimethoxytrityloxy-5-[N-((3,6-dipivaloylfluoresceinyl)-aminohexyl)-3-acrylimido]-2-deoxyUridine-3-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite) dT residue) is incorporated near the 3 end (e.g., 2, 3, 4 or 5 bases away from the 3 end of the oligonucleotide substrate). To a PCR reaction mixture (e.g., 50 mM Tris-HCl, pH 8.3, 50 mM NaCl, 5 mM MgCl.sub.2, and 2 L of 2 mM dATP), a polymerase preparation is added wherein the polymerase is in the presence or absence of the inhibitor aptamer. In some embodiments comprising both polymerase and inhibitor aptamer, about 0.8 M polymerase is mixed with 8 M aptamer (1:10 ratio). In other embodiments, the polymerase/aptamer ratio is about 1:5 to 1:15 or about 1:5 or 1:15. After addition of polymerase to the PCR reaction mix containing the labeled hairpin substrate, the reaction is heated from about 25 C. to 75 C. and the FAM signal is measure using a standard dissociation curve program (e.g., Mx3005P, Agilent Technologies) to determine the temperature at which the polymerase is active, and the temperature below which the polymerase is inhibited by the aptamer.
[0135] Another method for measuring thermostable polymerase activity in the presence and
[0136] absence of an aptamer involves use of an oligonucleotide substrate for the polymerase which forms a hairpin structure having a stem and a loop, wherein the stem has a long single-stranded portion which terminates at the 3 end. A quencher (e.g., N,N-tetramethyl-rhodamine, TAMRA) is attached to the stem near the 5 end of the loop and a fluorescent dye (e.g., carboxyfluorescein, FAM) is attached to the stem near the 3 end of the loop. The fluorescence of the dye is quenched through resonance energy transfer by the quencher when the aptamer substrate is in its predicted folded structure until a oligonucleotide primer is added and allowed to anneal to the 3 end of the stem single-stranded portion and is extended to synthesize the complementary strand by the polymerase, resulting in opening of the loop and spatial separation of the quencher and dye. The polymerase and aptamer are mixed in an appropriate solution of reagents at least including nucleotide triphosphates, a divalent metal cation, an appropriate buffer and primer and fluorescence is measured over time, with fluorescence increasing at a rate proportional to the polymerase activity. The kinetics of enzymatic DNA synthesis exhibit Michaelis-Menten dependence on substrate concentration. Accordingly, inhibition profiles for various aptamers can be generated by running a series of polymerase reactions in the presence of increasing amounts of aptamer. The resulting data can be used to determine an IC.sub.50 value for each aptamer (Summerer and Marx, Angew Chem Int, 2002, 41:3620-3622). Moreover, IC.sub.50 values for each aptamer can be determined over a range of temperatures.
[0137] A third alternative method for measuring the ability of an aptamer as described herein to inhibit a thermostable polymerase in a temperature-dependent manner is by using a template oligonucleotide DNA molecule which is labeled at its 5 end with .sup.32P--ATP and which forms a hairpin wherein a 5 portion (e.g., 12-24 nucleotides) of the oligonucleotide is single-stranded followed by a double-stranded stem and small loop. As above, the thermostable polymerase is incubated with varying concentrations of an aptamer as described herein, then added to the substrate and standard PCR reaction mixture and the PCR reaction is allowed to proceed for a set period of time (e.g., 45 min. to 1 hour) at different temperatures (e.g., 25 C. to 75 C.), stopped by the addition of EDTA, and then resolved using polyacrylamide gel electrophoresis. Standard phosphorimager detection and quantitation methods can be used to determine polymerase activity level as only when the polymerase is active (not inhibited by the aptamer at a given temperature) will the 3 end of the hairpin substrate be extended to form a longer product which is radio-labeled and detected. As with the assays above, an IC.sub.50 for each aptamer at a given temperature can be determined by quantitation and analysis.
[0138] The use of the aptamers described herein for hot start polymerase applications which can decrease nonspecific product generation relies on the ability of the aptamer to dissociate from the polymerase as the temperature. Accordingly, an aptamer according to the present disclosure dissociates from a thermostable polymerase when a reaction mixture containing the aptamer and the polymerase is raised to a temperature of at least about 45 C., 50 C., 55 C., 60 C., 65 C., 70 C., 75 C., or 80 C. As a loss of inhibition of the polymerase is a likely indication of aptamer dissociation from the polymerase, in other embodiments, a reversibly inhibitory aptamer of the present disclosure does not inhibit thermostable polymerase activity when the reaction mixture containing the aptamer and the polymerase is raised to a temperature of at least about 45 C., 50 C., 55 C., 60 C., 65 C., 70 C., 75 C., or 80 C. It is understood that the temperature above which an aptamer no long inhibits polymerase activity depends on the sequence, composition and inherent structure of the aptamer in solution with the polymerase. Accordingly, any aptamer sequence as described herein may be further characterized or defined by its lack of polymerase activity inhibition at or above a specified temperature.
[0139] Moreover, any aptamer sequence and predicted structure as described herein may be further characterized or defined by its ability to inhibit polymerase activity at or below a specified temperature. In some embodiments, the aptamer inhibits the polymerase by 95%-100%, 98% to 100% or by about 100% relative to polymerase activity in the absence of the aptamer at or below a temperature of about 25 C., 30 C., or 35 C. As the temperature of the mixture containing the aptamer and the polymerase is raised, there will be a corresponding loss of inhibition. Experimental studies suggest that a transition from about 95% to 100% of polymerase activity to loss of substantially all inhibition can occur over a temperature range of about 4 C. to 10 C., or 5 C. to 7 C.
[0140] Inhibition of polymerase activity by an aptamer as described herein can also be affected by the concentration of the aptamer and polymerase in a mixture or by the ratio of aptamer: polymerase. For example, the aptamer is effective in inhibiting polymerase activity when the aptamer is present in the mixture at a concentration of about 100 nM to 1000 nM, 100 nM to 500 nM, 25 nM to 750 nM, for 500 nM to 1000 nM. The aptamers described are useful for reversibly inhibiting thermostable polymerases including DNA polymerases, RNA polymerases and reverse transcriptases.
[0141] The ability of the aptamers provided herein to inhibit polymerase activity at ambient temperatures or at temperatures lower than temperatures which are optimal for polymerase activity is advantageous for at least the reason that there will be a decrease in or elimination of non-specific products generated at these lower temperatures. As shown at least in Examples 4 and 5 and
Applications
[0142] As described above, aptamers of the present disclosure have the ability to reversibly inhibit thermostable polymerases at ambient temperatures or temperatures below the optimal temperatures for various thermostable polymerases. These aptamers thus can readily be applied to any applications wherein a thermostable nucleotide polymerase is used and wherein it is desirable to have the polymerase activity turned off at a lower temperature but then be able to regain its activity at a higher temperature (hot start). Such applications include but are not limited to standard PCR, reverse transcriptase PCR, in-situ PCR, quantitative PCR, and minisequencing or other reactions involving primer extension in which a thermostable polymerase present and a hot-start method is advantageous. Such methods are well known in the art. In some embodiments, the increased sensitivity and specificity provided by the disclosed compositions is useful during the amplification and analysis of DNA and RNA in medical genetics research and diagnosis, pathogen detection, forensic analysis, and animal and plant genetics applications. The methods and compositions of the present disclosure are useful in any polynucleotide synthesis reaction that requires thermostable polymerase to cycle anywhere between 40 C. and 80 C.
[0143] Examples 4 and 5 below describe PCR experiments performed using Taq polymerase in the presence or absence of an aptamer according to the present disclosure. These studies demonstrate the ability of the aptamers described herein to both decrease generation of non-specific amplification products as well as increase quantities of target amplicons in the reaction mix. Example 4 describes a biplex PCR reaction containing genomic DNA and 2 primer pairs for amplification of two target sequences. Prior to initiating a PCR reaction by addition of the thermostable polymerase, 4 units of Taq polymerase was incubated with 200 nM prior to adding the Taq to the PCR master mix. In this particular experiment, an unligated (open) dumbbell aptamer was used which was shown (Example 2) to have a melting temperature of about 42 C. Detection and analysis of fluorescence signals as well as gel analysis of the PCR products show effects on both non-specific product generation and on the quantity of target amplicon production. It is contemplated that any of the aptamers described herein which have melting temperatures below the optimal temperature of the thermostable polymerase in the reaction mix can enhance target amplicon generation and detection.
[0144] Example 5 explores varying ratios of aptamer: thermostable polymerase on non-specific product and target amplicon generation. Ratios ranging from about 2.5:1 to 15:1 were tested. While all ratios resulting in generation of the desired product, the 15:1 ratio was most effective in reducing non-specific product generation while maintaining levels of target amplicon generation.
[0145] Accordingly, contemplated herein are methods which involve using a thermostable polymerase to extend a primer which is annealed to a nucleotide template or substrate molecule. As well understood in the art, wherein the primer is extended by the polymerase in the presence of nucleotides (e.g., the deoxyribonucleotides, dATP, dGTP, dCTP, dTTP), a divalent metal cation such as Mg.sup.2+ or Mn.sup.2+, a buffer, and at least one primer.
[0146] In some embodiments, the inhibitors described herein may be used in combination with other hot-start technologies such as antibody-based hot start. In other embodiments, for example, two or more aptamers which dissociate from a polymerase at different temperatures may be combined in a single reaction.
Exemplary Automation and Systems
[0147] In some embodiments, a target nucleic acid sequence is copied or amplified, then detected using an automated sample handling and/or analysis platform. In some embodiments, commercially available automated analysis platforms are utilized. For example, in some embodiments, the GeneXpert system (Cepheid, Sunnyvale, Calif.) is utilized.
[0148] The present disclosure is illustrated for use with the GeneXpert system. Exemplary sample preparation and analysis methods are described below. However, the present disclosure is not limited to a particular detection method or analysis platform. One of skill in the art recognizes that any number of platforms and methods may be utilized.
[0149] The GeneXpert utilizes a self-contained, single use cartridge. Sample extraction, amplification, and detection may all be carried out within this self-contained laboratory in a cartridge. (See e.g., U.S. Pat. Nos. 5,958,349, 6,403,037, 6,440,725, 6,783,736, 6,818,185; each of which is herein incorporated by reference in its entirety.)
[0150] Components of the cartridge include, but are not limited to, processing chambers containing reagents, filters, and capture technologies useful to extract, purify, and amplify target nucleic acids. A valve enables fluid transfer from chamber to chamber and contains nucleic acids lysis and filtration components. An optical window enables real-time optical detection. A reaction tube enables very rapid thermal cycling.
[0151] In some embodiments, the GenXpert system includes a plurality of modules for scalability. Each module includes a plurality of cartridges, along with sample handling and analysis components.
[0152] After the sample is added to the cartridge, the sample is contacted with lysis buffer and released DNA is bound to a DNA-binding substrate such as a silica or glass substrate. The sample supernatant is then removed and the DNA eluted in an elution buffer such as a Tris/EDTA buffer. The eluate may then be processed in the cartridge to detect target genes as described herein. In some embodiments, the eluate is used to reconstitute at least some of the PCR reagents, which are present in the cartridge as lyophilized particles.
[0153] In some embodiments, PCR is used to amplify and detect the presence of the target nucleic acid sequence and/or a nucleic acid sequence that indicates genomic copy number. In some embodiments, the PCR uses Taq polymerase with hot start function imparted by use of an aptamer as provided herein.
Kits
[0154] Kits for detecting a nucleic acid target sequence present in solid, semi-solid, or liquid biological samples are also provided. The kit includes a reagent mix comprising a thermostable polymerase and an aptamer as described herein that can reversibly inhibit activity of the polymerase. In some embodiments, the kit can be used for detection, quantifying or sequencing any target nucleic acid. Alternatively, the kit includes one or more oligonucleotide primers (e.g., a forward and/or reverse primer) that specifically hybridize to a specified target nucleic acid and may also include labeled primers and/or probes as is routine in the art.
[0155] The kits may include instructions for obtaining biological samples and contacting them with sample buffer, for mixing the samples with sample buffer, placing labels on the apparatus and recording relevant test data; for shipping the apparatus, and the like. The kits may include instructions for reading and interpreting the results of an assay. The kits may further comprise reference samples that may be used to compare test results with the specimen samples.
EXAMPLES
Example 1
Oligonucleotide Synthesis and Ligation
[0156] Aptamers as described herein were synthesized using standard oligonucleotide synthesis methods. Oligonucleotide synthesis was performed on a MerMade 12 DNA Synthesizer (BioAutomation). Standard phosphoramidite synthesis cycles were used, and coupling time was increased to 360 seconds for modified phosphoramidites. Cleavage from the solid support and deprotection was carried in concentrated aqueous ammonia at RT for 24 hrs. HPLC analyses were done on an Agilent 1100 instrument equipped with a quaternary pump, autosampler, and diode array detector. Oligonucleotides were analyzed using reversed-phase HPLC (RP HPLC) on a C18 Gemini column (4.6 mm250 mm, 5 um, Phenomenex) eluting with a linear gradient of acetonitrile/0.1 M triethylammonium bicarbonate, pH 7:16-23% acetonitrile over 20 min for DMT-on oligonucleotides and 7-14% acetonitrile for oligonucleotides with DMT groups removed (DMT-off). DMT-on oligonucleotides were purified using reverse phase HPLC, DMT groups were cleaved, and the final oligonucleotide products were isolated by ethanol precipitation and quantified by UV.
[0157] Where indicated, some aptamers were modified at the 5 and/or 3 end after synthesis. 5 and 3 phosphorylation was achieved using (3-(4,4-Dimethoxytrityloxy)-2,2-(dicarboxymethylamido)propyl-1-O-succinoyl-long chain alkylamino-CPG) (Glen Research Cat. No. 10-1901; U.S. Pat. No. 5,959,090 and EP Pat. No. EP0816368) and (3-(4,4-Dimethoxytrityloxy)-2,2-dicarboxyethyl]propyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite) (Glen Research Cat. No. 20-2903; U.S. Pat. No. 5,959,090). Modification of the 5 end with an amino group was achieved using 5-Amino-dT-CE Phosphoramidite (Glen Research Cat. No. 10-1932), (5-monomethoxytritylamino-2-deoxyThymidine, 3-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite). Modification of the 3 end with a propanediol spacer CPG (-C3) was achieved using ((1-Dimethoxytrityloxy-propanediol-3-succinoyl)-long chain alkylamino-CPG) (Cat. No. 20-2913).
[0158] To produce ligated dumbbell aptamers, oligonucleotides synthesized as above were ligated either enzymatically or chemically. For enzymatic ligation, 1 mL of 16 M 5-phosphate-modified oligonucleotide in a 50 mM KCl solution was heated to 95 C. for 5 min in a heating block and slowly cooled to room temperature in the same heating block by switching the power off to allow annealing (intramolecular hybridization) of the oligonucleotide. 900 L of the annealed oligonucleotide was mixed with 100 L T4 ligation buffer, then with 10 L T4 ligase (New England BioLabs) and left overnight at 16 C. Ligated aptamer was purified by RP-HPLC method.
[0159] To produce chemically ligated aptamers, 5 ((amino)-T))-modified oligonucleotide (220 M) in 5 mM HEPES-KOH buffer pH 7.5 and 50 mM KCl was denatured at 95 C. for 5 min. followed by slow (approximately 1 hr) cooling-annealing to room temperature. Then 100 L of annealed oligonucleotide was mixed with 66.7 L 0.1 M imidazole-HCl (pH 6.0) and 16.7 mg EDC (1-Ethyl-e-(3-dimethylaminopropyl)carbodiimide). After a brief vortexing and centrifugation, an additional 266 L of 0.1 M imidazole-HCl (pH 6.0) was supplied to the reaction and mix was left overnight at room temperature. Ligated oligonucleotide was purified by RP-HPLC.
Example 2
Melting Temperature (Tm) Determination
[0160] UV-melt curve analysis was performed for various aptamers generated according to Example 1 above. Oligonucleotides were prepared at a concentration of 1 M in buffer (3 mM MgCl.sub.2, 15 KCl, 25 mM HEPES, pH 8.0) and analyzed using an Agilent Technologies Cary 4000 Series UV-Vis-NIR spectrophotometer and associated software according to the manufacturer's instructions. Results are presented below in Table 5. As expected, the Tm's of unligated dumbbell aptamers are lower than Tm's of the ligated dumbbell aptamers.
TABLE-US-00005 TABLE5 SEQ ID Tm LinearOligonucleotideSequence(5.fwdarw.3) NO (C.) Description (includingterminalmodificationsifpresent) 54 63.1 Ligated(closed) AAATTATATCTTAGCGTTTTATAATTTTTTAATATTCTT dumbbell AGCGTTTATATTAAA 55 60.2 Ligated AATTATATCTTAGCGTTTTATAATTTTAATATTCTTAG (closed)dumbbell CGTTTATATTAA 56 62.7 Ligated(closed) AAATTATATTCTTAGCGTTTTATAATTTTTTAATATTTC dumbbell TTAGCGTTTATATTAAA 95 55.3 hairpin GCGTTTTTATTTTTAAAAAATATTCTTAGCGTTTTATTT TTTAAAAATAATTCTTA-C3 96 52.9 hairpin GCGTTTTTATATTTAAATTATATTCTTAGCGTTTTATA ATTTAAATATAATTCTTA-C3 97 55.5 hairpin CGTTTTTATTTTTAAAAAATATTCTTAGCGTTTTATTTT TTAAAAATAATTCTTAG-C3 98 55.5 hairpin GTTTTTATTTTTAAAAAATATTCTTAGCGTTTTATTTTT TAAAAATAATTCTTAGC-C3 99 56.6 hairpin CGTTTATATTTTTAAAAATTATTCTTAGCGTTTTAATTT TTAAAAATATTTCTTAG-C3 57 63 Ligated(closed) AAATTATATTCTTAGCGTTTTATAATTTTAAAATAATT dumbbell CTTAGCGTTTTTATTTTA 88 55 hairpin CGTTTTTATTTTAAAATTATATTCTTAGCGTTTTATAAT TTTAAAATAATTCTTAG-C3 89 54.4 hairpin TAGCGTTTTTATTTTAAAATTATATTCTTAGCGTTTTAT AATTTTAAAATAATTCT-C3 90 54.6 hairpin GTTTTTATTTTAAAATTATATTCTTAGCGTTTTATAATT TTAAAATAATTCTTAGC-C3 91 54.4 hairpin TAGCGTTTTTATTTTAAAATTATATTCTTAGCGTTTTAT AATTTTAAAATAATTCT-C3 92 55.2 hairpin GCGTTTTATTTTTAAAAATATATTCTTAGCGTTTTATA TTTTTAAAAATATTCTTA-C3 93 54.5 hairpin GCGTTTTTAATTTAAATTTATATTCTTAGCGTTTTATA AATTTAAATTAATTCTTA-C3 94 55.2 hairpin GCGTTTTTAATTTTAAAATATATTCTTAGCGTTTTATA TTTTAAAATTAATTCTTA-C3 100 56.2 hairpin GTTTATATTTTTAAAAATTATTCTTAGCGTTTTAATTTT TAAAAATATTTCTTAGC-C3 44 45 Non-ligated (amino)- dumbbell TAAAATAATTCTTAGCGTTTTTATTTTAAAATTATATT CTTAGCGTTTTATAATTT-p 44 42 Non-ligated TAAAATAATTCTTAGCGTTTTTATTTTAAAATTATATT dumbbell CTTAGCGTTTTATAATTT-C3
Example 3
Polymerase Inhibition
[0161] Studies are done to measure the inhibitory activity of aptamers described herein as a function of temperature. Polymerase activity of Taq polymerase in the presence of aptamers is assayed by a method described in the art (Nikiforov T., Analytical Biochemistry, 412:229-236 (2011) with the following modification. Because the aptamers of the present invention inhibit Taq polymerase activity above ambient temperature, the structure of the hairpin substrate is modified to increase its Tm. Hairpin substrate TTTTTTTGCAGGTGACAGGCGCGAAGCGCCTGTCACCXGC (SEQ ID NO:6), wherein X denotes a fluorescein dT residue is used in the assay. To a solution of 150 nM of the hairpin substrate in 50 mM Tris-HCl, 50 mM NaCl, 5 mM MgCl.sub.2, and Taq polymerase, 2 L of 2 mM dATP is added, and the FAM signal is monitored while the reaction mixture is heated from 25 C. to 74 C. using the standard dissociation curve program (Mx3005P, Agilent). The assays measure the reversible inhibition activity of the aptamers whereby polymerase activity is regained upon heating of the reaction mixture. The temperature at which inhibition is lost depends on the sequence and structure of the aptamer.
Example 4
Hot Start Activity
[0162] To test the ability of aptamers designed as described herein to reduce non-specific product generation in a PCR reaction, a human genomic biplex PCR amplification assay was performed in which two regions of the beta-globin gene were detected followed by post-PCR melt curve analysis using Eva-Green. The two primer pairs had the sequences: AAAAGGCATTCCTGAAGCTGACAGCATTC (SEQ ID NO:7, forward primer 1) and GAGAGAGTAGCGCGAGCACAGCTA (SEQ ID NO:8, reverse primer 1); and AAAACCTGCCTTCTGCGTGAGATTCT (SEQ ID NO:9, forward primer 2) and CTGTACGAAAAGACCACAGGGCCCAT (SEQ ID NO:10, reverse primer 2). The PCR master mix, prepared at room temperature, contained 100 M dNTPs, 5 mM MgCl.sub.2, 25 mM HEPES, pH 8.5, X1 EvaGreen (1 concentration), human genomic DNA (1000 copies/reaction), 0.30% Tween 20, and 1 mg/mL BSA. 4 u Taq DNA polymerase (GMP Taq, Roche Diagnostics) was added to each reaction from a 0.25 u/L preparation. An aptamer comprising CAAAATAATTCTTAGCGTTTTTATTTTGCAATTATATTCTTAGCGTTTTATAATTG-C3 (SEQ ID NO:106) was added to selected reactions at a concentration of 200 nM. The reactions were initiated by the addition of Taq or Taq plus aptamer. Where aptamer was included in the reaction, the Taq and aptamer were premixed at room temperature just prior to addition to the PCR master mix. The Stratagene Mx3005P 96 well-plate system (Agilent Technologies) was used to run and analyze the PCR reactions. Cycling conditions were as follows: 95 C. for 100 s, 45 cycles of 95 C. for 8 s and 68 C. for 30 s, then 95 C. for 10 s, 60 C. for 30 s, concluding with melt curve analysis at 60 C. to 95 C. over a 20 min period.
[0163] Results in which product generation measured by an increase in fluorescence vs. cycle number (
Example 5
Hot Start PCR
[0164] As described herein, aptamers can reversibly inhibit polymerase activity at temperatures below the optimal reaction temperature for the polymerase. Studies were done to evaluate the effects of varying aptamer:Taq (T. aquaticus DNA polymerase) ratios using the Xpert C. difficile/Epi Assay (Cepheid), and to determine an optimal aptamer:Taq ratio with respect to target product and non-specific product generation. The aptamer used in the present the aptamer described herein example is as SEQ ID NO:106 (CAAAATAATTCTTAGCGTTTTTATTTTGCAATTATATTCTTAGCGTTTTATAATTG-C3), modified at its 3 end with a propanediol spacer CPG as described in Example 1.
[0165] Live C. difficile cells at 3 concentrations (275, 92, or 23 CFU/test) in a human stool background matrix were used in the assay. The experiment was run in open cartridges on the GeneXpert instrument with all wet master mixes prepared on the day of the experiment. 48 units of Taq polymerase was used in each reaction and were run in parallel with an AptaTaq control (Roche Diagnostics). All solutions of Aptamer:Taq were stored in 10% glycerol. Aptamer:Taq ratios of 2.5:1, 5:1, 10:1 and 15:1 were tested. Eight replicates were run for each condition. At the end of the GeneXpert runs, amplicon was collected from the PCR tubes of the cartridges and evaluated in an Agilent DNA 1000 chip via the 2100 Agilent Bioanalyzer (Agilent Technologies). Only the 1LoD (equivalent to 92 CFU/test) samples were selected to be evaluated in duplicates in the Agilent system.
[0166] Amplicon lengths for the targets of interest are as follow: 81 bp for toxin B (tcdB), 91 bp for tcdC deletion nt 117, 133 bp for SPC (sample-processing control) and 143 bp for binary toxin (cdt). Non-specific bands at 210 bp were observed in all reaction mixtures tested but were the faintest for the 15:1 Aptamer:Taq ratio. The non-specific bands at 210 and 400 bp were the most prominent for the 2.5:1 Aptamer:Taq ratio (data not shown).
[0167] Furthermore, the binary toxin end points increased as the amount of non-specific binding decreased (data not shown). The lowest binary toxin end points were observed with the 2.5:1 Aptamer:Taq ratio. The highest binary toxin end points were observed with the 15:1 Aptamer:Taq ratio. This suggests that more of the target binary toxin product was made when non-specific amplification was limited. The results of this study suggest that an Aptamer:Taq ratio of 15:1 for the aptamer comprising SEQ ID NO:106 is optimal for hot start PCR methods using T. aquaticus DNA polymerase.